D-BIOL

PRACTICAL: SS 2013

FUNDAMENTALS OF BIOLOGY II (551-0104-01)

PLANT PHYSIOLOGY PART

Department of Biology

Professorships of Plant Biotechnology (Prof. W. Gruissem)

RNA Biology (Prof. O. Voinnet)

Plant Biochemistry (Prof. S. Zeeman)

Course Rooms: LFW C4 and C31

2

1. DAY: PLANT SIGNALING: PHYTOHORMONES AND

SMALL RNAS

A) Introduction

The growth of plants has to be adapted to (external) environmental influences as well

as to (internal) developmental stages. Environmental influences include light,

temperature, water, d ifferent biotic and abiotic stresses and soil fertility. Plant

hormones and small RNA molecules p lay an important role in adaptation of plant

growth to the environmental and developmental conditions. In the experiments

during this course we will examine various aspects of growth regulation in plants.

Signal molecules: phytohormones and small RNAs

Many processes within a plant are triggered and coordinated by messenger

molecules. Different messenger molecules include small proteins, small RN As and

several d ifferent classes of chemical molecules. Six d ifferent classes of molecules

constitute the most prominent phytohormones: Auxins, Gibberellins, Cytokinins,

Ethylen, Abscisic Acid , and Brassinosteroides. In today’s experiments, several

specific activities of some of these hormones will be demonstrated . In addition, we

will explore how local production of a specific kind of RNA can generate a signal

that will systemically spread through the plant and cause effects on gene expression

elsewhere.

Phytohormones

Figure 1 shows the structure of the most common natural auxin Indole Acetic Acid

(IAA). IAA is produced in the tip of the plant and d istributed basipetally (from top to

bottom) throughout the plant. Distribution occurs according to the chem iosmotic

model (Taiz & Zeiger, pp. 433-437) by combined passive (d iffusion of the

undissociated form) and active (polar efflux of the anion across the basal cell

membrane) transport. When a plant is cu t in two halves, the basipetal active

transport leads to accumulation of auxins at the lower end of the upper half. Higher

concentrations of auxin lead to reduced growth of primary roots but stimulate the

development of side- and adventitious roots (Taiz & Zeiger, p . 450).

3

Figure 1: Structure of Indole Acetic Acid (IAA).

Gibberellins are modified diterpenes, which are synthesized by combination of two

isoprenoid units (Taiz & Zeiger, pp.466-468). Figure 2 shows the chemical structure

of gibberellic acid GA3. The most visible effect of gibberellins is the in creased growth

of the shoot axis, which can be readily observed in dwarf mutants and rosette plants.

The increased growth is caused by a combination of increased cell expansion and

enhanced cell d ivision (Taiz & Zeiger, pp. 477-480).

Figure 2: Structure of Gibberellic acid (GA3)

Gibberelllins also promote germination. Abscisic Acid ABA has exactly opposite

effect: it inhibits premature germination of plant seeds (e.g. when seeds are still

associated with the mother plant). ABA is a sesquiterpene (“one and a half” terpene),

i.e. a C15 molecule (Figure 3). The particular relation between ABA and gibberellins

is crucial for proper (timely) germination of plant seeds: a high ABA concentration

with a concomitant low gibberellin concentration leads to dormancy, while high

gibberellin and low ABA concentration leads to germination of plant seeds (Taiz &

Zeiger, pp. 543-546). (The experiment with relation to the text marked in grey will

not be performed this year).

Figure 3: Structure of Abscisic Acid (ABA)

Gibberellinsäure

4

Small RNA molecules

RNA silencing or RNA interference (RNAi) is a process in which small RNA

molecules (short interfering RNAs (siRNA) or micro RNAs (miRNA)) influence gene

expression at the transcriptional or post-transcriptional level. The process is

conserved between most eukaryotes and is important for, among others,

maintenance of genome stability or the expression of many developmental factors.

The small RNA molecules influence either the chromatinstructure or the stability and

use of mRNA. In plants, RN A silencing is an important part of the plant’s antiviral

defense.

The effectors are small (21 to 24 bases) double-stranded RNA molecules, which are

processed from long precursors. One of the two strands of the short molecule d irects

a silencing complex to the sequence homologous target RNA or DNA. The

precursors are generated by simultaneous expression of sense- and antisense RNA or

by expression of an RNA which has the potential to form double strands by

intramolecular base pairing (hairpin RNA). In many cases, new siRNA is generated

during degradation of the target RNA. This initiates a self-enhanced and self-

maintained mechanism. siRNAs can be mobile between cells and within a plant and

lead to systemic effects.

Environmental influences: Light

The experiment on photosynthetic generation of starch illustrates the light

requirement for this process. The light reaction generates reduced NADPH and ATP

which are used in the dark reaction to fix CO2 and generate Glyceraldehyde-3-

Phosphate, which serves as su bstrate for the formation of starch in the chloroplast

and sucrose in the cytosol. In plants, carbohydrates are mainly transported as

sucrose. Starch is immobile and has to be cleaved to generate carbohydrates that can

be transported to other parts of the plant (Taiz & Zeiger, pp. 162 – 168).

5

B) Experiments

B1) in C4:

1. Polar regeneration of auxin induced adventitious roots

2. Regeneration of Linum usitat issimum seedlings

3. Comparison of internodal growth

4. Distribution of the articles for the Journal Clubs on the 4th day

B2) in C31:

1. Systemic gene silencing

2. Photosynthetic starch

6

B1) in C4:

1. Polar regeneration of auxin induced adventitious roots in hypocotyls of beans

fill one 50 ml Falcon tube with 30 ml of either d istilled water or auxin solution

(0.1 mM IAA) and label the tubes

cut in the middle of the hypocotyl of 10 seven day old , etiolated bean seedlings

place the halves of 5 seedlings each with the cut surface for 2 hours into the

water or the auxin solution (approximately 1 cm deep)

label 2 times 2 Petri d ishes (control, auxin), place 5 layers of filter paper and wet

well

place the seedling halves on the wet filter paper

seal the Petri d ishes with Parafilm, wrap them in Aluminum foil and place

them in grey boxes

wrap the grey boxes in black cloth

2. Regeneration of Linum usitat issimum seedlings

!!Filters and cotton should be moist but not too wet!!

place 3 layers of filter paper into 5 Petri d ishes and wet well

label the Petri d ishes (according to the length of the fragments)

cut 10 seedlings for each length (0 mm, 5 mm, 10 mm, 15 mm und 20 mm

measured from the cotyledons downwards) on millimetre paper, cover the

hypocotyl with wet cotton wool to avoid dessication

place the upper seedling fragments (with the cotyledons) of the same length on

the wet filter paper in the Petri d ish

seal the Petri d ishes and place them near the window

3. Comparison of internodal growth of dwarfed and normal pea

observe the d ifferences of 11 day old pea seedlings (varieties „früher Zwerg“

and „Konservenkönigin“); measure all (at least 3; later one has to find out,

which internodes react most) internodes of 5 plants per treatment

7

spray for each variety one tray with control solution (1 % Tween 20), label the

tray and take it out of the room before spraying with the GA3 solution

spray the other trays with gibberellin solution (0.1 mM GA3 in 1 % Tween 20)

and label the trays

labelling: normal/ dwarf; control/ GA; date; name of the group

Distribution of the articles for the Jounal Club of the 4th day

6 articles to choose from

two groups of 2 to 3 students choose one article and prepare a presentation

on the 4th day one group per article will be elected by chance to present a

Jounal Club power point presentation):

- Introduction: embed the problem in a general context

- Methods and Results: how did the authors arrive to which results?

What do these results mean?

- Summary: point out the important, take home message

Discussion and questions: the other group makes comments, all students ask

questions and d iscuss

8

B2) in C31:

1. Systemic gene silencing in Nicot iana benthamiana plants

To generate siRNA locally, plants are incoculated locally with Agrobacterium

tumefaciens. These soil bacteria transfer naturally a piece of a plasmid (the so

called T-DNA) into plant cells. The T-DNA of the strains Agro-TRV-PDS and

Agro-gffg used in the experiment contains genes that lead to generation of siRNA

against the plant’s own Phytoene Desaturase Gene (PDS) or against a GFP gene.

The siRNA against the GFP gene is generated by production of a self-

complementary (“inverted repeat”) RNA covering parts of the GFP sequence,

TRV-PDS generates in transfected cells by a virus-like replication process a

double-stranded RNA that contains PDS sequences. Phytoene Desaturase is

required for Cartenoid Biosynthesis. A lack of PDS leads to photobleaching due

to chlorophyll photooxidation . GFP is a protein that is expressed from a transgene

in the plants used in this experiment, which is green fluorescing when it is

irrad iated with UV light.

Experiment:

Agrobacterium suspensions of the d ifferent strains in LB medium have been grown

over night and will be provided .

The bacterial strains and the plants used in this experiment are transgenic

organisms and have to be discarded accordingly! All plants, bacterial solutions,

and used materials have to be collected and sterilised by autoclaving or adequate

procedures.

Centrifuge 25 ml of each culture for 10 min at room temperature at 5000g

Discard the supernatant into a beaker containing Bleach (Bleach is corrosive ;

handle with caution!).

Resuspend the pellet by pipetting in 10 ml 10mM MgCl2

Dilute 100l to 1 ml in a cuvette and measure the optical density at 600 nm

Dilute the remaining culture with 10mM MgCl2 to OD

600nm=1.5

Mix in 50 ml Falcon tubes the following suspensions:

5ml Agro-TRV-PDS + 5 ml 10mM MgCl2

5ml Agro-gffg + 5 ml 10mM MgCl2

Add to each mix 10 l 100 mM Acetosyringone and incubate 1 h at RT

9

Infiltrate 2 to 3 leaves of a Nicotiana benthamiana p lant, i.e. take up bacterial

suspensions in a syringe (without needle) and press into leaf surface

(together with an assistant). Use one plant for every mix and label them

accordingly. You will observe these plants during the next weeks.

2. Photosynthetic starch in leaves of geranium (Pelargonium zonale)

Important: Keep the geraniums in the dark until the experiment begins

cut out a figure from aluminum foil with a razor blade

wrap a geranium leaf into the aluminum foil with the figure opening to the

upper (smooth) side of the leaf

(the lower side of the leaf has to be completely covered by aluminum)

illuminate the wrapped leaves behind a filled watercontainer (to d issipate the

heat) for 2 hours with a strong light source

remove the aluminum foil after illumination

place the leaves into hot (70 °C) methanol (do not inhale the vapour) until they

have completely lost the green colour

transfer the leaves subsequently to hot (70 °C) water (to soften them)

place the leaves into Iodine-potassium (Lugol) solution until the starch is visible

compare the starch synthesis in illuminated and dark adapted parts of the leaves

10

2. DAY: PLANTS AND LIGHT

A) Introduction

Light is the most important energy source for plants which convert sunlight into

chemical energy in the chloroplasts. This conversion is called photosynthesis. But

light also constitute an important environmental factor, which influences the

development of plants in various ways. The experiments of the second course day

address both of these functions of light.

Photosynthesis

Plants, algae and some bacteria can use the energy of sunlight to produce glucose

from water and CO2 and therefore can live as photoautotrophs. Photosynthesis can

be roughly d ivided in two phases: In the first phase (the so called light reaction)

water is oxid ized to molecular oxygen. The released electrons migrate through the

electron transport chain until they finally reduce NADP+. As a consequence of the

electron transport, a proton gradient is generated across the thylakoid membrane,

which is used to phosphorylate ADP, i.e. to generate ATP (Taiz & Zeiger, pp. 124-

135).

The second phase of photosynthesis is not d irectly dependent on light -energy and is

therefore also called dark reaction. In this second phase the reduced NADPH and

the generated ATP from the light reaction is used to reduced CO2 to an aldehyde in

reaction steps that can be summarized in the reductive pentosephosphate cycle (also

named Calvin Cycle after its d iscoverer) (Taiz & Zeiger, pp. 145-150).

Photosynthesis pigments, which absorb light, enable photoautotrophic orga nisms to

use the energy from sunlight. Three d ifferent classes of photosynthesis pigments can

be d iscriminated (Taiz & Zeiger, pp. 114-115).

Chlorophylls constitu te the first group. They consist of a porphyrin ring (four

pyrrols which are connected by C-bridges), which encloses a magnesium ion and is

esterified with phytol, a hydrophobic alcohol (Figure 4). Chlorophylls absorb blue

and red light and are therefore responsible for the green colour of chloroplasts and

leaves. The most important pigment of this class is chlorophyll a, which is present in

all oxygen-producing, photosynthetic organisms. Chlorophyll b is present in

Euglenophytes, green algae and all higher plants, whereas chlorophyll c can be

found in brown algae and d iatoms.

11

Figure 4: Biosynthesis and Structure of Chlorophyll a.

The second class of pigments are the carotenoids. These lipophilic pigments are

yellow, orange or red . Their main function, besides extending the range of the

absorption spectrum, is the protection of the photosynthesis apparatus against

photooxidative damage. Carotenoides are subdivided into two subgroups, based on

the chemical composition. Carotines are pure hydrocarbons with -carotine as the

most prominent member. Xanthophylles are oxygen containing derivatives of

carotines; lutein is the most abundant xanthophyll.

The third pigment class are the phycobilines, which are present in red - and blue

algae but not in higher plants.

Light-influenced plant development (Photomorphogenesis)

Most plant seeds germinate in the soil. The (subterranean) growth of the seedlings is

supported by nutrition reserves in the seed until the plantlets reach the surface and

build their photosynthesis apparatus. In the dark, most energy is invested in the

growth of the shoot axis, which is bent at the top (plumule hook or apical hook). In

this way, the developing plant can penetrate through the soil most efficiently and

12

without damage to the sensitive leaflets. This growth is called Skotomorphogenesis

or Etiolation. In contrast, the development when the seedlings reached the light is

called Photomorphogenesis and is characterized by opening of the plumula hook,

slower growth of the shoot axis and leaves unfold (Taiz & Zeiger, p . 375-376).

Germination of many seeds depends not only on a critical water content but also on

the amount of light irrad iation. Only seeds that have perceived a sufficient quantity

of light will begin to germinate. Germination is an irreversible process, which cannot

be reverted (e.g. by putting seeds back to darkness).

The transition of plants to growth in light does not only consist of the changes in

growth described above, but also involves intracellular (e.g. the development of

chloroplasts from etioplasts) and molecular changes. This includes (in Angiosperms)

the biosynthesis of chlorophylls: the conversion of protochlorophyllid a, which

accumulates in etioplasts on the dark, to chlorophyllid a is the only step in the

biosynthesis pathway of chlorophylls that requires light (Figure 4). The

photoreduction of protochlorophyllid a to chlorophyllid can be followed

spectroscopically in a photometer, because changes in the system of conjugated

double-bonds cause a shift in the absorption spectru m of the pigment.

Chlorophyllid a is subsequently transformed to chlorophyll a by addition of phytol

to the porphyrinring (Taiz & Zeiger, p . 139-140).

Germination of seeds and subsequent development of seedlings is ad justed to the

environment and is controlled by light receptors. Plants have receptors for blue and

for red light. Red light receptors are responsible for the control of

photomorphogenesis and are called Phytochromes. Phytochrome d irected transitions

in plants are basically dependent on alterations of gene expression programs. An

environmental change which was detected by a photoreceptor will be transmitted

through a signal transduction chain to the nucleus of a plant cell and cause there the

up- or down-regulation of various genes by causing changes of transcription, RNA

processing or other steps in the expression pathway (Taiz & Zeiger, pp. 393).

The expression of individual genes can be monitored with so called reporter genes,

which encode enzymes, whose expression can be easily detected (e.g. by monitoring

the conversion of a colourless substrate into a coloured product).

13

B) Experiments

B1) in C4:

1. Analysis of LHCP-gene promoter activity by means of the GUS reporter gene

2. (Polar regeneration of auxin induced adventitious roots)

3. (Regeneration of Linum usitat issimum seedlings

4. (Comparison of internodal growth)

5. (Systemic gene silencing)

6. Comparison of development in light and darkness

B2) in C31:

1. Hill-Reaction in isolated thylacoids

2. Chromatographical separation of pigments of the chloroplasts

(in parentheses: continuation and/ or analysis of last week’s experiments)

14

B1) in C4:

1. Analysis of LHCP-gene and PORA-gene promoter activity by means of the

GUS reporter gene in light-grown and etiolated transgenic Arabidopsis thaliana

seedlings

The uidA gene from Escherichia coli codes for -Glucuronidase (GUS), which is

used intensively in plants to study the expression of genes via promoter fusions

(Jefferson et al., 1987). The substrate for subsequent histochemical analysis is

X-Gluc (5-Brom-4-chlor-3-indolyl--D-glucuronid). The GUS-enzyme cleaves

off glucuronic acid before an indigo blue colorant is formed in an additional

step (Taiz & Zeiger, pp. 491 - 492)..

Here, the GUS-fusion approach is used to study the regulation of a LHCP gene

(light harvesting complex protein, cab3) and a PORA gene (NADPH -

Protochlorophyllid Oxidoreductase) in transgenic Arabidopsis lines with cab3 or

PORA promoter-uidA fusions, which were grown with and without light

(etiolated).

GUS-staining solution:

- 50 mM Phosphate buffer pH 7

- 10 mM EDTA

- 0.1 % Triton X-100

- 1 mM X-Gluc

- 5 mM K3 (CN)

6

- 5 mM K4 Fe (CN)

6

each group uses 6 wells of a microtiterplate: write down the coordinates

pipet in each well 750 µl staining solution

place in each well 3 six day old seedlings of either light-grown or etiolated

cab3::GUS, PORA::GUS or wild type

make sure the seedlings are totally submerged in the solution

place the microtiterplate in a desiccator

vacuum-infiltrate the seedlings for 4 min

as soon as bubbles emerge in a regular fashion, aerate the dessicator carefully

incubate the microtiterplate at 37 °C

after 2 hours remove the staining solution carefully with a pipet te and replace it

with 70 % ethanol

(which removes the Chlorophyll and thereby enhances the contrast)

compare the staining pattern under the binocular in the next course day

15

2. Polar regeneration of auxin induced adventitious roots in bean hypocotyls

Petri d ishes from last week:

take note of the position, length and number of adventitious roots on the hypocotyls

and explain the observations

3. Regeneration of Linum usitat issimum seedlings

Petri d ishes from last week:

count the number of roots per Petri dish (i.e. per hypocotyl segment length)

observe the length of the adventitious roots

(does the number of roots correlate with maximal length?)

explain the observations

4. Comparison of internodal growth

Trays from last week:

measure the length of the individual internodes of 12 plants of each tray („früher

Zwerg“ GA -treated, control; „Konservenkönigin“ GA -treated, control)

calculate the average for each internode (do not take into account the highest and the

lowest value)

compare the average lengths of the internodes and explain

5. Systemic gene silencing

Nicotiana benthamiana p lants of last week

Observe the plants at normal and at UV light and describe what you see.

For observation in UV light, plants are moved to the dark room and irrad iated with a

UV lamp.

Protect your eyes with a face shield and/or safety glasses and keep exposure of

skin to UV light at a minimum.

16

6. Comparison of development in light and dark in

- hypogeic (pea) d icotyledonous seedlings

- epigeic (mustard) d icotyledonous seedlings

- monocotyledonous (barley) seedlings

!!This experiment is only started today; evaluation is next week; it is

important to overlay the peas with enough vermiculit!!

extract a typical seedling including the roots of each tray

observe, draw and describe the different photomorphoses

measure the lengths of (pea and barley) seedlings and draw a distribution curve (with

10 size classes)

17

B2) in C31:

1. Hill-Reaction in isolated thylacoids of peas

This reaction was d iscovered by Hill 1937. The electrons are transferred from

water to photosystem II and some additional steps of the electron transport

chain to an artificial electron acceptor. In addition, oxygen is released .

2 H2O + 2 A 2 AH

2 + O

2

light

Here, the reduction of the artificial electron acceptor is followed by measuring

photometrically the transformation of the oxid ised blue dye 2,6-

Dichlorophenolindophenol (DCPIP) into its colourless reduced form.

The electron transport chain can be interrupted by blocking reagents. Here the

two herbicides Dichlorphenyld imethylurea (DCMU) and Atrazin are used to

illustrate this aspect.

Medium A: Medium B:

- 0.33 M Sorbitol

- 30 mM KCl - 30 mM KCl

- 5 mM NaCl - 5 mM NaCl

- 25 mM Hepes-KOH pH 7.6 - 25 mM Hepes-KOH pH 7.6

- 2 mM EDTA - 2 mM EDTA

- 1 mM MgCl2 - 1 mM MgCl

2

- 1 mM MnCl2 - 1 mM MnCl

2

- 0.5 mM KH2PO

4

- 5 mM Ascorbat (add freshly)

- 4 mM Cystein

important: proceed on ice for the isolation of chloroplasts and use precooled

glassware

weigh 5 to 10 g fresh pea leaves

homogenise with 120 ml cold medium A in the mixer: blend twice for 3 sec

prepare 4 layers of cloth in a funnel and prewet the cloth with medium A

filtrate the homogenised pea leaves through the cloth

distribute the chloroplast suspension to 50 ml centrifuge tubes

equilibrate the weight of the centrifuge tubes

18

spin 5 min in the precooled centrifuge at 2000 g (4000 rpm; SS34 Rotor)

discard the supernatant

resuspend the chloroplasts in 20 ml med ium B

leave 4 min on ice

(the thylacoids are set free, why?)

spin 5 min at 3000 rpm

discard the supernatant

resuspend the thylacoids in 5 ml Medium B and leave on ice in the dark

Dilute a portion of the thylacoids with medium B to an extinction of 1.0

(measured at 600 nm against medium B); final volume up to 10 ml (This d iluted

solution will be used further on)

prepare the following reactions by pipetting the correct amount of solutions

(in ml) to glass test tubes:

Reaction-

Nr.

1 2 3 4 5-8 9-12

Zero Light Dark heat

inactivated

DCMU Atrazin

Thylacoids - 0.5 0.5 0.5 0.5 0.5

Medium B 3.5 3.0 3.0 3.0 3.0 3.0

DCMU - - - 0.2 -

Atrazin - - - - 0.2

DCPIP* 0.2 0.2 0.2 0.2 0.2 0.2

H20 0.3 0.3 0.3 0.3 0.1 0.1

* add DCPIP only at the end to all the test tubes

Notes:

Reaction-Nr. 3: wrap the test tube with aluminum foil (also on top)

Reaction -Nr. 4: place the test-tube containing the thylacoids and medium B

into a heated (60 °C) water bath for 5 to 10 min

Reaction -Nr. 5-8: concentration series DCMU (in 10 % Ethanol), Make DCMU

solutions of 5 x 10-5, 5 x 10

-6, 5 x 10

-7 und 5 x 10

-8 M;

add 0.2 ml to reaction

Reaction -Nr. 9-12: concentration series Atrazin (in 100 % Ethanol), as for

DCMU

seal with parafilm and mix the reactions by shaking the test tubes

19

place the test tubes in front of a strong light source beh ind a filled water

container (to d issipate the heat)

pipet 1 ml of each reaction into an Eppendorf tube

spin the Eppendorf tubes 2 min at 5000 rpm on the benchtop centrifuge

transfer the supernatant to plastic cuvettes

measure the extinction at 600 nm against a cuvette filled with medium B

set the d ifference (2-1) between reaction-nr. 2 (in the light) and reaction-nr. 1 (no

thylacoids) as 100 % (of DCPIP reduction)

give the results of the other reactions in % of maximal DCPIP reduction

2. Chromatographical separation of pigments of the chloroplasts

Extraction:

weigh 2 g of pea leaves

place in a mortar and add a little bit of CaCO3 (to neutralise the acid ity of the

acid ic cell sap)

while grinding the leaf tissue, add50 ml Aceton and 5 ml Benzin in small

portions without letting the plant material getting dry

filtrate with the vacuum-bottle through a filter paper

transfer the cleared solution into a separating funnel (Scheidetrichter)

add 30 ml Aceton and 50 ml 10 % NaCl

mix carefully and let the phases separate (the pigments move to the upper

benzin phase)

discard the lower Aceton-/ Water phase (aerate the separating funnel)

wash the remaining benzin phase twice with d istilled water

transfer the benzin phase into an Erlenmeyer flask and dry it by adding a little

bit of Na2SO

4

Thin-layer-chromatography (DC):

fill the DC Tank 0.5 cm to 1 cm with 100 ml Petrolether and 50 ml Aceton

place filterpaper imbibed with the solution in the tank on the walls and close

the lid (to saturate the atmosphere of the tank)

20

define on a DC-silica gel plate a starting line 2 cm above the lower end

apply the pigment mixture on the starting line with a pipet until the band is

intensely green ( not wider than 1 cm)

let the solvent evaporate

place the plate in the tank and leave it in until the migration front has reached a

d istance of 16 cm to 18 cm

mark the migration front and let the plate dry

document the position of the pigment bands

calculate the Rf values and explain the relative mobility of the pigments

Spectroscopy:

scratch off the most visible pigment bands from the plate with the best

separation

elute the carotin band with Hexan

elute the chlorophyll bands with Diethylether (warning: Ether boils at 35oC and

can become explosive; avoid heat; work under the hood)

elute the Lutein- (Xanthophyll-) band with ethanol

transfer immediately after elution 1 ml into glass cuvettes and register the absorption

spectra between 300 nm and 800 nm

(since the pigments degrade in the light)

21

3. DAY: MOLECULAR BIOLOGY AND

HERBICIDES

A) Introduction

The capability to generate transgenic plants has widened the research possibilities in

plant biochemistry, physiology, genetics and development enormously. It also led to

biotechnological applications. The most important method to introduce new genes

into plants relies on gene transfer by Agrobacterium tumefaciens, similar as was

performed in the experiment in the first week. For the current experiment, DNA

needed to be transferred into plant cells only for transient expression. If a transgenic

plant should be generated , cells from the inoculated tissue have to be regenerated to

a complete plant, which then contains the transgene stably integrated in the nuclear

genome of all its cells. In this way, the Nicotiana benthamiana p lants expressing GFP or

the Arabidopsis p lants containing light-regulated GUS reporter genes, which are used

in the course, have been generated . Today we will analyse a transgenic plant with

molecular methods to detect a transgene and its expression. The identification of

transgenes is an experiment that in this or similar form is performed in many

laboratories to test if food or feed contains genetically modified plant(material).

One important application of genetechnology with plants is the generation of

herbicide resistant plants for agriculture. Weed control is a necessary part of any

agriculture and herbicides provide the most effective means of control. Herbicide

resistant crop plants allow a more efficient and environmentally safe application of

herbicides.

Herbicides inhibit plant specific molecular processes. Today, we will analyse some

aspects of the function of the herbicide Norflurazone. Norflurazone inhibits the

enzyme phytoene desaturase (PDS), which catalyses the conversion of phytoene to

phytofluene, which will finally be converted to – carotene. PDS therefore is

essential for the biosynthesis of carotenoides (the photopigments that have been

analysed in the first week). In this experiment we will analyse the photooxidative

protection by carotenoids (which is also seen in the experiment with silencing of

PDS).

22

B) Experiments

B1) in C4:

1. Analysis of Norflurazon effect on plant growth

2. (Analysis of the promoter-GUS-plants)

3. (Evaluation of experiment on dark/light seedling development)

4. (Observation of Nicot iana benthamiana from first day)

B2) in C31:

1. Molecular Analysis of transgenic Nicot ioana benthamiana plants from first

week

(in parentheses: continuation and/ or analysis of last week’s experiments)

23

B1) in C4:

1. Analysis of Norflurazon effect on plant growth

label 4 black trays

(lowlight, lowlight + Norflurazon; strong light, strong light + Norflurazon)

fill these 4 trays plus an additional one with vermiculite and place in green

trays

irrigate the trays with water (to soak the vermiculite)

place ca. 20 mustard seed s per tray and cover them with 1 cm of vermiculite

(from the additional tray)

irrigate the trays labelled with „+ Norflurazon“ thoroughly with 2 µM

Norflurazon

irrigate the other 2 trays with d istilled water

wrap the “Lowlight” trays with 3 layers of household paper and place them

under the strong light source (together with the “strong light” trays)

2. Analysis of LHCP and PORA-gene promoter activity by means of the GUS

reporter gene in light-grown and etiolated transgenic Arabidopsis thaliana

seedlings

compare the staining pattern under the binocular

3. (Evaluation of experiment on dark/light seedling development)

See day two

4. (Observation of Nicot iana Benthamiana from first day)

See day two

24

B2) in C31:

1. Molecular analysis of transgenic Nicot iana benthamiana plants after systemic

gene silencing

The plants used in this experiment contain GFP as a transgene. This gene can be

detected by the Polymerase chain reaction (PCR). In a PCR reaction, a DNA

substrate (in this case genomic DNA from Nicotiana plants) is in cubated a DNA

Polymerase in a buffer with synthetic short DNA sequences which are

complementary to regions of the substrate (so called Primers). The mixture is then

cycled through a number of temperature changes (Figure 5). In the first phase, the

mixture is heated to 94 °C, which denatures the DNA by breaking the hydrogen

bonds that keep the two strands of the DNA double helix together. In th e second

phase, the temperature is reduced to allow basepairing of the denatured DNA. Since

the primers are present in excess, most suitable regions of the substrate will pair with

primers. The primers in this experiment are complementary to regions of the GFP

gene and flank an about 400 basepair long fragment. In the third (and last) phase, the

mixture is heated to 72 °C, because the heat stable DNA polymerase which is used in

PCR elongates strands partially double-stranded DNA at this temperature with

highest efficiency. This cycle of denaturation, renaturation with primers and DNA

elongation is repeated multiple times and finally leads to an exponential

amplification of the DNA piece between the two primers.

Gene expression can be measured with the same method, provided that the mRNA is

first copied into a complementary cDNA by the enzyme Reverse transriptase. The

DNA can then be further amplified by PCR. When the PCR reaction is stopped

during the exponential amplification phase (i.e. before saturation effects set in), the

signal (amount of obtained DNA fragment) is proportional to the amount of initial

mRNA and can be used as an approximate readout for the initial expression

strength, particularly when it can be compared to the signal derived from a second,

presumably constant mRNA species. In our experiment, expression of an TCTP gene

serves as an internal standard .

Biosafety: All plant material has to be collected in specific autoclave bags for

proper sterilization and disposal.

25

26

Raw DNA extract out of leaf tissue:

Solutions/Buffers:

- Extractionbuffer: 100 mM Tris/ HCl, pH 8

700 mM NaCl

50 mM EDTA, pH 8

- Chloroform (work under the fume hood!)

- 100 % Isopropanol

- 70 % Ethanol

Every group extracts DNA from two Nicotiana benthamiana p lants. Label two

1.5ml Eppendorf-tubes respectively. For simplicity and economy, we start

with non-transgenic plants.

Cool a mortar with some liquid nitrogen (Attention: wear protective glasses!!).

Add one piece of leaf to liquid nitrogen in the mortar and grind it to a fine

powder.

Transfer the powder w ith a cold spatula to one of the two Eppendorf tubes

and add 650 µl Extractionbuffer.

Mix vigourously by shaking and inversion. Incubate for about 10-15 min at

65°C (invert occasionally during this time).

Inbetween repeat the procedure with one leaf from the genetically modified

Nicotiana p lant using the same mortar and pestle. Why is the order of the

procdeedings important in this case?

Cool the leaf extract for about 1 min and add 325 µl Chloroform (in the fume

hood!). Shake gently for 3 min at room temperature (RT).

Centrifuge extracts for 2 min at 13200 rpm at RT. Prepare two new 1.5ml-

Eppendorf-tubes.

Carefully transfer the upper, aqueous phase to a respectively labeled

Eppendorf-tube (avoid to transfer cell debris).

Add 350 µl Isopropanol, mix well but gently (genomic DNA easily breaks to

pieces due to mechanic forces), incubate for 2 min at RT. DNA precipitates

and can be separated from molecular impurities..

Dry DNA Pellet after precipitation. DNA is

stained blue here. In our experiment the pellet should be clear or white.

27

Centrifuge the samples at 13200 rpm for 10 min, RT and remove the liquid

carefully.

Add 0.5 ml 70 % Ethanol to the DNA Pellett, shake and centrifuge again for 5

min at 13200 rpm, RT.

Remove liquid carefully and dry DNA pellet by letting the open tube sit at RT

for a few minutes

Dissolve DNA in 100 µl of water.

RNA extraction and Reverse transcription

RNA extraction can be done similarly. However, RNA is significantly less stable

than DNA and therefore, RNA isolation requires particular safety measures and

denaturation steps during the work. Wearing gloves and the use of RNAse free

solutions and material are essential. Since the isolation of undegraded RNA

appears very d ifficult under the working conditions of the course, RNA and

incubation solutions will be provided . In the experiment, we will measure the

expression of the phytoene desaturase gene with and without induced systemic

gene silencing. The RNA has been isolated from plant material showing (or not)

symptoms of gene silencing in an experiment that was performed in parallel to

the course.

Reverse t ranscript ion

All RNA species are copied into a complementary DNA strand . A DNA primer

binding to the polyA tail of the mRNA serves as a start point for DNA synthesis

by the enzyme reverse transcriptase.

Experiment

Mix in two 200 l Eppendorf tubes 5 l (1g) RNA from either Agro-TRV-PDS

or Agro-gffg plants with 15 l reaction mix

Centrifuge briefly and incubate for 1 h at 42°C.

Subsequently, heat the mix for 5 min at 70°C to inactivate the reverse

transcriptase and d ilute 5 fold with water.

The reaction mix contains:

28

1mM dNTPs, 10M oligo dT; 20U Ribolock RNase Inhibitor; 200U Reverse

Transcriptase and Buffer (50 mM Tris-HCl pH 8.3, 50 mM KCl, 4 mM

MgCl2, 10 mM DTT)

.

PCR:

To detect the GFP transgene you will use the DNA that you have isolated , for

quantification of PDS mRNA you use the generated cDNA.

Reagents:

- 5x Buffer (containing MgCl2)

- 2.5 mM dNTPs (dATP, dTTP, dCTP, dGTP)

- forward and reverse p rimer for the GFP gene

- Taq-Polymerase

Label six 0.2 ml-PCR-tubes

Add 5 µl of the respective DNA in the respective PCR tube and add 45 µl PCR

Mix to every sample.

The PCR Mix consists of::

5x Buffer

(containing

MgCl2)

10 µl

2.5 mM dNTPs 5 µl

2 µM Primer FW

5 µl

2 µM Primer RV

5 µl

Taq-Polymerase

(5U/ µl)

0.5 µl

H2O 19.5µl

5 µl Plant DNA 45 µl PCR Mix

29

Always use a new pipette tip. Minute amounts of DNA can be sufficient for a

wrong result

Load all samples into the PCR machine and start the following program:

95°C for 3 min

95°C for 20 sec

55°C for 30 sec

72°C for 40 sec

72°C for 5min

20 °C for ever

TCTP

Forward primer : GAGCTTCTGTCTGACTCTTTCCC

Reverse primer : GTTGAACCCTCCTTGTAGTAAGC

PDS

Forward primer : CTGAAGAACACATATGATCACC

Reverse primer : ATGATACTGTTGCCTCCGAC

GFP

Forward primer : AGTAAAGGAGAAGAACTTTTCACT

Reverse primer: TTCCGTCCTCCTTGAAATCGA

Repeat 27 x

30

4. DAY: PLANT WATER RELATIONS

A) Introduction

Today’s experiments deal with the crucial importance of water for plants and

visualize important concepts of water balance.

The waterpotential (W) measures the d ifference per unit volume between the free

energy of water (a thermodynamic parameter) in a particular state and a defined

standard state (pure water in an open volume, i.e. under atmospheric pressure).

Three main components contribute to the waterpotential, which therefore can be

described by the following equation:

w =

s +

p +

g

The first of these three components is the potential of solutes in the water (solute

potential, s), which reduce the free energy of water . This component is also termed

osmotic potential () of a solution and is described by van't Hoff’s law :

s = - RTc

s

In this equation, the osmotic potential is related to the universal gas constant (R =

8.314 J mol-1 K

-1), the absolute temperature (in Kelvin, 273.15 units larger than °C) and

the molal (mol l-1) concentration (c

s) of all osmotically active solutes (Taiz & Zeiger,

pp. 39-43).

The second component is the hydrostatic pressure (p) exerted on the water. In

turgescent, i.e. fully swollen, plant cells the rigid cell wall exerts a pressure that

hinders cells to take up more water. The third component is the gravity (g), which is

negligible in comparison to the other complonents for d istances below five meters

and will therefore not be considered in the current experiments.

The waterpotential of a tissue equals the potential of a solution, w hen no water

transport can be detected when the tissue is immersed in this solution in an open

volume. I.e., when the tissue neither takes up water nor loses water, its osmotic

potential equals that of the solution.

The turgor, i.e. the hydrostatic pressu re exerted by the cell on the cell wall, is of

crucial importance for extension of the cell wall and therefore for plant growth. This

principle is valid for all plant cells, but nevertheless not all plant cells in a plant

contribute equally to the restriction of plant growth. Particularly cells of the outer

most cell layer – the so called epidermis – are charaterised by thick cell walls and

contribute to the generation of a turgor within the plant, which confers strength and

stability to the plant even without additional strengthening elements.

31

B) Experiments

B1) in C4:

1. (Analysis of Norflurazon effect on plant growth)

2. Journal Club

B2) in C31:

1. Water potential measurement

2. Tissue tension

3. (Molecular characterization of Nicot iana benthamiana plants)

(in parentheses: continuation and/ or analysis of last week’s experiments)

32

B1) in C4:

1. Analysis of Norflurazon effect on plant growth

Trays from last week:

compare the seedlings in each tray and explain the observations

2. Journal Club

for each article:

- Introduction 5 to 10 min

- Methods, Results 10 to 15 min

- Summary, conclusions 5 to 10 min

Not more than 25 min alltogether

- Questions, discussion

33

B2) in C31:

1. Water potential measurement of potato parenchyma

dilute 1 M Sucrose solution with d istilled w ater into 0.5 M, 0.4 M, 0.3 M, 0.2 M

and 0.1 M solutions (10 ml for each concentration)

label 6 glass test tubes (0, 0.1, 0.2, 0.3, 0.4, 0.5) and fill with 10 ml d istilled water

or the corresponding sucrose solutions

cut cylinders out of potatoes with a drilling instrument (Korkbohrer)

cut the cylinders subsequently into small slices (about 3 mm thick) and place

these slices on wet filter paper

form 6 portions of ca. 2 g (write down the exact weight of every portion)

dip the portions into the sucrose solutions

mix regularly during the equilibration time of 2 hours

take out the tissue slices, d ry them (without applying pressure) and weigh the

portions again

calculate the % of weight difference ((End weight – Initial weight)/ Initial weight *100)

and plot in a diagram

- x-axis: Molarity of sucrose

– y-axis: weight difference

define by interpolation the concentration (K0) at which no weight difference would be

observed

set the waterpotential of the potato parenchyma approximatively equal to the potential

of the sucrose solution at a concentration of K0 and calculate the value

2. Tissue tension in sunflower hypocotyls

Stretching of the epidermis:

isolate 1 cm long fragments from the elongation zone of the hypocotyl (just

below the cotyledons) of 10 seven day old sunflower seedlings

incubate these fragments for 2 hours in d istilled water

peel off a strip of 1 to 2 mm width of the epidermis with flat tweezers

34

measure the length of the hypocotyl fragments and off the peeled epidermis strips,

calculate the averages and explain the difference in length

Compression of the inner tissues:

isolate 2 cm long fragments from the elongation zone just below the cotyledons

of 20 sunflower seedlings

peel off the epidermis of 10 of these fragments with a pair of flat tweezers

cut all the fragments (peeled and unpeeled) to 1.5 cm

incubate the fragments for 2 hours in d istilled water

measure the length of the peeled and unpeeled hypocotyl fragments, calculate the

averages and explain the difference in length

3. Molecular characterization of Nicot iana benthamiana plants

Running buffer (1 x TAE): Loading buffer:

- 40 mM Tris-Acetate pH 7.6 - 40 % Sucrose

- 1 mM EDTA - 0.25 % Bromophenolblue

- 0.25 % Xylene Cyanol

Gel electrophoresis:

weigh 1.5 g Agarose in a 250 ml Erlenmeyer flask

add 80 ml running buffer (1 x TAE)

heat in microwave until agarose melts

mix well (be careful: boiling retardation is possible) and add TAE to 150ml

cool the solution to about 60 ° C

prepare the gel chamber: seal the lower and the upper end with a tape

add 5 µl ethid ium bromide into the cooled agarose solution

Attention: Ethid iumbromide is carcinogenic, work with gloves!

swirl the Erlenmeyer flask to mix and pour the solution into the sealed gel

chamber

place 1 comb at the top

let the gel set for 30 min

35

take the PCR reactions from last week out of the fridge

add 5 µl of blue loading buffer into each PCR tube

remove the sealing tape after the gel has set

place the gel chamber into the electrophoresis tank

fill the electrophoresis tank with running buffer

load 20 µl of the PCR Reactions into individual gel slots

load one gel slot on the top and in the middle of the gel with each 10 µl DNA

ladder

close the lid and connect the electrodes (DNA is negatively charged at this pH –

why? – and thus migrates to the positive electrode)

run the electrophoresis at 70 V, until the blue color has migrated through half of

the gel (ca. 30 min)

observe the gel under UV-light (protect your eyes with safety glasses)

take a picture of the gel (assistant)

the expected fragments are around 500 base pairs

Interpretation

Compare your results according to plant genotype and treatment with d ifferent

Agrobacterium strains. Compare the signal for the TCPT gene with that for the PDS

gene under the d ifferent conditions.