-
Molecular, biochemical and hematological
investigations of -thalassemic children in Gaza
governorate
Prepared by
Rami M. Al Haddad
Co-supervisor
Dr. Mahmoud Sirdah
Associate Professor of Medicine
Blood Pathophysiology
Al-Azhar University of Gaza
Supervisor
Prof. Dr . Maged Yassin
Professor of Physiology
Faculty of Medicine
The Islamic University of Gaza
A thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in Biological Sciences Medical
Technology
2012�ϡ�1433�˰ϫ
ΔϳϣϼγϹ�Δ˰όϣΎΟϟ-�Γί˰Ϗ
˰ϳϠόϟ�ΕΎ˰γέΩϟ�ΓΩΎ˰ϣϋΎ
ϡϭ˰Ϡόϟ�Δ˰ϳϠϛ
Δ˰ϳΗΎϳΣϟ�ϡϭ˰Ϡόϟ�έϳΗγΟΎϣ
ΔϳΑρ�ϝϳϟΎΣΗ
The Islamic University-Gaza
Deanery of Post Graduate Studies
Faculty of Science
Master of Biological Sciences
Medical Technology
id2016640 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
-
II
Dedication
To my Great Parents who have always
supporting me
To my Brothers and Sisters
Special Dedication to my Wife Heba
who helped me to accomplish this thesis
To my beloved sons Muneer, Nada, and
Jana
And to all Thalassemics in Gaza Strip
To all of them Idedicate this work
-
III
Declaration
I hereby declare that this submission is my own work and that, to the best of my
knowledge and belief, it contains material neither previously published or written
by another person nor material which to a substantial extent has been accepted for
the award of any other degree of the university of other institute, except where due
a acknowledgment has been made in the text.
Signature Name Date
Rami Rami M.Al Haddad 25-12-2012
Copy Right
All rights reserved: No part of this work can be copied, translated or
stored in any retrieval system, without prior permission of the author.
-
IV
Acknowledgment
I would like to express my deepest gratitude and appreciation to my supervisor Prof. Dr Maged M. Yassin, Professor of Physiology, Faculty of Medicine, The Islamic University of Gaza for his continuous support, encouragement and kind of supervision that leads to the emergence of this work in its current form.
I would like also to express my deepest thanks to my co-supervisor Dr.
Mahmoud M.S. Sirdah, Associate Professor of Blood Pathophysiology Al-Azhar University of Gaza for his continuous support, encouragement , guidance and help throughout this work. Thank you for being a great inspiration to me , iam greatfull for all that you have done for me.
My special deep and sincere gratitude are to my great parents, brothers and
sisters how have always supporting me . My deep and sincere appreciation to my wife Heba who was always behind
me to help and give all possible support. My warmest thanks for all the members of Thalassemia and Heamophilia
Center team specially for Dr. Issa Tarazi Vice Manager of Thalassaemia and Haemophilia Center - Palestine Avenir Foundation for his encouragement and continuous support . Thank you for helping me grow in my career. My colleagues at work Mr. Ahmed El-ghefary, Ms. Sawsan El-sory, Ms. Reem El -Kord, Ms. Neamat El -Franjee and Miss. Rana El-Dramli.
Also I would like to thank Dr. Hisham E. El Jeadi Hematologist in European- Gaza Hospital for his help and support.
My deep grateful to nursing staff Mr. Shady Shtawey, Mr. Atef and Miss. Wesam Khader who helped me to assess the patients in the study and for providing facilities for sample collection from them.
I would like to thank Mr. Amid Mushtaha, the director of Abd El-Aziz El-Rantisy laboratories and Miss. Najwa El -Borno for their assistance in preparing samples.
My appreciation is extended to Mr. Ahmad Ashour in the Biology department at Al-Azhar university-Gaza for his help and support.
I am especially grateful to all Thalassemics children and their parents, for their understanding and cooperation. Without them this study would not have been possible. I wish to present my thanks to the people who served as healthy controls in my study. Finally, thanks are extended to everyone who has a hand in this work.
-
V
Molecular, biochemical and hematological investigations of -thalassemic children in Gaza governorate
Abstract
Background: Thalassemias are hereditary anemias mostly common in the
Mediterranean, the equatorial, or near equatorial regions of Africa and Asia.
They are classified according to which particular globin chain(s) is/are
produced in a reduced amount: , , , , and thalassemias. In the Gaza
Strip, more than 300 patients have been diagnosed with â-thalassemia major,
they are currently being transfused and managed in local hospitals.
Aims: To investigate molecular, biochemical and hematological aspects of
â-thalassemic children aged 5-12 years in Gaza City.
Methodology: Blood samples were collected from 53 â-thalassemic
children who are transfused and managed at the pediatric hospitals at Gaza
City. Blood withdrawals were performed just before the scheduled blood
transfusion. In addition blood samples were also collected from 53 apparently
healthy children. Cases and controls were age and sex matched. Part of data
was collected by using close-ended questionnaire. Complete blood count and
biochemical tests were performed. Screening for possible mutations in HBB
gene was performed at the molecular medicine laboratories of the Bernhard
Nocht Institute (BNI), Germany, according to Dynamic Allele-Specific
Hybridization (DASH) method. This work was performed according to the
cross-sectional descriptive study design. An official approvals letters were
obtained from Helsinki committee at the Palestinian ministry of health and
from the Palestinian Thalassemia Center who approved performing the study
on the thalassemic children. The data were tabulated, encoded and
statistically analyzed using the IBM SPSS Statistics (version 17, IBM
Corporation, Somers, NY). The Chi square test, the independent-samples t-
test, and One-Way analysis of variance (ANOVA) were performed aiming at
the description, identification of significant relationship, correlations and
-
VI
differences between the study items, variables and parameters. A p-value <
0.05 was considered statistically significant.
Results: A significant difference was reported in the parents' consanguinity
of the two groups (P=0.001). About 71% of the â-thalassemia major children
parents are 1st degree cousins compared to the control group where the
percentage is
-
VII
�±Ş�ŗŪ¦°®ŗƒőƒ ƆƒƂƒŕ�µ°Ɔŕ�ÀƒŕœŮƆ�¾œŽ¶ƕ�ŗƒÂƆ®Â�ŗƒőœƒ �œřƒŕ� Â̧ƈ�ÀƆ�œƒƆƒŪƚśƃ¦غŗ·żœšƆ ÉÒ في
ŗŪ¦°®ƃ¦�´ŤƄƆ ŗƆ®ƀƆƃ¦ : �±»ţŗƅ§�¶Ãţ�Ɠž�ÆŕŷÃƔŮ�±ŝƄ£�ƓƍÃ�Ɠŝ§±Ã�À¯�±Ƃž�Ɠƍ�ŕƔƈƔŬƜŝƅ§�¶Ɣ»ŗƗ§�Ɠ»žÃ��·»ŬÃśƈƅ§
�Ã�ŕ»»»»ƔƂƔ±ž£�Á»»»»ƈ�řƔœ§Ãś»»»»Ŭƛ§�ƌŗ»»»»Ů�ã�řƔœ§Ãś»»»»Ŭƛ§�½·ŕ»»»»Ɗƈƅ§Â��ŕƔ»»»»Ŭ�řƆ»»»»ŬƆŬƅ§�¹Ã»»»»Ɗ�¨»»»»Ŭţ�Ƒ»»»»Ɔŷ�À»»»»ŬƂƊś�Ɠ»»»»ƍÃ�©²»Ż�¹ŕ»·Ɓ�Ɠ»ž�¯»ŠÃƔ��ໜƅ¯�ŕ»ƈŕŠÃ�ໜƅ¯��ໜƔŗ�ໜƅ¯��ໜƔŗ��ŕ»ſƅ£����Ƒ»ƅ¥�µƂƊ�ŕƎƔž�«¯ţƔ�Ɠśƅ§�řƔƊƔśÃ±ŗƅ§
�Áƈ�±ŝƄ£300 �Ƒƈ¸ŷ�ŕƔƈƔŬƜŝ�¶Ɣ±ƈ���řƔƆţƈƅ§�ªŕƔſŮśŬƈƅ§�Ɠž�¬ƜŸƅ§�ÁÃƂƆśƔÃ�À¯ƅ§�ÁÃƆƂƊƔ ÝÏÜÜلهÇ: �ř»»œƔŕƔƈƔƄÃƔŗƅ§��ř»»ƔœƔ²Šƅ§�Ɠţ§Ã»»Ɗƅ§�ÀƔ»»ƔƂś�ç±»»śś�ÁƔ°»»ƅ§�ŕƔƈƔ»»ŬƜŝƅ§�Ƒ»»Ų±ƈ�¿ŕ»»ſ·£�į»»ƅ�ř»»ƔÃƈ¯ƅ§Ã
�Áƈ�Àƍ±ŕƈŷ£5-12 �©²Ż�řƊƔ¯ƈ�Ɠž�řƊŬ ÞÑÜÜØلÇ: �Á»»ƈ�À¯�ªŕ»»ƊƔŷ�¨ţ»»Ŭ�À»»ś53 �ªŕƔſ»»ŮśŬƈ�Ɠ»»ž�¬Ɯ»»Ÿƅ§�Áû»ƂƆśƔÃ�À¯»»ƅ§�Áû»ƆƂƊƔ�ŕƔƈƔ»»ŬƜŝ�¶Ɣ±»»ƈ
��©²Ż�řƊƔ¯ƈ�Ɠž�¿ŕſ·Ɨ§Àś �¨ţŬªŕƊƔŷ �řžŕ»Ųƙŕŗ��Ƒ»Ų±ƈƅ§�¡ƛ¤»Ǝƅ�©±±»Ƃƈƅ§�À¯»ƅ§�¿ƂƊ�řƔƆƈŷ�¿ŗƁ�À¯ƅ§�Á»»ƈ�À¯�ªŕ»»ƊƔŷ�¨ţ»»Ŭ�À»»ś�¾»»ƅ°�Ƒ»»ƅ¥53 �ÆŕƈƔƆ»»Ŭ�ÆƜ»»ſ· ř·ŗŕ»»Ų�ř»»ƊƔŸƄ . Ŷ»»ƈŠ�À»»ś ªŕ»»ƊŕƔŗƅ§�Á»»ƈ�¡²»»Š äÜÜع
¯»»»»ƁÃ�řƊŕŗś»»»»Ŭƙ§�ř»»»»œŗŸś�½»»»»Ɣ±· �¡§±»»»»ƈţƅ§�À¯»»»»ƅ§�ªŕ»»»»Ɣ±Ƅƅ�Ɠ»»»»ƆƄƅ§�¯¯»»»»Ÿƅ§�Ƒ»»»»Ɔŷ�¿Ã»»»»ŰţƆƅ�ªŕ»»»»ƊƔŸƅ§�¿»»»»ƔƆţś�À»»»»ś��ř»»»ƔœŕƔƈƔƄÃƔŗƅ§�ªŕ»»»ŰÃţſƅ§Ã ÏÜÜÜقæ �řŗŗ»»»Ŭƈƅ§�ř»»»ƔƊƔŠƅ§�ª§±»»»ſ·ƅ§�Á»»»ŷ�¼»»»ŮƄƆƅ� Ã̈»»»Ɔ·ƈƅ§�Ţ»»»Ŭƈƅ§�¡§±»»»Š¥�À»»»ś
��Ɠ»ž�ª»ŦƊ ةŸŗŕśƅ§�ř»ƔœƔ²Šƅ§�¨»·ƅ§�ª§±»ŗśŦƈ�Ɠž�¡§±Šƙ§�§°ƍ�Àś�¯ƁÃ�ŕśƔŗ�¹ÃƊ�Áƈ�ŕƔƈƔŬƜŝ«لل ±̄ŕ»Ɗ±ŗ�¯»ƎŸƈƅ��řƂƔ±·ƅ�ÆŕƂŗ·��ŕƔƊŕƈƅ£DASH(. Ç���ř»Ų±ŸśŬƈƅ§�řƔſ»ŰÃƅ§�ªŕŬ§±¯ƅ§�řƂƔ±·�¨Ŭţ�«ţŗƅ§�§°ƍ�ıŠ�À»ś
�Á»»»»ƈ�Ã�řƔƊƔ·»»»»ŬƆſƅ§�řţ»»»»Űƅ§�©±§²Ã�Ɠ»»»»ž�ƓƄƊ»»»»ŬƆƍ�ř»»»»ƊŠƅ�Á»»»»ƈ�řƔƈ»»»»Ŭ±ƅ§�ªŕ»»»»Ƃž§Ãƈƅ§�Ƒ»»»»Ɔŷ�¿Ã»»»»Űţƅ§�²»»»»Ƅ±ƈ�Ã�²»»Ɣƈ±ś�Ã�¿ŕ»»Ŧ¯§�À»»ś��Ƒ»»Ų±ƈƅ§�¿ŕ»»ſ·Ɨ§�Á»»ŷ�ř»»Ŭ§±¯�°»»ƔſƊś�Ƒ»»Ɔŷ�½»»ž§Ã�Ä°»»ƅ§�Ã�ƓƊƔ·»»ŬƆſƅ§�ŕƔƈƔ»»ŬƜŝƅ§�ÁƔŕ»»ŗśƅ§�¿»»ƔƆţś�±ŕ»»ŗśŦ§�Ã�¿Ƃś»»Ŭƈƅ§�Ɠ»»ś�±ŕ»»ŗśŦ§�Ã�Åŕ»»Ƅ�Ŷ»»ŗ±ƈ�±ŕ»»ŗśŦ§�À§¯Ŧś»»Ŭŕŗ�ŕ»»ƎƆƔƆţś�Ã�şœŕ»»śƊƅ§�ř»»ƅïŠ
ƙ§Ã�ř»ƅ¯ŕŗśƈƅ§�ªŕ»ƁƜŸƅ§Ã�ř»ƈƎƈƅ§�ªŕ»ƁƜŸƅ§�¼»ŰÃÃ�¯»Ɣ¯ţś�¼¯»Ǝŗ�¾ƅ°�Ã�ŕžÃƊ§Ŧśال�Ã�ª§±»Ɣżśƈ�ÁƔ»ŗ�ªŕ»žřŬ§±¯ƅ§� Ã̄Ɗŗ�ª§°�ªŕžƜśŦƛ§�±ŕŗśŷ§�Àś�Ã��Ï�ř»ƅƛ¯Ɔƅ�ř»Ɣƅŕƈśţƛ§�ř»ƈƔƂƅ§�ª»ƊŕƄ�§°§�ř»Ɣ±ƍÊ�řƔœŕŰţ§�řƅƛ
�Áƈ�¿Ɓ§�řƔœŕŰţƛ§0.05 ŝőœřƈƃ¦: ��ÁƔśŷûƈŠƈƅ§�ÁƔ»ŗ�ÁƔ¯»ƅ§Ãƅ§�ř»ŗ§±Ɓ�ř»Š±¯�Ɠž�ªƆŠŬ�řƔœŕŰţ¥�řƅƛ¯�¾ŕƊƍP=0.001�Ɠƅ§Ã»ţ��
%71 Ÿƅ§�ŕƔƈƔŬƜŝƅ§�ƑŲ±ƈ�¡ŕŗ¢�Áƈ�Ƒƈ¸ÀƎƔ¯ƅ �±Ɓ�řŠ±¯Ƒƅã�řŗ§ �řŗŬƊƅ§�«Ɣţ�ř·ŗŕŲƅ§�řƊƔŸƅŕŗ�řƊ±ŕƂƈ %�Á»ƈ�¿»Ɓ§%2 .Ɠƅ§Ã»»ţƅ�ª»ŲſŦƊ§�ÁƔŗûƆŠÃƈƔƎƅ§�řŗ»ŬƊ�Á£�«»»Ɣţ�Ƒ»Ų±ƈƅ§�Ɠ»ž�¯ŕ»ţ�À¯�±»»Ƃž�¸ţûƅهÜي 30 ř·ŗŕ»Ųƅ§�ªŕ»ƊƔŸƅ§�Ɠ»ž�řƆŠ»Ŭƈƅ§�řŗ»ŬƊƅŕŗ�ř»Ɗ±ŕƂƈg/dl 1.0±8.0 �¿»ŗŕƂƈ0.8±11.4 . ŕ»ƈƄ �¸ţûƅ
�¡§±»ƈţƅ§�À¯»ƅ§�ŕ»»ƔƜŦ�À»Šţ�±ż»Ű ìÏÜÜل °�Áŕ»Ƅ�½±»ſƅ§�§°»»ƍÃ�ř·ŗŕ»Ųƅ§�ř»ƊƔŸƅ§�Ŷ»»ƈ�ř»Ɗ±ŕƂƈ�Ƒ»Ų±ƈƅ§æ ةÜÜاللÏ�ƓƅໜƅŕƄ�řƔœŕ»Űţ¥fl 7.3±75.9æ 2.3 pg±24.1 �¿»ŗŕƂƈ�Ƒ»Ų±ƈƅ§�Ɠ»ž4.4 fl±79.5æ2.2 pg
±24.7 ��ř·ŗŕ»»Ųƅ§�ř»»ƊƔŸƅ§�Ɠ»»ž¯¯»»ŷÃ�¡ŕ»»ŲƔŗƅ§�À¯»»ƅ§�ªŕ»»Ɣ±Ƅ�¯¯»»ŷ�©¯ŕ»»Ɣ²�Ɠ»»ž�řƔœŕ»»Űţ¥�ř»»ƅƛ¯��ªƆŠ»»Ŭ
-
VIII
»»»Ų±ƈƅ§�į»»»ƅ�ÅÃƊŕ»»»ŝƅ§�ř»»»ƔÃƈ¯ƅ§�Ţœŕſ»»»Űƅ§ى ƅŕŗ���ř»»»ƅƛ¯�§°�±Ãƍ¯»»»ś�¸ţû»»ƅ�ř»»»ƔœŕƔƈƔƄÃƔŗƅ§�µœŕ»»»ŰŦƆƅ�řŗ»»»ŬƊ»»Ų±ƈƅ§�Ɠ»»ž�ŕ»»Ɣ±ÃƔƅ§�§¯»»ŷŕƈ�ř»»ƔƆƄƅ§�¼œŕ»» Ã̧Ã�¯»»ŗƄƅ§�¼œŕ»» Ã̧�Ɠ»»ž�řƔœŕ»»Űţ¥ي ��ř·ŗŕ»»Ųƅ§�ř»»ƊƔŸƅ§�Ɠ»»ž�ř»»Ɗ±ŕƂƈ
Ƒ»»»»ƊƔśÃ±ŗƅ§�Äû»»»śţƈƆƅ�řŗ»»»»ŬƊƅŕŗ: �§°»»»»ƍÃ�Ƒ»»»»Ų±ƈƅ§�į»»»»ƅ�¶»»»»ſŦƊ§�ÁƔƅû»»»ƔŗÃƆŠƅ§Ã�ÁƔƈû»»»ŗƅƗ§�Ɠ»»»»ƆƄƅ§�ÁƔśÃ±»»»»ŗƅ§»»Ɔŷ�©ÃƜ»»ŷ�řƔœŕ»»Űţ¥�ř»»ƅƛ¯�§°�¶ŕ»»ſŦƊƛ§ŕƂƈ�Ƒ»»Ų±ƈƅ§�į»»ƅ�¯»»Ɣ¯ţƅ§�ÄÃś»»Ŭƈ�Ɠ»»ž�©¯ŕ»»Ɣ²�¾ŕ»»Ɗƍ�¾»»ƅ°�Ƒ�ř»»Ɗ±
řŗŬƊ�«Ɣţ�ř·ŗŕŲƅ§�řƊƔŸƅŕŗFerritin ƓƅໜƅŕƄ)1560.5 ng/l±3231.0 ¿»ŗŕƂƈ46.8±23.1 ng/l(. Á£�ªſ»»»ŮƄ�ř»»»ƔœƔ²Šƅ§�µœŕ»»»ŰŦƆƅ�řŗ»»»ŬƊƅŕŗ ÉÑÜÜÜفØلÇ IVS-I-110 檯»»»Š �ªŕƈû»»ŬÃƈñƄ�Ŷ»»»ŗ±�Ɠ»»»ž�Æŕ»»»ŗƔ±Ƃś
Ƒ»Ų±ƈƅ§ 106/24 œ§¯»ŗ�±§±»Ƅśŗ�ÿ =0.23 ŕ»ƎŸŗśƔIVS-I-1 æCD39 »Ɣţ�Ɠ»ž�ª¯»ŠÃ�«18 �Á»ƈƑ»»»Ų±ƈƅ§�ªŕƈû»»ŬÃƈñƄ يÜÜÜفæ17 »»»Ų±ƈƅ§�ªŕƈû»»ŬÃƈñƄ�Á»»»ƈى œ§¯»»»ŗ�±§±»»»Ƅśŗ¿ �ÅÃŕ»»»ŬƔ0.17 æ o.16
�¯Ƃƅ��Ɠƅ§Ãśƅ§�ƑƆŷ �¿ŝƈ�Ƨ±§±Ƅś�¿Ɓ£�ª§±ſ·�ª¯ŠÃIVS-I-6 æ .CD37 Ç«œřƈřŪƙ : �¾ŕƊƍ¹ÃƊś »Ų±ƈƅ§�į»ƅ�ໜƔŗ�¹Ã»Ɗ�Á»ƈ�ŕƔƈƔŬƜŝƆƅ�řŗŗŬƈƅ§�ª§±ſ·ƅ§�Ɠž�ƓœƔ²Šي ىÜف ÚاÜØق
�¿Ã»»ƄÃśÃ±ŗ�Ŷ»»ŲÃ�¨»»Ɔ·śƔ�ŕ»»ƈƈ�¶±»»ƈƅ§�į»»ƅ�ř»»ƔÃƈ¯ƅ§Ã�ř»»ƔœŕƔƈƔƄÃƔŗƅ§�µœŕ»»ŰŦƅ§�Ɠ»»ž�±Ãƍ¯»»ś�¾ŕ»»Ɗƍ���©²»»Ż©¯ŕţ�řƔƊƔŠ�ª§±ſ·�ÀƎƔ¯ƅ�ÁƔ°ƅ§�ƑŲ±ƈƆƅ�řŰŕŦ�¨ŬŕƊƈ�ƓŠƜŷ.
ŗººººƒšœřŽƆƃ¦�©œººººƆƄƂƃ¦: �ŕƔƈƔ»»»»ŬƜŝ�ŕ»»»»śƔŗª§±»»»»ſ·ƅ§��¿ŕ»»»»ſ·Ɨ§� �ř»»»»ƔÃƈ¯ƅ§Ã�ř»»»»ƔœŕƔƈƔƄÃƔŗƅ§�µ§Ã»»»»Ŧƅ§� ř¸žŕţƈ .ÉÒغ
-
IX
Table of Contents
Contents page Dedication.. II Declaration . III Acknowledgements IV Abstract (English).. V Abstract (Arabic)... VII Table of contents IX List of Figures XII List of Tables. XII
Chapter 1:Introduction
1.1Overview 1 1.2 General objective 2 1.3 Specific objectives . 2 1.4 Significance of the study. 3
Chapter 2: Literature Review
2.1 Human hemoglobins 4 2.1.1 Structure of hemoglobin 4 2.1.2 Ontogeny of human hemoglobins......... 5 2.1.3 Fetal to adult hemoglobin switch.......... 5 2.1.4 Genetic control of human hemoglobins........ 6 2.1.5 Hemoglobin disorders 8 2.2 Thalassemia. 8 2.2.1 Types of thalassemia. 8 2.3 -thalassemia... 9 2.3.1 Distribution of -thalassemia 10 2.3.2 Clinical classification of -thalassemia. 11 2.3.3 Pathophysiology of -thalassemia. 11 2.3.4 Molecular genetics of -thalassemia. 13 2.3.5 Complications of -thalassemia 15 2.3.6 Diagnosis of -thalassemia 16 2.3.7 Management of -thalassemia... 17 2.4 Related studies.. 18
Chapter 3: Materials and methods 3.1 Study design 22 3.2 Target population... 22 3.2.1 Inclusion criteria 22 3.2.2 Exclusion criteria... 22
-
X
3.3 Sample size...................................................................................... 22 3.4 Ethical consideration.. 22 3.5 Data collection. 23 3.5.1 Questionnaire. 23 3.5.2 Venous blood withdrawal.. 23 3.5.3 Spotting and transfer of Dried Blood Samples (DBS)... 24 3.5.4. HBB mutations screening. 25 3.6 Biochemical analysis 27 3.6.1 Determination of serum urea. 27 3.6.2 Determination of serum creatinine 28 3.6.3 Determination of serum uric acid.. 29 3.6.4 Determination of serum Aspartate aminotransferase(AST) enzyme activity... 31
3.6.5 Determination of serum Alanine Aminotransferase (ALT) enzyme activity... 32
3.6.6 Determination of bilirubin. 34 3.6.7 Determination of total protein... 36 3.6.8 Determination of albumin.. 38 3.6.9 Determination of globulin.. 39 3.6.10 Determination of serum Calcium (Tca)... 39 3.6.11 Determination of phosphorus.. 40 3.7 Hematological analysis. 41 3.7.1 Complete blood count (CBC) 41 3.7.2 Determination of serum ferritin. 41 3.7.3 Fetal haemoglobin (HbF) quantitation.. 41 3.7.4 Blood film.. 43 3.8 Statistical analysis. 43
Chapter 4: Results 4.1 General characteristics of the study groups.. 44 4.2 General and some clinical characteristics of the patient.. 45 4.3 Hematological characteristics of the study groups.. 46 4.4 Biochemical characteristics of the study groups.. 47 4.5 Poikilocytosis in patients blood 48 4.6 Mutation spectrum of â-thalassemia major patients. 49 4.7 Genotype of patients according to the identified variants... 50 4.8 Hematological and biochemical characteristics of patients according to gender.
51
4.10 Hematological and biochemical characteristics according to patients Genotype... 52
-
XI
Chapter 5: Discussion
5.1 General characteristics of the study population.... 56 5.2 Hematological characteristics of the study groups... 57 5.3 Biochemical characteristics of the study group 58 5.4 Hematological and biochemical characteristics according to patients Genotype...
60
5.5 Mutation spectrum of â-thalassemia major patients. 60 5.6 Genotype of patients according to the identified variants... 61
Chapter 6: Conclusions and Recommendations 6.1 Conclusions... 63 6.2 Recommendations. 64
Chapter 7: References References. 65
Appendices Annex 1: Approval to conduct the study from Helsinki committee in the Gaza Strip...
79
Annex 2: Approval from the Palestinian Thalassemia Center who approved performing the study on the thalassemic children
80
-
XII
List of Figures
Figure 2.1 An illustration of the three dimensional structure of hemoglobin tetramer, and the chemical structure of heme.
4
Figure 2.2 The changes in human globin chains synthesis during developmental stages of life.
6
Figure 2.3 Structure of the á-globin and -globin genes.. 7 Figure 2.4 Geographical distribution of â-thalassemia around the world 10 Figure 2.5 Pathophysiology of -thalassemia.. 12 Figure 3.1 Newborn screening filter paper... 25
List of Tables Table 2.1 Hemoglobin types in the different developmental stages of human life.
5
Table 2.2 The spectrum of -thalassemia mutations in the Middle East region.
14
Table 3.1 Characteristics of hybridization assays used for genotyping 26 Table 4.1 General characteristics of the study groups. 45 Table 4.2 General and some clinical characteristics of the patients 46 Table 4.3 Hematological characteristics of the study groups... 47 Table 4.4 Biochemical characteristics of the study groups... 48 Table 4.5 Poikilocytosis score of the patients... 49 Table 4.6 Relative allelic frequencies of HBB variants in Gaza strip patients...
50
Table 4.7 Genotype of patients according to the identified variants. 50 Table 4.8 Hematological characteristics of patients according to gender 51
Table 4.9 Biochemical characteristics of patients according to gender 52
Table 4.10 Hematological characteristics according to patients genotype.
54
Table 4.11 Biochemical characteristics according to patients Genotype 55
-
1
Chapter 1
Introduction
1.1 Overview
The thalassemias are hereditary anemias caused by mutations that affect the
synthesis of the globin, the protein component of the hemoglobin. Thalassemias
produce a massive public health problems in many parts of the world (Vichinsky,
2005). They are the commonest genetic diseases of mankind and have been encountered
practically in every racial group and geographic location in the world, however, they are
most common in the Mediterranean, the equatorial, or near equatorial regions of Africa
and Asia (Weatherall, 2010).
Thalassemias are classified according to which particular globin chain(s) is/are
produced in a reduced amount, which may lead to an imbalance in globin chains
synthesis, ineffective erythropoiesis, hemolysis, and eventually to a variable degree of
anemia.The main types of thalassemias are the , , , , and . The and
thalassemias are the most common classes, and thalassemia is the most important and
widely spread type which causes severe anemia in the homozygous and compound
heterozygous states (Weatherall, 1996 and 2004��2OLYLHUL������� and Galanello and
Origa, 2010).
Thalassemias are clinically classified according to their severity into thalassemia
major requiring a regular blood transfusion throughout life, thalassemia intermedia
characterized by anemia but not of such severity as to require regular blood transfusion,
and thalassemia minor or trait which is the symptomless carrier state (Nienhuis and
Benz, 1996; Lahiry et al., 2008 and Cao and Galanello, 2010). The severity of the
clinical syndrome of â-thalassemia depends on the type of mutation in the â gene. More
than 400 different mutations have been reported and identified in the globin gene
which are responsible for the development of the thalassemia (Patrinos et al., 2004
and Pan, 2010). Most types of -thalassemias are due to point mutations, and large
deletion mutations are found in rare cases (Sanguansermsri et al., 1990; Galanello
and Origa, 2010 and Danjou et al., 2011). Well known relationships have been
-
2
reported between the hematological-clinical phenotype and the type of the -
thalassemia mutation (Rosatelli et al., 1992). Consequently, identifying the mutation in
the patients is highly appreciated for a better management protocol (Winichagoon et
al., 2000 and Arumugam and Malik, 2010).
Blood transfusions are gradually introduced by physician to suppress
thalassemic manifestation. However, humans have a very limited ability to excrete iron,
so regular blood transfusion inevitably lead to iron overload (Luangasanatip et al.,
2011). Evidences of marked iron deposition in the liver, heart, pancreas, thyroid,
parathyroid, adrenal, renal medulla, bone marrow, and spleen are commonly reported.
This parenchymal iron loading is the major cause of morbidity and mortality in the
severe -thalassemias. The normal adolescent growth spurt fails to occur, and hepatic,
endocrine, and cardiac complications producing a variety of clinical problems including
diabetes, hypoparathyroidism, adrenal insufficiency, and liver failure will take place.
Secondary sexual development is delayed, or does not occur at all (Peters et al.,
2012).The management of severe forms of the -thalassemia diseases depends on 3
mainstays regimen: regular blood transfusion, removal of overloaded iron with
chelating agents such as deferoxamine and Exjade, and splenectomy when rate of
transfusion is increasing (Peters et al., 2012 and Vichinsky et al., 2011).
1.2 General objective
The general objective of the present study is to investigate molecular,
biochemical and hematological aspects of â-thalassemic children aged 5-12 years in
Gaza.
1.3 Specific objectives
1. To identify the causative mutation of â-thalassemic children in Gaza.
2. To determine serum levels of aspartate aminotransferase (AST), alanine
aminotransferase (ALT), creatinine, urea, uric acid, bilirubin, total protein, albumin,
ferritin, calcium, and phosphorous in â-thalassemic children.
3. To measure CBC parameters in â-thalassemic children.
4. To quantify the level of HbF in â-thalassemic children.
5. To perform blood films for â-thalassemic children.
-
3
6. To evaluate the clinical severity of the â-thalassemia disease in terms of the
frequency of regular blood transfusions.
7. To correlate the causative mutation to the clinical, biochemical and hematological
characteristics of â-thalassemic children.
1.4 Significance of the study
1. More than 325 patients have been diagnosed as â-thalassemic major, they are
currently transfused and chelated in governmental hospitals of the Gaza Strip.
2. Lack of molecular studies on thalassemia mutation in Gaza Strip; only a preliminary
study linked laboratory indices of â-thalassemia with type of the thalassaemia
mutation. Therefore, it is worthwhile to evaluate the thalassemic children in Gaza for
their hematological and biochemical characteristics and also to find a possible
correlation between these characteristics and the molecular genetics of the disease.
3. Identifying the mutation could improve or establish a proper management protocol
for those thalassemic children in terms of the regularity and quantity of blood
transfusions, and consequently the chelation treatment of the associated iron
overload.
-
�
Chapter 2
Literature review
2.1 Human hemoglobins
The human hemoglobins are heterogeneous proteins packed inside the red blood
cells. This heterogeneity is expressed at all stages of development, during which
different forms of hemoglobin are synthesized (Weatherall and Clegg, 1996;
Weatherall, 2000 and Schechter, 2008).
2.1.1 Structure of hemoglobin
All the human hemoglobins are tetrameric in structure, made up of two different
pairs of globin polypeptide chains (2 like, 2 like). Each globin chain is attached to
one heme molecule (Figure 2.1). However, different types of hemoglobins are
synthesized during the developmental stages of human life Table 2.1. (Maniatis et al.,
1980 and Sanders et al., 2002).
Figure 2.1. An illustration of the three dimensional structure of hemoglobin tetramer, and the
chemical structure of heme (Kingston, 2002).
-
5
Table 2.1. Hemoglobin types in the different developmental stages of human life.
Hemoglobin Type Structure Developmental Stage
Hb Gower 1 2 2 Embryo
Hb Gower 2 2 2 Embryo
Hb Portland 2 2 Embryo
HbF 2 2 Fetal and adult
HbA2 2 2 Adult
HbA 2 2 Adult
2.1.2 Ontogeny of human hemoglobins
Normally, hemoglobin tetrameres contain 2-like ( or ) chains and 2- like
(, , ,or ) chains (Weatherall, 1997; Patrinos et al., 2005 and Higgs et al., 2012).
Hemoglobin synthesis (Figure 2.2) begins during the second month of gestation in the
yolk sac. The earliest embryonic hemoglobin tetramere is called Hb Gower1 (2 2),
which consist of 2 like (2) and 2 like (2) chains. Then, two other embryonic
hemoglobins are synthesized: Hb Gower2 (2 2) and Hb Portland (2 2). At 10 to 11
weeks of gestation, erythropoiesis takes place in liver and spleen, at which, embryonic
hemoglobins (Hb Gower1, Hb Gower2 and Hb Portland) decline and fetal hemoglobin
(HbF: 2 2) eventually becomes the predominant throughout the fetal life (Karlsson
and Nienhuis, ������0F'RQDJK�and Nienhuis, ����� Manning, 2007 and Elizabeth
and Mary Ann, 2010).
2.1.3 Fetal to adult hemoglobin switch
After birth, the adult and globin chains begin gradually to replace the -
globin chain. This results in a major switch from HbF (2 2) to the adult hemoglobin
HbA (2 2) synthesis which occurs at about the time of birth and ends 6 months later
(Figure 2.2). After switch from fetal to adult hemoglobin, 97-98% of the hemoglobin is
HbA, while HbA2 (2 2) accounts for approximately 2%. Small amount (1%) of HbF
is also found in adults blood (Stamatoyannopoulos and Grosveld, 2001 and Thein et
al., 2009).
-
�
Figure 2.2. The changes in human globin chains synthesis during developmental stages of life
(Schechter, 2008).
2.1.4 Genetic control of human hemoglobins
The production of the various types of human globin chains is controlled by two
gene clusters: the -like genes and -like genes cluster (Proudfoot et al., ������
Weatherall, 1997 and Elizabeth and Mary Ann, 2010).
2.1.4.1 -like genes cluster
The -like globin genes are clustered in 26 Kb DNA segment on the distal
segment of the short arm of chromosome 16. The genes cluster consist of a duplicated
highly homologous genes (1, 2), an embryonic gene, three pseudogenes (,
2, 1), and a gene of undetermined function () (Figure 2.3). These genes are
arranged on chromosome 16 in the order: -5- - - 2 - 1 -2 - 1- -3(Higgs
et al., 1989 and Ribeiro and Sonati, 2008).
2.1.4.2 -like genes cluster
The -like globin genes cluster is found near the terminus of the short arm of
chromosome 11. The cluster spread over approximately 60 Kb. It consists of a single
-
�
embryonic () gene, 2 (G, A) fetal genes, one pseudogene (), and the adults and
genes (Figure 2.3). These genes are arranged on chromosome 11 in the order:5- -
G - A - - - -3(Fritsch et al., 1980 and Ribeiro and Sonati, 2008).
Figure 2.3. Structure of the á-globin and-globin genes(Kingston2002).
Figure 2.3. Structure of the á-globin and -globin genes (Kingston 2002).
-
8
2.1.5 Hemoglobin disorders
2.1.5.1 Acquired hemoglobin disorders
The acquired disorders of hemoglobin are secondary to other disease processes
or external factors rather than resulting from genetic derangement of hemoglobin
synthesis or structure. The acquired disorders can be subdivided into those characterized
by defective synthesis of globin chain (e.g. elevated HbF levels in states of erythroid
stress and bone marrow dysplasia), and those in which the structure of hemoglobin
molecules is altered by toxins (e.g. acquired Methemoglobinaemia) (Benz, 1996).
2.1.5.2 Inherited hemoglobin disorders
The inherited disorders of the hemoglobin constitute a major public health
problem in many parts of the world, and they are commonly known as
hemoglobinopathies �:+2�� ������ :HDWKHUDOO� and Clegg, 2001 and AlQahtani,
2012). The mutations in the genes controlling the production of the human hemoglobins
can result in either quantitative (defect in the rate of production of one or more of the
globin chains) or qualitative (production of different hemoglobin molecules)
abnormalities. The quantitative abnormalities are known as thalassemias, while the
qualitative abnormalities are known as structural hemoglobin variants (Weatherall,
2001).
2.2 Thalassemia
Thalassemia is a group of inherited autosomal recessive blood disorders that
originated in the Mediterranean region. In thalassemia the genetic defect, which could
be either mutation or deletion, results in reduced rate of synthesis or no synthesis of one
of the globin chains that make up hemoglobin. This can cause the formation of
abnormal hemoglobin molecules, thus causing anemia, the characteristic presenting
symptom of the thalassemias (Rund and Rachmilewitz, 2005 and Lahiry et al.,
2008).
2.2.1Types of thalassemia
The thalassemias are due to a large number of mutations causing abnormal
globin gene expression and resulting in total absence or quantitative reduction of globin
-
9
chain synthesis (Steinberg et al., 2001 and Muncie and Campbell, 2009). They are
divided according to which globin chain is produced in reduced amounts into the:
1. Reduced or absent â-globin chain: â-thalassemia
2. Reduced or absent -globin chain: -thalassemia
3. Reduced or absent äâ- globin chain: äâ-thalassemia
4. Reduced or absent ãäâ- globin chain: ãäâ- thalassemia
All types of thalassemias are considered quantitative hemoglobin disease. From
a public health view point only the and â-thalassemias are sufficiently common to be
of importance (Weatherall and Clegg, 2001; Hoffbrand et al., 2005 and Galanello
and Origa, 2010).
2.2.1.1 -thalassemia
Is usually due to deletions within the -globin gene cluster, leading to loss of
function of one or both -globin genes in each locus leading to excess â-globin chains.
á-thalassemia generally presents as a milder form of the disease. This is due to the fact
that there are four á-globin genes, requiring multiple mutations to result in a clinical
impact. Also, the unpaired â-globin chains are intrinsically less prone to precipitation as
compared with unpaired á-globin chains in â-thalassemia (Rund and Rachmilewitz,
2005 and Muncie and Campbell, 20����+DUWHYHOG�DQG�+LJJV��������
2.2.1.2 â-thalassemia
Is the most important among the thalassemia syndromes because it is so
common and usually produce severe anemia (Weatherall, 1998).
2.3 -thalassemia
Is the result of deficient or absent synthesis of beta globin chains, leading to
excess alpha chains. â-thalassemia generally presents as severe form of the disease
because it produces severe anemia in their homozygous and compound heterozygous
states (Olivieri, 1999 and Borgna-Pignatti et al., 2005).
-
��
2.3.1 Distribution of -thalassemia
-Thalassemia has been encountered sporadically in practically every racial
group. However, â-thalassemia is most common in persons of Mediterranean, African,
and Southeast Asian descent. Thalassemia trait affects 5 to 30 percent of persons in
these ethnic groups (Fleming, ������ 5XQG� DQG� 5DFKPLOHZLW]�� ����� DQG Cao and
Galanello, 2010). Palestine is one of the Mediterranean basin countries in which
thalassemia disease is prevalent. The carrier frequency for â-thalassemia in these areas
ranges from 1% to 20%, rarely greater (WHO, 1989). Figure 2.4 shows geographical
distribution of â-thalassemia around the world. In Gaza Strip the average incidence of
thalassemia trait is 3.0 4.5% (Sirdah et al., 1998). The number of thalassemia patients
in Gaza Strip is 325 patients. There are 246 confirmed â-thalassemia major, 2 patients
are á-thalassemia and 77 individuals are thalassemia intermediate (Thalassemia
Center, 2010). Thalassemic patients get their treatment and health care in three
hospitals in Gaza Strip. Patients living in both Rafah and Khan-Younis are treated at the
European Hospital regardless of their age. Adult thalassemic patients living in Gaza
City, Northern and Middle Governorates are treated at AlShifa Hospital in Gaza City
while young thalassemic patients (
-
11
2.3.2 Clinical classification of -thalassemia
The clinical severity of â-thalassemia is related to the extent of imbalance between
the alpha and non alpha globin chains, so â-thalassemia can be categorized into three
classes according to the severity of the symptoms:
2.3.2.1 â-thalassemia minor
Is the â-thalassemia carrier state, which results from heterozygosity for â-
thalassemia, is clinically asymptomatic and is defined by specific hematological
features (Lahiry et al., 2008).
2.3.2.2 â-thalassemia intermedia
It is comprehend a clinically and genotypically as very heterogeneous group of
thalassemia-like disorders, ranging in severity from the asymptomatic carrier state to the
severe transfusion-dependent type (Cao and Galanello, 2010).
2.3.2.3 â-thalassemia major
The â-thalassemia major, also known as Cooleys anemia or Mediterranean
anemia, is a severe transfusion-dependent anemia. It is ahomozygous or compound
heterozygous state for a recessive mendelian disorder not confined to the
Mediterranean, but occurring widely throughout tropical countries (Urbinati et al.,
2006 and Galanello and Origa, 2010). At birth patients with -thalassemia major are
nearly normal hematologically, since globin chain synthesis is normal and HbF (22)
production is adequate. Thus when such newborns need to replace their fetal RBC (fetal
to adult Hb switch) with cells that contain predominantly HbA (22) the defect in -
globin synthesis become apparent. As the major switch from HbF to HbA were
occurring during the first year of life, most severe forms of -thalassemia present within
the first year of newborn life (Olivieri, 1999 and Sankaran et al., 2010 ).
2.3.3 Pathophysiology of -thalassemia
The basic molecular defect in -thalassemia results in either absence (o) or
reduced (+) beta chain production, however, chain synthesis proceeds at a normal
rate.The first consequence of reduced -chain production is reduced production of the
-
��
adult hemoglobin (HbA: 2 2). A second consequence is imbalanced globin chain
synthesis, in which chain synthesis proceeds at a normal rate and hence there is an
excess of chain in the erythrocytes. The excess chains are unstable and precipitate
in the bone marrow red cell precursors, giving rise to a large intracellular inclusions that
interfere with the red cell maturation, function and survival (Figure 2.5)(Weatherall,
2000 and Elizabeth and Mary Ann, 2010 ).
Figure 2.5. Pathophysiology of -thalassemia (Rund and Rachmilewitz, 2005).
The interference of these intracellular inclusions with red-cell maturation
subsequently gives rise to intramedullarly destruction of red-cell precursors, i.e.
ineffective erythropoiesis. However, those red cells that become mature and enter the
circulation contain chain inclusions, which interfere with their passage through the
microcirculation, particularly in the spleen, and hence extramedullarly destruction of red
cells become the norm.Thus, the anemia of -thalassemias results from both ineffective
erythropoiesis and a shortened red cell survival (Weatherall, 1996 and Ginzburg and
Rivella, 2012).
The anemia in thalassemic patients is a stimulus to increased erythropoietin
production from the kidney and hence erythropoiesis. However, the severe ineffective
erythropoiesis results in erythroid marrow expansion to as much as 30 times the normal
level, and consequently causes massive bone marrow expansion and hyperplasia that
lead not only to serious deformities of the skull and long bones, but also to increased
-
13
iron absorption and progressive deposition of iron in tissues. Increased erythropoietin
synthesis may also stimulate the formation of extramedullary erythropoietic tissue,
primarily in the thorax and paraspinal region (Olivieri, 1999 and Galanello and Origa,
2010). Moreover, because the spleen is being constantly bombarded with abnormal
RBC production in thalassemic patients, it hypertrophies and splenomegaly becomes a
main feature of thalassemic patients. The increase in plasma volume as a result of
shunting through expanded marrow and progressive splenomegaly exacerbate the
anemia and worsen the condition (Hess et al., 1976 and Ginzburg and Rivella, 2012).
Numerous abnormalities in the membrane of thalassemic erythrocytes have been
described. Studies of the consequences of excess -globin chains accumulation, and
their degradation products within the red-cell membrane and its skeleton have
demonstrated abnormalities in main red cell membrane cytoskeleton proteins to include
spectrin, band 3 and band 4.1 (Grinberg and Rachmilewitz 1995 and Olivieri,
1999).These abnormalities were found to affect not only the survival of the RBC but
also the platelets function through the RBC-platelets interaction (Valles et al., 2002).
2.3.4 Molecular genetics of -thalassemia
The new recombinant DNA technology has facilitated the study of the -globin
genes from many patients with -thalassemias. Up-to-date, more than 400 different
mutations have been reported and identified in the globin gene which are responsible
for the development of the -thalassemia �3DWULQRV�HW�DO���������3DQ���������
2.3.4.1 Types of mutations of -thalassemia
The -thalassemia syndromes arise from mutations that affect every step in the
pathway of -globin gene expression: transcription, mRNA processing, mRNA
translation, and post translational integrity of the polypeptide chains (Schwartz and
%HQ]��������2OLYLHUL������ and Higgs et al., 2012). Most types of -thalassemias are
due to point mutations, and large deletion mutations are found in rare cases
(Sanguansermsri et al., 1990., Galanello and Origa, 2010 and Danjou et al., 2011).
-
14
2.3.4.2 Spectrum of mutations of -thalassemia
-thalassemias are heterogeneous group with respect to the molecular
pathogenesis, and different populations and ethnic groups differ with respect to the
predominately mutations. The variable spectrum of the -thalassemia mutations has
resulted in extensive studies in different populations and ethnic groups to identify the
major mutations (Weatherall., 2000). Table 2.2 illustrates the spectrum of - mutations
in the Middle East region. In the Gaza Strip some of these mutations have been
identified by others (Filon et al., 1995), however further detailed studies to identify the
entire spectrum of -thalassemia mutations in the Gaza Strip are required.
Table 2.2. The spectrum of -thalassemia mutations in the Middle East region
($IWHU� +XVVHLQ� HW� DO��� ������ )LORQ� HW� DO�� ������ (O-Khateeb et al., 1997 and
Weatherall, 2000).
Frequency (%)
Mutation Type Gaza Strip Jordan Egypt Lebanon Turkey
IVS.1, nt 110 GA + 37.5 27.5 41 62 42
IVS.1, nt 1 GA 0 20 17 13 - 5
Codon 39 GT 0 11.5 10.1 1 4 4
Framshift 5 -CT 0 10 8.4 3 - 4
IVS.1, nt 6 T C + 7.5 6.2 13 8 10
Framshift 6 -A 0 5 - - - 1
AATAAA A + 2.5 - - - -
Codon 37 G A 0 1 7.3 1 - -
IVS.2, nt 1 GA 0 1 5.6 3 4 4
Codon 27 G T + 1 - 1 - -
Framshift 8 -AA 0 - - 3 6 5
IVS.2, nt 745 C G + - - 3 4 2
IVS.1, nt 5 G C + - - - 4 1
Codon 29 C T 0 - - - 8 -
Framshift 106/107 0 - - 3 - -
Framshift 8-9 0 - - - - 3
-30 T A + - - - - 4
-87 C G + - - - - 1
Unknown 0 2.5 18 3 - 14
-
15
2.3.5 Complications of -thalassemia
Transfused thalassemic patients may develop complications related to iron
overload. Complications of iron overload in children include growth retardation and
failure or delay of sexual maturation. Later iron overload-related complications include
involvement of the heart (dilated myocardiopathy or rarely arrythmias), liver (fibrosis
and cirrhosis), and endocrine glands (diabetes mellitus, hypogonadism and insufficiency
of the parathyroid, thyroid, pituitary, and, less commonly, adrenal glands (Higgs et al.,
2012 and Peters et al., 2012). Other complications are hypersplenism, chronic hepatitis
(resulting from infection with viruses that cause hepatitis B and/or C), HIV infection,
venous thrombosis, and osteoporosis (Muncie and Campbell, 2009). The risk for
hepatocellular carcinoma is increased in patients with liver, viral infection and iron
overload. Individuals who have not been regularly transfused usually die before the
second-third decade, survival of individuals who have been regularly transfused and
treated with appropriate chelation extends beyond age of 40 years. Cardiac disease
caused by myocardial siderosis is the most important life-limiting complication of iron
overload in â-thalassemia. In fact, cardiac complications are the cause of the deaths in
71% of the patients with â-thalassemia major (Galanello and Origa, 2010).
2.3.5.1 Iron metabolism and iron overload in â-thalassemic patients
Iron is essential to most life forms and to normal human physiology. The
recommended dietary allowance for iron for children is 8 mg/day, for adult males is 11
mg/day and for adult females is 18 mg/day (Institute of Medicine: Food and
Nutrition Board, 2001). Most well-nourished people in industrialized countries have 4
to 5 grams of iron in their bodies. Of this, about 2.5 g is contained in hemoglobin and
most of the rest is stored as ferritin (Camaschella and Schrier, 2011). The majority of
the iron absorbed from digested food or supplements is absorbed in the
duodenum by enterocytes of the duodenal lining (Fleming and Bacon, 2005). Once it
absorbed from the duodenum, iron is immediately combined in the blood plasma with a
beta globulin, apotransferrrin, to form transferrin, which is then transported in the
plasma (Duffy, 1996). The iron is loosely bound in the transferrin and, consequently,
can be released to any tissue cell at any point in the body. Excess iron in the blood is
stored as ferritin which is the major iron storage protein compound present primarily in
-
16
the liver, reticuloendothelial cells and erythroid precursors of the bone marrow (Pipard,
1996; Guyton and Hall, 2006 and Camaschella and Schrier, 2011).
Human has alimited capacity to excrete excess iron from the body.The absence
of a physiological pathway for the excretion of excess iron means that patients with an
increased iron intake are at risk of dangerous and progressive accumulation of body iron
reserves, which leads to abnormally large amount of iron in tissues and consequently
lethal tissue damage (Bacon and Britton, 1990 and Pipard, 1996). Iron is deposited in
the parenchymal cells of the liver, the heart, and a subgroup of endocrine tissues
�1DWKDQ�DQG�2VDNL��������$QGUHZV�������DQG������. Iron overload results from the
increased catabolism of erythrocytes like in patients who receive frequent blood
transfusion e.g. thalassemia major, sickle cell (Weatherall, 1997). Quantitavely, one
unit of packed RBCs that used in the transfusion regimen contains approximately 200
mg of iron (Weatherall, 1996). Thus, with regular blood transfusion a 6 years old
thalassemic patient (who have receiving 60-75 units of packed RBCs) is expected to
accumulate 12-15 grams of excess iron, compared to 3-4 grams found in normal non-
transfused adults. Iron accumulates in the reticuloendothelial macrophages first, and
only later deposits in parenchymal cells (Brittenham et al., 1994, Kushner et al.,
2001). This leads to tissue damage and fibrosis, and finally organ damage (Andrews,
1999 and 2000 and Waldmeier et al., 2010).
2.3.6 Diagnosis of -thalassemia 2.3.6.1 Clinical diagnosis
It is usually suspected in an infant younger than two years of age with severe
microcytic anemia, mild jaundice and hepatosplenomegaly (Higgs et al., 2012).
2.3.6.2 Hematologic diagnosis Is characterized by reduced Hb level ( 50 12
-
17
2.3.6.3 Qualitative and quantitative Hb analysis
By cellulose acetate electrophoresis and DE-52 microchromatography or HPLC
identifies the amount and type of Hb present. The Hb pattern in â-thalassemia varies
according to â-thalassemia type. In beta0 thalassemia, homozygotes HbA is absent and
HbF constitutes the 92-95% of the total Hb. In beta+ thalassemia homozygotes and
beta+/beta0 genetic compounds HbA levels are between 10 and 30% and HbF between 70-
90%. HbA2 is variable in beta thalassemia homozygotes and it is enhanced in beta
thalassemia minor. Hb electrophoresis and HPLC also detect other hemoglobinopathies (S,
C, E, OArab, Lepore) that may interact with â-thalassemia (Clarke and Higgins, 2000 and
Cao and Galanello, 2010).
2.3.6.4 Molecular genetic analysis
The prevalence of a limited number of mutations in each population has greatly
facilitated molecular genetic testing. Commonly occurring mutations of the beta globin
gene are detected by PCR-based procedures. The most commonly used methods are
reverse dot blot analysis or primer-specific amplification, with a set of probes or
primers complementary to the most common mutations in the population from which
the affected individual originated. If targeted mutation analysis fails to detect the
mutation, beta globin gene sequence analysis can be used to detect mutations in the beta
globin gene (Old et al., 2005 and Galanello and Origa, 2010).
2.3.7 Management of -thalassemia
2.3.7.1 Prevention strategies
Prevention of -thalassemia is based on public awareness of the disease,
detection of carriers, genetic counselling, and prenatal testing (Peters et al., 2012).
2.3.7.2 Blood transfusion
Persons with -thalassemia major require periodic and life long blood
transfusions every 2-3 weeks to maintain a hemoglobin level higher than 9.5 gm/dl and
sustain normal growth. The need for blood transfusions may begin as early as six
months of age.
-
18
2.3.7.3 Chelation therapy
Experts recommend that iron overload be treated when serum ferritin levels
exceed 1000 ìg/L, which will occur after 10 to 20 red cell transfusions (Peters et al.,
2012). Chelation therapy is usually started between five and eight years of age.
Deferoxamine (Desferal), subcutaneously or intravenously, has been the treatment of
choice. Recommended dosage depends on the individuals age and the serum ferritin
concentration (Porter, 2001 and Borgna-Pignatti et al., 2004). Although this therapy
is relatively nontoxic, it is cumbersome and expensive. The U.S. Food and Drug
Administration recently approved oral deferasirox (Exjade) as an alternative treatment.
Adverse effects of deferasirox were transient and gastrointestinal in nature, and no cases
of agranulocytosis were reported.
2.3.7.4 Bone marrow transplant
Bone marrow transplantation in childhood is the only curative therapy for -
thalassemia major. Hematopoietic stem cell transplantation generally results in an excellent
outcome in low-risk persons, defined as those with no hepatomegaly, no portal fibrosis on
liver biopsy, and regular chelation therapy, or at most, two of these abnormalities (Rund
DQG�5DFKPLOHZLW]������� Muncie and Campbell, 2009 and Cao and Galanello, 2010).
2.3.7.5 Splenectomy
Can be considered if hypersplenism causes a marked increase in transfusion
requirements. In general, it should be delayed for as long as possible, in order to prevent
ife threatening infections, pulmonary hypertension and thrombo-embolic complications
(Peters et al., 2012). At present, therapies under investigation are the induction of fetal
hemoglobin, antioxidants and stem cell gene therapy (Arumugam and Malik, 2010).
2.4 Related studies
El-Hazmi et al. (1994) determined the level of testosterone, cortisol, luteinizing hormone
(LH), follicle stimulating hormone (FSH), free thyroxine (T4), tri-iodothyronine (T3),
growth hormone (GH), iron, ferritin, and hematological parameters in 44 -thalassemia
patients (21=-thal. major, 23 -thal minor), 25 Hb S/ zero-thalassemia patients, and 50
normal controls with age range 2-15 years. In comparison with controls the -thalassemia-
-
19
major and the Hb S/ zero-thalassemia patients had a significantly higher level of plasma
ferritin (PA) (25%), IVS2-1 (G>A) (15%), IVS2-745 (C>G)
(14.2%), IVS1-1 (G>A) (10%), IVS1-6 (T>C) (8.3%), codon 37 (G>A) (6.3%), codon 39
(C>T) (4.6%), and codon 5 (-C) (3.8%). The remaining eleven mutations were rare and
including two novel mutations and four others detected in Jordan for the first time. The
novel mutations were the frame shift (-C) at codon 49 and the substitution (A>C) at
position -��� LQ� WKH� 7$7$� ER[�� )RXU� DOOHOHV� ������� UHPDLQHG� XQLGHQWLILHG�� KDYLQJ� QR�
abnormalities in their beta-globin gene sequences and therefore, constituted additional
defects causing -thalassemia in the Jordanian population.
Laksmitawati et al. (2003) demonstrated significant increase in serum iron ferritin,
AST, ALT, and bilirubin. Results can be summarized that non-transfused thalassemia
intermedia patients exert slight signs of oxidative stress, and increased hemoglobin
degradation but no significant indication of tissue or cell damage. This picture differs
considerably from transfusion-dependent thalassemia major patients: highly significant
decrease in antioxidants and thiols and tremendous iron overload and cell damage. The
picture is even worsened in long-term transfused patients. Iron chelation after
transfusion is not sufficient in Indonesia, because it is normally (with few exceptions)
applied only once together with transfusion. Hence, one major reason of the bad
condition of transfusion-dependent thalassemia patients in Indonesia appears to be
frequent transfusions (on the average one per month) and insufficient chelation of one
treatment per month together with transfusion.
-
20
Napoli et al. (2006) found increased serum ferritin, AST and ALT as well as low bone
density in 90 thalassemic major Italian patients. They concluded that calcium
metabolism is frequently impaired in thalassemic patients. In addition, Al-Samarrai et
al. (2008) studied 105 thalassemic major blood transfusion dependent children. He
found that the mean serum calcium level was lower in thalassemic patients than
controls. In contrast serum phosphorus level was higher in thalassemic patients.
Glycometabolic function, lipid profile and liver function in patients with â
thalassemia major and their relationship with serum iron and ferritin was evaluated
(Shams et al., 2010). Fasting serum glucose, triglyceride, AST, ALT and insulin
resistance index were significantly higher in the homozygous thalassemic major patients
than in the controls. Serum cholesterol was significantly lower in patients. In addition,
Hamed and ElMelegy. (2010) reported significant decrease in serum calcium and
significant increase in uric acid in 69 thalassemic major patients compared to controls.
Waseem et al. (2011) designed a study to obtain a comprehensive picture of the iron
overload, antioxidant status and cell damage in 48 â-thalassemia major patients
undergoing regular blood transfusion. The levels of vitamin E, antioxidant enzymes
GPX and SOD were significantly lowered in â-thalassemic patients as compared with
the control group. Serum total and direct bilirubin, AST and ALT were significantly
elevated in thalassemic subjects as compared with the control group, indicating liver
cell damage. In the same context, Attia et al. (2011) studied the effects of antioxidant
vitamins on antioxidant status and liver function in homozygous â-thalassemic patients.
The results of enzymes showed that thalassemic major children suffer from high levels
of ALT, AST, glutathione peroxidase, and superoxide dismutase enzymes activities
before vitamins treatment. The activities of ALT, AST, GPx, and SOD decreased
significantly, also the activities of catalase and glutathione reductase significantly
increased in â-thalassemic patients after treatment compared with their activities before
treatment.
-
21
Arýca et al. (2012) examined the blood lipid profile in 85 children with beta-
thalassemia major on regular chelation therapy, and determined the factors that affect it.
Blood of 55 healthy children were taken for use as the control group. Hemoglobin and
hematocrit values of the group with -thalassemia major were significantly lower than
the control group. Ferritin values in the group with -thalassemia major were found to
be significantly higher than in the control group. Cholesterol, HDL-cholesterol, LDL-
cholesterol levels were found to be significantly lower in patients with -thalassemia
major than in the control group, while the triglyceride level was found to be higher.
-
22
Chapter 3
Materials and Methods
3.1 Study design This work was performed according to the cross-sectional descriptive study design.
3.2 Target population 3.2.1 Inclusion criteria
All â-thalassemic unrelated children aged 5-12 years old at public hospitals in
Gaza city who are currently being transfused and managed for the clinical symptoms
and manifestations of the disease were considered as a target for the present study. Only
one child was included for each couple.
3.2.2 Exclusion criteria
All other â-thalassemic related children were excluded from the study. Children
less than 5 or older than 12 years were also excluded. Any unconfirmed blood
transfusion dependent children were also excluded.
3.3 Sample size Sample size was 53 transfusion dependent â-thalassemic children (27 boys and
26 girls) and 53 apparently healthy children (27 males and 26 females) served as a
control group. The cases and controls were age and sex matched.
3.4 Ethical consideration An official approval was obtained from Helsinki committee at the Palestinian
ministry of health (Annex 1). Another official letter of request was obtained from the
Palestinian Thalassemia Center who approved performing the study on the thalassemic
children (Annex 2). The researcher has explained the purpose and objectives of the
study to the parent (s) or guardian (s) of all the participants. The inclusion in the study
was optional and confidential. After the free acceptance to be enrolled in the study, one
of parent (the father or the mother) was asked to sign the consent form of the study.
-
23
3.5 Data collection The data of the study was collected via questionnaire and also from laboratory
investigation of blood sampled for the type of causative mutation, biochemical and
hematological parameters of the of -thalassemic children.
3.5.1 Questionnaire
Part of data was collected by using close-ended questionnaire which was
constructed and conducted in Arabic language. The questionnaire was designed to
include 3 major components with 18 items
1- Socio-demographic and general characteristics of the subjects
2- Health characteristics of the subjects.
3- Health complains of the subjects.
The questionnaire was distributed to the parent who accompanying the
thalassemic child on the day of blood transfusion at the public hospitals. The researcher
explained the purpose and objectives of the study and declared and committed to the
participant about the confidentiality of the study. After the free acceptance, one parent
was asked to fill the questionnaire.
3.5.2 Venous blood withdrawal
Five ml of venous blood were collected from each subject (cases and controls) involved
in the present study samples, and the collected blood was divided almost equally (2.5
ml) into 12x56mm K3-EDTA polypropylene tubes (Meus, Piove Di Sacco, Italy) and in
serum tubes (2.5 ml). Blood withdrawals of the patients were performed just before the
scheduled blood transfusion of the â-thalassemic children. The blood in the K3-EDITA
tubes was used to perform a Complete blood counts (CBC) [white blood cell (WBC),
red blood cell (RBC), haemoglobin (Hb), haematocrit (Hct), mean corpuscular volume
(MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin
concentration (MCHC), red cell distribution width (RDW), and platelets (PLT)] using a
Cell Dyne 1700 electronic counter (Sequoia-Turner corporation, California, USA).
About 400 of The K3-EDTA blood was used for spotting, DNA extraction and
purification in order to carry out molecular diagnosis to identify the causative mutation
using PCR based techniques. Also the K3-EDTA blood was used for quantifying the
level of HbF in all thalassemic children of the study. Blood film was performed in
-
24
triplicates from fresh blood of the thalassemic children. While, the blood in the serum
tube was centrifuged to separate the serum which preserved in new plastic screw tip
tubes and used to determine the following biochemical parameters according to the
available commercial kits:
Liver function enzymes:
Aspartate aminotransferase (AST) and alanine aminotransferase (ALT), serum bilirubin.
Kidney function tests:
Urea, creatinine, uric acid.
Blood chemistry
Total protein, albumin, globulins, serum ferritin, serum calcium, serum phosphorus.
3.5.3 Spotting and Transfer of Dried Blood Samples (DBS)
Almost 400 l of whole venous blood collected in K3-EDTA tubes were
spotted equally into 4 circles of Ahlstrom 226 grade (Figure 3.1) newborn screening
filter paper (ID Biological Systems, Greenville, SC, USA). After an overnight drying at
room temperature, the filter papers with the spotted blood were placed between sheets
of glassine weighing paper (Schleicher and Schuell, Germany ) so that the DBS cards
are not touching each other, and packaged with few desiccant packages to absorb any
humidly. Then the DBS were sent to Bernhard Nocht Institute (BNI), Germany, where
DNA extraction, purification and mutation analysis were performed.
-
��
Figure 3.1. Newborn screening filter paper (ID Biological Systems, Greenville, SC, USA).
DNA extraction and purification
DNA was extracted and purified from two dried blood spots (~200 L) using
BL and BLM lysis buffers (Agowa, GmbH, Berlin, Germany) by a magnetic bead-based
DNA extraction and purification technique (Rudi et al., 1997, Deggerdal and Larsen,
1997). The beads-based kit depends on superparamagnetic particles for isolating DNA
from whole blood.
3.5.4 HBB mutations screening
The screening for the possible mutations in HBB gene was performed at the
molecular medicine laboratories of the Bernhard Nocht Institute (BNI), Germany,
according to Dynamic Allele-Specific Hybridization (DASH) method aiming at
identification of the most common single nucleotide polymorphisms (SNP) in HBB
reported in the literature for the Arabic and/or Mediterranean populations: IVS-I-1 (G -
-
26
-> A), IVS-I-6 (T --> C), IVS-I-110 (G --> A), codon 37 (G --> A), and codon 39 (C -->
T) (5XQG�HW�DO���������)LORQ��HW�DO���������.\ULDFRX�HW�DO��������DQG Zahed, 2001).
Three PCR based hybridization assays based on DASH technique (+RZHOO�HW�DO���������
Jobs et al., 2003). Were established to type for these 5 mutations . Specific annealing
temperatures of the hybridization of probes for wild types and for each of the mutations
were identified (Table 3.1) This enabled the identification of homozygous,
heterozygous and compound heterozygous genotypes of the 5 mutations.
Table 3.1. Characteristics of hybridization assays used for genotyping
PCR Screened
mutation Amplicon Primers 5- 3
Probes 5- 3
Mutation position underlined
Annealing
temperature
Assay 1
IVS-I-1
IVS-I-6
wildtype
186 bp
Forw
TGAGGAGAAGTCTGCCGTTA
Rev
CCAATAGGCAGAGAGAGTCA
Anchor
Cy5-
ACAAGACAGGTTTAAGGAGACCAATAGAAACTGG-
Phosphate
Sensor for IVS-I-1 G>A and IVS-I-6 T>C
GCAGGTTGGCATCAAGGT-Fluorescein
58 oC
Assay 2
CD37
CD39
wildtype
208 bp
Forw
AAGGTTACAAGACAGGTTTAAG
Rev
TTAGGGTTGCCCATAACAGC
Anchor
Cy5-CTTTGAGTCCTTTGGGGATCTGTCCAC-
Phosphate
Sensor for CD37 G>A and CD39 C>T
CCCTTGAACCCAGAGGT-Fluorescein
55 oC
Assay 3 IVS-I-110
wildtype 208 bp
Forw
AAGGTTACAAGACAGGTTTAAG
Rev
TTAGGGTTGCCCATAACAGC
Anchor
Cy5-TCCCACCCTTAGGCTGCTGGT-Phosphate
Sensor for IVS-I-110 A>G
CTCTCTCTGCCTATTAGTCTATT-Fluorescein
58 oC
-
27
3.6 Biochemical analysis
3.6.1 Determination of serum urea
Principle
Serum urea was determined by using "Urease-GLDH": enzymatic UV test, according to
Thomas method (Thomas, 1998) using DiaSys reagent kits.
Urea + 2H2O→2NH4 + 2HCO
2-Oxoglutarate + NH4 + NADH→ L-Glutamate + NAD+ + H2O Reagents
Concentrations are those in the final test mixture.
Concentration Reagent
120 mmol/l
7 mmol/l
0.6 mmol/l
≥ 0.6 ku/l
≥ 1 ku/l
R1: TRIS
2- Oxoglutarate
ADP
Urease
GLDH
0.25 mmol/l R2: NADH
50 mg/dl Standard
Assay procedure
The working solution was prepared by mixing 4 parts of R1 with 1 part of R2.
Wavelength: 340 nm
Optical path: 1cm
Temperature: 37 ºC
Measurement: against distilled water.
Ten µl of standard (sample or control) was added to 1 ml of working reagent and
mixed well.
The mixture was incubated for 30 sec then absorbance (A1) was recorded.
After exactly further 60 sec the absorbance (A2) was measured.
Urease
GLDH
-
28
Calculation
∆A = (A1 A2) sample or standard
Urea (mg/dl) =
Reference value (Palestinian Clinical Laboratory Tests Guide, 2005)
Child 5 - 30 mg/dl
Adult 13 - 43 mg/dl
3.6.2 Determination of serum creatinine
Serum creatinine was determined by using kinetic test without deproteinization
according to Newman and Price method (Newman and Price, 1999) using DiaSys
reagent kits.
Principle
Creatinine forms a colored orange-red complex in an alkaline picrate solution. The
difference in absorbance at fixed times during conversion is proportional to the
concentration of creatinine in the sample.
Creatinine + Picric acid → creatinine picrate complex
Reagents
Concentrations are those in the final test mixture.
Concentration Reagent
0.16 mol/l R1: Sodium hydroxide (pH approx. 13)
4.0 mmol/l R2: Picric acid (pH approx. 1.2)
2.0 mg/dl Standard
Assay procedure
The working solution was prepared by mixing 4 parts of R1 with 1 part of R2.
Wavelength: 490 nm
Optical path: 1cm
Temperature: 37 ºC
Measurement: against distilled water.
∆A sample X concentration of standard∆A standard
-
29
Uricase
POD
Fifty µl of standard (sample or control) was added to 1 ml of working reagent add
and mixed well.
The Mixture was incubated for 60 sec then absorbance (A1) was recorded.
After exactly further 120 sec the absorbance (A2) was measured.
Calculation
∆A = (A1 A2) sample or standard
Creatinine (mg/dl) =
Reference value (in serum) (Palestinian Clinical Laboratory Tests Guide, 2005)
Child 0.3 - 0.7 mg/dl Adult: Male
Female 0.6 - 1.2 mg/dl 0.5 -1.1 mg/dl
3.6.3 Determination of serum uric acid
Serum uric acid was determined by enzymatic photometric test with TBHBA (2,4,6-
tribromo-3-hydroxybenzoic acid) (Fossati et al., 1980) using DiaSys reagent kits.
Principle
Uric acid is oxidized to allantoin by uricase. The generated hydrogen peroxide reacts
with 4-aminoantipyrine and 2,4,6-tribromo-3-hydroxybenzoic acid (TBHBA) to
quinonemine.
Uric acid + H2O + O2 Allantoin + CO2 + H2O2
TBHBA + 4-aminoantipyrine + 2H2O2 Quinoneimine + 3 H2O
Reagents
Reagent Components Concentrations
Reagent 1 Phosphate buffer pH 7.0
TBHBA
100 mmol/l
1 mmol/l
Reagent 2
Phosphate buffer pH 7.0
4-Aminoantipyrine
K4[Fe(CN)6]
Peroxidase (POD)
Uricase
100 mmol/l
0.3 mmol/l
10 ìmol/l
≥ 2 kU/L
≥ 30 U/L
Reagent 3 Standard 6.0 mg/dl
∆A sample X concentration of standard∆A standard
-
30
Substrate start
The reagents are ready to use.
Sample start
Four parts of R1 with 1 part of R2 was mixed (e.g. 20 ml R1 + 5 ml R2) = mono
reagent. This reagent is stable for 3 months if stored at +2 to +8 0C and for 2 weeks if
stored at +15 to +25 0C. Protect the mono reagent from light.
Assay Procedure
Substrate start
Reagent Blank Sample or Standard
Sample or Standard - 20ì
Dist. Water 20ì -
Reagent 1 1000ì 1000ì
Mix, incubate 5 min., then add:
Reagent 2 250ì 250ì
Mix, incubate 30min. at 20-25 oC or 10 min. at 37 oC. The absorbance was read
against the reagent blank within 60 minat wavelength 520 nm.
Sample start
Reagent Blank Sample or Standard
Sample or Standard - 20ì
Dist. Water 20ì -
Monoreagent 1000ì 1000ì
Mix, incubate 30min. at 20 25 oC or 10 min. at 37 oC. the absorbance was read against the reagent blank within 60 min at wavelength 520 nm.
Calculation:
With standard or calibrator
Uric acid [mg/dl] = ∆A Sample
x Conc. of Std/Cal [mg/dl] ∆A Std/Cal
Reference value (In serum) (Palestinian Clinical Laboratory Tests Guide, 2005)
Child 2 5.5 mg/dl.
Adult M 3.5 7.2 mg/dl.
F 2.5 7 mg/dl.
-
31
3.6.4 Determination of Serum Aspartate Aminotransferase (AST) Enzyme
Activity
Serum aspartate aminotransferase activity was measured by using optimized UV
test according to international federation of clinical chemistry and laboratory medicine
(Thomas, 1998), using Diasys reagent Kits.
Principle
The principle of the method is based on the following enzymatic reactions:
L-Aspartate + 2-Oxoglutarate AST L-Glutammate + Oxalacetate
Oxalacetate + NADH + H+ MDH L-Malate + NAD+
Decrease in absorbance value at 340 nm, due to the oxidation of NADH to NAD+, is
directly proportional to the AST activity in the sample.
Composition of reagents.
Reagent Concentration
Reagent A:
TRIS
EDTA-Na2
L-Aspartate
MDH
Sodium azide
Reagent B:
2-Oxoglutarato
NADH
Sodium azide
28 mmol/l
5.68 mmol/l
284 mmol/l
≥ 800 U/l
2 g /l
68 mmol/l
1.12 mmol/l
0.095 g/l
preparation of reagents
Bireagent procedure. The reagents are liquids ready to use.
Monoreagent procedure. Ten parts of Reagent A and one part of Reagent B to obtain
the working reagent (ex. 20 ml of RA + 2 ml of RB).
Analytical procedure
About 0.5 ml of serum was transferred to the Mindray BS-300 chemistry auto analyzer
to perform the test according to these parameters:
-
32
Parameter Value
Reagent (ìI) 200
Serum (ìI) 20
Incubation period (s) 15 cycle(3.5minutes)
Reaction type Kinetic
Wavelength (nm) 340
Reaction Descending
Reference value
Male 0-37 U/l
Female 0-31 U/l
3.6.5 Determination of Serum Alanine Aminotransferase (ALT) Enzyme
Activity
Serum alanine aminotransferase activity was measured by using optimized UV test
according to International Federation of Clinical Chemistry and Laboratory Medicine
(IFCC) [modified] using Diasys reagent Kits.
Principle
L-Alanine + 2-Oxoglutarate ALAT L-Glutamate + Pyruvate
Pyruvate + NADH + H+ LDH D-Lactate + NAD+
Addition of pyridoxal-5-phosphate (P-5-P) stabilizes the activity of transaminases and
avoids falsely low values in samples containing insufficient endogenous P-5-P, e.g.
from patients with myocardial infarction, liver disease and intensive care patients.
-
33
Reagents
Components and Concentrations
R1: TRIS pH 7.15 140 mmol/L
L-Alanine 700 mmol/L
LDH (lactate dehydrogenase) ³ 2300 U/L
R2: 2-Oxoglutarate 85 mmol/L
NADH 1 mmol/L
Pyridoxal-5-Phosphate FS
Goods buffer pH 9.6 100 mmol/L
Pyridoxal-5-phosphate 13 mmol/L
Reagent Preparation
Sample Start
without pyridoxal-5-phosphate
Mix 4 parts of R1 + 1 part of R2
(e.g. 20 mL R1 + 5 mL R2) = mono-reagent
Stability: 4 weeks at 2 - 8° C
5 days at 15 - 25° C
The mono-reagent must be protected from light!
Assay Procedure
Wavelength 340 nm, Hg 365 nm, Hg 334 nm
Optical path 1 cm
Temperature 37 °C
Measurement Against air
Sample Start Do not use sample start with pyridoxal-5-phosphate! Sample or calibrator 100 µl Mono-reagent 1000 µl Mix, read absorbance after 1 min. and start stopwatch. Read absorbance again 1, 2 and 3 min thereafter.
-
34
Calculation
With factor
From absorbance readings calculate DA/min and multiply
by the corresponding factor from table below:
DA/min x factor = ALAT activity [U/L]
Substrate Start Sample Start
340 nm 2143 1745
334 nm 2184 1780
365 nm 3971 3235
With calibrator
ALAT [U/L] = (Ä A/min Sample ) X Conc. Calibrator [U/L]
(Ä A/min Calibrator )
Reference Range
Women < 31 U/L Men < 41 U/L
Children < 25 U/L
3.6.6 Determination of bilirubin
Determination of direct and total bilirubin with the Jendrassik-Gróf method on
photometric systems using Diasys reagent Kits.
Principle
Bilirubin reacts with diazotized sulfanilic acid to form an azo dye which is red in
neutral and blue in alkaline solutions. Where as the water-soluble bilirubin glucuronides
react directly, the free indirect bilirubin reacts only in the presence of an
accelerator. The total bilirubin in serum or plasma is determined using the method of
Jendrassik and Grof by coupling with diazotized sulfanilic acid after the addition of
caffeine, sodium benzoate and sodium acetate. A blue azobilirubin is formed in alkaline
Fehlings solution II. This blue compound can also be determined selectively in the
presence of yellow by-products (green mixed coloration) by photometry at 578 nm.
-
35
Direct bilirubin is measured as the red azo dye at 546 nm using the method of Schellong
and Wende without the addition of alkali. Indirect bilirubin is calculated from the
difference between the total and direct bilirubin.
Reagents
Concentrations of the Reagents
R1: Sulfanilic acid 29 mmol/L
HCl 170 mmol/L
R2: Sodium nitrite 29 mmol/L
R3: Caffeine 130 mmol/L
Sodium benzoate 156 mmol/L
Sodium acetate 460 mmol/L
R4: Fehlings solution II:
Potassium sodium tartrate 930 mmol/L
Sodium hydroxide 1.9 mol/L
Assay Procedure
Optical path 1 cm
Temperature 15 25 °C
Measurement Against sample blank
Determination of total bilirubin
(Refer to note 1)
Wavelength: Hg 578 nm
Sample Sample
Blank
-
Reagent 2 - 50 µl
Reagent 1 200 µl 200 µl
Reagent 3 1000 µl 1000 µl
Sample 200 µl 200 µl
Mix and allow to stand for 10 to 60 min. at 15 to 25 °C,
then add:
-
36
Reagent 4 1000 µl 1000 µl
Mix well and after 5 to 30 min. measure the absorbance
of the sample against the sample blank.
Calculation
Concentration total bilirubin: [mg/dL] = A x 10.5
Determination of direct bilirubin Wavelength: Hg 546 nm
Sample Sample
blank
Reagent 2 - 50 µl
Reagent 1 200 µl 200 µl
NaCl solution 2000 µl 2000 µl
Sample 200 µl 200 µl
Mix immediately and allow standing at 15 to 25 °C.
Exactly 5 min. after the addition of serum measure the
absorbance against the sample blank.
Calculation
Concentration of direct bilirubin: [mg/dL] = A x 14.0
Reference Range
Bilirubin total
Adults 0.1 1.2 mg /dL
Children >1 month 0.2 1.0 mg /dL
Direct Bilirubin 0.2 mg /dL
3.6.7 Determination of total protein Serum total protein was determined by photometric test according toThomas method
(Thomas, 1998) using DiaSys reagent kits.
-
37
Principle Protein together with copper ions form aviolet blue color complex in alkaline solution.
The absorbance of color is directly proportional to concentration.
Reagents
Components Concentrations
Reagent 1: Sodium hydroxide Potassium sodiumtartrate
80 mmol/L 12.8mmol/L
Reagent 2: Sodium hydroxide Potassiumsodium
tartrate Potassiumiodide
Copper sulfate
100 mmol/L 16mmol/L 15mmol/L 6mmol/L
Standard 5g/dl
Mono reagent preparation
Four parts of R1were mixed with1 part of R2 (e.g. 20ml R1+5mlR2) = one reagent.
Procedure
Blank Sample Monoreagent 1000 ìl 1000 ìl
Sample - 20 ìl
Dist.water 20 ìl -
Mix, incubate for 5 min at 25°C and read absorbance against ther eagent blank within
60 min at 540 nm.
Calculation The protein concentration in the sample is calculated using the following general
formula:
-
38
Total protein[g/dL]= (Ä Asample) XConc.St[g/dl]
(ÄAstandard )
Reference Range
5.6 8 g/dl
3.6.8 Determination of albumin
Serum albumin was determined by photometric test according to the method
described by Johnson and his colleagues (Johnson et al., 1999) using DiaSys reagent
kits.
Principle
Serum albumin in the presence of bromecresol green at a slightly acid pH produces a
color change of the indicator iron yellow-green to green blue.
Reagents
Components Concentrations
Reagent
Citrate buffer pH 4.2
Bromocresol green
30mmol/L
0.26mmol/L
Standard 5g/dl
Assay procedure
Blank Sample
Reagent 1000 ìl 1000 ìl
Sample - 10 ìl
Dist.water 10 ìl -
Mix, incubate for approx. 10min. The absorbance was read against reagent blank
within 60 min at 540600 nm.
Calculation Serum albumin concentration in the sample is calculated using the following general
formula:
-
39
Albumin[g/dL] = (ÄAsample) XConc.Std[g/dl]
(Ä AStandard )
Reference Range
4 days 14 years 3.8 5.4 g/dl
3.6.9 Determination of globulin
Globulin was calculated according the following formula: Globulin= Total
protein Albumin.
3.6.10 Determination of serum Calcium (Tca)
Tca is determined by ion Selective Electrode (ISE) method (Eisenmann, 1967)
On Nova 10 Electrolytes analyzer, USA.
Principle
An ISE is composed of an electrochemical half cell and ion specific glass
membrane for every ion used. When an ion specific membrane separates two solutions
that differ in the concentration of that ion, a potential is developed across the membrane
and the size of potential depends on the difference in the ion concentration . The activity
of any ion can be determined potentiometrically if an electrode can be developed this
respond selectively to the ion interest Na ion and insensitive to other k sensitive glass is
sensitive for k ion and Tca sensitive glass is sensitive for Tca ions (Kaplan, 1995).
Reagent
Reagent component concentration
Cal A
Na 140 mmol/L
K 4.0mmol/L
Cl 114mmol/L
TCa 2.0mmolL
Li 0.5mmol/l
Cal B
Na 60 mmol/L
K 10.0mmol/L
Cl 46mmol/L
TCa 4.0mmolL
Li 5.0mmol/l
Reference Ca ++ Releasing Agent
-
40
Procedure
1. To be able to perform the tests, the instrument calibrates itself automatically by 1, and 2
point calibrations using Cal A , and Cal B every 2 hours.
2. Pull the sampler up to the stat position .
3. Press the sample type key , select the appropriate type , press then number and then
press exit
4. Press Analyze .
5. Wait until the probe is fully extended and hold the sample cup to the probe.
6. Press analyze again . Be sure to keep the probe immersed in the sample white it is
aspirating.
7. Wait until the printed result appears after about 45 second.
Reference Range
3 12 years 8.8 10.8 mg/dl
3.6.11 Determination of phosphorus
Serum phosphorus was determined by phosphomolybdate UV end point (Tiez, 1994)
using Amonium Molybdate Diagnostic kit.
Principle:
Determination of inorganic phosphate was made according to the following reaction:
Amonium molybdate + Sulfuric acid Phosphomolybdic complex
Reagents:
Reagent Components Concentrations
Reagent Sulfuric acid
Amonium molybdate
210 mmol/L
650 umol/L
Standard Phosphorus 5 mg/dl
Preparation and stability of working reagent:
The reagent is ready for use.
Phosphorus
-
41
Procedure:
Wavelength 340 nm
Temperature 37°C
Cuvette 1 cm light path
Reading against reagent blank was done
Reference Range
4-15 years 2.9 5.4 mg/dl
3.7 Hematological analysis
3.7.1 Complete blood count (CBC)
A complete system of reagents of control and calibrator, Cell-Dyn 1700 was
used to determine complete blood count (CBC) of children in Central blood laboratory-
Thalassemia Center in Gaza (Abbott laboratories, USA).
3.7.2 Determination of serum ferritin
In the present study serum ferritin was determined using a Microparticle
Enzyme Immunoassay (MEIA) technology. For this purpose we used Abbott full
automated Axsym immunoassay analyzer ferritin assay system (Abbott laboratories,
USA). was used.
3.7.3 Fetal haemoglobin (HbF) quantitation
HbF is usually quantitated based on its resistance to denaturation at alkaline pH
(Singer et al., 1951). In 1959 Betke et al., modified the original method of Singer et al.
(1951) so that it can accurately measures HbF when present in relatively small amounts
(Betke et al., 1959). However, Pembrey et al. (1972) slightly modified the Betke et
al.(1959) method so that it gives highly reproducible results over the range of HbF 0.5-
50% (Pembrey et al., ������:HDWKHUDOO�and Clegg, 1981). In the present study we
followed the modified Betke et al.,(1959) method.
-
42
Principle of the method:
Most human haemoglobins denature when exposed to a strong alkaline solution.
Denaturation is stopped by the addition of ammonium sulphate, which precipitates the
denatured haemoglobins. However, foetal haemoglobin is not denatured and remains
soluble, which can be filtered and measured spectrophotometery.
Rea