Download - L20 Translation

Transcript
  • 8/6/2019 L20 Translation

    1/20

    Genetic codon

    A sequence of_ ________ in mRNA thatcodes for one amino acid

    Eg.___ methionine

    A collection of all genetic codons is called_______ ____

    With four bases, a total of__ triplet codons is

    possible

    Three are___ _______ codons:___ , ___ ,

    ___ (signal the stop of protein synthesis)

    Hence,__ codons for 20 amino acids

  • 8/6/2019 L20 Translation

    2/20

    Features of the genetic code

    1. Specific

    Explain:

  • 8/6/2019 L20 Translation

    3/20

    Features of the genetic code

    2. Universal

    Explain:

  • 8/6/2019 L20 Translation

    4/20

    Features of the genetic code

    3. Redundant/degenerate

    Explain:

    Eg. Phe has__ codons

    Ile has__ codons

    Ala has__ codons

    Leu has__ codons

  • 8/6/2019 L20 Translation

    5/20

    Features of the genetic code4. Non-overlapping

    Explain:

    UCGGUACAGAAUCCAACAGAAUCCGGUACA

    Codon 1Codon 2

    Codon 3

    This is the_____ (wrong/correct) reading pattern

    UCGGUACAGAAUCCAACAGAAUCCGGUACACodon 1 Codon 2 Codon 3

    This is the_____ (wrong/correct) reading pattern

  • 8/6/2019 L20 Translation

    6/20

    Features of the genetic code

    5. Commaless

    Explain: No base is wasted for__________

    UCGGUACAGAAUCCAACAGAAUCCGGUACACodon 1 Codon 2 Codon 3

    This is the_____ (wrong/correct) reading pattern

    UCGGUACAGAAUCCAACAGAAUCCGGUACA

    Codon 1 Codon 2 Codon 3

    This is the_____ (wrong/correct) reading pattern

  • 8/6/2019 L20 Translation

    7/20

    The process of_______ synthesis

    The process of TRANSLATING the________language of mRNA to the______ language of

    proteins

    Translation

  • 8/6/2019 L20 Translation

    8/20

    Steps in prokaryotic translation

    1. _________

    2. _________

    3. _________4. _________

  • 8/6/2019 L20 Translation

    9/20

    1. Activation

    Amino acids are attached to the A of the____sequence at the__ end of tRNA

    The product is called_____ ____ tRNA or

    ______ tRNA This process activates both the amino acid and

    the tRNA

    Enzyme for activation is_____ ____ ______________

    There is______ ___ enzyme for each amino acid

  • 8/6/2019 L20 Translation

    10/20

    1. Activation (contd.) Each enzyme recognises a specific_____ ____ as

    well as its__________ tRNA

    Activation is___ dependent

    Extreme specificity and the proofreading ability of

    the enzyme ensures fidelity of translation

    Proofreading activity of the enzyme helps in

    removal of mischarged amino acids from the

    enzyme or the tRNA The________ tRNA is first charged with__________

    which is later converted to_ ______ __________ by

    ______ __________ (N10 formyl THF is the cofactor)

  • 8/6/2019 L20 Translation

    11/20

    2. Initiation Involves the assembly of the two_________

    subunits, the___ RNA, the initiator tRNA withthe first amino acid (N-formyl methionine)

    Initiation is aided by proteins called________

    ______ (3 in number :__ , __ & __ ) Initiation is___ dependent for energy

    Ribosome in prokaryotes is a__s ribosome.

    Made up of 2 subunits,___ and___. 50s subunit is made of___ rRNA,__ rRNA and

    31 proteins

    30s subunit has___ rRNA & 21 proteins

  • 8/6/2019 L20 Translation

    12/20

    2. Initiation (contd.)

    mRNA has a consensus sequence of purine

    rich nucleotide bases located 6-10 bases

    upstream of the start codon, called_____

    ________ sequence ______ has a nucleotide sequence at its 3end

    complementary to Shine Dalgarno sequence

  • 8/6/2019 L20 Translation

    13/20

    First step of initiation involves binding of the____ to___ subunit of ribosome

    Shine Dalgarno sequence binds to the 16s

    rRNA at the 3 end. This facilitates proper

    positioning of the____ on the________ so

    that translation can accurately begin on start

    codon AUG

    Next, the charged_______ ____ recognisesthe start codon.The_______ of tRNA binds

    antiparallel to the_____ on mRNA

    2. Initiation (contd.)

  • 8/6/2019 L20 Translation

    14/20

    __ __________ subunit binds to this complexto form a complete ribosome as a part of the

    ________ complex

    The complete ribosome has 3 sites :__

    (_____),_ (________) and_ (_____ ____)

    _____ tRNA leaves the ribosome from the__

    site

    All new tRNAs bind to the ribosome at the__

    site (except the_______ tRNA which binds at

    the__ site)

    2. Initiation (contd.)

  • 8/6/2019 L20 Translation

    15/20

    tRNA with the growing peptide is bound tothe__ site

    Initiation is complete with the formation of

    the initiation complex

    Initiation complex enters the next stage -

    __________

    2. Initiation (contd.)

  • 8/6/2019 L20 Translation

    16/20

    3. Elongation The next tRNA with the next amino acid

    binds to the_ site of the ribosomal complex.

    The enzyme________ ___________ transfers

    the_____ amino acid from the_______ tRNA

    on_ site to form a_______ bond with theamino acid on the next tRNA on the_ site

    Now the tRNA on P-site is_____ and that on

    A-site carries a_________ The whole________ moves along the mRNA

    towards the__end by a distance of one

    codon. This process is called____________

  • 8/6/2019 L20 Translation

    17/20

    3. Elongation

    Now the E site has the_____ ____ , P site has the

    ________ ____ and A site is ready to accept the

    next tRNA with the next amino acid. The steps of

    elongation repeat to elongate the peptide chain

    Elongation is aided by proteins called_________________ (3 in number:_____ , _____ and ____ )

    Elongation is___ dependent for energy

    Elongation continues till__ site falls on a____codon

  • 8/6/2019 L20 Translation

    18/20

    4. Termination Termination begins when one of the____

    codons occupies the_ site

    Instead of a tRNA, proteins called_______

    ______ bind to the stop codon (RF-1 recognises

    ___ and___ , RF-2 recognises___ and___) Peptidyl transferase hydrolyses the bond

    between the peptide chain and the tRNA,

    releasing the peptide chain free ___ causes the release of RF-1 and RF-2

    The ribosomal subunits, the mRNA and the

    empty tRNA dissociate from each other

  • 8/6/2019 L20 Translation

    19/20

    Eukaryotic translation

    The initiator tRNA carries________ , not N-formyl

    methionine, to the P-site

    Initiation factors are__ in number (__ ___ ) Ribosomes are__s with___ and___ subunits

    60s subunit is made up of___ rRNA,___ rRNA,

    __ rRNA and 50 proteins 40s subunit is made up of___ rRNA and 30

    proteins

    mRNA is___________ (polycistronic in prokaryotes)

    Similar to prokaryotic translation, with the

    following differences:

  • 8/6/2019 L20 Translation

    20/20

    Eukaryotic translation (contd.)

    No Shine Dalgarno sequence. 40s subunit, aidedby eIFs, binds to the 5 cap and slides down the

    mRNA to reach the start codon

    Elongation factors are EF__, EF___ and EF__instead of EF-Tu, EF-Ts and EF-G respectively

    A single release factor,___, functions to

    recognise all stop codons. Another release

    factor____ functions instead of RF-3


Top Related