Molecular, biochemical and hematological

investigations of -thalassemic children in Gaza

governorate

Prepared by

Rami M. Al Haddad

Co-supervisor

Dr. Mahmoud Sirdah

Associate Professor of Medicine

Blood Pathophysiology

Al-Azhar University of Gaza

Supervisor

Prof. Dr . Maged Yassin

Professor of Physiology

Faculty of Medicine

The Islamic University of Gaza

A thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in Biological Sciences Medical

Technology

2012�ϡ�1433�˰ϫ

ΔϳϣϼγϹ�Δ˰όϣΎΟϟ-�Γί˰Ϗ

˰ϳϠόϟ�ΕΎ˰γέΩϟ�ΓΩΎ˰ϣϋΎ

ϡϭ˰Ϡόϟ�Δ˰ϳϠϛ

Δ˰ϳΗΎϳΣϟ�ϡϭ˰Ϡόϟ�έϳΗγΟΎϣ

ΔϳΑρ�ϝϳϟΎΣΗ

The Islamic University-Gaza

Deanery of Post Graduate Studies

Faculty of Science

Master of Biological Sciences

Medical Technology

id2016640 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com

II

Dedication

To my Great Parents who have always

supporting me

To my Brothers and Sisters

Special Dedication to my Wife Heba

who helped me to accomplish this thesis

To my beloved sons Muneer, Nada, and

Jana

And to all Thalassemics in Gaza Strip

To all of them Idedicate this work

III

Declaration

I hereby declare that this submission is my own work and that, to the best of my

knowledge and belief, it contains material neither previously published or written

by another person nor material which to a substantial extent has been accepted for

the award of any other degree of the university of other institute, except where due

a acknowledgment has been made in the text.

Signature Name Date

Rami Rami M.Al Haddad 25-12-2012

Copy Right

All rights reserved: No part of this work can be copied, translated or

stored in any retrieval system, without prior permission of the author.

IV

Acknowledgment

I would like to express my deepest gratitude and appreciation to my supervisor Prof. Dr Maged M. Yassin, Professor of Physiology, Faculty of Medicine, The Islamic University of Gaza for his continuous support, encouragement and kind of supervision that leads to the emergence of this work in its current form.

I would like also to express my deepest thanks to my co-supervisor Dr.

Mahmoud M.S. Sirdah, Associate Professor of Blood Pathophysiology Al-Azhar University of Gaza for his continuous support, encouragement , guidance and help throughout this work. Thank you for being a great inspiration to me , iam greatfull for all that you have done for me.

My special deep and sincere gratitude are to my great parents, brothers and

sisters how have always supporting me . My deep and sincere appreciation to my wife Heba who was always behind

me to help and give all possible support. My warmest thanks for all the members of Thalassemia and Heamophilia

Center team specially for Dr. Issa Tarazi Vice Manager of Thalassaemia and Haemophilia Center - Palestine Avenir Foundation for his encouragement and continuous support . Thank you for helping me grow in my career. My colleagues at work Mr. Ahmed El-ghefary, Ms. Sawsan El-sory, Ms. Reem El -Kord, Ms. Neamat El -Franjee and Miss. Rana El-Dramli.

Also I would like to thank Dr. Hisham E. El Jeadi Hematologist in European- Gaza Hospital for his help and support.

My deep grateful to nursing staff Mr. Shady Shtawey, Mr. Atef and Miss. Wesam Khader who helped me to assess the patients in the study and for providing facilities for sample collection from them.

I would like to thank Mr. Amid Mushtaha, the director of Abd El-Aziz El-Rantisy laboratories and Miss. Najwa El -Borno for their assistance in preparing samples.

My appreciation is extended to Mr. Ahmad Ashour in the Biology department at Al-Azhar university-Gaza for his help and support.

I am especially grateful to all Thalassemics children and their parents, for their understanding and cooperation. Without them this study would not have been possible. I wish to present my thanks to the people who served as healthy controls in my study. Finally, thanks are extended to everyone who has a hand in this work.

V

Molecular, biochemical and hematological investigations of -thalassemic children in Gaza governorate

Abstract

Background: Thalassemias are hereditary anemias mostly common in the

Mediterranean, the equatorial, or near equatorial regions of Africa and Asia.

They are classified according to which particular globin chain(s) is/are

produced in a reduced amount: , , , , and thalassemias. In the Gaza

Strip, more than 300 patients have been diagnosed with â-thalassemia major,

they are currently being transfused and managed in local hospitals.

Aims: To investigate molecular, biochemical and hematological aspects of

â-thalassemic children aged 5-12 years in Gaza City.

Methodology: Blood samples were collected from 53 â-thalassemic

children who are transfused and managed at the pediatric hospitals at Gaza

City. Blood withdrawals were performed just before the scheduled blood

transfusion. In addition blood samples were also collected from 53 apparently

healthy children. Cases and controls were age and sex matched. Part of data

was collected by using close-ended questionnaire. Complete blood count and

biochemical tests were performed. Screening for possible mutations in HBB

gene was performed at the molecular medicine laboratories of the Bernhard

Nocht Institute (BNI), Germany, according to Dynamic Allele-Specific

Hybridization (DASH) method. This work was performed according to the

cross-sectional descriptive study design. An official approvals letters were

obtained from Helsinki committee at the Palestinian ministry of health and

from the Palestinian Thalassemia Center who approved performing the study

on the thalassemic children. The data were tabulated, encoded and

statistically analyzed using the IBM SPSS Statistics (version 17, IBM

Corporation, Somers, NY). The Chi square test, the independent-samples t-

test, and One-Way analysis of variance (ANOVA) were performed aiming at

the description, identification of significant relationship, correlations and

VI

differences between the study items, variables and parameters. A p-value <

0.05 was considered statistically significant.

Results: A significant difference was reported in the parents' consanguinity

of the two groups (P=0.001). About 71% of the â-thalassemia major children

parents are 1st degree cousins compared to the control group where the

percentage is

VII

�±Ş�ŗŪ¦°®ŗƒőƒ ƆƒƂƒŕ�µ°Ɔŕ�ÀƒŕœŮƆ�¾œŽ¶ƕ�ŗƒÂƆ®Â�ŗƒőœƒ �œřƒŕ� Â̧ƈ�ÀƆ�œƒƆƒŪƚśƃ¦غŗ·żœšƆ ÉÒ في

ŗŪ¦°®ƃ¦�´ŤƄƆ ŗƆ®ƀƆƃ¦ : �±»ţŗƅ§�¶Ãţ�Ɠž�ÆŕŷÃƔŮ�±ŝƄ£�ƓƍÃ�Ɠŝ§±Ã�À¯�±Ƃž�Ɠƍ�ŕƔƈƔŬƜŝƅ§�¶Ɣ»ŗƗ§�Ɠ»žÃ��·»ŬÃśƈƅ§

�Ã�ŕ»»»»ƔƂƔ±ž£�Á»»»»ƈ�řƔœ§Ãś»»»»Ŭƛ§�ƌŗ»»»»Ů�ã�řƔœ§Ãś»»»»Ŭƛ§�½·ŕ»»»»Ɗƈƅ§Â��ŕƔ»»»»Ŭ�řƆ»»»»ŬƆŬƅ§�¹Ã»»»»Ɗ�¨»»»»Ŭţ�Ƒ»»»»Ɔŷ�À»»»»ŬƂƊś�Ɠ»»»»ƍÃ�©²»Ż�¹ŕ»·Ɓ�Ɠ»ž�¯»ŠÃƔ��ໜƅ¯�ŕ»ƈŕŠÃ�ໜƅ¯��ໜƔŗ�ໜƅ¯��ໜƔŗ��ŕ»ſƅ£����Ƒ»ƅ¥�µƂƊ�ŕƎƔž�«¯ţƔ�Ɠśƅ§�řƔƊƔśÃ±ŗƅ§

�Áƈ�±ŝƄ£300 �Ƒƈ¸ŷ�ŕƔƈƔŬƜŝ�¶Ɣ±ƈ���řƔƆţƈƅ§�ªŕƔſŮśŬƈƅ§�Ɠž�¬ƜŸƅ§�ÁÃƂƆśƔÃ�À¯ƅ§�ÁÃƆƂƊƔ ÝÏÜÜلهÇ: �ř»»œƔŕƔƈƔƄÃƔŗƅ§��ř»»ƔœƔ²Šƅ§�Ɠţ§Ã»»Ɗƅ§�ÀƔ»»ƔƂś�ç±»»śś�ÁƔ°»»ƅ§�ŕƔƈƔ»»ŬƜŝƅ§�Ƒ»»Ų±ƈ�¿ŕ»»ſ·£�į»»ƅ�ř»»ƔÃƈ¯ƅ§Ã

�Áƈ�Àƍ±ŕƈŷ£5-12 �©²Ż�řƊƔ¯ƈ�Ɠž�řƊŬ ÞÑÜÜØلÇ: �Á»»ƈ�À¯�ªŕ»»ƊƔŷ�¨ţ»»Ŭ�À»»ś53 �ªŕƔſ»»ŮśŬƈ�Ɠ»»ž�¬Ɯ»»Ÿƅ§�Áû»ƂƆśƔÃ�À¯»»ƅ§�Áû»ƆƂƊƔ�ŕƔƈƔ»»ŬƜŝ�¶Ɣ±»»ƈ

��©²Ż�řƊƔ¯ƈ�Ɠž�¿ŕſ·Ɨ§Àś �¨ţŬªŕƊƔŷ �řžŕ»Ųƙŕŗ��Ƒ»Ų±ƈƅ§�¡ƛ¤»Ǝƅ�©±±»Ƃƈƅ§�À¯»ƅ§�¿ƂƊ�řƔƆƈŷ�¿ŗƁ�À¯ƅ§�Á»»ƈ�À¯�ªŕ»»ƊƔŷ�¨ţ»»Ŭ�À»»ś�¾»»ƅ°�Ƒ»»ƅ¥53 �ÆŕƈƔƆ»»Ŭ�ÆƜ»»ſ· ř·ŗŕ»»Ų�ř»»ƊƔŸƄ . Ŷ»»ƈŠ�À»»ś ªŕ»»ƊŕƔŗƅ§�Á»»ƈ�¡²»»Š äÜÜع

¯»»»»ƁÃ�řƊŕŗś»»»»Ŭƙ§�ř»»»»œŗŸś�½»»»»Ɣ±· �¡§±»»»»ƈţƅ§�À¯»»»»ƅ§�ªŕ»»»»Ɣ±Ƅƅ�Ɠ»»»»ƆƄƅ§�¯¯»»»»Ÿƅ§�Ƒ»»»»Ɔŷ�¿Ã»»»»ŰţƆƅ�ªŕ»»»»ƊƔŸƅ§�¿»»»»ƔƆţś�À»»»»ś��ř»»»ƔœŕƔƈƔƄÃƔŗƅ§�ªŕ»»»ŰÃţſƅ§Ã ÏÜÜÜقæ �řŗŗ»»»Ŭƈƅ§�ř»»»ƔƊƔŠƅ§�ª§±»»»ſ·ƅ§�Á»»»ŷ�¼»»»ŮƄƆƅ� Ã̈»»»Ɔ·ƈƅ§�Ţ»»»Ŭƈƅ§�¡§±»»»Š¥�À»»»ś

��Ɠ»ž�ª»ŦƊ ةŸŗŕśƅ§�ř»ƔœƔ²Šƅ§�¨»·ƅ§�ª§±»ŗśŦƈ�Ɠž�¡§±Šƙ§�§°ƍ�Àś�¯ƁÃ�ŕśƔŗ�¹ÃƊ�Áƈ�ŕƔƈƔŬƜŝ«لل ±̄ŕ»Ɗ±ŗ�¯»ƎŸƈƅ��řƂƔ±·ƅ�ÆŕƂŗ·��ŕƔƊŕƈƅ£DASH(. Ç���ř»Ų±ŸśŬƈƅ§�řƔſ»ŰÃƅ§�ªŕŬ§±¯ƅ§�řƂƔ±·�¨Ŭţ�«ţŗƅ§�§°ƍ�ıŠ�À»ś

�Á»»»»ƈ�Ã�řƔƊƔ·»»»»ŬƆſƅ§�řţ»»»»Űƅ§�©±§²Ã�Ɠ»»»»ž�ƓƄƊ»»»»ŬƆƍ�ř»»»»ƊŠƅ�Á»»»»ƈ�řƔƈ»»»»Ŭ±ƅ§�ªŕ»»»»Ƃž§Ãƈƅ§�Ƒ»»»»Ɔŷ�¿Ã»»»»Űţƅ§�²»»»»Ƅ±ƈ�Ã�²»»Ɣƈ±ś�Ã�¿ŕ»»Ŧ¯§�À»»ś��Ƒ»»Ų±ƈƅ§�¿ŕ»»ſ·Ɨ§�Á»»ŷ�ř»»Ŭ§±¯�°»»ƔſƊś�Ƒ»»Ɔŷ�½»»ž§Ã�Ä°»»ƅ§�Ã�ƓƊƔ·»»ŬƆſƅ§�ŕƔƈƔ»»ŬƜŝƅ§�ÁƔŕ»»ŗśƅ§�¿»»ƔƆţś�±ŕ»»ŗśŦ§�Ã�¿Ƃś»»Ŭƈƅ§�Ɠ»»ś�±ŕ»»ŗśŦ§�Ã�Åŕ»»Ƅ�Ŷ»»ŗ±ƈ�±ŕ»»ŗśŦ§�À§¯Ŧś»»Ŭŕŗ�ŕ»»ƎƆƔƆţś�Ã�şœŕ»»śƊƅ§�ř»»ƅïŠ

ƙ§Ã�ř»ƅ¯ŕŗśƈƅ§�ªŕ»ƁƜŸƅ§Ã�ř»ƈƎƈƅ§�ªŕ»ƁƜŸƅ§�¼»ŰÃÃ�¯»Ɣ¯ţś�¼¯»Ǝŗ�¾ƅ°�Ã�ŕžÃƊ§Ŧśال�Ã�ª§±»Ɣżśƈ�ÁƔ»ŗ�ªŕ»žřŬ§±¯ƅ§� Ã̄Ɗŗ�ª§°�ªŕžƜśŦƛ§�±ŕŗśŷ§�Àś�Ã��Ï�ř»ƅƛ¯Ɔƅ�ř»Ɣƅŕƈśţƛ§�ř»ƈƔƂƅ§�ª»ƊŕƄ�§°§�ř»Ɣ±ƍÊ�řƔœŕŰţ§�řƅƛ

�Áƈ�¿Ɓ§�řƔœŕŰţƛ§0.05 ŝőœřƈƃ¦: ��ÁƔśŷûƈŠƈƅ§�ÁƔ»ŗ�ÁƔ¯»ƅ§Ãƅ§�ř»ŗ§±Ɓ�ř»Š±¯�Ɠž�ªƆŠŬ�řƔœŕŰţ¥�řƅƛ¯�¾ŕƊƍP=0.001�Ɠƅ§Ã»ţ��

%71 Ÿƅ§�ŕƔƈƔŬƜŝƅ§�ƑŲ±ƈ�¡ŕŗ¢�Áƈ�Ƒƈ¸ÀƎƔ¯ƅ �±Ɓ�řŠ±¯Ƒƅã�řŗ§ �řŗŬƊƅ§�«Ɣţ�ř·ŗŕŲƅ§�řƊƔŸƅŕŗ�řƊ±ŕƂƈ %�Á»ƈ�¿»Ɓ§%2 .Ɠƅ§Ã»»ţƅ�ª»ŲſŦƊ§�ÁƔŗûƆŠÃƈƔƎƅ§�řŗ»ŬƊ�Á£�«»»Ɣţ�Ƒ»Ų±ƈƅ§�Ɠ»ž�¯ŕ»ţ�À¯�±»»Ƃž�¸ţûƅهÜي 30 ř·ŗŕ»Ųƅ§�ªŕ»ƊƔŸƅ§�Ɠ»ž�řƆŠ»Ŭƈƅ§�řŗ»ŬƊƅŕŗ�ř»Ɗ±ŕƂƈg/dl 1.0±8.0 �¿»ŗŕƂƈ0.8±11.4 . ŕ»ƈƄ �¸ţûƅ

�¡§±»ƈţƅ§�À¯»ƅ§�ŕ»»ƔƜŦ�À»Šţ�±ż»Ű ìÏÜÜل °�Áŕ»Ƅ�½±»ſƅ§�§°»»ƍÃ�ř·ŗŕ»Ųƅ§�ř»ƊƔŸƅ§�Ŷ»»ƈ�ř»Ɗ±ŕƂƈ�Ƒ»Ų±ƈƅ§æ ةÜÜاللÏ�ƓƅໜƅŕƄ�řƔœŕ»Űţ¥fl 7.3±75.9æ 2.3 pg±24.1 �¿»ŗŕƂƈ�Ƒ»Ų±ƈƅ§�Ɠ»ž4.4 fl±79.5æ2.2 pg

±24.7 ��ř·ŗŕ»»Ųƅ§�ř»»ƊƔŸƅ§�Ɠ»»ž¯¯»»ŷÃ�¡ŕ»»ŲƔŗƅ§�À¯»»ƅ§�ªŕ»»Ɣ±Ƅ�¯¯»»ŷ�©¯ŕ»»Ɣ²�Ɠ»»ž�řƔœŕ»»Űţ¥�ř»»ƅƛ¯��ªƆŠ»»Ŭ

VIII

»»»Ų±ƈƅ§�į»»»ƅ�ÅÃƊŕ»»»ŝƅ§�ř»»»ƔÃƈ¯ƅ§�Ţœŕſ»»»Űƅ§ى ƅŕŗ���ř»»»ƅƛ¯�§°�±Ãƍ¯»»»ś�¸ţû»»ƅ�ř»»»ƔœŕƔƈƔƄÃƔŗƅ§�µœŕ»»»ŰŦƆƅ�řŗ»»»ŬƊ»»Ų±ƈƅ§�Ɠ»»ž�ŕ»»Ɣ±ÃƔƅ§�§¯»»ŷŕƈ�ř»»ƔƆƄƅ§�¼œŕ»» Ã̧Ã�¯»»ŗƄƅ§�¼œŕ»» Ã̧�Ɠ»»ž�řƔœŕ»»Űţ¥ي ��ř·ŗŕ»»Ųƅ§�ř»»ƊƔŸƅ§�Ɠ»»ž�ř»»Ɗ±ŕƂƈ

Ƒ»»»»ƊƔśÃ±ŗƅ§�Äû»»»śţƈƆƅ�řŗ»»»»ŬƊƅŕŗ: �§°»»»»ƍÃ�Ƒ»»»»Ų±ƈƅ§�į»»»»ƅ�¶»»»»ſŦƊ§�ÁƔƅû»»»ƔŗÃƆŠƅ§Ã�ÁƔƈû»»»ŗƅƗ§�Ɠ»»»»ƆƄƅ§�ÁƔśÃ±»»»»ŗƅ§»»Ɔŷ�©ÃƜ»»ŷ�řƔœŕ»»Űţ¥�ř»»ƅƛ¯�§°�¶ŕ»»ſŦƊƛ§ŕƂƈ�Ƒ»»Ų±ƈƅ§�į»»ƅ�¯»»Ɣ¯ţƅ§�ÄÃś»»Ŭƈ�Ɠ»»ž�©¯ŕ»»Ɣ²�¾ŕ»»Ɗƍ�¾»»ƅ°�Ƒ�ř»»Ɗ±

řŗŬƊ�«Ɣţ�ř·ŗŕŲƅ§�řƊƔŸƅŕŗFerritin ƓƅໜƅŕƄ)1560.5 ng/l±3231.0 ¿»ŗŕƂƈ46.8±23.1 ng/l(. Á£�ªſ»»»ŮƄ�ř»»»ƔœƔ²Šƅ§�µœŕ»»»ŰŦƆƅ�řŗ»»»ŬƊƅŕŗ ÉÑÜÜÜفØلÇ IVS-I-110 檯»»»Š �ªŕƈû»»ŬÃƈñƄ�Ŷ»»»ŗ±�Ɠ»»»ž�Æŕ»»»ŗƔ±Ƃś

Ƒ»Ų±ƈƅ§ 106/24 œ§¯»ŗ�±§±»Ƅśŗ�ÿ =0.23 ŕ»ƎŸŗśƔIVS-I-1 æCD39 »Ɣţ�Ɠ»ž�ª¯»ŠÃ�«18 �Á»ƈƑ»»»Ų±ƈƅ§�ªŕƈû»»ŬÃƈñƄ يÜÜÜفæ17 »»»Ų±ƈƅ§�ªŕƈû»»ŬÃƈñƄ�Á»»»ƈى œ§¯»»»ŗ�±§±»»»Ƅśŗ¿ �ÅÃŕ»»»ŬƔ0.17 æ o.16

�¯Ƃƅ��Ɠƅ§Ãśƅ§�ƑƆŷ �¿ŝƈ�Ƨ±§±Ƅś�¿Ɓ£�ª§±ſ·�ª¯ŠÃIVS-I-6 æ .CD37 Ç«œřƈřŪƙ : �¾ŕƊƍ¹ÃƊś »Ų±ƈƅ§�į»ƅ�ໜƔŗ�¹Ã»Ɗ�Á»ƈ�ŕƔƈƔŬƜŝƆƅ�řŗŗŬƈƅ§�ª§±ſ·ƅ§�Ɠž�ƓœƔ²Šي ىÜف ÚاÜØق

�¿Ã»»ƄÃśÃ±ŗ�Ŷ»»ŲÃ�¨»»Ɔ·śƔ�ŕ»»ƈƈ�¶±»»ƈƅ§�į»»ƅ�ř»»ƔÃƈ¯ƅ§Ã�ř»»ƔœŕƔƈƔƄÃƔŗƅ§�µœŕ»»ŰŦƅ§�Ɠ»»ž�±Ãƍ¯»»ś�¾ŕ»»Ɗƍ���©²»»Ż©¯ŕţ�řƔƊƔŠ�ª§±ſ·�ÀƎƔ¯ƅ�ÁƔ°ƅ§�ƑŲ±ƈƆƅ�řŰŕŦ�¨ŬŕƊƈ�ƓŠƜŷ.

ŗººººƒšœřŽƆƃ¦�©œººººƆƄƂƃ¦: �ŕƔƈƔ»»»»ŬƜŝ�ŕ»»»»śƔŗª§±»»»»ſ·ƅ§��¿ŕ»»»»ſ·Ɨ§� �ř»»»»ƔÃƈ¯ƅ§Ã�ř»»»»ƔœŕƔƈƔƄÃƔŗƅ§�µ§Ã»»»»Ŧƅ§� ř¸žŕţƈ .ÉÒغ

IX

Table of Contents

Contents page Dedication.. II Declaration . III Acknowledgements IV Abstract (English).. V Abstract (Arabic)... VII Table of contents IX List of Figures XII List of Tables. XII

Chapter 1:Introduction

1.1Overview 1 1.2 General objective 2 1.3 Specific objectives . 2 1.4 Significance of the study. 3

Chapter 2: Literature Review

2.1 Human hemoglobins 4 2.1.1 Structure of hemoglobin 4 2.1.2 Ontogeny of human hemoglobins......... 5 2.1.3 Fetal to adult hemoglobin switch.......... 5 2.1.4 Genetic control of human hemoglobins........ 6 2.1.5 Hemoglobin disorders 8 2.2 Thalassemia. 8 2.2.1 Types of thalassemia. 8 2.3 -thalassemia... 9 2.3.1 Distribution of -thalassemia 10 2.3.2 Clinical classification of -thalassemia. 11 2.3.3 Pathophysiology of -thalassemia. 11 2.3.4 Molecular genetics of -thalassemia. 13 2.3.5 Complications of -thalassemia 15 2.3.6 Diagnosis of -thalassemia 16 2.3.7 Management of -thalassemia... 17 2.4 Related studies.. 18

Chapter 3: Materials and methods 3.1 Study design 22 3.2 Target population... 22 3.2.1 Inclusion criteria 22 3.2.2 Exclusion criteria... 22

X

3.3 Sample size...................................................................................... 22 3.4 Ethical consideration.. 22 3.5 Data collection. 23 3.5.1 Questionnaire. 23 3.5.2 Venous blood withdrawal.. 23 3.5.3 Spotting and transfer of Dried Blood Samples (DBS)... 24 3.5.4. HBB mutations screening. 25 3.6 Biochemical analysis 27 3.6.1 Determination of serum urea. 27 3.6.2 Determination of serum creatinine 28 3.6.3 Determination of serum uric acid.. 29 3.6.4 Determination of serum Aspartate aminotransferase(AST) enzyme activity... 31

3.6.5 Determination of serum Alanine Aminotransferase (ALT) enzyme activity... 32

3.6.6 Determination of bilirubin. 34 3.6.7 Determination of total protein... 36 3.6.8 Determination of albumin.. 38 3.6.9 Determination of globulin.. 39 3.6.10 Determination of serum Calcium (Tca)... 39 3.6.11 Determination of phosphorus.. 40 3.7 Hematological analysis. 41 3.7.1 Complete blood count (CBC) 41 3.7.2 Determination of serum ferritin. 41 3.7.3 Fetal haemoglobin (HbF) quantitation.. 41 3.7.4 Blood film.. 43 3.8 Statistical analysis. 43

Chapter 4: Results 4.1 General characteristics of the study groups.. 44 4.2 General and some clinical characteristics of the patient.. 45 4.3 Hematological characteristics of the study groups.. 46 4.4 Biochemical characteristics of the study groups.. 47 4.5 Poikilocytosis in patients blood 48 4.6 Mutation spectrum of â-thalassemia major patients. 49 4.7 Genotype of patients according to the identified variants... 50 4.8 Hematological and biochemical characteristics of patients according to gender.

51

4.10 Hematological and biochemical characteristics according to patients Genotype... 52

XI

Chapter 5: Discussion

5.1 General characteristics of the study population.... 56 5.2 Hematological characteristics of the study groups... 57 5.3 Biochemical characteristics of the study group 58 5.4 Hematological and biochemical characteristics according to patients Genotype...

60

5.5 Mutation spectrum of â-thalassemia major patients. 60 5.6 Genotype of patients according to the identified variants... 61

Chapter 6: Conclusions and Recommendations 6.1 Conclusions... 63 6.2 Recommendations. 64

Chapter 7: References References. 65

Appendices Annex 1: Approval to conduct the study from Helsinki committee in the Gaza Strip...

79

Annex 2: Approval from the Palestinian Thalassemia Center who approved performing the study on the thalassemic children

80

XII

List of Figures

Figure 2.1 An illustration of the three dimensional structure of hemoglobin tetramer, and the chemical structure of heme.

4

Figure 2.2 The changes in human globin chains synthesis during developmental stages of life.

6

Figure 2.3 Structure of the á-globin and -globin genes.. 7 Figure 2.4 Geographical distribution of â-thalassemia around the world 10 Figure 2.5 Pathophysiology of -thalassemia.. 12 Figure 3.1 Newborn screening filter paper... 25

List of Tables Table 2.1 Hemoglobin types in the different developmental stages of human life.

5

Table 2.2 The spectrum of -thalassemia mutations in the Middle East region.

14

Table 3.1 Characteristics of hybridization assays used for genotyping 26 Table 4.1 General characteristics of the study groups. 45 Table 4.2 General and some clinical characteristics of the patients 46 Table 4.3 Hematological characteristics of the study groups... 47 Table 4.4 Biochemical characteristics of the study groups... 48 Table 4.5 Poikilocytosis score of the patients... 49 Table 4.6 Relative allelic frequencies of HBB variants in Gaza strip patients...

50

Table 4.7 Genotype of patients according to the identified variants. 50 Table 4.8 Hematological characteristics of patients according to gender 51

Table 4.9 Biochemical characteristics of patients according to gender 52

Table 4.10 Hematological characteristics according to patients genotype.

54

Table 4.11 Biochemical characteristics according to patients Genotype 55

1

Chapter 1

Introduction

1.1 Overview

The thalassemias are hereditary anemias caused by mutations that affect the

synthesis of the globin, the protein component of the hemoglobin. Thalassemias

produce a massive public health problems in many parts of the world (Vichinsky,

2005). They are the commonest genetic diseases of mankind and have been encountered

practically in every racial group and geographic location in the world, however, they are

most common in the Mediterranean, the equatorial, or near equatorial regions of Africa

and Asia (Weatherall, 2010).

Thalassemias are classified according to which particular globin chain(s) is/are

produced in a reduced amount, which may lead to an imbalance in globin chains

synthesis, ineffective erythropoiesis, hemolysis, and eventually to a variable degree of

anemia.The main types of thalassemias are the , , , , and . The and

thalassemias are the most common classes, and thalassemia is the most important and

widely spread type which causes severe anemia in the homozygous and compound

heterozygous states (Weatherall, 1996 and 2004��2OLYLHUL������� and Galanello and

Origa, 2010).

Thalassemias are clinically classified according to their severity into thalassemia

major requiring a regular blood transfusion throughout life, thalassemia intermedia

characterized by anemia but not of such severity as to require regular blood transfusion,

and thalassemia minor or trait which is the symptomless carrier state (Nienhuis and

Benz, 1996; Lahiry et al., 2008 and Cao and Galanello, 2010). The severity of the

clinical syndrome of â-thalassemia depends on the type of mutation in the â gene. More

than 400 different mutations have been reported and identified in the globin gene

which are responsible for the development of the thalassemia (Patrinos et al., 2004

and Pan, 2010). Most types of -thalassemias are due to point mutations, and large

deletion mutations are found in rare cases (Sanguansermsri et al., 1990; Galanello

and Origa, 2010 and Danjou et al., 2011). Well known relationships have been

2

reported between the hematological-clinical phenotype and the type of the -

thalassemia mutation (Rosatelli et al., 1992). Consequently, identifying the mutation in

the patients is highly appreciated for a better management protocol (Winichagoon et

al., 2000 and Arumugam and Malik, 2010).

Blood transfusions are gradually introduced by physician to suppress

thalassemic manifestation. However, humans have a very limited ability to excrete iron,

so regular blood transfusion inevitably lead to iron overload (Luangasanatip et al.,

2011). Evidences of marked iron deposition in the liver, heart, pancreas, thyroid,

parathyroid, adrenal, renal medulla, bone marrow, and spleen are commonly reported.

This parenchymal iron loading is the major cause of morbidity and mortality in the

severe -thalassemias. The normal adolescent growth spurt fails to occur, and hepatic,

endocrine, and cardiac complications producing a variety of clinical problems including

diabetes, hypoparathyroidism, adrenal insufficiency, and liver failure will take place.

Secondary sexual development is delayed, or does not occur at all (Peters et al.,

2012).The management of severe forms of the -thalassemia diseases depends on 3

mainstays regimen: regular blood transfusion, removal of overloaded iron with

chelating agents such as deferoxamine and Exjade, and splenectomy when rate of

transfusion is increasing (Peters et al., 2012 and Vichinsky et al., 2011).

1.2 General objective

The general objective of the present study is to investigate molecular,

biochemical and hematological aspects of â-thalassemic children aged 5-12 years in

Gaza.

1.3 Specific objectives

1. To identify the causative mutation of â-thalassemic children in Gaza.

2. To determine serum levels of aspartate aminotransferase (AST), alanine

aminotransferase (ALT), creatinine, urea, uric acid, bilirubin, total protein, albumin,

ferritin, calcium, and phosphorous in â-thalassemic children.

3. To measure CBC parameters in â-thalassemic children.

4. To quantify the level of HbF in â-thalassemic children.

5. To perform blood films for â-thalassemic children.

3

6. To evaluate the clinical severity of the â-thalassemia disease in terms of the

frequency of regular blood transfusions.

7. To correlate the causative mutation to the clinical, biochemical and hematological

characteristics of â-thalassemic children.

1.4 Significance of the study

1. More than 325 patients have been diagnosed as â-thalassemic major, they are

currently transfused and chelated in governmental hospitals of the Gaza Strip.

2. Lack of molecular studies on thalassemia mutation in Gaza Strip; only a preliminary

study linked laboratory indices of â-thalassemia with type of the thalassaemia

mutation. Therefore, it is worthwhile to evaluate the thalassemic children in Gaza for

their hematological and biochemical characteristics and also to find a possible

correlation between these characteristics and the molecular genetics of the disease.

3. Identifying the mutation could improve or establish a proper management protocol

for those thalassemic children in terms of the regularity and quantity of blood

transfusions, and consequently the chelation treatment of the associated iron

overload.

�

Chapter 2

Literature review

2.1 Human hemoglobins

The human hemoglobins are heterogeneous proteins packed inside the red blood

cells. This heterogeneity is expressed at all stages of development, during which

different forms of hemoglobin are synthesized (Weatherall and Clegg, 1996;

Weatherall, 2000 and Schechter, 2008).

2.1.1 Structure of hemoglobin

All the human hemoglobins are tetrameric in structure, made up of two different

pairs of globin polypeptide chains (2 like, 2 like). Each globin chain is attached to

one heme molecule (Figure 2.1). However, different types of hemoglobins are

synthesized during the developmental stages of human life Table 2.1. (Maniatis et al.,

1980 and Sanders et al., 2002).

Figure 2.1. An illustration of the three dimensional structure of hemoglobin tetramer, and the

chemical structure of heme (Kingston, 2002).

5

Table 2.1. Hemoglobin types in the different developmental stages of human life.

Hemoglobin Type Structure Developmental Stage

Hb Gower 1 2 2 Embryo

Hb Gower 2 2 2 Embryo

Hb Portland 2 2 Embryo

HbF 2 2 Fetal and adult

HbA2 2 2 Adult

HbA 2 2 Adult

2.1.2 Ontogeny of human hemoglobins

Normally, hemoglobin tetrameres contain 2-like ( or ) chains and 2- like

(, , ,or ) chains (Weatherall, 1997; Patrinos et al., 2005 and Higgs et al., 2012).

Hemoglobin synthesis (Figure 2.2) begins during the second month of gestation in the

yolk sac. The earliest embryonic hemoglobin tetramere is called Hb Gower1 (2 2),

which consist of 2 like (2) and 2 like (2) chains. Then, two other embryonic

hemoglobins are synthesized: Hb Gower2 (2 2) and Hb Portland (2 2). At 10 to 11

weeks of gestation, erythropoiesis takes place in liver and spleen, at which, embryonic

hemoglobins (Hb Gower1, Hb Gower2 and Hb Portland) decline and fetal hemoglobin

(HbF: 2 2) eventually becomes the predominant throughout the fetal life (Karlsson

and Nienhuis, ������0F'RQDJK�and Nienhuis, ����� Manning, 2007 and Elizabeth

and Mary Ann, 2010).

2.1.3 Fetal to adult hemoglobin switch

After birth, the adult and globin chains begin gradually to replace the -

globin chain. This results in a major switch from HbF (2 2) to the adult hemoglobin

HbA (2 2) synthesis which occurs at about the time of birth and ends 6 months later

(Figure 2.2). After switch from fetal to adult hemoglobin, 97-98% of the hemoglobin is

HbA, while HbA2 (2 2) accounts for approximately 2%. Small amount (1%) of HbF

is also found in adults blood (Stamatoyannopoulos and Grosveld, 2001 and Thein et

al., 2009).

�

Figure 2.2. The changes in human globin chains synthesis during developmental stages of life

(Schechter, 2008).

2.1.4 Genetic control of human hemoglobins

The production of the various types of human globin chains is controlled by two

gene clusters: the -like genes and -like genes cluster (Proudfoot et al., ������

Weatherall, 1997 and Elizabeth and Mary Ann, 2010).

2.1.4.1 -like genes cluster

The -like globin genes are clustered in 26 Kb DNA segment on the distal

segment of the short arm of chromosome 16. The genes cluster consist of a duplicated

highly homologous genes (1, 2), an embryonic gene, three pseudogenes (,

2, 1), and a gene of undetermined function () (Figure 2.3). These genes are

arranged on chromosome 16 in the order: -5- - - 2 - 1 -2 - 1- -3(Higgs

et al., 1989 and Ribeiro and Sonati, 2008).

2.1.4.2 -like genes cluster

The -like globin genes cluster is found near the terminus of the short arm of

chromosome 11. The cluster spread over approximately 60 Kb. It consists of a single

�

embryonic () gene, 2 (G, A) fetal genes, one pseudogene (), and the adults and

genes (Figure 2.3). These genes are arranged on chromosome 11 in the order:5- -

G - A - - - -3(Fritsch et al., 1980 and Ribeiro and Sonati, 2008).

Figure 2.3. Structure of the á-globin and-globin genes(Kingston2002).

Figure 2.3. Structure of the á-globin and -globin genes (Kingston 2002).

8

2.1.5 Hemoglobin disorders

2.1.5.1 Acquired hemoglobin disorders

The acquired disorders of hemoglobin are secondary to other disease processes

or external factors rather than resulting from genetic derangement of hemoglobin

synthesis or structure. The acquired disorders can be subdivided into those characterized

by defective synthesis of globin chain (e.g. elevated HbF levels in states of erythroid

stress and bone marrow dysplasia), and those in which the structure of hemoglobin

molecules is altered by toxins (e.g. acquired Methemoglobinaemia) (Benz, 1996).

2.1.5.2 Inherited hemoglobin disorders

The inherited disorders of the hemoglobin constitute a major public health

problem in many parts of the world, and they are commonly known as

hemoglobinopathies �:+2�� ������ :HDWKHUDOO� and Clegg, 2001 and AlQahtani,

2012). The mutations in the genes controlling the production of the human hemoglobins

can result in either quantitative (defect in the rate of production of one or more of the

globin chains) or qualitative (production of different hemoglobin molecules)

abnormalities. The quantitative abnormalities are known as thalassemias, while the

qualitative abnormalities are known as structural hemoglobin variants (Weatherall,

2001).

2.2 Thalassemia

Thalassemia is a group of inherited autosomal recessive blood disorders that

originated in the Mediterranean region. In thalassemia the genetic defect, which could

be either mutation or deletion, results in reduced rate of synthesis or no synthesis of one

of the globin chains that make up hemoglobin. This can cause the formation of

abnormal hemoglobin molecules, thus causing anemia, the characteristic presenting

symptom of the thalassemias (Rund and Rachmilewitz, 2005 and Lahiry et al.,

2008).

2.2.1Types of thalassemia

The thalassemias are due to a large number of mutations causing abnormal

globin gene expression and resulting in total absence or quantitative reduction of globin

9

chain synthesis (Steinberg et al., 2001 and Muncie and Campbell, 2009). They are

divided according to which globin chain is produced in reduced amounts into the:

1. Reduced or absent â-globin chain: â-thalassemia

2. Reduced or absent -globin chain: -thalassemia

3. Reduced or absent äâ- globin chain: äâ-thalassemia

4. Reduced or absent ãäâ- globin chain: ãäâ- thalassemia

All types of thalassemias are considered quantitative hemoglobin disease. From

a public health view point only the and â-thalassemias are sufficiently common to be

of importance (Weatherall and Clegg, 2001; Hoffbrand et al., 2005 and Galanello

and Origa, 2010).

2.2.1.1 -thalassemia

Is usually due to deletions within the -globin gene cluster, leading to loss of

function of one or both -globin genes in each locus leading to excess â-globin chains.

á-thalassemia generally presents as a milder form of the disease. This is due to the fact

that there are four á-globin genes, requiring multiple mutations to result in a clinical

impact. Also, the unpaired â-globin chains are intrinsically less prone to precipitation as

compared with unpaired á-globin chains in â-thalassemia (Rund and Rachmilewitz,

2005 and Muncie and Campbell, 20����+DUWHYHOG�DQG�+LJJV��������

2.2.1.2 â-thalassemia

Is the most important among the thalassemia syndromes because it is so

common and usually produce severe anemia (Weatherall, 1998).

2.3 -thalassemia

Is the result of deficient or absent synthesis of beta globin chains, leading to

excess alpha chains. â-thalassemia generally presents as severe form of the disease

because it produces severe anemia in their homozygous and compound heterozygous

states (Olivieri, 1999 and Borgna-Pignatti et al., 2005).

��

2.3.1 Distribution of -thalassemia

-Thalassemia has been encountered sporadically in practically every racial

group. However, â-thalassemia is most common in persons of Mediterranean, African,

and Southeast Asian descent. Thalassemia trait affects 5 to 30 percent of persons in

these ethnic groups (Fleming, ������ 5XQG� DQG� 5DFKPLOHZLW]�� ����� DQG Cao and

Galanello, 2010). Palestine is one of the Mediterranean basin countries in which

thalassemia disease is prevalent. The carrier frequency for â-thalassemia in these areas

ranges from 1% to 20%, rarely greater (WHO, 1989). Figure 2.4 shows geographical

distribution of â-thalassemia around the world. In Gaza Strip the average incidence of

thalassemia trait is 3.0 4.5% (Sirdah et al., 1998). The number of thalassemia patients

in Gaza Strip is 325 patients. There are 246 confirmed â-thalassemia major, 2 patients

are á-thalassemia and 77 individuals are thalassemia intermediate (Thalassemia

Center, 2010). Thalassemic patients get their treatment and health care in three

hospitals in Gaza Strip. Patients living in both Rafah and Khan-Younis are treated at the

European Hospital regardless of their age. Adult thalassemic patients living in Gaza

City, Northern and Middle Governorates are treated at AlShifa Hospital in Gaza City

while young thalassemic patients (

11

2.3.2 Clinical classification of -thalassemia

The clinical severity of â-thalassemia is related to the extent of imbalance between

the alpha and non alpha globin chains, so â-thalassemia can be categorized into three

classes according to the severity of the symptoms:

2.3.2.1 â-thalassemia minor

Is the â-thalassemia carrier state, which results from heterozygosity for â-

thalassemia, is clinically asymptomatic and is defined by specific hematological

features (Lahiry et al., 2008).

2.3.2.2 â-thalassemia intermedia

It is comprehend a clinically and genotypically as very heterogeneous group of

thalassemia-like disorders, ranging in severity from the asymptomatic carrier state to the

severe transfusion-dependent type (Cao and Galanello, 2010).

2.3.2.3 â-thalassemia major

The â-thalassemia major, also known as Cooleys anemia or Mediterranean

anemia, is a severe transfusion-dependent anemia. It is ahomozygous or compound

heterozygous state for a recessive mendelian disorder not confined to the

Mediterranean, but occurring widely throughout tropical countries (Urbinati et al.,

2006 and Galanello and Origa, 2010). At birth patients with -thalassemia major are

nearly normal hematologically, since globin chain synthesis is normal and HbF (22)

production is adequate. Thus when such newborns need to replace their fetal RBC (fetal

to adult Hb switch) with cells that contain predominantly HbA (22) the defect in -

globin synthesis become apparent. As the major switch from HbF to HbA were

occurring during the first year of life, most severe forms of -thalassemia present within

the first year of newborn life (Olivieri, 1999 and Sankaran et al., 2010 ).

2.3.3 Pathophysiology of -thalassemia

The basic molecular defect in -thalassemia results in either absence (o) or

reduced (+) beta chain production, however, chain synthesis proceeds at a normal

rate.The first consequence of reduced -chain production is reduced production of the

��

adult hemoglobin (HbA: 2 2). A second consequence is imbalanced globin chain

synthesis, in which chain synthesis proceeds at a normal rate and hence there is an

excess of chain in the erythrocytes. The excess chains are unstable and precipitate

in the bone marrow red cell precursors, giving rise to a large intracellular inclusions that

interfere with the red cell maturation, function and survival (Figure 2.5)(Weatherall,

2000 and Elizabeth and Mary Ann, 2010 ).

Figure 2.5. Pathophysiology of -thalassemia (Rund and Rachmilewitz, 2005).

The interference of these intracellular inclusions with red-cell maturation

subsequently gives rise to intramedullarly destruction of red-cell precursors, i.e.

ineffective erythropoiesis. However, those red cells that become mature and enter the

circulation contain chain inclusions, which interfere with their passage through the

microcirculation, particularly in the spleen, and hence extramedullarly destruction of red

cells become the norm.Thus, the anemia of -thalassemias results from both ineffective

erythropoiesis and a shortened red cell survival (Weatherall, 1996 and Ginzburg and

Rivella, 2012).

The anemia in thalassemic patients is a stimulus to increased erythropoietin

production from the kidney and hence erythropoiesis. However, the severe ineffective

erythropoiesis results in erythroid marrow expansion to as much as 30 times the normal

level, and consequently causes massive bone marrow expansion and hyperplasia that

lead not only to serious deformities of the skull and long bones, but also to increased

13

iron absorption and progressive deposition of iron in tissues. Increased erythropoietin

synthesis may also stimulate the formation of extramedullary erythropoietic tissue,

primarily in the thorax and paraspinal region (Olivieri, 1999 and Galanello and Origa,

2010). Moreover, because the spleen is being constantly bombarded with abnormal

RBC production in thalassemic patients, it hypertrophies and splenomegaly becomes a

main feature of thalassemic patients. The increase in plasma volume as a result of

shunting through expanded marrow and progressive splenomegaly exacerbate the

anemia and worsen the condition (Hess et al., 1976 and Ginzburg and Rivella, 2012).

Numerous abnormalities in the membrane of thalassemic erythrocytes have been

described. Studies of the consequences of excess -globin chains accumulation, and

their degradation products within the red-cell membrane and its skeleton have

demonstrated abnormalities in main red cell membrane cytoskeleton proteins to include

spectrin, band 3 and band 4.1 (Grinberg and Rachmilewitz 1995 and Olivieri,

1999).These abnormalities were found to affect not only the survival of the RBC but

also the platelets function through the RBC-platelets interaction (Valles et al., 2002).

2.3.4 Molecular genetics of -thalassemia

The new recombinant DNA technology has facilitated the study of the -globin

genes from many patients with -thalassemias. Up-to-date, more than 400 different

mutations have been reported and identified in the globin gene which are responsible

for the development of the -thalassemia �3DWULQRV�HW�DO���������3DQ���������

2.3.4.1 Types of mutations of -thalassemia

The -thalassemia syndromes arise from mutations that affect every step in the

pathway of -globin gene expression: transcription, mRNA processing, mRNA

translation, and post translational integrity of the polypeptide chains (Schwartz and

%HQ]��������2OLYLHUL������ and Higgs et al., 2012). Most types of -thalassemias are

due to point mutations, and large deletion mutations are found in rare cases

(Sanguansermsri et al., 1990., Galanello and Origa, 2010 and Danjou et al., 2011).

14

2.3.4.2 Spectrum of mutations of -thalassemia

-thalassemias are heterogeneous group with respect to the molecular

pathogenesis, and different populations and ethnic groups differ with respect to the

predominately mutations. The variable spectrum of the -thalassemia mutations has

resulted in extensive studies in different populations and ethnic groups to identify the

major mutations (Weatherall., 2000). Table 2.2 illustrates the spectrum of - mutations

in the Middle East region. In the Gaza Strip some of these mutations have been

identified by others (Filon et al., 1995), however further detailed studies to identify the

entire spectrum of -thalassemia mutations in the Gaza Strip are required.

Table 2.2. The spectrum of -thalassemia mutations in the Middle East region

($IWHU� +XVVHLQ� HW� DO��� ������ )LORQ� HW� DO�� ������ (O-Khateeb et al., 1997 and

Weatherall, 2000).

Frequency (%)

Mutation Type Gaza Strip Jordan Egypt Lebanon Turkey

IVS.1, nt 110 GA + 37.5 27.5 41 62 42

IVS.1, nt 1 GA 0 20 17 13 - 5

Codon 39 GT 0 11.5 10.1 1 4 4

Framshift 5 -CT 0 10 8.4 3 - 4

IVS.1, nt 6 T C + 7.5 6.2 13 8 10

Framshift 6 -A 0 5 - - - 1

AATAAA A + 2.5 - - - -

Codon 37 G A 0 1 7.3 1 - -

IVS.2, nt 1 GA 0 1 5.6 3 4 4

Codon 27 G T + 1 - 1 - -

Framshift 8 -AA 0 - - 3 6 5

IVS.2, nt 745 C G + - - 3 4 2

IVS.1, nt 5 G C + - - - 4 1

Codon 29 C T 0 - - - 8 -

Framshift 106/107 0 - - 3 - -

Framshift 8-9 0 - - - - 3

-30 T A + - - - - 4

-87 C G + - - - - 1

Unknown 0 2.5 18 3 - 14

15

2.3.5 Complications of -thalassemia

Transfused thalassemic patients may develop complications related to iron

overload. Complications of iron overload in children include growth retardation and

failure or delay of sexual maturation. Later iron overload-related complications include

involvement of the heart (dilated myocardiopathy or rarely arrythmias), liver (fibrosis

and cirrhosis), and endocrine glands (diabetes mellitus, hypogonadism and insufficiency

of the parathyroid, thyroid, pituitary, and, less commonly, adrenal glands (Higgs et al.,

2012 and Peters et al., 2012). Other complications are hypersplenism, chronic hepatitis

(resulting from infection with viruses that cause hepatitis B and/or C), HIV infection,

venous thrombosis, and osteoporosis (Muncie and Campbell, 2009). The risk for

hepatocellular carcinoma is increased in patients with liver, viral infection and iron

overload. Individuals who have not been regularly transfused usually die before the

second-third decade, survival of individuals who have been regularly transfused and

treated with appropriate chelation extends beyond age of 40 years. Cardiac disease

caused by myocardial siderosis is the most important life-limiting complication of iron

overload in â-thalassemia. In fact, cardiac complications are the cause of the deaths in

71% of the patients with â-thalassemia major (Galanello and Origa, 2010).

2.3.5.1 Iron metabolism and iron overload in â-thalassemic patients

Iron is essential to most life forms and to normal human physiology. The

recommended dietary allowance for iron for children is 8 mg/day, for adult males is 11

mg/day and for adult females is 18 mg/day (Institute of Medicine: Food and

Nutrition Board, 2001). Most well-nourished people in industrialized countries have 4

to 5 grams of iron in their bodies. Of this, about 2.5 g is contained in hemoglobin and

most of the rest is stored as ferritin (Camaschella and Schrier, 2011). The majority of

the iron absorbed from digested food or supplements is absorbed in the

duodenum by enterocytes of the duodenal lining (Fleming and Bacon, 2005). Once it

absorbed from the duodenum, iron is immediately combined in the blood plasma with a

beta globulin, apotransferrrin, to form transferrin, which is then transported in the

plasma (Duffy, 1996). The iron is loosely bound in the transferrin and, consequently,

can be released to any tissue cell at any point in the body. Excess iron in the blood is

stored as ferritin which is the major iron storage protein compound present primarily in

16

the liver, reticuloendothelial cells and erythroid precursors of the bone marrow (Pipard,

1996; Guyton and Hall, 2006 and Camaschella and Schrier, 2011).

Human has alimited capacity to excrete excess iron from the body.The absence

of a physiological pathway for the excretion of excess iron means that patients with an

increased iron intake are at risk of dangerous and progressive accumulation of body iron

reserves, which leads to abnormally large amount of iron in tissues and consequently

lethal tissue damage (Bacon and Britton, 1990 and Pipard, 1996). Iron is deposited in

the parenchymal cells of the liver, the heart, and a subgroup of endocrine tissues

�1DWKDQ�DQG�2VDNL��������$QGUHZV�������DQG������. Iron overload results from the

increased catabolism of erythrocytes like in patients who receive frequent blood

transfusion e.g. thalassemia major, sickle cell (Weatherall, 1997). Quantitavely, one

unit of packed RBCs that used in the transfusion regimen contains approximately 200

mg of iron (Weatherall, 1996). Thus, with regular blood transfusion a 6 years old

thalassemic patient (who have receiving 60-75 units of packed RBCs) is expected to

accumulate 12-15 grams of excess iron, compared to 3-4 grams found in normal non-

transfused adults. Iron accumulates in the reticuloendothelial macrophages first, and

only later deposits in parenchymal cells (Brittenham et al., 1994, Kushner et al.,

2001). This leads to tissue damage and fibrosis, and finally organ damage (Andrews,

1999 and 2000 and Waldmeier et al., 2010).

2.3.6 Diagnosis of -thalassemia 2.3.6.1 Clinical diagnosis

It is usually suspected in an infant younger than two years of age with severe

microcytic anemia, mild jaundice and hepatosplenomegaly (Higgs et al., 2012).

2.3.6.2 Hematologic diagnosis Is characterized by reduced Hb level ( 50 12

17

2.3.6.3 Qualitative and quantitative Hb analysis

By cellulose acetate electrophoresis and DE-52 microchromatography or HPLC

identifies the amount and type of Hb present. The Hb pattern in â-thalassemia varies

according to â-thalassemia type. In beta0 thalassemia, homozygotes HbA is absent and

HbF constitutes the 92-95% of the total Hb. In beta+ thalassemia homozygotes and

beta+/beta0 genetic compounds HbA levels are between 10 and 30% and HbF between 70-

90%. HbA2 is variable in beta thalassemia homozygotes and it is enhanced in beta

thalassemia minor. Hb electrophoresis and HPLC also detect other hemoglobinopathies (S,

C, E, OArab, Lepore) that may interact with â-thalassemia (Clarke and Higgins, 2000 and

Cao and Galanello, 2010).

2.3.6.4 Molecular genetic analysis

The prevalence of a limited number of mutations in each population has greatly

facilitated molecular genetic testing. Commonly occurring mutations of the beta globin

gene are detected by PCR-based procedures. The most commonly used methods are

reverse dot blot analysis or primer-specific amplification, with a set of probes or

primers complementary to the most common mutations in the population from which

the affected individual originated. If targeted mutation analysis fails to detect the

mutation, beta globin gene sequence analysis can be used to detect mutations in the beta

globin gene (Old et al., 2005 and Galanello and Origa, 2010).

2.3.7 Management of -thalassemia

2.3.7.1 Prevention strategies

Prevention of -thalassemia is based on public awareness of the disease,

detection of carriers, genetic counselling, and prenatal testing (Peters et al., 2012).

2.3.7.2 Blood transfusion

Persons with -thalassemia major require periodic and life long blood

transfusions every 2-3 weeks to maintain a hemoglobin level higher than 9.5 gm/dl and

sustain normal growth. The need for blood transfusions may begin as early as six

months of age.

18

2.3.7.3 Chelation therapy

Experts recommend that iron overload be treated when serum ferritin levels

exceed 1000 ìg/L, which will occur after 10 to 20 red cell transfusions (Peters et al.,

2012). Chelation therapy is usually started between five and eight years of age.

Deferoxamine (Desferal), subcutaneously or intravenously, has been the treatment of

choice. Recommended dosage depends on the individuals age and the serum ferritin

concentration (Porter, 2001 and Borgna-Pignatti et al., 2004). Although this therapy

is relatively nontoxic, it is cumbersome and expensive. The U.S. Food and Drug

Administration recently approved oral deferasirox (Exjade) as an alternative treatment.

Adverse effects of deferasirox were transient and gastrointestinal in nature, and no cases

of agranulocytosis were reported.

2.3.7.4 Bone marrow transplant

Bone marrow transplantation in childhood is the only curative therapy for -

thalassemia major. Hematopoietic stem cell transplantation generally results in an excellent

outcome in low-risk persons, defined as those with no hepatomegaly, no portal fibrosis on

liver biopsy, and regular chelation therapy, or at most, two of these abnormalities (Rund

DQG�5DFKPLOHZLW]������� Muncie and Campbell, 2009 and Cao and Galanello, 2010).

2.3.7.5 Splenectomy

Can be considered if hypersplenism causes a marked increase in transfusion

requirements. In general, it should be delayed for as long as possible, in order to prevent

ife threatening infections, pulmonary hypertension and thrombo-embolic complications

(Peters et al., 2012). At present, therapies under investigation are the induction of fetal

hemoglobin, antioxidants and stem cell gene therapy (Arumugam and Malik, 2010).

2.4 Related studies

El-Hazmi et al. (1994) determined the level of testosterone, cortisol, luteinizing hormone

(LH), follicle stimulating hormone (FSH), free thyroxine (T4), tri-iodothyronine (T3),

growth hormone (GH), iron, ferritin, and hematological parameters in 44 -thalassemia

patients (21=-thal. major, 23 -thal minor), 25 Hb S/ zero-thalassemia patients, and 50

normal controls with age range 2-15 years. In comparison with controls the -thalassemia-

19

major and the Hb S/ zero-thalassemia patients had a significantly higher level of plasma

ferritin (PA) (25%), IVS2-1 (G>A) (15%), IVS2-745 (C>G)

(14.2%), IVS1-1 (G>A) (10%), IVS1-6 (T>C) (8.3%), codon 37 (G>A) (6.3%), codon 39

(C>T) (4.6%), and codon 5 (-C) (3.8%). The remaining eleven mutations were rare and

including two novel mutations and four others detected in Jordan for the first time. The

novel mutations were the frame shift (-C) at codon 49 and the substitution (A>C) at

position -��� LQ� WKH� 7$7$� ER[�� )RXU� DOOHOHV� ������� UHPDLQHG� XQLGHQWLILHG�� KDYLQJ� QR�

abnormalities in their beta-globin gene sequences and therefore, constituted additional

defects causing -thalassemia in the Jordanian population.

Laksmitawati et al. (2003) demonstrated significant increase in serum iron ferritin,

AST, ALT, and bilirubin. Results can be summarized that non-transfused thalassemia

intermedia patients exert slight signs of oxidative stress, and increased hemoglobin

degradation but no significant indication of tissue or cell damage. This picture differs

considerably from transfusion-dependent thalassemia major patients: highly significant

decrease in antioxidants and thiols and tremendous iron overload and cell damage. The

picture is even worsened in long-term transfused patients. Iron chelation after

transfusion is not sufficient in Indonesia, because it is normally (with few exceptions)

applied only once together with transfusion. Hence, one major reason of the bad

condition of transfusion-dependent thalassemia patients in Indonesia appears to be

frequent transfusions (on the average one per month) and insufficient chelation of one

treatment per month together with transfusion.

20

Napoli et al. (2006) found increased serum ferritin, AST and ALT as well as low bone

density in 90 thalassemic major Italian patients. They concluded that calcium

metabolism is frequently impaired in thalassemic patients. In addition, Al-Samarrai et

al. (2008) studied 105 thalassemic major blood transfusion dependent children. He

found that the mean serum calcium level was lower in thalassemic patients than

controls. In contrast serum phosphorus level was higher in thalassemic patients.

Glycometabolic function, lipid profile and liver function in patients with â

thalassemia major and their relationship with serum iron and ferritin was evaluated

(Shams et al., 2010). Fasting serum glucose, triglyceride, AST, ALT and insulin

resistance index were significantly higher in the homozygous thalassemic major patients

than in the controls. Serum cholesterol was significantly lower in patients. In addition,

Hamed and ElMelegy. (2010) reported significant decrease in serum calcium and

significant increase in uric acid in 69 thalassemic major patients compared to controls.

Waseem et al. (2011) designed a study to obtain a comprehensive picture of the iron

overload, antioxidant status and cell damage in 48 â-thalassemia major patients

undergoing regular blood transfusion. The levels of vitamin E, antioxidant enzymes

GPX and SOD were significantly lowered in â-thalassemic patients as compared with

the control group. Serum total and direct bilirubin, AST and ALT were significantly

elevated in thalassemic subjects as compared with the control group, indicating liver

cell damage. In the same context, Attia et al. (2011) studied the effects of antioxidant

vitamins on antioxidant status and liver function in homozygous â-thalassemic patients.

The results of enzymes showed that thalassemic major children suffer from high levels

of ALT, AST, glutathione peroxidase, and superoxide dismutase enzymes activities

before vitamins treatment. The activities of ALT, AST, GPx, and SOD decreased

significantly, also the activities of catalase and glutathione reductase significantly

increased in â-thalassemic patients after treatment compared with their activities before

treatment.

21

Arýca et al. (2012) examined the blood lipid profile in 85 children with beta-

thalassemia major on regular chelation therapy, and determined the factors that affect it.

Blood of 55 healthy children were taken for use as the control group. Hemoglobin and

hematocrit values of the group with -thalassemia major were significantly lower than

the control group. Ferritin values in the group with -thalassemia major were found to

be significantly higher than in the control group. Cholesterol, HDL-cholesterol, LDL-

cholesterol levels were found to be significantly lower in patients with -thalassemia

major than in the control group, while the triglyceride level was found to be higher.

22

Chapter 3

Materials and Methods

3.1 Study design This work was performed according to the cross-sectional descriptive study design.

3.2 Target population 3.2.1 Inclusion criteria

All â-thalassemic unrelated children aged 5-12 years old at public hospitals in

Gaza city who are currently being transfused and managed for the clinical symptoms

and manifestations of the disease were considered as a target for the present study. Only

one child was included for each couple.

3.2.2 Exclusion criteria

All other â-thalassemic related children were excluded from the study. Children

less than 5 or older than 12 years were also excluded. Any unconfirmed blood

transfusion dependent children were also excluded.

3.3 Sample size Sample size was 53 transfusion dependent â-thalassemic children (27 boys and

26 girls) and 53 apparently healthy children (27 males and 26 females) served as a

control group. The cases and controls were age and sex matched.

3.4 Ethical consideration An official approval was obtained from Helsinki committee at the Palestinian

ministry of health (Annex 1). Another official letter of request was obtained from the

Palestinian Thalassemia Center who approved performing the study on the thalassemic

children (Annex 2). The researcher has explained the purpose and objectives of the

study to the parent (s) or guardian (s) of all the participants. The inclusion in the study

was optional and confidential. After the free acceptance to be enrolled in the study, one

of parent (the father or the mother) was asked to sign the consent form of the study.

23

3.5 Data collection The data of the study was collected via questionnaire and also from laboratory

investigation of blood sampled for the type of causative mutation, biochemical and

hematological parameters of the of -thalassemic children.

3.5.1 Questionnaire

Part of data was collected by using close-ended questionnaire which was

constructed and conducted in Arabic language. The questionnaire was designed to

include 3 major components with 18 items

1- Socio-demographic and general characteristics of the subjects

2- Health characteristics of the subjects.

3- Health complains of the subjects.

The questionnaire was distributed to the parent who accompanying the

thalassemic child on the day of blood transfusion at the public hospitals. The researcher

explained the purpose and objectives of the study and declared and committed to the

participant about the confidentiality of the study. After the free acceptance, one parent

was asked to fill the questionnaire.

3.5.2 Venous blood withdrawal

Five ml of venous blood were collected from each subject (cases and controls) involved

in the present study samples, and the collected blood was divided almost equally (2.5

ml) into 12x56mm K3-EDTA polypropylene tubes (Meus, Piove Di Sacco, Italy) and in

serum tubes (2.5 ml). Blood withdrawals of the patients were performed just before the

scheduled blood transfusion of the â-thalassemic children. The blood in the K3-EDITA

tubes was used to perform a Complete blood counts (CBC) [white blood cell (WBC),

red blood cell (RBC), haemoglobin (Hb), haematocrit (Hct), mean corpuscular volume

(MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin

concentration (MCHC), red cell distribution width (RDW), and platelets (PLT)] using a

Cell Dyne 1700 electronic counter (Sequoia-Turner corporation, California, USA).

About 400 of The K3-EDTA blood was used for spotting, DNA extraction and

purification in order to carry out molecular diagnosis to identify the causative mutation

using PCR based techniques. Also the K3-EDTA blood was used for quantifying the

level of HbF in all thalassemic children of the study. Blood film was performed in

24

triplicates from fresh blood of the thalassemic children. While, the blood in the serum

tube was centrifuged to separate the serum which preserved in new plastic screw tip

tubes and used to determine the following biochemical parameters according to the

available commercial kits:

Liver function enzymes:

Aspartate aminotransferase (AST) and alanine aminotransferase (ALT), serum bilirubin.

Kidney function tests:

Urea, creatinine, uric acid.

Blood chemistry

Total protein, albumin, globulins, serum ferritin, serum calcium, serum phosphorus.

3.5.3 Spotting and Transfer of Dried Blood Samples (DBS)

Almost 400 l of whole venous blood collected in K3-EDTA tubes were

spotted equally into 4 circles of Ahlstrom 226 grade (Figure 3.1) newborn screening

filter paper (ID Biological Systems, Greenville, SC, USA). After an overnight drying at

room temperature, the filter papers with the spotted blood were placed between sheets

of glassine weighing paper (Schleicher and Schuell, Germany ) so that the DBS cards

are not touching each other, and packaged with few desiccant packages to absorb any

humidly. Then the DBS were sent to Bernhard Nocht Institute (BNI), Germany, where

DNA extraction, purification and mutation analysis were performed.

��

Figure 3.1. Newborn screening filter paper (ID Biological Systems, Greenville, SC, USA).

DNA extraction and purification

DNA was extracted and purified from two dried blood spots (~200 L) using

BL and BLM lysis buffers (Agowa, GmbH, Berlin, Germany) by a magnetic bead-based

DNA extraction and purification technique (Rudi et al., 1997, Deggerdal and Larsen,

1997). The beads-based kit depends on superparamagnetic particles for isolating DNA

from whole blood.

3.5.4 HBB mutations screening

The screening for the possible mutations in HBB gene was performed at the

molecular medicine laboratories of the Bernhard Nocht Institute (BNI), Germany,

according to Dynamic Allele-Specific Hybridization (DASH) method aiming at

identification of the most common single nucleotide polymorphisms (SNP) in HBB

reported in the literature for the Arabic and/or Mediterranean populations: IVS-I-1 (G -

26

-> A), IVS-I-6 (T --> C), IVS-I-110 (G --> A), codon 37 (G --> A), and codon 39 (C -->

T) (5XQG�HW�DO���������)LORQ��HW�DO���������.\ULDFRX�HW�DO��������DQG Zahed, 2001).

Three PCR based hybridization assays based on DASH technique (+RZHOO�HW�DO���������

Jobs et al., 2003). Were established to type for these 5 mutations . Specific annealing

temperatures of the hybridization of probes for wild types and for each of the mutations

were identified (Table 3.1) This enabled the identification of homozygous,

heterozygous and compound heterozygous genotypes of the 5 mutations.

Table 3.1. Characteristics of hybridization assays used for genotyping

PCR Screened

mutation Amplicon Primers 5- 3

Probes 5- 3

Mutation position underlined

Annealing

temperature

Assay 1

IVS-I-1

IVS-I-6

wildtype

186 bp

Forw

TGAGGAGAAGTCTGCCGTTA

Rev

CCAATAGGCAGAGAGAGTCA

Anchor

Cy5-

ACAAGACAGGTTTAAGGAGACCAATAGAAACTGG-

Phosphate

Sensor for IVS-I-1 G>A and IVS-I-6 T>C

GCAGGTTGGCATCAAGGT-Fluorescein

58 oC

Assay 2

CD37

CD39

wildtype

208 bp

Forw

AAGGTTACAAGACAGGTTTAAG

Rev

TTAGGGTTGCCCATAACAGC

Anchor

Cy5-CTTTGAGTCCTTTGGGGATCTGTCCAC-

Phosphate

Sensor for CD37 G>A and CD39 C>T

CCCTTGAACCCAGAGGT-Fluorescein

55 oC

Assay 3 IVS-I-110

wildtype 208 bp

Forw

AAGGTTACAAGACAGGTTTAAG

Rev

TTAGGGTTGCCCATAACAGC

Anchor

Cy5-TCCCACCCTTAGGCTGCTGGT-Phosphate

Sensor for IVS-I-110 A>G

CTCTCTCTGCCTATTAGTCTATT-Fluorescein

58 oC

27

3.6 Biochemical analysis

3.6.1 Determination of serum urea

Principle

Serum urea was determined by using "Urease-GLDH": enzymatic UV test, according to

Thomas method (Thomas, 1998) using DiaSys reagent kits.

Urea + 2H2O→2NH4 + 2HCO

2-Oxoglutarate + NH4 + NADH→ L-Glutamate + NAD+ + H2O Reagents

Concentrations are those in the final test mixture.

Concentration Reagent

120 mmol/l

7 mmol/l

0.6 mmol/l

≥ 0.6 ku/l

≥ 1 ku/l

R1: TRIS

2- Oxoglutarate

ADP

Urease

GLDH

0.25 mmol/l R2: NADH

50 mg/dl Standard

Assay procedure

The working solution was prepared by mixing 4 parts of R1 with 1 part of R2.

Wavelength: 340 nm

Optical path: 1cm

Temperature: 37 ºC

Measurement: against distilled water.

Ten µl of standard (sample or control) was added to 1 ml of working reagent and

mixed well.

The mixture was incubated for 30 sec then absorbance (A1) was recorded.

After exactly further 60 sec the absorbance (A2) was measured.

Urease

GLDH

28

Calculation

∆A = (A1 A2) sample or standard

Urea (mg/dl) =

Reference value (Palestinian Clinical Laboratory Tests Guide, 2005)

Child 5 - 30 mg/dl

Adult 13 - 43 mg/dl

3.6.2 Determination of serum creatinine

Serum creatinine was determined by using kinetic test without deproteinization

according to Newman and Price method (Newman and Price, 1999) using DiaSys

reagent kits.

Principle

Creatinine forms a colored orange-red complex in an alkaline picrate solution. The

difference in absorbance at fixed times during conversion is proportional to the

concentration of creatinine in the sample.

Creatinine + Picric acid → creatinine picrate complex

Reagents

Concentrations are those in the final test mixture.

Concentration Reagent

0.16 mol/l R1: Sodium hydroxide (pH approx. 13)

4.0 mmol/l R2: Picric acid (pH approx. 1.2)

2.0 mg/dl Standard

Assay procedure

The working solution was prepared by mixing 4 parts of R1 with 1 part of R2.

Wavelength: 490 nm

Optical path: 1cm

Temperature: 37 ºC

Measurement: against distilled water.

∆A sample X concentration of standard∆A standard

29

Uricase

POD

Fifty µl of standard (sample or control) was added to 1 ml of working reagent add

and mixed well.

The Mixture was incubated for 60 sec then absorbance (A1) was recorded.

After exactly further 120 sec the absorbance (A2) was measured.

Calculation

∆A = (A1 A2) sample or standard

Creatinine (mg/dl) =

Reference value (in serum) (Palestinian Clinical Laboratory Tests Guide, 2005)

Child 0.3 - 0.7 mg/dl Adult: Male

Female 0.6 - 1.2 mg/dl 0.5 -1.1 mg/dl

3.6.3 Determination of serum uric acid

Serum uric acid was determined by enzymatic photometric test with TBHBA (2,4,6-

tribromo-3-hydroxybenzoic acid) (Fossati et al., 1980) using DiaSys reagent kits.

Principle

Uric acid is oxidized to allantoin by uricase. The generated hydrogen peroxide reacts

with 4-aminoantipyrine and 2,4,6-tribromo-3-hydroxybenzoic acid (TBHBA) to

quinonemine.

Uric acid + H2O + O2 Allantoin + CO2 + H2O2

TBHBA + 4-aminoantipyrine + 2H2O2 Quinoneimine + 3 H2O

Reagents

Reagent Components Concentrations

Reagent 1 Phosphate buffer pH 7.0

TBHBA

100 mmol/l

1 mmol/l

Reagent 2

Phosphate buffer pH 7.0

4-Aminoantipyrine

K4[Fe(CN)6]

Peroxidase (POD)

Uricase

100 mmol/l

0.3 mmol/l

10 ìmol/l

≥ 2 kU/L

≥ 30 U/L

Reagent 3 Standard 6.0 mg/dl

∆A sample X concentration of standard∆A standard

30

Substrate start

The reagents are ready to use.

Sample start

Four parts of R1 with 1 part of R2 was mixed (e.g. 20 ml R1 + 5 ml R2) = mono

reagent. This reagent is stable for 3 months if stored at +2 to +8 0C and for 2 weeks if

stored at +15 to +25 0C. Protect the mono reagent from light.

Assay Procedure

Substrate start

Reagent Blank Sample or Standard

Sample or Standard - 20ì

Dist. Water 20ì -

Reagent 1 1000ì 1000ì

Mix, incubate 5 min., then add:

Reagent 2 250ì 250ì

Mix, incubate 30min. at 20-25 oC or 10 min. at 37 oC. The absorbance was read

against the reagent blank within 60 minat wavelength 520 nm.

Sample start

Reagent Blank Sample or Standard

Sample or Standard - 20ì

Dist. Water 20ì -

Monoreagent 1000ì 1000ì

Mix, incubate 30min. at 20 25 oC or 10 min. at 37 oC. the absorbance was read against the reagent blank within 60 min at wavelength 520 nm.

Calculation:

With standard or calibrator

Uric acid [mg/dl] = ∆A Sample

x Conc. of Std/Cal [mg/dl] ∆A Std/Cal

Reference value (In serum) (Palestinian Clinical Laboratory Tests Guide, 2005)

Child 2 5.5 mg/dl.

Adult M 3.5 7.2 mg/dl.

F 2.5 7 mg/dl.

31

3.6.4 Determination of Serum Aspartate Aminotransferase (AST) Enzyme

Activity

Serum aspartate aminotransferase activity was measured by using optimized UV

test according to international federation of clinical chemistry and laboratory medicine

(Thomas, 1998), using Diasys reagent Kits.

Principle

The principle of the method is based on the following enzymatic reactions:

L-Aspartate + 2-Oxoglutarate AST L-Glutammate + Oxalacetate

Oxalacetate + NADH + H+ MDH L-Malate + NAD+

Decrease in absorbance value at 340 nm, due to the oxidation of NADH to NAD+, is

directly proportional to the AST activity in the sample.

Composition of reagents.

Reagent Concentration

Reagent A:

TRIS

EDTA-Na2

L-Aspartate

MDH

Sodium azide

Reagent B:

2-Oxoglutarato

NADH

Sodium azide

28 mmol/l

5.68 mmol/l

284 mmol/l

≥ 800 U/l

2 g /l

68 mmol/l

1.12 mmol/l

0.095 g/l

preparation of reagents

Bireagent procedure. The reagents are liquids ready to use.

Monoreagent procedure. Ten parts of Reagent A and one part of Reagent B to obtain

the working reagent (ex. 20 ml of RA + 2 ml of RB).

Analytical procedure

About 0.5 ml of serum was transferred to the Mindray BS-300 chemistry auto analyzer

to perform the test according to these parameters:

32

Parameter Value

Reagent (ìI) 200

Serum (ìI) 20

Incubation period (s) 15 cycle(3.5minutes)

Reaction type Kinetic

Wavelength (nm) 340

Reaction Descending

Reference value

Male 0-37 U/l

Female 0-31 U/l

3.6.5 Determination of Serum Alanine Aminotransferase (ALT) Enzyme

Activity

Serum alanine aminotransferase activity was measured by using optimized UV test

according to International Federation of Clinical Chemistry and Laboratory Medicine

(IFCC) [modified] using Diasys reagent Kits.

Principle

L-Alanine + 2-Oxoglutarate ALAT L-Glutamate + Pyruvate

Pyruvate + NADH + H+ LDH D-Lactate + NAD+

Addition of pyridoxal-5-phosphate (P-5-P) stabilizes the activity of transaminases and

avoids falsely low values in samples containing insufficient endogenous P-5-P, e.g.

from patients with myocardial infarction, liver disease and intensive care patients.

33

Reagents

Components and Concentrations

R1: TRIS pH 7.15 140 mmol/L

L-Alanine 700 mmol/L

LDH (lactate dehydrogenase) ³ 2300 U/L

R2: 2-Oxoglutarate 85 mmol/L

NADH 1 mmol/L

Pyridoxal-5-Phosphate FS

Goods buffer pH 9.6 100 mmol/L

Pyridoxal-5-phosphate 13 mmol/L

Reagent Preparation

Sample Start

without pyridoxal-5-phosphate

Mix 4 parts of R1 + 1 part of R2

(e.g. 20 mL R1 + 5 mL R2) = mono-reagent

Stability: 4 weeks at 2 - 8° C

5 days at 15 - 25° C

The mono-reagent must be protected from light!

Assay Procedure

Wavelength 340 nm, Hg 365 nm, Hg 334 nm

Optical path 1 cm

Temperature 37 °C

Measurement Against air

Sample Start Do not use sample start with pyridoxal-5-phosphate! Sample or calibrator 100 µl Mono-reagent 1000 µl Mix, read absorbance after 1 min. and start stopwatch. Read absorbance again 1, 2 and 3 min thereafter.

34

Calculation

With factor

From absorbance readings calculate DA/min and multiply

by the corresponding factor from table below:

DA/min x factor = ALAT activity [U/L]

Substrate Start Sample Start

340 nm 2143 1745

334 nm 2184 1780

365 nm 3971 3235

With calibrator

ALAT [U/L] = (Ä A/min Sample ) X Conc. Calibrator [U/L]

(Ä A/min Calibrator )

Reference Range

Women < 31 U/L Men < 41 U/L

Children < 25 U/L

3.6.6 Determination of bilirubin

Determination of direct and total bilirubin with the Jendrassik-Gróf method on

photometric systems using Diasys reagent Kits.

Principle

Bilirubin reacts with diazotized sulfanilic acid to form an azo dye which is red in

neutral and blue in alkaline solutions. Where as the water-soluble bilirubin glucuronides

react directly, the free indirect bilirubin reacts only in the presence of an

accelerator. The total bilirubin in serum or plasma is determined using the method of

Jendrassik and Grof by coupling with diazotized sulfanilic acid after the addition of

caffeine, sodium benzoate and sodium acetate. A blue azobilirubin is formed in alkaline

Fehlings solution II. This blue compound can also be determined selectively in the

presence of yellow by-products (green mixed coloration) by photometry at 578 nm.

35

Direct bilirubin is measured as the red azo dye at 546 nm using the method of Schellong

and Wende without the addition of alkali. Indirect bilirubin is calculated from the

difference between the total and direct bilirubin.

Reagents

Concentrations of the Reagents

R1: Sulfanilic acid 29 mmol/L

HCl 170 mmol/L

R2: Sodium nitrite 29 mmol/L

R3: Caffeine 130 mmol/L

Sodium benzoate 156 mmol/L

Sodium acetate 460 mmol/L

R4: Fehlings solution II:

Potassium sodium tartrate 930 mmol/L

Sodium hydroxide 1.9 mol/L

Assay Procedure

Optical path 1 cm

Temperature 15 25 °C

Measurement Against sample blank

Determination of total bilirubin

(Refer to note 1)

Wavelength: Hg 578 nm

Sample Sample

Blank

-

Reagent 2 - 50 µl

Reagent 1 200 µl 200 µl

Reagent 3 1000 µl 1000 µl

Sample 200 µl 200 µl

Mix and allow to stand for 10 to 60 min. at 15 to 25 °C,

then add:

36

Reagent 4 1000 µl 1000 µl

Mix well and after 5 to 30 min. measure the absorbance

of the sample against the sample blank.

Calculation

Concentration total bilirubin: [mg/dL] = A x 10.5

Determination of direct bilirubin Wavelength: Hg 546 nm

Sample Sample

blank

Reagent 2 - 50 µl

Reagent 1 200 µl 200 µl

NaCl solution 2000 µl 2000 µl

Sample 200 µl 200 µl

Mix immediately and allow standing at 15 to 25 °C.

Exactly 5 min. after the addition of serum measure the

absorbance against the sample blank.

Calculation

Concentration of direct bilirubin: [mg/dL] = A x 14.0

Reference Range

Bilirubin total

Adults 0.1 1.2 mg /dL

Children >1 month 0.2 1.0 mg /dL

Direct Bilirubin 0.2 mg /dL

3.6.7 Determination of total protein Serum total protein was determined by photometric test according toThomas method

(Thomas, 1998) using DiaSys reagent kits.

37

Principle Protein together with copper ions form aviolet blue color complex in alkaline solution.

The absorbance of color is directly proportional to concentration.

Reagents

Components Concentrations

Reagent 1: Sodium hydroxide Potassium sodiumtartrate

80 mmol/L 12.8mmol/L

Reagent 2: Sodium hydroxide Potassiumsodium

tartrate Potassiumiodide

Copper sulfate

100 mmol/L 16mmol/L 15mmol/L 6mmol/L

Standard 5g/dl

Mono reagent preparation

Four parts of R1were mixed with1 part of R2 (e.g. 20ml R1+5mlR2) = one reagent.

Procedure

Blank Sample Monoreagent 1000 ìl 1000 ìl

Sample - 20 ìl

Dist.water 20 ìl -

Mix, incubate for 5 min at 25°C and read absorbance against ther eagent blank within

60 min at 540 nm.

Calculation The protein concentration in the sample is calculated using the following general

formula:

38

Total protein[g/dL]= (Ä Asample) XConc.St[g/dl]

(ÄAstandard )

Reference Range

5.6 8 g/dl

3.6.8 Determination of albumin

Serum albumin was determined by photometric test according to the method

described by Johnson and his colleagues (Johnson et al., 1999) using DiaSys reagent

kits.

Principle

Serum albumin in the presence of bromecresol green at a slightly acid pH produces a

color change of the indicator iron yellow-green to green blue.

Reagents

Components Concentrations

Reagent

Citrate buffer pH 4.2

Bromocresol green

30mmol/L

0.26mmol/L

Standard 5g/dl

Assay procedure

Blank Sample

Reagent 1000 ìl 1000 ìl

Sample - 10 ìl

Dist.water 10 ìl -

Mix, incubate for approx. 10min. The absorbance was read against reagent blank

within 60 min at 540600 nm.

Calculation Serum albumin concentration in the sample is calculated using the following general

formula:

39

Albumin[g/dL] = (ÄAsample) XConc.Std[g/dl]

(Ä AStandard )

Reference Range

4 days 14 years 3.8 5.4 g/dl

3.6.9 Determination of globulin

Globulin was calculated according the following formula: Globulin= Total

protein Albumin.

3.6.10 Determination of serum Calcium (Tca)

Tca is determined by ion Selective Electrode (ISE) method (Eisenmann, 1967)

On Nova 10 Electrolytes analyzer, USA.

Principle

An ISE is composed of an electrochemical half cell and ion specific glass

membrane for every ion used. When an ion specific membrane separates two solutions

that differ in the concentration of that ion, a potential is developed across the membrane

and the size of potential depends on the difference in the ion concentration . The activity

of any ion can be determined potentiometrically if an electrode can be developed this

respond selectively to the ion interest Na ion and insensitive to other k sensitive glass is

sensitive for k ion and Tca sensitive glass is sensitive for Tca ions (Kaplan, 1995).

Reagent

Reagent component concentration

Cal A

Na 140 mmol/L

K 4.0mmol/L

Cl 114mmol/L

TCa 2.0mmolL

Li 0.5mmol/l

Cal B

Na 60 mmol/L

K 10.0mmol/L

Cl 46mmol/L

TCa 4.0mmolL

Li 5.0mmol/l

Reference Ca ++ Releasing Agent

40

Procedure

1. To be able to perform the tests, the instrument calibrates itself automatically by 1, and 2

point calibrations using Cal A , and Cal B every 2 hours.

2. Pull the sampler up to the stat position .

3. Press the sample type key , select the appropriate type , press then number and then

press exit

4. Press Analyze .

5. Wait until the probe is fully extended and hold the sample cup to the probe.

6. Press analyze again . Be sure to keep the probe immersed in the sample white it is

aspirating.

7. Wait until the printed result appears after about 45 second.

Reference Range

3 12 years 8.8 10.8 mg/dl

3.6.11 Determination of phosphorus

Serum phosphorus was determined by phosphomolybdate UV end point (Tiez, 1994)

using Amonium Molybdate Diagnostic kit.

Principle:

Determination of inorganic phosphate was made according to the following reaction:

Amonium molybdate + Sulfuric acid Phosphomolybdic complex

Reagents:

Reagent Components Concentrations

Reagent Sulfuric acid

Amonium molybdate

210 mmol/L

650 umol/L

Standard Phosphorus 5 mg/dl

Preparation and stability of working reagent:

The reagent is ready for use.

Phosphorus

41

Procedure:

Wavelength 340 nm

Temperature 37°C

Cuvette 1 cm light path

Reading against reagent blank was done

Reference Range

4-15 years 2.9 5.4 mg/dl

3.7 Hematological analysis

3.7.1 Complete blood count (CBC)

A complete system of reagents of control and calibrator, Cell-Dyn 1700 was

used to determine complete blood count (CBC) of children in Central blood laboratory-

Thalassemia Center in Gaza (Abbott laboratories, USA).

3.7.2 Determination of serum ferritin

In the present study serum ferritin was determined using a Microparticle

Enzyme Immunoassay (MEIA) technology. For this purpose we used Abbott full

automated Axsym immunoassay analyzer ferritin assay system (Abbott laboratories,

USA). was used.

3.7.3 Fetal haemoglobin (HbF) quantitation

HbF is usually quantitated based on its resistance to denaturation at alkaline pH

(Singer et al., 1951). In 1959 Betke et al., modified the original method of Singer et al.

(1951) so that it can accurately measures HbF when present in relatively small amounts

(Betke et al., 1959). However, Pembrey et al. (1972) slightly modified the Betke et

al.(1959) method so that it gives highly reproducible results over the range of HbF 0.5-

50% (Pembrey et al., ������:HDWKHUDOO�and Clegg, 1981). In the present study we

followed the modified Betke et al.,(1959) method.

42

Principle of the method:

Most human haemoglobins denature when exposed to a strong alkaline solution.

Denaturation is stopped by the addition of ammonium sulphate, which precipitates the

denatured haemoglobins. However, foetal haemoglobin is not denatured and remains

soluble, which can be filtered and measured spectrophotometery.

Rea