ww.sciencedirect.com
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5
Available online at w
ScienceDirect
journal homepage: www.JournalofSurgicalResearch.com
Association for Academic Surgery
The glypican 3 hepatocellular carcinoma markerregulates human hepatic stellate cells viaHedgehog signaling
Paolo Magistri, MD,a,b Stephanie Y. Leonard, BS,a Chih-Min Tang, PhD,a
Jonathan C. Chan, BS,a Tracy E. Lee,a and Jason K. Sicklick, MDa,*aDivision of Surgical Oncology, Department of Surgery, Moores UCSD Cancer Center, University of California,
San Diego, Californiab Faculty of Medicine and Psychology, Azienda Ospedaliera Sant’Andrea, SapienzaeUniversita di Roma, Rome, Italy
a r t i c l e i n f o
Article history:
Received 27 June 2013
Received in revised form
9 December 2013
Accepted 13 December 2013
Available online 17 December 2013
Keywords:
Epithelial-mesenchymal
interactions
GPC3
Hepatoma
HCC
Hedgehog-interacting protein
HSC
Tumorestroma interactions
This article was presented at the seventh* Corresponding author. Division of Surgical
Sciences Drive, MC 0987 La Jolla, CA 92093-0E-mail address: [email protected] (J.K. S
0022-4804/$ e see front matter ª 2014 Elsevhttp://dx.doi.org/10.1016/j.jss.2013.12.010
a b s t r a c t
Background: Hepatocellular carcinoma (HCC) frequently represents two diseases as it often
arises in the setting of cirrhosis caused by the proliferation and activation of hepatic
stellate cells (HSCs). Previously, we identified that Hedgehog (Hh) signaling regulates HSC
viability and fibrinogenesis, as well as HCC tumorigenesis. Although it is increasingly
recognized that HSCs and HCCs communicate via paracrine signaling, Hh’s role in this
process is just emerging. We hypothesized that a secreted HCC tumor marker and Hh
mediator, glypican 3 (GPC3), may regulate HSC.
Methods: Using three human HCC lines (Hep3B, PLC/PRF/5 and SK-Hep-1) and one Hh-
responsive human HSC line (LX-2), we developed two in vitro models of HCC-to-HSC
paracrine signaling using a Transwell coculture system and HCC-conditioned media. We
then evaluated the effects of these models, as well as GPC3, on HSC viability and gene
expression.
Results: Using our coculture and conditioned media models, we demonstrate that the three
HCC lines decrease HSC viability. Furthermore, we demonstrate that recombinant GPC3
dose-dependently decreases the LX-2 viability while inhibiting the expression of Hh target
genes that regulate HSC viability. Finally, GPC3’s inhibitory effects on cell viability and Hh
target gene expression are partially abrogated by heparin, a competitor for GPC3 binding.
Conclusions: For the first time, we show that GPC3, an HCC biomarker and Hh mediator,
regulates human HSC viability by regulating Hh signaling. This expands on existing data
suggesting a role for tumorestroma interactions in the liver and suggests that GPC3 plays a
role in this process.
ª 2014 Elsevier Inc. All rights reserved.
Annual Academic Surgical Congress, February 14e16, 2012, Las Vegas, Nevada.Oncology, Moores UCSD Cancer Center, University of California, San Diego, 3855 Health987. Tel.: þ1 858 822 6173; fax: þ1 858 228 5153.icklick).ier Inc. All rights reserved.
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5378
1. Introduction in decreased HSC viability. Similarly, exogenous GPC3 treat-
Hepatocellular carcinoma (HCC) is one of the most common
cancers worldwide and the third leading cause of cancer-
related death [1]. Furthermore, patients with cirrhosis have
an approximately 20% risk of developing HCC over 5 y. In the
United States, HCC and cirrhosis often occur secondary to
hepatitis C virus [2]. Because of the latency of hepatitis C virus
and its increasing spread over the last 40 y, the incidences of
HCC and cirrhosis are expected to rise [3]. Alcoholic liver dis-
ease and nonealcoholic fatty liver disease serve as additional
risk factors for both diseases [4,5]. In addition, we know that
epithelialemesenchymal interactions are important in ma-
lignancies [6]. Emerging data in pancreatic adenocarcinomas
suggest that tumor cells send signals to the stroma to provide
a more favorable environment for tumor growth and pro-
gression [7]. As a result, these paracrine interactions may
serve as targets for treating cancers. During the evolution of
liver fibrosis and cirrhosis, hepatic stellate cells (HSCs) are the
major profibrogenic cells in the liver. Emerging data suggest
that tumorestroma, or HCCeHSC, paracrine interactions
occur in the liver [8e12]. Thus, the interplay between HCCs
and peritumoral HSCs deserves further investigation.
There is a growing body of knowledge demonstrating the
role of Hedgehog (Hh) signaling within liver cell populations
including HSC, progenitors, and endothelial cells [13e16]. We
first described evidence of Hh pathway activity in HSCs and
demonstrated that this pathway plays an important role in
maintaining their viability and activation [13,17]. It was later
shown that these stromal cells have Hh-mediated paracrine
interactions with hepatic epithelial cells [18]. We, and others,
have also defined a role for Hh signaling in the genesis of HCC
and shown that dysregulation of Hh signaling lies at several
checkpoints within the pathway [19,20].
Glypican 3 (GPC3), an Hhmediator [21], is expressed at high
levels in up to 72% of human HCCs [22] and in Hh-responsive
HCC lines (Hep3B, Huh7, and PLC/PRF/5) [23]. GPC3 is one of
six proteoglycans (PGs) that acts as an Hh pathway inhibitor
during embryogenesis [24]. GPC3 binds with Hh ligands on the
cell surface. In turn, this binding leads to internalization and
degradation of the GPC3eHh ligand complex [25]. Thus, the
amount of Hh ligand available for activating its receptor,
patched (Ptc), is reduced at the cell surface. This leads to a
reduction in Hh signaling and expression of Hh target genes,
including Ptc. As a result, loss-of-function mutations in GPC3
are the cause of the X-linked Simpson-Golabi-Behmel syn-
drome [26], which is characterized, in part, by hepatomegaly.
Conversely, high expression of GPC3 leads to suppression of
hepatocyte proliferation [27] and liver regeneration [28].
Because GPC3 is not detectable in normal hepatocytes, benign
liver diseases or peritumoral stroma (i.e., HSC) [29], it is used as
a serum tumormarker and prognostic factor for HCC. Patients
withHCCs that express high levels of GPC3 have a significantly
worse 5-y survival rate than patients with HCCs that do not
express GPC3 [30]. Given the previous data, we hypothesized
that this secreted HCC tumor marker, and Hh mediator, may
modulate HCC (tumor)-to-HSC (stroma) interactions.
Herein, we show evidence that coculture of an activated
humanHSC line with three GPC3-expressing HCC lines results
ment of HSCs decreases cell viability in a dose-dependent
fashion. We also show that exogenous GPC3 treatment of
HSCs decreases the messenger RNA (mRNA) expression of Hh
target genes including patched 1 (Ptc1) and Hh-interacting
protein (HHIP). Because GPC3 is classified as a heparan sul-
fate PGs (HSPGs) that display heparin-inhibitable binding, the
effects of GPC3 on HSC viability and gene expression can be
partially abrogated by HSC treatment with unfractionated
heparin. Taken together, this suggests that GPC3 plays an
unreported role in regulating hepatic tumor-to-stroma in-
teractions that is partially mediated by Hh signaling.
2. Materials and methods
2.1. Reagents
Transwell plates were purchased from Corning (Lowell, MA).
Recombinant human GPC3 and HHIP were purchased from
R&D Systems (Minneapolis, MN). Heparin sodium salt derived
from porcine intestinal mucosa was purchased from Sigma-
Aldrich (St. Louis, MO). Antibodies against human GPC3 and
b-actinwere purchased fromAbbiotec (SanDiego, CA) andCell
Signaling (Danvers,MA), respectively.Horseradishperoxidase-
conjugated goat anti-rabbit immunoglobulin Gwas purchased
from Thermo Scientific (Waltham, MA). Cell culture media
were purchased from GIBCO/BRL (Carlsbad, CA). Cell viability
wasmeasuredwith the Cell Counting Kit-8 (DojindoMolecular
Technologies, Rockville,MD)andfindingswereconfirmedwith
an MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium
bromide) assay using Thiazolyl Blue Tetrazolium Bromide
(Sigma-Aldrich). Detergent compatible protein assay was
purchased from Bio-Rad (Hercules, CA). An enhanced chem-
iluminescence system for Western blot detection was pur-
chased from Pierce (Rockford, IL).
2.2. Cell culture
The activated human LX-2 HSC line was kindly provided by Dr
S.L. Friedman (Mount Sinai School of Medicine, New York, NY)
[31] and maintained in 2% serum-supplemented Dulbecco’s
modified Eagle’s medium -to-Ham’s F-12 (1:1, GIBCO/BRL),
10 mM hydroxyethyl piperazineethanesulfonic acid, penicillin
100 IU/mL and streptomycin 100 mg/mL (GIBCO/BRL). This is a
well-validated human HSC line that has been used as a model
systemforstudyingHSCbiology inmore than120peer-reviewed
manuscripts. As opposed to primary HSC isolates, this cell line
unequivocally eliminates other contaminating types of cells,
such as macrophages, endothelial cells, and vascular smooth
muscle cells. Hep3B, SK-Hep1, and PLC/PRF/5 cell lines were
purchased from American Type Culture Collection (Manassas,
VA) and maintained in 10% serum-supplemented Dulbecco’s
modified Eagle’s medium (GIBCO/BRL), 2 mM glutamine, peni-
cillin 100 IU/mL, and streptomycin 100 mg/mL (GIBCO/BRL).
During experimental manipulations as described in the
following, the respective media conditions for HSC and HCC
were adjusted to control for differences in serum conditions
between the sets of lines.
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5 379
2.3. Cell viability and apoptosis assays
Cell viability was measured with the Cell Counting Kit-8
(Dojindo) [13]. Briefly, HSCs were cultured for up to 72 h, and
then incubated with tetrazolium reagent and absorbance was
measured. Experiments were replicated and findings
confirmed with MTT reagent according to manufacturer’s in-
structions (Sigma-Aldrich). Results are presented as the
percent of control. Apoptotic activity was assayed in parallel
cultures using the Apo-ONE Homogenous Caspase 3/7
Apoptosis Assay (Promega, Madison, WI) according to the
manufacturer’s instructions.
2.4. Transwell coculture model
Similar to a previously described model [32], HSC and HCC
lines were cultured in a Transwell insert coculture system for
72 h, using 3-mm pore size polyester inserts (Corning). Briefly,
LX-2 cells were plated at a density of 500,000 cells/well in six-
well plates, and cultured overnight as monocultures. Insert
chambers containing HCC cells (500,000 cells/polyester insert)
were then transferred into the coculture systems and incu-
bated with the LX-2 cells for an additional 72 h. Thus, cocul-
ture experiments were performed with HSC in the bottom
well, and HCC in the top well (1:1 cell ratio), using 2% serum-
supplemented LX-2 media. For analyses of HCC lines, the
well positions and media were reversed.
2.5. Conditioned media model
AfterHCC lineculture for 72h, 2%,or 10%serum-supplemented
conditioned media were collected from culture flasks and
centrifugedat1500 rpmfor10mintopellet cellulardebris.HSCs
were cultured in LX-2 media for 24 h and then treated for 72 h
with HCC-conditioned medium. Results were compared with
cells treated with corresponding control medium (i.e., 2% or
10%serum-supplementedmediumwithoutHCCconditioning).
2.6. Two-step real-time RT-PCR
Two-step real-time RT-PCR (reverse transcription polymerase
chain reaction) was performed to compare the expression of
target genes. Total RNA was extracted from cells using Trizol
Reagent (Invitrogen/Life Technologies, Carlsbad, CA). Reverse
transcription to complementary DNA (cDNA) templates was
performed using iScript cDNA Synthesis kit (Bio-Rad). For
quantitative RT-PCR, human GPC3, HHIP, and b-actin (house-
keeping gene) primers were designed using Genbank se-
quences. Additional oligonucleotide primers were
synthesized by ValueGene (San Diego, CA). The sense (S) and
antisense (AS) primer sequences are as follows: GPC3: (S)
TGAAAGTGGAGACTGCGGTGATGA, (AS) TCCCGAGGTTGT
GAAAGGTGCTTA; Ptc1: (S) CCACCAGACGCTGTTTAGTCA,
(AS) CGATGGAGTCCTTGCCTACAA; HHIP: (S) CCCACACTTCA
ACAGCACCA, (AS) GCACATCTGCCTGGATCGT; Gli1: (S)
TGCAGTAAAGCCTTCAGCAATG, (AS) TTTTCGCAGCGAGC
TAGGAT; a-SMA: (S) CTTTTCCATGTCGTCCCAGT, (AS) GTGA
CGAAGCACAGAGCAAA; Col1a1: (S) TGTGAGGCCACGCAT
GAG, (AS) CAGATCACGTCATCGCACAA; b-actin: (S) AATGTGG
CCGAGGACTTTGATTGC, (AS) AGGATGGCAAGGGACTTCCTG
TAA. Quantitative RT-PCR was performed by using 1e2 mL of
the first-strand cDNA product. The real-time reaction was
amplified (N ¼ 3e9) using SsoFast EvaGreen supermix (Bio-
Rad), the previously mentioned primers, and the CFX96 Real-
Time PCR Detection System (Bio-Rad). Target gene levels in
cells are presented as a ratio to levels of b-actin, according to
the DCt method, or as a ratio to levels detected in the corre-
sponding control cells, according to the DDCt method [19].
These fold changes were determined using point and interval
estimates.
2.7. Western analysis
Western analyses of cell extracts were performed according to
conventional methods. Cells were lysed with radio-
immunoprecipitation assay buffer (Cell Signaling), which
included Halt Protease and Phosphatase Inhibitor Cocktail
(Pierce). Protein was quantified using a detergent compatible
protein assay. An amount of 40 mg protein samples were
subjected to 4%e12% Nu PAGE BIS-Tris gel (Life Technologies),
and transferred using the Invitrogen I-Blot 7 min transfer
system onto a polyvinylidene difluoride membrane. After
blocking themembranewith 5% (wt/vol) nonfat milk and 0.1%
(vol/vol) Tween-20 in phosphate-buffered saline for 30 min at
room temperature, the membrane was incubated with anti-
GPC3 antibody (1:500, Abbiotec) or anti-b-actin antibody
(1:1000, Cell Signaling) overnight at 4�C. Themembranes were
then washed three times with phosphate-buffered saline/
Tween-20 (0.1% [vol/vol]). Horseradish peroxidase-conjugated
goat anti-rabbit immunoglobulin G (1:40,000, Thermo Scien-
tific) was used as a secondary antibody for both primary an-
tibodies. Proteinwas detected using the SuperSignalWest Pico
Chemiluminescent Substrate (Pierce). Quantitative densi-
tometrywas performed using the Bio-Rad Gel Doc and Bio-Rad
Quantity One software.
2.8. Statistical analysis
Results are expressed as mean � standard error mean or
standard deviation as appropriate. Comparisons between
groups were performed using the Student t-test (Stata 9.0,
StataCorp, College Station, TX). Statistical significance was
accepted at the 5% level and statistical trends were accepted
at the 10% level.
3. Results
3.1. Three human HCC lines express GPC3
Previous work by Nakatsuraet al. [33] demonstrated that both
the Hep3B and PLC/PRF/5 lines express GPC3 mRNA and pro-
tein by real-time RT-PCR and Western analyses, respectively.
We confirmed these findings (Fig. 1), as well as determined
that the SK-Hep1 line also expresses GPC3mRNA (Fig. 1A) and
protein (Fig. 1B). To recapitulate the tumorestroma in-
teractions, and in particular, the effects of HCC on HSC, we
developed a Transwell coculture system using the activated
human HSC line, LX-2, and three different HCC cell lines
(Hep3B, SK-Hep-1, and PLC/PRF/5). Using our coculture assay,
Fig. 1 e HCC cell lines (SK-Hep1, Hep3B, and PLC/PRF/5) express GPC3. (A) Quantitative real-time RT-PCR of Gpc3 mRNA was
performed to compare expression with the b-actin housekeeping gene using the DCt method. (B) Western blot analyses
showing the protein expression of GPC3 in the HCC lines before (odd lanes) and after (even lanes) Transwell coculture with
activated human LX-2 HSC. b-actin serves as the control. (C) Densitometric analyses of Western blot. Volume units of GPC3
protein are adjusted for volume units of b-actin. Data are normalized to SK-Hep1 levels and reported as percent control.
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5380
we studied the LX-2 cells in the bottomwell and each HCC line
in the top well. These lines express GPC3 protein after cocul-
ture with LX-2 (Fig. 1B, even lanes). Despite having the lowest
mRNA expression, SK-Hep1 cells have the highest GPC3 pro-
tein expression. Conversely, the PLC/PRF/5 cells have the
lowest GPC3 protein expression despite having the highest
mRNA expression. Protein densitometry analysis confirmed
these findings (Fig. 1C).
3.2. Human HCC cell lines modulate the viability andapoptosis of a human LX-2 HSC line
Given that HCC rarely occurs in the absence of hepatic fibrosis
and/or cirrhosis, we aimed to determine if HCC cells affect the
viability of the LX-2 HSC line. Coculture with all three HCC
lines (top well) resulted in decreased HSC viability after 72 h
(Fig. 2A) as compared with LX-2 cultured without HCC cells in
the top well. Coculture with SK-Hep1, Hep3B, and PLC/PRF/5
cells resulted in 26.4% (P < 0.05), 20.9% (P < 0.05), and 9.3%
(P ¼ NS) decreases in viability, respectively. These reductions
paralleled the relative expression pattern of GPC3 protein in
the respective HCC lines (Fig. 1B and C). For instance, SK-Hep1
cells express the most GPC3 protein and coculture with LX-2
cells decreases LX-2 viability more than the other lines.
To validate the previously mentioned findings, we used a
second model of paracrine tumorestroma interactions. We
used conditioned media from confluent HCC lines for
culturing HSC. Figure 2B demonstrates that 72 h culture in the
presence of either 2% or 10% serum-supplementedHCCmedia
reduces HSC viability in two of three lines as compared with
culture in the presence of unconditioned HCC media. Culture
with 2% serum-supplemented SK-Hep1, Hep3B, and PLC/PRF/5
conditioned media resulted in 24.4% (P < 0.01), 5.9% (P ¼ 0.17),
and 20.5% (P < 0.01) decreases in viability, respectively.
Concomitantly, culture with 10% serum-supplemented SK-
Hep1, Hep3B, and PLC/PRF/5 conditioned media resulted in
19.6% (P< 0.001), 0.6% (P¼ 0.79), and 15.1% (P< 0.01) decreases
in viability, respectively. These findings generally parallel
those in Figure 2A while also controlling for the potential ef-
fects of serum supplementation. However, these effects on
cell viability appear to be independent of cellular apoptosis as
measured by caspase activity because we only observed
Fig. 2 e HCC-to-HSC interactions regulate the viability of
activated HSC. (A) HSC viability after 72 h coculture with
PLC/PRF/5, Hep3B, and SK-Hep1 versus LX-2 cultured
without cells in the top well. *P < 0.05. (B) HSC viability
after 72 h culture with 2% or 10% serum-supplemented
conditioned media from PLC/PRF/5, Hep3B, and SK-Hep1
compared with culture in the presence of unconditioned
HCC media. **P < 0.01 and yP < 0.001.
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5 381
0.24%e2.6% changes as compared with controls (data not
shown). Together, these data suggest that tumor-to-stroma
(HCC-to-HSC) paracrine signaling may occur in vitro and these
interactions regulate HSC viability.
Fig. 3 e GPC3 dose-dependently regulates the viability and
Hh target gene levels in activated HSC. (A) Dose-response
curves of LX-2 viability after treatment (0.0098e10 mg/mL)
with recombinant GPC3 (black square) and the positive
control Hh ligand antagonist, HHIP (red triangle). (B)
Quantitative real-time RT-PCR analysis of Ptc1, HHIP, and
Gli1 mRNA was performed in LX-2 cells without and with
GPC3 treatment (5 mg/mL) for 72 h. *P < 0.05 versus control.
(Color version of figure is available online.)
3.3. GPC3 modulates the viability of HSC in vitro
GPC3 is a HCC tumor marker and Hh pathway modulator that
is known to regulate the viability of parenchymal cells in the
liver [27,28]. However, its role in viability of HSC, an Hh-
dependent nonparenchymal cell [13], is unknown. Given
effects of HCC onHSC,we sought to determine if these could be
augmented with supplemental GPC3. We added recombinant
GPC3 (5 mg/mL) to HCC-conditioned media. In data not shown,
culture with GPC3-supplemented Hep3B and PLC/PRF/5
conditionedmedia (10% serum) resulted in an additional 19.2%
(P ¼ NS) and 4.4% (P ¼ NS) decrease in viability, respectively, as
compared with cells cultured with unsupplemented HCC-
conditioned media. In contrast, GPC3 supplementation of SK-
Hep1 conditioned media resulted in a 1.6% (P ¼ NS) increase
in viability. Thus, GPC3 did not have a significant additive or
synergistic effect in HSC exposed to HCC-conditioned media.
We then treated the LX-2 line with increasing concentra-
tions of GPC3 (0.0098e10 mg/mL). We determined that GPC3
reduces the viability of HSC in a dose-dependent manner
(Fig. 3A). We noted up to a 27.0% reduction in the viability of
cells treated with 5 mg/mL of GPC3 (P ¼ 0.005). Thus, this dose-
response curve spans the doses from no observable effect
(0.0098 mg/mL) versus control (P¼NS) to amaximal effect (5 mg/
mL) versus control (P ¼ 0.005). For the 10 mg/mL treatment,
there is no additional effect on viability as compared with the
5 mg/mL treatment (P¼NS). For the treatments<0.3125 mg/mL,
there is a plateau effect and no differences in viability as
compared with one another or control (P ¼ NS). Thus, the
changes seen in the dose response curve occur between 0.3125
and 5 mg/mL. These data suggest that GPC3, a protein secreted
by HCC, can partially modulate the viability of activated HSC,
which reside within the stroma of fibrotic and cirrhotic livers.
To confirm our findings that GPC3, an endogenous inhibitor of
Hh signaling, can reduce HSC viability by binding to Hh
ligands, we performed the same experiments using HHIP. This
membrane glycoprotein negatively regulates Hh signaling by
competitively binding to human Hh ligands with an affinity
similar to the Hh receptor, Ptc. [34e36]. Thus, its mechanism
of action is similar to that of GPC3. Moreover, this Hh inhibitor
is downregulated in liver cancers [34,36] and during HSC
activation [14,17]. As expected, treating LX-2 cells with
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5382
exogenous HHIP (0.3125e10 mg/mL) decreases HSC viability in
a dose-dependent manner (Fig. 3A). This also demonstrates
that active Hh signaling at the HSC surface is Hh ligand
dependent.
3.4. GPC3 regulates Hh target gene expression
When Hh signaling is activated in Hh-responsive cells, target
gene transcription occurs. Interestingly, several members of
the canonical Hh signaling pathway are also downstream
gene targets. Ptc1 and HHIP provide negative feedback
because of their inhibitor actions, whereas the Gli1 tran-
scription factor provides positive feedback. Alternations in
their relative mRNA levels indicate regulation of the Hh
pathway. We treated LX-2 cells with recombinant GPC3 at a
dose (10 mg/mL) which decreases cell viability. Real-time RT-
PCR analysis after 72 h treatment demonstrated that GPC3
treatment decreases Ptc1 and HHIP mRNA levels, although
these were not statistically significant (Fig. 3B). However, Gli1
mRNA expression increased by 9.02-fold (P ¼ 0.012) as
compared with untreated cells. Despite these changes in Hh
signaling, we did not observe a statistically significant effect
on the expression of HSC activation biomarkers including
a-SMA or Col1a1 (data not shown). These results suggest that
GPC3 regulates the viability, but not the further activation, of
HSC in vitro and that this is partially regulated by modulating
Hh signaling.
3.5. Heparin partially abrogates the inhibitory effects ofGPC3 on HSC viability and gene transcription
GPC3 is an HSPG. Members of this family display heparin-
inhibitable binding because heparin, a heparan sulfate gly-
cosaminoglycans, can covalently bind to HSPGs. As a result,
we hypothesized that heparin could competitively bind with
GPC3 to form GPC3-heparin complexes in lieu of GPC3-Hh
ligand complexes. In turn, we hypothesized that GPC3
effects on HSC viability and gene transcription could be
abrogated by heparin. To test this hypothesis, we treated LX-2
HSC with GPC3 (10 mg/mL) and heparin (1:2 serial dilutions
from 100e3.125 mg/mL). GPC3 alone decreased cell viability by
34.2% (P ¼ 0.04). Comparison of all GPC3- and heparin-treated
cells with GPC3-only treated cells demonstrated an abrogation
of GPC3 effects. We observed a 2.5%e22.4% increase in cell
viability across all groups (Fig. 4A). The effects were statisti-
cally significant (P < 0.05) at heparin doses of 25 mg/mL or
greater. Meanwhile, treatment of LX-2 with heparin alone
(100 mg/mL) results in a 2.0% change in HSC viability (P ¼ NS).
At the 25 and 50 mg/mL doses, we observed 18%e23% increases
in HSC viability. However, these were not statistically signifi-
cant because of variability in the replicates (N ¼ 4). At two
lower doses of heparin (6.25 and 12.5 mg/mL), we do see a
statistically significant increase in HSC viability (P ¼ 0.04 and
P ¼ 0.03, respectively). However, only at the 6.25 mg/mL dose
does this translate into either a partial rescue of GPC3’s effects
or an independent increase in HSC viability (P ¼ 0.13 versus
control, Fig. 4A). At all other doses (25e100 mg/mL) that result
in rescue from GPC3’s effects, there was not a statistically
significant effect from heparin alone on LX-2 viability (Fig. 4A).
On its own, the higher doses of heparin that result in rescue
from GPC3’s effects had no statistically significant effect on
the relative cell viability of the LX-2 HSC line. Our results
demonstrate that heparin is capable of a partial dose-
dependent rescue of GPC3’s effects on HSC viability. This
appears to be independent of heparin’s ability to regulate HSC
viability at lower doses. Thus, we find that the viability of
untreated HSC is similar to that of HSC treated with GPC3 and
higher doses of heparin. Taken together, this further demon-
strates GPC3’s regulation of HSC viability.
3.6. Heparin rescues Hh target genes expression inGPC3-treated HSC
To determine if heparin could rescue the transcriptional ef-
fects of GPC-treatment on HSC, we treated LX-2 cells with
recombinant GPC3 (10 mg/mL) and heparin (10 mg/mL). Inverse
to our earlier findings with GPC3 alone (Fig. 3B), quantitative
real-time RT-PCR analysis after 72 h treatment demonstrated
that heparin treatment increases Ptc1 and HHIP mRNA levels
by 4.92- (P ¼ 0.05) and 1904-fold (P ¼ 0.074), respectively, as
compared with GPC3-treated cells (Fig. 4B). Interestingly, Gli1
mRNA expression decreased by 2.0-fold (P ¼ NS) as compared
with GPC3-treated cells. Thus, we observed a heparin-induced
rescue of Hh target gene expression in GPC3-treated HSC.
4. Discussion
For the first time, we demonstrate that the HCCmarker, GPC3,
regulates human HSCs via paracrine signaling. In turn, this
modulates Hh signaling in the HSC. Because GPC3 binds with
Hh ligands (i.e., Sonic hedgehog and Indian hedgehog) on the
cell surface, there is a resultant reduction in Hh signaling, an
HSC viability factor [13]. Thus, these tumorestroma in-
teractions via GPC3 regulate the viability of activated human
HSC that are implicated in hepatic fibrosis and cirrhosis.
Furthermore, these effects correlate with the relative expres-
sion levels of GPC3 in HCC lines. Using a coculture model and
HCC-conditioned media, we replicated these findings.
Furthermore, we show that recombinant GPC3 dose depen-
dently decreases HSC viability and GPC3 can decrease Hh
signaling in HSC. Finally, because GPC3 is a HSPG, we deter-
mined that the inhibitory effects of GPC3 are partially abro-
gated by the treatment with unfractionated heparin. Taken
together, these results suggest that hepatic tumor-to-stroma
interactions are partially regulated by the HCC biomarker and
prognostic factor, GPC3 [33].
Our present findings complement and expand on earlier
studies suggesting that hepatic GPC3mRNA and protein levels
are inverse to the proliferative activities of hepatic paren-
chymal cells [27,28]. We now demonstrate that GPC3
decreases the viability of activated human HSC, a non-
parenchymal cell. Such intriguing findings are in alignment
with the paradoxical nature of GPC3. Despite GPC3 upregula-
tion in HCCs, earlier work by Michalopoulos’ group suggested
that GPC3 plays an overall growth inhibitory role in liver
regeneration and hepatocyte proliferation [28,37]. We now
add HSC to the list of hepatic cells that are negatively regu-
lated by GPC3. Mechanistically, we show that this is partially
regulated through the Hh signaling pathway and its target
Fig. 4 e Heparin partially abrogates the anti-HSC effects of GPC3. (A) Cells were treated with increasing doses of
unfractionated heparin (3.125e100 mg/mL) with or without a constant dose of GPC3 (10 mg/mL). Results are compared with
untreated control cells (0/0) and cells treated with GPC3, but not heparin (10/0). Absolute changes in normalized (percentage
control) LX-2 cell viability and P values are presented in the table. (B) Quantitative real-time RT-PCR analysis of Ptc1 and
HHIP mRNA was performed in GPC3-treated (10 mg/mL) LX-2 cells without and with heparin treatment (10 mg/mL) for 72 h.
*P < 0.05 versus control.
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5 383
genes, including HHIP. Given that HCCs are also Hh regulated
and secrete GPC3, this may explain the earlier finding that
HHIP mRNA expression is increased in peritumoral stroma
when compared with human HCCs [20,34,36]. It remains to be
determined whether this is through autocrine regulation of
the pathway.
The current findings also add to the growing body of evi-
dence suggesting that tumorestroma interactions are present
and active in the liver. We demonstrate a previously unknown
role for GPC3 in this process. Although we show that HSC
coculture with HCC lines (i.e., SK-Hep1 and Hep3B) with higher
GPC3 expression can decreaseHSC viability, others have shown
that coculture with HCC lines (i.e., Huh7) can stimulate cellular
proliferation and migration via PI3K/AKT activation. Moreover,
they demonstrated that Huh7 can increase the expression of
proangiogenic genes while decreasing the expression of profi-
brinogenic genes [11]. Together, our findings and the earlier
findings demonstrate the heterogeneity of HCC lines and their
variable effects on HSC in vitro.
HCC’s tumor-to-stroma interactions are crucial for modi-
fying this cancer’s natural history. Ju et al. [38] demonstrated
that a higher density of activated peritumoral HSCs correlates
with more advanced clinicopathologic features including
increased HCC size, vascular invasion, lack of tumor encap-
sulation, and elevated alpha-fetoprotein levels. Work by
Chanet al. [12] showed that malignant hepatocytes secrete Hh
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5384
ligands, which stimulate glycolysis in neighboring myofibro-
blasts. This results in the release of lactate, which cancer
cells uses as an energy source. Others [10,11] have also
demonstrated that HCC-HSC cross talk generates a permissive
pro-angiogenic microenvironment that promotes HCC pro-
gression. Although our findings may seem counterintuitive,
we can postulate that aggressive HCC cells that secrete more
GPC3 will kill HSC via inhibition of Hh signaling to possibly
allow for a niche that permits tumor outgrowth and/or
angiogenesis. In line with this hypothesis, GPC3 is known to
be highly expressed in HCCs, and its expression pattern differs
according to the degree of cell differentiation. [39] In fact,
membranous GPC3 expression in HCCs correlates with a
worse prognosis because after resection, GPC3-positive HCC
patients have lower disease-free survival rate than GPC3-
negative HCC patients. [40] Mechanistically, transfection of
HepG2, MHCC-97H, and Huh7 cell lines with anti-GPC3 short
hairpin RNA significantly reduced GPC3 mRNA and proteins
levels. [41] In turn, this reduced proliferative, migratory, and
invasive capacities, as well as significantly increased
apoptosis. Moreover, this was associated with increased Gli1
mRNA expression and decreased vascular endothelial growth
factor protein in HepG2 cells. Thus, GPC3 appears to
contribute to HCC migration, invasion, angiogenesis, and
apoptosis, possibly through its interactions with the Hh
signaling pathway. But, in opposition to these findings, Zit-
terman et al. [42] noted an antiangiogenic effect of GPC3 in
Huh7 and HepG2-derived tumors, but not in Huh6 xenografts.
Thus, the exact role of GPC3 in these processes remains
debatable.
Interestingly, our newly identified Hh-dependent tumore
stroma interactions are quite distinct from those in pancreatic
ductal adenocarcinoma, where tumor secretion of Hh ligands
drives stromal proliferation and promotes desmoplasia [7].
Teleologically, pancreatic ductal adenocarcinoma arise first
and secondarily leads to peritumoral fibrosis, which causes
chemoresistance. Conversely, chronic liver injury leads to
hepatic fibrosis and cirrhosis, which create a permissive
environment for HCC development. However, because the
HCCs arise in the milieu of fibrotic liver, their growth and
angiogenesis may be limited without serially depleting HSCs
or decreasing their expression of profibrinogenic genes [11]. In
line with this hypothesis, we show that the tumorestroma
interactions lead to decreased HHIP expression, which others
have shown can promote angiogenesis in HCC [36]. While
assigning a specific role to each protein mediator in this
complicated milieu remains difficult, a better comprehension
of tumorestroma interactions may have important conse-
quences for the treatment of HCC and cirrhosis. For instance,
the finding that heparin increases human HSC viability at low
doses is probably multifactorial and based on the fact that
HSCs express other cell surface HSPGs, including syndecan-1
and syndecan-3, as well as the matrix HSPG, perlecan. [43]
These are cofactors in cell-matrix adhesion processes, in
cellecell recognition systems, and in receptor-growth factor
interactions with HSC growth factors such as epidermal
growth factor, vascular endothelial growth factor fibroblast
growth factor-1/2, hepatocyte growth factor, and interleukin
8. [44] As a result, on its own, heparin appears to play a role in
regulating HSC viability at lower doses, possibly by
modulating HSPGs and the functional levels of the afore-
mentioned growth factors.
Clinically, GPC3 may represent not only a reliable tumor
marker, but also a prognostic factor and a therapeutic target.
GC33 (Chugai Pharmaceutical, Japan), a recombinant
humanized anti-GPC3 antibody, is now being studied as a
potential therapeutic agent for patients with advanced HCC
[45,46]. Preclinical pharmacologic assessments have shown
that rather than directly targeting GPC3, GC33 elicits antibody-
dependent cellular cytotoxicity mediated by natural killer
cells and macrophages targeted against GPC3-expressing
human HCC cells. [47] Moreover, our results demonstrate
that the regulation of the Hh pathway may be a useful tool to
control HCC progression, influencing both tumorestroma
cross talk and tumor growth. In this context, we provide
additional insight into potential consequences of such
approaches in patients with HCC and cirrhosis.
Acknowledgment
We thank Professor Stefania Uccini and Dr Michael Peterson
for their expertise and discussions. This work was supported
by the American Cancer Society’s Institutional Research Grant
No. 70-002 (JKS) and the SapienzaeUniversita di Roma student
research fellowship (PM).
Author contributions: PM, SYL, CMT, and JKS were partic-
ipated in conception and design; PM, SYL, CMT, and JKS were
responsible for analyses and interpretation; PM, SYL, CMT,
JCC, and TEL were responsible for data collection; PM, SYL,
CMT, and JKS were responsible for drafting the article; PM,
SYL, CMT, and JKS were responsible for the critical revision of
article; PM and JKS were responsible for funding.
r e f e r e n c e s
[1] El-Serag HB, Rudolph KL. Hepatocellular carcinoma:epidemiology andmolecular carcinogenesis. Gastroenterology2007;132:2557.
[2] El-Serag HB. Hepatocellular carcinoma: recent trends in theUnited States. Gastroenterology 2004;127(5 Suppl 1):S27.
[3] El-Serag HB. Epidemiology of hepatocellular carcinoma inUSA. Hepatol Res 2007;37(Suppl 2):S88.
[4] Ascha MS, Hanouneh IA, Lopez R, Tamimi TA, Feldstein AF,Zein NN. The incidence and risk factors of hepatocellularcarcinoma in patients with nonalcoholic steatohepatitis.Hepatology 2010;51:1972.
[5] Clark JM, Diehl AM. Nonalcoholic fatty liver disease: anunderrecognized cause of cryptogenic cirrhosis. JAMA 2003;289:3000.
[6] Sicklick JK. Correcting the misnomers of epithelial-mesenchymal relations. J Surg Res; 2012.
[7] Olive KP, Jacobetz MA, Davidson CJ, et al. Inhibition ofHedgehog signaling enhances delivery of chemotherapy in amouse model of pancreatic cancer. Science 2009;324:1457.
[8] Mazzocca A, Fransvea E, Dituri F, Lupo L, Antonaci S,Giannelli G. Down-regulation of connective tissue growthfactor by inhibition of transforming growth factor betablocks the tumor-stroma cross-talk and tumor progressionin hepatocellular carcinoma. Hepatology 2010;51:523.
j o u r n a l o f s u r g i c a l r e s e a r c h 1 8 7 ( 2 0 1 4 ) 3 7 7e3 8 5 385
[9] Amann T, Bataille F, Spruss T, et al. Activated hepatic stellatecells promote tumorigenicity of hepatocellular carcinoma.Cancer Sci 2009;100:646.
[10] Coulouarn C, Corlu A, Glaise D, Guenon I, Thorgeirsson SS,Clement B. Hepatocyte-stellate cell cross-talk in the liverengenders a permissive inflammatory microenvironmentthat drives progression in hepatocellular carcinoma. CancerRes 2012;72:2533.
[11] Sancho-Bru P, Juez E, Moreno M, et al. Hepatocarcinoma cellsstimulate the growth, migration and expression of pro-angiogenic genes in human hepatic stellate cells. Liver Int2010;30:31.
[12] Chan IS, Guy CD, Chen Y, et al. Paracrine Hedgehog signalingdrives metabolic changes in hepatocellular carcinoma.Cancer Res 2012;72:6344.
[13] Sicklick JK, Li YX, Choi SS, et al. Role for hedgehog signalingin hepatic stellate cell activation and viability. Lab Invest2005;85:1368.
[14] Choi SS, Omenetti A, Witek RP, et al. Hedgehog pathwayactivation and epithelial-to-mesenchymal transitions duringmyofibroblastic transformation of rat hepatic cells in cultureand cirrhosis. Am J Physiol Gastrointest Liver Physiol 2009;297:G1093.
[15] Sicklick JK, Li YX, Melhem A, et al. Hedgehog signalingmaintains resident hepatic progenitors throughout life. Am JPhysiol Gastrointest Liver Physiol 2006;290:G859.
[16] Witek RP, Yang L, Liu R, et al. Liver cell-derivedmicroparticles activate hedgehog signaling and alter geneexpression in hepatic endothelial cells. Gastroenterology2009;136:320.
[17] Yang L, Wang Y, Mao H, et al. Sonic hedgehog is anautocrine viability factor for myofibroblastic hepaticstellate cells. J Hepatol 2008;48:98.
[18] Omenetti A, Syn WK, Jung Y, et al. Repair-related activationof hedgehog signaling promotes cholangiocyte chemokineproduction. Hepatology 2009;50:518.
[19] Sicklick JK, Li YX, Jayaraman A, et al. Dysregulation of theHedgehog pathway in human hepatocarcinogenesis.Carcinogenesis 2006;27:748.
[20] Patil MA, Zhang J, Ho C, Cheung ST, Fan ST, Chen X.Hedgehog signaling in human hepatocellular carcinoma.Cancer Biol Ther 2006;5:111.
[21] Gallet A, Staccini-Lavenant L, Therond PP. Cellular traffickingof the glypican Dally-like is required for full-strengthHedgehog signaling and wingless transcytosis. Dev Cell 2008;14:712.
[22] Capurro M, Wanless IR, Sherman M, et al. Glypican-3: a novelserum and histochemical marker for hepatocellularcarcinoma. Gastroenterology 2003;125:89.
[23] Midorikawa Y, Ishikawa S, Iwanari H, et al. Glypican-3,overexpressed in hepatocellular carcinoma, modulates FGF2and BMP-7 signaling. Int J Cancer 2003;103:455.
[24] Capurro MI, Xu P, Shi W, Li F, Jia A, Filmus J, et al. Glypican-3inhibitsHedgehog signalingduringdevelopment bycompetingwith patched for Hedgehog binding. Dev Cell 2008;14:700.
[25] Yan D, Lin X. Opposing roles for glypicans in Hedgehogsignalling. Nat Cell Biol 2008;10:761.
[26] Pilia G, Hughes-Benzie RM, MacKenzie A, et al. Mutations inGPC3, a glypican gene, cause the Simpson-Golabi-Behmelovergrowth syndrome. Nat Genet 1996;12:241.
[27] Lin CW, Mars WM, Paranjpe S, et al. Hepatocyte proliferationand hepatomegaly induced by phenobarbital and 1,4-bis [2-(3,5-dichloropyridy-loxy)] benzene is suppressed inhepatocyte-targeted glypican 3 transgenic mice. Hepatology2011;54:620.
[28] Liu B, Bell AW, Paranjpe S, et al. Suppression of liverregeneration and hepatocyte proliferation in hepatocyte-targeted glypican 3 transgenic mice. Hepatology 2010;52:1060.
[29] Wang XY, Degos F, Dubois S, et al. Glypican-3 expression inhepatocellular tumors: diagnostic value for preneoplasticlesions and hepatocellular carcinomas. Hum Pathol 2006;37:1435.
[30] Shirakawa H, Suzuki H, Shimomura M, et al. Glypican-3expression is correlated with poor prognosis inhepatocellular carcinoma. Cancer Sci 2009;100:1403.
[31] Xu L, Hui AY, Albanis E, et al. Human hepatic stellate celllines, LX-1 and LX-2: new tools for analysis of hepaticfibrosis. Gut 2005;54:142.
[32] Omenetti A, Yang L, Li YX, et al. Hedgehog-mediatedmesenchymal-epithelial interactions modulate hepaticresponse to bile duct ligation. Lab Invest 2007;87:499.
[33] Nakatsura T, Yoshitake Y, Senju S, et al. Glypican-3,overexpressed specifically in human hepatocellularcarcinoma, is a novel tumor marker. Biochem Biophys ResCommun 2003;306:16.
[34] Tada M, Kanai F, Tanaka Y, et al. Down-regulation ofhedgehog-interacting protein through genetic and epigeneticalterations in human hepatocellular carcinoma. Clin CancerRes 2008;14:3768.
[35] Omenetti A, Popov Y, Jung Y, et al. The hedgehog pathwayregulates remodelling responses to biliary obstruction inrats. Gut 2008;57:1275.
[36] Olsen CL, Hsu PP, Glienke J, Rubanyi GM, Brooks AR.Hedgehog-interacting protein is highly expressed inendothelial cells but down-regulated during angiogenesisand in several human tumors. BMC Cancer 2004;4:43.
[37] Liu B, Paranjpe S, BowenWC, et al. Investigation of the role ofglypican 3 in liver regeneration and hepatocyte proliferation.Am J Pathol 2009;175:717.
[38] Ju MJ, Qiu SJ, Fan J, et al. Peritumoral activated hepaticstellate cells predict poor clinical outcome in hepatocellularcarcinoma after curative resection. Am J Clin Pathol 2009;131:498.
[39] Suzuki M, Sugimoto K, Tanaka J, et al. Up-regulation ofglypican-3 in human hepatocellular carcinoma. AnticancerRes 2010;30:5055.
[40] Yorita K, Takahashi N, Takai H, et al. Prognostic significanceof circumferential cell surface immunoreactivity of glypican-3 in hepatocellular carcinoma. Liver Int 2011;31:120.
[41] Yu DD, Yao M, Chen J, et al. [Short hairpin RNA mediatedglypican-3 silencing inhibits hepatoma cell invasiveness anddisrupts molecular pathways of angiogenesis]. ZhonghuaGan Zang Bing Za Zhi 2013;21:452.
[42] Zittermann SI, Capurro MI, Shi W, Filmus J. Soluble glypican3 inhibits the growth of hepatocellular carcinoma in vitroand in vivo. Int J Cancer 2010;126:1291.
[43] Roskams T, Rosenbaum J, De Vos R, David G, Desmet V, et al.Heparan sulfate proteoglycan expression in chroniccholestatic human liver diseases. Hepatology 1996;24:524.
[44] Friedman SL. Hepatic stellate cells: protean, multifunctional,and enigmatic cells of the liver. Physiol Rev 2008;88:125.
[45] Ho M. Advances in liver cancer antibody therapies: a focuson glypican-3 and mesothelin. BioDrugs 2011;25:275.
[46] Motomura Y, Ikuta Y, Kuronuma T, et al. HLA-A2 and -A24-restricted glypican-3-derived peptide vaccine induces specificCTLs: preclinical study using mice. Int J Oncol 2008;32:985.
[47] Ishiguro T, Sugimoto M, Kinoshita Y, et al. Anti-glypican 3antibody as a potential antitumor agent for human livercancer. Cancer Res 2008;68:9832.