l20 translation
TRANSCRIPT
-
8/6/2019 L20 Translation
1/20
Genetic codon
A sequence of_ ________ in mRNA thatcodes for one amino acid
Eg.___ methionine
A collection of all genetic codons is called_______ ____
With four bases, a total of__ triplet codons is
possible
Three are___ _______ codons:___ , ___ ,
___ (signal the stop of protein synthesis)
Hence,__ codons for 20 amino acids
-
8/6/2019 L20 Translation
2/20
Features of the genetic code
1. Specific
Explain:
-
8/6/2019 L20 Translation
3/20
Features of the genetic code
2. Universal
Explain:
-
8/6/2019 L20 Translation
4/20
Features of the genetic code
3. Redundant/degenerate
Explain:
Eg. Phe has__ codons
Ile has__ codons
Ala has__ codons
Leu has__ codons
-
8/6/2019 L20 Translation
5/20
Features of the genetic code4. Non-overlapping
Explain:
UCGGUACAGAAUCCAACAGAAUCCGGUACA
Codon 1Codon 2
Codon 3
This is the_____ (wrong/correct) reading pattern
UCGGUACAGAAUCCAACAGAAUCCGGUACACodon 1 Codon 2 Codon 3
This is the_____ (wrong/correct) reading pattern
-
8/6/2019 L20 Translation
6/20
Features of the genetic code
5. Commaless
Explain: No base is wasted for__________
UCGGUACAGAAUCCAACAGAAUCCGGUACACodon 1 Codon 2 Codon 3
This is the_____ (wrong/correct) reading pattern
UCGGUACAGAAUCCAACAGAAUCCGGUACA
Codon 1 Codon 2 Codon 3
This is the_____ (wrong/correct) reading pattern
-
8/6/2019 L20 Translation
7/20
The process of_______ synthesis
The process of TRANSLATING the________language of mRNA to the______ language of
proteins
Translation
-
8/6/2019 L20 Translation
8/20
Steps in prokaryotic translation
1. _________
2. _________
3. _________4. _________
-
8/6/2019 L20 Translation
9/20
1. Activation
Amino acids are attached to the A of the____sequence at the__ end of tRNA
The product is called_____ ____ tRNA or
______ tRNA This process activates both the amino acid and
the tRNA
Enzyme for activation is_____ ____ ______________
There is______ ___ enzyme for each amino acid
-
8/6/2019 L20 Translation
10/20
1. Activation (contd.) Each enzyme recognises a specific_____ ____ as
well as its__________ tRNA
Activation is___ dependent
Extreme specificity and the proofreading ability of
the enzyme ensures fidelity of translation
Proofreading activity of the enzyme helps in
removal of mischarged amino acids from the
enzyme or the tRNA The________ tRNA is first charged with__________
which is later converted to_ ______ __________ by
______ __________ (N10 formyl THF is the cofactor)
-
8/6/2019 L20 Translation
11/20
2. Initiation Involves the assembly of the two_________
subunits, the___ RNA, the initiator tRNA withthe first amino acid (N-formyl methionine)
Initiation is aided by proteins called________
______ (3 in number :__ , __ & __ ) Initiation is___ dependent for energy
Ribosome in prokaryotes is a__s ribosome.
Made up of 2 subunits,___ and___. 50s subunit is made of___ rRNA,__ rRNA and
31 proteins
30s subunit has___ rRNA & 21 proteins
-
8/6/2019 L20 Translation
12/20
2. Initiation (contd.)
mRNA has a consensus sequence of purine
rich nucleotide bases located 6-10 bases
upstream of the start codon, called_____
________ sequence ______ has a nucleotide sequence at its 3end
complementary to Shine Dalgarno sequence
-
8/6/2019 L20 Translation
13/20
First step of initiation involves binding of the____ to___ subunit of ribosome
Shine Dalgarno sequence binds to the 16s
rRNA at the 3 end. This facilitates proper
positioning of the____ on the________ so
that translation can accurately begin on start
codon AUG
Next, the charged_______ ____ recognisesthe start codon.The_______ of tRNA binds
antiparallel to the_____ on mRNA
2. Initiation (contd.)
-
8/6/2019 L20 Translation
14/20
__ __________ subunit binds to this complexto form a complete ribosome as a part of the
________ complex
The complete ribosome has 3 sites :__
(_____),_ (________) and_ (_____ ____)
_____ tRNA leaves the ribosome from the__
site
All new tRNAs bind to the ribosome at the__
site (except the_______ tRNA which binds at
the__ site)
2. Initiation (contd.)
-
8/6/2019 L20 Translation
15/20
tRNA with the growing peptide is bound tothe__ site
Initiation is complete with the formation of
the initiation complex
Initiation complex enters the next stage -
__________
2. Initiation (contd.)
-
8/6/2019 L20 Translation
16/20
3. Elongation The next tRNA with the next amino acid
binds to the_ site of the ribosomal complex.
The enzyme________ ___________ transfers
the_____ amino acid from the_______ tRNA
on_ site to form a_______ bond with theamino acid on the next tRNA on the_ site
Now the tRNA on P-site is_____ and that on
A-site carries a_________ The whole________ moves along the mRNA
towards the__end by a distance of one
codon. This process is called____________
-
8/6/2019 L20 Translation
17/20
3. Elongation
Now the E site has the_____ ____ , P site has the
________ ____ and A site is ready to accept the
next tRNA with the next amino acid. The steps of
elongation repeat to elongate the peptide chain
Elongation is aided by proteins called_________________ (3 in number:_____ , _____ and ____ )
Elongation is___ dependent for energy
Elongation continues till__ site falls on a____codon
-
8/6/2019 L20 Translation
18/20
4. Termination Termination begins when one of the____
codons occupies the_ site
Instead of a tRNA, proteins called_______
______ bind to the stop codon (RF-1 recognises
___ and___ , RF-2 recognises___ and___) Peptidyl transferase hydrolyses the bond
between the peptide chain and the tRNA,
releasing the peptide chain free ___ causes the release of RF-1 and RF-2
The ribosomal subunits, the mRNA and the
empty tRNA dissociate from each other
-
8/6/2019 L20 Translation
19/20
Eukaryotic translation
The initiator tRNA carries________ , not N-formyl
methionine, to the P-site
Initiation factors are__ in number (__ ___ ) Ribosomes are__s with___ and___ subunits
60s subunit is made up of___ rRNA,___ rRNA,
__ rRNA and 50 proteins 40s subunit is made up of___ rRNA and 30
proteins
mRNA is___________ (polycistronic in prokaryotes)
Similar to prokaryotic translation, with the
following differences:
-
8/6/2019 L20 Translation
20/20
Eukaryotic translation (contd.)
No Shine Dalgarno sequence. 40s subunit, aidedby eIFs, binds to the 5 cap and slides down the
mRNA to reach the start codon
Elongation factors are EF__, EF___ and EF__instead of EF-Tu, EF-Ts and EF-G respectively
A single release factor,___, functions to
recognise all stop codons. Another release
factor____ functions instead of RF-3