![Page 1: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/1.jpg)
![Page 2: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/2.jpg)
The Islamic University – Gaza
Research and Postgraduate Affairs
Faculty of Science
Biological Sciences Master Program
Medical Technology
غزة -الجبمعت االسالميت
شئىن البحث العلمي والذراسبث العليب
كليت العلىم
بروبمج مبجيستير العلىم الحيبتيت
طبيت تحبليل
Polymorphisms in the clotting Factors II, V and XI
Genes and Risk of Recurrent Pregnancy Loss
in Gaza Strip
By:
Mohammed Jamel Ashour
Supervisor:
Prof. Dr. Fadel A. Sharif
A Thesis Submitted in partial fulfillment for the degree of
Master of Science in Biological Sciences – Medical Technology
2015-1436
![Page 3: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/3.jpg)
![Page 4: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/4.jpg)
I
Polymorphisms in Factors II, V and XI Genes and Risk of
Recurrent Pregnancy Loss in Gaza Strip
Abstract
Background:
Recurrent miscarriage is defined as the occurrence of three or more consecutive
pregnancy losses during the first trimester, and accounts for about 1-3% of clinically
recognized pregnancy losses. Despite extensive research to explain the causative
effects of recurrent pregnancy loss (RPL), about 50%-60% of RPLs are still
idiopathic. Despite the increasing prospective studies with sufficient power related to
the association between various thrombophilias and RPL, controversy still remains
regarding screening for thrombophilia in women with RPL.
Objective:
To investigate the association between recurrent pregnancy loss (RPL) and common
polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C
(A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-
Palestine.
Methods:
This study is an association study with a case-control design. Using molecular
biological techniques, the factor-V G1691A, factor-V H1299R (A4070G), factor-V
Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T)
polymorphisms were determined for 200 women who had at least three consecutive
abortions and 200 controls without a previous history of abortion.
![Page 5: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/5.jpg)
II
Results:
The factor V: G1691A is associated with and may represent a risk factor for RPL in
our population. The A-allele seems to significantly double the risk for RPL (OR =
2.06; P = 0.0093). Factor V: A4070G is also associated with RPL in our population
with the G-allele increasing the RPL risk more than three times (OR = 3.14; P =
0.003). Factor V: A5279G was not significantly different between RPL patients and
controls (P-value = 0.140). Factor II: G20210A also did not significantly differ
between RPL patients and controls (P-value = 0.096). Factor XI: rs3756008 (A>T)
allele frequencies showed that there is no significant difference between the RPL
patients and the controls (P-value = 0.15). After excluding the three samples in which
both G1691A and A4070G polymorphisms coexisted, the A4070G minor allele
remained as a risk factor for RPL with an odds ratio of (OR = 2.34; P = 0.0003),
implicating that A4070G represent an independent risk factor for RPL.
Conclusion:
The study showed that there is significant associations between factor V: G1691A
(R506Q; rs6025) and H1299R (R2) polymorphisms and RPL. No significant
association was observed between Y1702C (rs118203907); factor II G20210A
(rs1799963), and factor XI rs3756008 (A>T) polymorphisms and RPL.
Key words: Factor V: G1691A, H1299R (R2), Y1702C (rs118203907), factor II
G20210A (rs1799963), factor XI rs3756008 (A>T) , polymorphism, Recurrent
pregnancy loss.
![Page 6: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/6.jpg)
III
العالقت بيه التعذد الشكلي في جيىبث عىامل التجلط الثبوي والخبمس والحبدي عشر وخطر
االجهبض المتكرر في قطبع غزة
الملخص
و زو خاله األشهش اىزالرت األوىى. او امزش خخبىت شاث رالرتبفقذا اىحو عشف اإلجهبض اىخنشس :مقذمت
عيى اىشغ أبحبد نزفت ىششح اربس و % حبالث فقذا اىحو اىزبخت سششب3-1االجهبض حىاى
. عيى اىشغ صبدة اىسبب هىىتال حضاه ج االجهبض٪ 05-٪ 05اىسببت ىفقذا اىحو اىخنشس، حىاى
، اىجذه ب صاه قبئب بشأ اىنشف ع االجهبض اىخنشساىخخزش و اىعذذ عىاو ب حىه اىعالقتاىذساسبث
اىخعشف عيى اىعالقت ب . وقذ ح حص هز اىذساست بغشضاىيىاح جهض اىخخزش ف اىسبء عىاو
ب اىخعذد اىشني ف جبث عىاو اىخجيظ اىزب واىخبس واىحبدي عشش ف قطبع غضة واىخنشس االجهبض
ف قطبع غضة اىفيسط االجهبض اىخنشساىسبء حعب
اىعالقت ب اىخعذد اىشني ف جبث عىاو اىخجيظ اىزب واىخبس واىحبدي عشش وخطش دساست الهذف:
االجهبض اىخنشس ف قطبع غضة
ىزالد شاث خخبىت عبج االجهبضاشاة 200ح فحص حيل االخخالفبث اىجت ف لطرق المستخذمت:ا
اشأة ى حن حعب اإلجهبض اىخنشس وح رىل ببسخخذا حقبث 200ف اىزيذ األوه اىحو وقىسج بـ
اىبىىىجب اىجضئت.
ف اىعبو اىخبس بخطىسة حذود االجهبض اىخنشس G1691Aهشث اىخبئج اسحببط اىظ ظأ الىتبئج:
اىظ ومزىل اسحبظ(. P =5.55.3؛ OR =6.50أىو ضبعف اىخطش )-Aجخعب حذ بذو أ
A4070G ،أ وجىد حذع االجهبض اىخنشسG- أىو ضذ خطش االجهبض اىخنشس أمزش رالد
خخيف بشنو مبش ب شضى ى اىعبو اىخبس A5279G (:. اىظ: P =5.553؛ OR =3.13شاث )
خخيف ى اىعبو اىزب أضب G20210A(. اىظ: 5.135قت = -P)واىعت اىضببطت االجهبض اىخنشس
اىظ (. وقذ أظهشث اىذساست أضب ا5.5.0قت = -P) واىعت اىضببطتمزشا ب شضى االجهبض اىخنشس
rs3756008 (A >T اىعبو اىحبدي عشش ) واىعت اىضببطت فشق مبش ب اىشضى ى شنو (P راث
أىو زو A4070G بق A4070Gواألشنبه G1691A(. بعذ اسخبعبد اىعبث اىزالد اىخ 5.10اىقت =
(.P =5.5553؛ OR =6.33عبو خطش ىالجهبض اىخنشس ع سبت احخبالث )
G1691A :اىعبو اىخبس االبط راث دالىت إحصبئت ب عالقت أ هبك اىذساست وأظهشث الخالصت:
(R506Q ؛rs6025) وH1299R (R2) راث دالىت إحصبئت عذ وجىد عالقت و االجهبض اىخنشس وقذ ىىحع
اىظ و، اىعبو اىزب G20210A (rs1799963) واىظ؛ اىعبو اىخبس Y1702C اىظ ب
rs3756008 اىحبدي عشش عبو اى (A> T) واالجهبض اىخنشس
.
اىعبو اىخبس، اىزب، اىحبدي عشش ، ابط ، االجهبض اىخنشس ، قطبع غضة . كلمبث مفتبحيت:
![Page 7: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/7.jpg)
IV
Dedication
To all of them I dedicate this work, fulfillment and recognition.
The Spirit of my father and mother
My lovely wife who supported me
My children: Baraa and Nema
who are proud of me, and insisted that their mother should achieve this
dream.
All my wonderful brothers and sisters,
for their endless love and support
My teachers, friends, great family and wife’s family
All Palestinian people,
who are steadfast and patient on the beloved land of Palestine and
all Palestinian people all over the world
![Page 8: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/8.jpg)
V
Acknowledgements
I am grateful to Allah, who granted me life, power, peace and courage to finish this
study.
I would like to express my thanks to Prof. Fadel A. sharif, the supervisor of the
study, who did not spare any effort to overcome all the difficulties aroused during the
theoretical and practical parts and for his constructive scientific advice.
I am grateful for Islamic University especially for Department of Biological science
program. I would like also to express my sincere gratitude to all members of genetic
lab in the medical technology department in particular Mr. Shadi Al- Ashi.
My deep and sincere appreciations are also to Mr. Mohammed Jaber and Miss
Amany Al Hindi for their encouragement, continuous support.
My special deep and sincere gratitude to my children (Baraa and Nema ), who
endure my busy life every day.
My deepest love to my brothers, sisters, friends, my family, my wife's family for their
encouragement, continuous support and help.
Finally, profuse thanks, love and appreciations to my gorgeous wife Aida Zuhair
Al Massri , who remained by my side every day by her knowledge, support and
effort. My deepest thanks go to her.
![Page 9: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/9.jpg)
VI
Table of Contents
Abstract (English)................................................................................................ I
Abstract (Arabic).............................................................................................. III
Dedication......................................................................................................... IV
Acknowledgements .......................................................................................... V
Table of Contents ............................................................................................... VI
List of Figures .................................................................................................... XI
List of Tables ..................................................................................................... XIII
Abbreviations ....................................................................................................XVII
Chapter One: Introduction
1.1. Overview................................................................................................... 2
1.2. Proplem..................................................................................................... 3
1.3. Overall objective............................................................................ 3
1.4. Specific objectives................................................................................ 4
1.5. Significance of the study................................................................ 5
Chapter Two: Literature Review
2.1. Physiological changes in pregnancy.................................................................. 7
2.2. Pregnancy loss.................................................................................................... 8
2.3. Recurrent pregnancy loss.................................................................................. 8
2.4. Causes of recurrent pregnancy loss.................................................................. 9
2.4.1. Genetic / chromosomal causes........................................................................ 9
2.4.2. Anatomic / Uterine abnormalities.................................................................. 9
2.4.3. Metabolic and Endocrine abnormalities......................................................... 9
2.4.4. Infectious causes............................................................................................. 10
2.4.5. Environmental and life style causes................................................................ 10
2.4.6. Immune causes................................................................................................ 10
2.4.7. Thrombophilic causes..................................................................................... 11
2.4.8. Unexplained causes........................................................................................ 11
2.5. Thrombophilia................................................................................................... 11
2.5.1. Definition of thrombophilia........................................................................... 11
2.5.2. Acquired thrombophilia................................................................................ 12
![Page 10: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/10.jpg)
VII
2.5.3. Hereditary thrombophilia............................................................................... 12
2.6. MTHFR mutation ………............................................................................... 13
2.7. Factor V polymorphisms…………… ......................................................... 14
2.7.1. Factor V gene …………………….. ........................................................ 14
2.7.2. Factor V protein and its structure---------------------------------------------
2.7.3. Factor V (G1691A) polymorphism---------------------------------------
2.7.4 VR2 (H1299R) polymorphism..................................................................
14
16
18
2.7.5 Factor V Y1702C polymorphism………………………………………….. 18
2.8. Prothrombin gene (G20210A) mutation (factor II)………………………… 19
2.8.1. Factor II gene…………………………………………............................... 20
2.9. Association between factor V and factor II genes polymorphisms and RPL
………………………………………………………………………………………..
2.10. Factor XI gene …………………………………………………..................................................
20
22
2.10.1. Chromosomal location of Factor XI gene……………………………. 22
2.10.2. Function of factor XI ................................................................................... 23
![Page 11: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/11.jpg)
VIII
Chapter Three: Materials and Methods
3.1. Materials.................................................................................................................... 25
3.1.1. Chemicals and reagents..............................................................................................25
3.1.2. Instruments and Disposables......................................................................................26
3.1.3. PCR primers..............................................................................................................27.
3.2. Study sample......................................................................................................................28
3.2.1. Study design......................................................................................................................28
3.2.2. Study location...................................................................................................................28
3.2.3. Characteristics of the study sample……. .............................................................28
3.2.4. Ethical considerations............................................................................................... 29
3.3. Methods..........................................................................................................................29
3.3.1. Sample collection......................................................................................................29.
3.3.2. DNA extraction.........................................................................................................29.
3.3.2.1. DNA purification..................................................................................................29
3.3.2.2. Detection and quantitation of extracted DNA.......................................................30
3.3.3. Genotyping........................................................................................................................30
3.3.3.1. Primers reconstitution...........................................................................................30
3.3.3.2. Determination of factor II (G20210A) Polymorphism.......................................30
3.3.3.2.1. - PCR-SSP procedure for factor II (G20210A) polymorphism......................30
3.3.3.3. Determination of factor V (G1691A) Polymorphism…………………………32
3.3.3.3.1. PCR-SSP procedure for factor V (G1691A) polymorphism……………….32
3.3.3.4. Determination of factor V (A4070G) Polymorphism………………………….33
3.3.3.4.1. Factor V (A4070G) PCR-RFLP procedure......................................................34
3.3.3.4.1.1. Polymerase Chain Reaction (PCR) for factor V (A4070G).....................34
3.3.3.4.1.2.Restriction Fragment Length Polymorphism (RFLP) by RsaI restriction
enzyme……………………………………………………………………………………35
3.3.3.4.2. Agarose gel electrophoresis (3.0%)…………………………………………..37
3.3.3.5. Determination of factor V (A5279G) polymorphism……………………………38
3.3.3.5.1. Factor V (A5279G) PCR-RFLP procedure…………………………………….38
3.3.3.5.1.1. Polymerase Chain Reaction (PCR) for factor V (A5279G)………………..38
![Page 12: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/12.jpg)
IX
3.3.3.5.1.2. Restriction Fragment Length Polymorphism (RFLP) by AccI restriction
enzyme……………………………………………………………………………………39
3.3.3.6. Determination of factor XI rs3756008 (A>T) polymorphism…………………..42
3.3.3.6.1. Factor XI rs3756008 (A>T) PCR-RFLP procedure………………………….42
3.3.3.6.1. 1. Polymerase Chain Reaction (PCR) for factor XI rs3756008 (A>T)………42
3.3.3.6.1.2 Restriction Fragment Length Polymorphism (RFLP) by MluCI restriction
enzyme…………………………………………………………………………………….43
3.4 Statistical analysis………………………………………………………………46
Chapter Four: Results
4.1. PCR Genotyping results...............................................................................................48
4.2. Factor V (G1691A) gene polymorphism...................................................................51.
4.2.1. Genotype frequency of factor V (G1691A) polymorphism among RPL patients and
controls……………………………………………………………………………………..51
4.2.2. Alleles frequency of factor V (G1691A) polymorphism among RPL patients and
controls………………………………………….………………………………………….53
4.2.3. Hardy-Weinberg equilibrium in factor V (G1691A) gene polymorphism………...54
4.3. Factor V (A4070G) gene polymorphism……………………..……………………55
4.3.1. Genotype frequency of factor V (A4070G) polymorphism among RPL patients and
controls…………………………………………………………………………………….55
4.3.2. Alleles frequency of factor V (A4070G) polymorphism among RPL patients and
controls……………………….…………………………………………………………….57
4.3.3. Hardy-Weinberg equilibrium in factor V (A4070G) gene polymorphism…..….....58
4.4. Factor V (G1691A)/ Factor V (A4070G) gene polymorphism…………………….59
4.4.1. Genotype frequency of factor V (G1691A) and Factor V (A4070G) polymorphisms
among RPL patients and controls…………………………….……………………………59
4.4.2. Alleles frequency of factor V (G1691A) and A4070G polymorphism among RPL
patients and controls……………………………………………………………………….61
4.5. Independent effects of factor V (G1691A) and (A4070G)
polymorphisms….…………………………………………………………………..62
4.6. Factor V (A5279G) gene polymorphism…………………………………………..64
4. 6.1. Genotype frequency of the factor V (A5279G) polymorphism among RPL patients
and controls………………………………………………………………………………..64
![Page 13: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/13.jpg)
X
4.6.2. Alleles frequency of factor V (A5279G) polymorphism among RPL patients and
controls………………………………………..……………………………………………66
4.6.3. Hardy-Weinberg equilibrium in factor V (A5279G) gene polymorphism………..67
4.7. Factor II (G20210A) gene polymorphism…………………………..…………….68
4.7.1. Genotype frequency of factor II(G20210A) polymorphism among RPL patients
and controls…………………………….……………………………………….……68
4.7.2. Alleles frequency of factor II (G20210A) polymorphism among RPL patients and
controls………………………………………………………………………………70
4.7.3. Hardy-Weinberg equilibrium in factor II (G20210A) gene polymorphism……….71
4.8. Factor XI rs3756008 A< T gene polymorphism………………………….………..72
4.8.1. Genotype frequency of factor XI rs3756008 A< T polymorphism among RPL
patients and controls………………..……………………………………………………..72
4.8.2. Alleles frequency of factor XI rs3756008 A< T polymorphism among RPL patients
and controls………………………………………………….……………………………..74
4.8.3. Hardy-Weinberg equilibrium in factor XI rs3756008 A< T gene polymorphism…75
Chapter Five: Discussion
5.1. The study sample….......................................................................................................77
5.2. Association between factor V: G1691A (R506Q; rs6025) gene polymorphisms and
RPL…………………………………………………………………………………………78
5.3. Association between factor V: H1299R (A4070G) gene polymorphism and RPL……79
5.4. Association between factor V: Y1702C (A5279G) gene polymorphism and RPL……80
5.5. Independent effects of Factor V (G1691A) and (A4070G) polymorphisms…………..81
5.6. Association between factor II: (G20210A) gene polymorphism and RPL..…………...82
5.7. Association between factor XI: rs3756008 (A>T) gene polymorphism and RPL…….83
Chapter Six: Conclusion and Recommendations
6.1. Conclusion......................................................................................................................85
6.2. Recommendations..........................................................................................................86
Chapter Seven: References
References............................................................................................................................87
![Page 14: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/14.jpg)
XI
List of Figures
Fig. 2-1: Location of factor V gene on chromosome 1……………………………. 14
Fig. 2-2: The blood clotting cascade…………………. ……………….……..…… 15
Fig. 2-3:
Fig. 2-4:
Mechanism of Action of Factor V leiden………………………………
Mechanism of action of factor II ………………………………………... 17
19
Fig. 2-5: Location of factor II gene on chromosome 11…………………………. 20
Fig. 2-6:
Location of factor XI gene on chromosome 4…………………………..
23
Fig. 3-1: The PCR-RFLP principle of detecting mutant and wild type alleles……. 35
Fig. 3-2: The recognition site for RsaI restriction enzyme …………………… 36
Fig. 3-3: The recognition site for AccI restriction enzyme …………………….. 39
Fig. 3-4: The PCR-RFLP principle of detecting mutant and wild type alleles 40
Fig. 3-5: The recognition site for MluCI restriction enzyme ………………… 43
Fig. 3-6: The PCR-RFLP principle of detecting mutant and wild type
alleles………………………………………………………………..... 44
Fig. 4-1:
A photograph of ethidium bromide stained 3% agrarose gel showing the
PCR-SSP product for factor V G1691A polymorphisms …..………….
47
Fig. 4-2: A photograph of ethidium bromide stained 3% agrarose gel showing the
PCR-SSP product for factor II G20210A polymorphisms…………….. 48
Fig. 4-3: A photograph of ethidium bromide stained 3% agarose gel showing the
RFLP-PCR product for factor V A4070G polymorphism…………….. 48
Fig. 4-4: A photograph of ethidium bromide stained 3% agarose gel showing the
RFLP-PCR product for factor V A5279G polymorphism……………… 49
Fig. 4-5: A photograph of ethidium bromide stained 3% agarose gel showing the
RFLP-PCR product for factor XI rs3756008 A<T polymorphism…..…. 49
Fig. 4-6:
Frequency of genotypes of factor V (G1691A) polymorphism among
RPL patients--------------------------------------------------
50
![Page 15: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/15.jpg)
XII
Fig. 4-7:
Frequency of genotypes of factor V (G1691A) polymorphism among
control women-----------------------------------------------------
51
Fig. 4-8:
Frequency of genotypes of factor V (A4070G) polymorphism among
RPL patients…………………………………………………….
54
Fig. 4-9:
Frequency of genotypes of factor V (A4070G) polymorphism among
control women………………………………………………….
55
Fig.4-10 Frequency of genotypes of factor V (G1691A)and A4070G
polymorphism among RPL patients--------------------------------------- 58
Fig.4-11
Frequency of genotypes of factor V (G1691A)and A4070G
polymorphism among control women------------------------------------
59
Fig.4-12
Frequency of genotypes of factor V (A5279G) polymorphism among
RPL patients…………………………………………………..
63
Fig.4-13
Frequency of genotypes of factor V (A5279G) polymorphism among
control women……………………………………………….
64
Fig.4-14
Frequency of genotypes of factor II (G20210A) polymorphism among
RPL patients-------------------------------------------------------
67
Fig.4-15
Frequency of genotypes of factor II (G20210A) polymorphism among
control women……………………………………………….
68
Fig.4-16 Frequency of genotypes of factor XI rs3756008 A< T polymorphism
among RPL patients …………………………………. 71
Fig.4-17
Frequency of genotypes of factor XI rs3756008 A< T polymorphism
among control women……………
72
![Page 16: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/16.jpg)
XIII
List of Tables
Table
3-1: Chemicals and reagents…………………....................................................... 24
Table
3-2:
Instruments and disposables………………………………………………….
25
Table
3-3: Nucleotide sequence of the PCR primers…………………………………… 26
Table
3-4:
PCR primers and lengths of PCR products for factor II (G20210A)
polymorphism………………………………………………………………
30
Table
3-5:
PCR components for amplification of the factor II (G20210A)
Polymorphism……………………………………………………………… 30
Table
3-6:
Thermocycler program for PCR amplification of the factor II (G20210A)
polymorphism……………………………………………………………..
30
Table
3-7:
PCR primers and lengths of PCR products for factor V (G1691A) polymorphism……………………………………………………………….
31
Table
3-8:
PCR components for amplification of the factor V (G1691A)
Polymorphism……………………………………………………………......
31
Table
3-9:
Thermocycler program for PCR amplification of the factor V (G1691A) polymorphism……………………………………………………….
32
Table
3-10:
Primer sequences and restriction enzymes for factor V (A4070G)
Polymorphism…………………………………………………………….. 32
Table
3-11:
PCR components for amplification of the factor V (A4070G)
Polymorphism………………………………………………………………
33
Table
3-12:
Thermocycler program for PCR amplification of the factor V (A4070G)
polymorphism…………………………………………………
33
Table
3-13:
The enzymatic digestion components of amplified factor V (A4070G)
gene………………………………………………………………………… 34
Table
3-14:
Primer sequences and restriction enzyme for factor V (A5279G)
Polymorphism………………………………………………………………
37
Table
3-15:
PCR components for amplification of the factor V (A5279G)
Polymorphism……………………………………………………………….
38
Table
3-16:
Thermocycler program for PCR amplification of the factor V (A5279G)
polymorphism…………………………………………………...
38
Table
3-17:
The enzymatic digestion components of amplified factor V (A5279G)
39
![Page 17: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/17.jpg)
XIV
Table
3-18:
Primer sequences and restriction enzyme for factor XI rs3756008 (A>T)
Polymorphism…………………………………………………………….
41
Table
3-19:
PCR components for amplification of factor XI rs3756008
Polymorphism……………………………………………………………
42
Table
3-20:
Thermocycler program for PCR amplification of the factor XI rs3756008
polymorphism………………………………………………..
42
Table
3-21: The enzymatic digestion components of amplified XI rs3756008 43
Table
4-1:
Frequency of genotypes of factor V (G1691A) polymorphism among RPL
patients…………………………………………………….
50
Table
4-2:
Frequency of genotypes of factor V G1691A polymorphism among control
women……………………………………………………………
51
Table
4-3:
Genotype frequency of factor V (G1691A) gene polymorphism among RPL
patients and controls…………………………………………………. 52
Table
4-4:
Alleles frequency of factor V (G1691A) polymorphism among RPL
patients and controls………………………………………………………..
53
Table
4-5:
Observed and expected genotype frequencies of factor V (G1691A)
polymorphism………………………………………………………………. 53
Table
4-6:
Frequency of genotypes of factor V (A4070G) polymorphism among RPL
patients………………………………………………………..
54
Table
4-7:
Frequency of genotypes of factor V A4070G polymorphism among control
women…………………………………………………………… 55
Table
4-8:
Genotype frequency of factor V (A4070G) gene polymorphism among RPL
patients and controls………………………………………………… 56
Table
4-9:
Alleles frequency of Factor V (A4070G) polymorphism among RPL
patients and controls……………………………………………………….
57
Table
4-10:
Observed and expected genotype frequencies of factor V (A4070G)
polymorphism………………………………………………………………
57
Table
4-11:
Frequency of genotypes of Factor V (G1691A)and A4070G polymorphism
among RPL patients ……………………………………… 58
Table
4-12:
Frequency of genotypes of factor V G1691A and A4070G polymorphism
among control women………………………………………………………
59
Table
4-13:
Genotype frequency of factor V (G1691A) and A4070G gene
polymorphism among RPL patients and controls……………………….
60
![Page 18: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/18.jpg)
XV
Table
4-14:
Alleles frequency of factor V (G1691A) and A4070G polymorphism among
RPL patients and controls………………………………………………….
61
Table
4-15:
Genotype frequency of FV variant "A4070G"and "G1691A" among RPL
patients and controls…………………………………………….
61
Table
4-16:
Alleles frequency of the FV "A4070G "and "G1691A" SNPs among RPL
patients and controls……………………………………………………..
62
Table
4-17:
Frequency of genotypes of factor V (A5279G) polymorphism among RPL
patients…………………………………………………..
63
Table
4-18:
Frequency of genotypes of factor V A5279G polymorphism among control
women……………………………………………………….
64
Table
4-19:
Genotype frequency of factor V (A5279G) gene polymorphism among RPL
patients and controls ……………………………………………… 65
Table
4-20:
Alleles frequency of factor V (A5279G) polymorphism among RPL
patients and controls……………………………………………………..
66
Table
4-21:
Observed and expected genotype frequencies of factor V (A5279G)
polymorphism…………………………………………………………….
66
Table
4-22:
Frequency of genotypes of factor II (G20210A) polymorphism among RPL
patients………………………………………………….
67
Table
4-23:
Frequency of genotypes of factor II G20210A polymorphism among control
women……………………………………………………….
68
Table
4-24:
Genotype frequency of factor II (G20210A) gene polymorphism among
RPL patients and controls………………………………………..
69
Table
4-25:
Alleles frequency of factor II (G20210A) polymorphism among RPL
patients and controls ……………………………………………………. 70
Table
4-26:
Observed and expected genotype frequencies of factor II (G20210A)
polymorphism …………………………………………………………… 70
Table
4-27:
Frequency of genotypes of Factor XI rs3756008 A< T polymorphism
among RPL patients……………………………………..
71
Table
4-28:
Frequency of genotypes of factor XI rs3756008 A< T polymorphism among
control women…………………………………………………….
72
![Page 19: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/19.jpg)
XVI
Table
4-29:
Genotype frequency of factor XI rs3756008 A< T gene polymorphism
among RPL patients and controls…………………………………………
73
Table
4-30:
Alleles frequency of factor XI rs3756008 A< T polymorphism among RPL
patients and controls ……………………………………………….. 74
Table
4-31:
Observed and expected genotype frequencies of factor V (A4070G)
polymorphism…………………………………………………………….
75
![Page 20: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/20.jpg)
XVII
Abbreviations APC activated protein C
APS antiphospholipid syndrome
ASRM American Society for Reproductive Medicine
bp base pair
CI Confidence interval
DNA deoxyribonucleic acid
EDTA ethyelenediaminetetraacetic acid
F forward
FVL Factor V leiden
LH luteinizing hormone
LPD Luteal phase defect
MTHFR methylenehydrofolate reductase
OR Odds ratio
PAI-1 Plasminogen activator inhibitor-1
PCOS polycystic ovarian syndrome
PCR polymerase chain reaction
PCR-RFLP polymerase chain reaction- restriction fragment length polymorphism
PCR-SSP polymerase chain reaction- sequence- specific primers
R reverse
RCOG Royal College of Obstetricians and Gynaecologists
RM recurrent miscarriage
RPL recurrent pregnancy loss
rs Reference sequence
SNPs single nucleotide polymorphisms
TORCH Toxoplasmosis, rubella, cytomegalovirus, chlamydia, herpes
VTE venous thromboembolism
WHO World Health Organization
![Page 21: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/21.jpg)
1
Chapter One
Introduction
![Page 22: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/22.jpg)
2
Chapter (1) Introduction
1.1 Overview
Normal pregnancy is associated with major changes in many aspects of
homeostasis all contributing to maintain placental function during pregnancy and to
prevent excessive bleeding during delivery (Prisco et al., 2005).
Recurrent pregnancy loss (RPL) is defined as three or more consecutive pregnancy
losses before the 24th week of gestation (WHO, 2009), however, two or more losses
were also considered in some studies (Abu-Asab et al., 2011). RPL is a devastating
problem, particularly to Palestinian families who are fond of having large families
(Sharif, 2012).
RPL has many possible causes that can be categorized as genetic abnormalities,
hormonal and metabolic disorders, uterine anatomic abnormalities, infectious causes,
immune disorders and thrombophilic disorders (Sharif, 2012). However, more than
50% of the RPL cases remain unexplained (Kovalevsky et al., 2004).
Thrombophilia can be defined as a predisposition to form clots inappropriately.
Thrombotic events are increasingly recognized as a significant source of mortality and
morbidity (Khan and Dickerman, 2006) and women with thrombophilia have been
shown to be at an increased risk of pregnancy loss and possibly other serious obstetric
complications (Kujovich, 2004).
Reasons for clotting of the placental vessels include both acquired and inherited
thrombophilia. Both inherited and combined inherited / acquired thrombophilias are
common, with more than 15% of the white population carrying an inherited
thrombophilic mutation (Ford and Schust, 2009).
![Page 23: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/23.jpg)
3
Chapter (1) Introduction
The most common cause of acquired thrombophilia is antiphospholipid antibodies.
Inherited thrombophilias, on the other hand, can result from gene mutations. Inherited
thrombophilia is further grouped into; inherited defects of coagulation (e.g., Factor V
von Leiden, Factor II Prothrombin, Fibrinogen, Factor XIII), inherited defects of
fibrinolysis (e.g., Plasminogen activator inhibitor-1(PAI-1)), inherited defects of
enzymatic pathway in relation to development of venous thromboembolism (VTE)
and inherited defects of platelets and thrombosis (Human Platelet Antigen-1HPA; also
Known as Integrin beta-3), Methylene tetrahydrofolate reductase “MTHFR”)
(Konecny, 2009).
Inherited thrombophilias are associated with recurrent miscarriage and this
association has been shown to be manifested by total number of mutations rather than
the specific genes involved (Coulam et al., 2006).
1.2 Problem
Recurrent pregnancy loss (RPL) is a worldwide clinical and stressful problem that
has been studied tremendously but the causes and treatment have not been fully
resolved. No unequivocal cause is currently available for more than half of the cases
suffering from RPL (Ledingham et al., 2000; Makino et al., 2004).
1.3 Overall objective
To investigate the relation between recurrent pregnancy loss (RPL) and common
polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C
(A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes.
![Page 24: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/24.jpg)
4
Chapter (1) Introduction
1.4 Specific Objectives
To investigate the association between G1691A, H1299R, Y1702C
polymorphisms in factor V gene and (RPL).
To investigate the association between G20210A polymorphism in factor II
gene and (RPL).
To investigate the association between rs3756008 (A>T) polymorphism in
factor XI gene and (RPL).
To determine the frequency of factor-V G1691A, factor-V H1299R
(A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI
rs3756008 (A>T) polymorphisms in our population.
To develop appropriate recommendations regarding the investigated
polymorphisms and the risk of RPL.
![Page 25: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/25.jpg)
5
Chapter (1) Introduction
1.5 Significance of the study
This study is the first of its kind in Gaza strip and was conducted in order to
determine the incidence of polymorphisms in factor-V G1691A, factor-V H1299R
(A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008
(A>T) genes and to determine the possible association between those polymorphisms
and RPL. The results of the study may help physicians in Gaza Strip to manage RPL
associated with inherited thrombophilia.
![Page 26: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/26.jpg)
6
Chapter Two
Literature Review
![Page 27: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/27.jpg)
7
Chapter (2) Literature Review
2.1. Physiological changes in pregnancy
Pregnancy is ahypercoagulable state (Kupfermic, 2003). There are several
physiological changes that occur in pregnancy that synergistically create a
hypercoagulable state and thus a tendency to clot (Dawood, 2013). Because
pregnancy is a hypercoagulable state, thrombophilia may raise the risk of
thromboembolism during gestation or postpartum (Sibai et al., 2007).
There is a demonstrable increase in the concentrations of hemostatic components such
as von Willebrand factor, factors V, VII, factor X and a dramatic increase is usually
observed in factor VIII C. Increases in the levels of fibrinogen factors II, VII, X and
XII may also be as high as 20-200%. In contrast, endogenous anticoagulant levels
increase minimally. While levels of antithrombin III and protein C remain constant
there is a fall in the free and total protein S antigen (Dawood, 2013).
Normal pregnancy is associated with changes in the coagulation and fibrinolytic
system of hemostasis. These include a decrease in platelet count, increases in a
number of clotting factors, a decrease in anticoagulant factor, protein S, a significant
fall in the activity of activated protein C and inhibition of fibrinolysis. These changes
that result in a state of hypercoagulability are likely due to hormonal changes and
increase the risk of thromboembolism (Prisco et al., 2005; Thornton and Douglas,
2009). A fine balance between coagulation and fibrinolysis is critical in early
pregnancy (Su et al., 2013).
Several studies have demonstrated an association between the presence of
a thrombophilic disorder and adverse obstetric complications such as placental
abruption, stillbirth, preeclampsia and recurrent miscarriage. The hypothesis is that
the pre-existence of a thrombophilic disorder exaggerates the physiologically induced
state of hypercoagulation causing microthrombi that disrupt the uteroplacental
perfusion (Dawood, 2013).
![Page 28: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/28.jpg)
8
Chapter (2) Literature Review
2.2. Pregnancy loss
According to the Royal College of Obstetricians and Gynaecologists (RCOG)
Green-top Guideline No. 17, a miscarriage can be defined as the spontaneous
loss of a pregnancy before the fetus has reached viability at 24 weeks. This
includes all pregnancy losses from the time of conception until 23 completed
weeks of gestation (Kruger et al., 2013).
Miscarriage occurs in approximately 15% of all pregnancies (Saito, 2009).
Pregnancy losses were classified as early (5–12 weeks) and late (13–30 weeks)
(Mahjoub et al., 2005).
2.3. Recurrent pregnancy loss
The American Society for Reproductive Medicine defines RPL as two or more
failed pregnancies, which have been documented by either ultrasound or
histopathological examination (Kruger et al., 2013).
Recurrent pregnancy loss (RPL) represents a major health problem with two-
three or more losses in up to 5% of women of reproductive age and is actually
one of the most common causes of female infertility (Pierpaolo et al., 2009).
Clinical studies indicate that the risk of another miscarriage after 3 consecutive
pregnancy losses is 30-45%. Furthermore, without any workup or treatment, the
chance of a successful live birth in a couple with a history of RPL and no previous
live birth is 55-60%. If the couple has a history of RPL and has had at least one
previous normal pregnancy, the chance of a subsequent live birth is 70%. These
percentages are based on studies of young women, and it is important to keep in mind
that the miscarriage rate increases with age (Evans, 2012).
![Page 29: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/29.jpg)
9
Chapter (2) Literature Review
2.4. Causes of recurrent pregnancy loss
There are several causes for recurrent pregnancy loss that are identifiable and
understood by medical science. However, in many couples the cause of RPL remains
unexplained (Lavigne et al., 2005; Ford and Schust, 2009).
2.4.1. Genetic / chromosomal causes
Embryonic chromosomal abnormalities (structural and numerical) may account
for 30 - 57% of miscarriages. Research has shown that the risk of aneuploidy
increases as the number of previous miscarriages increases. Parental chromosomal
rearrangements are the cause of RPL in 3 - 5% of couples. The most common
abnormalities are balanced reciprocal or Robertsonian translocations (Kruger et al.,
2013).
2.4.2. Anatomic / Uterine abnormalities
Congenital uterine abnormalities have been associated most often with second
trimester pregnancy loss. However, 10-15 % of women with recurrent early
pregnancy loss have congenital uterine abnormalities (Reddy et al., 2006). Congenital
uterine abnormalities include a double uterus, uterine septum, and a uterus in which
only one side has formed. Asherman’s syndrome (scar tissue in the uterine cavity),
uterine fibroids, and possibly uterine polyps are acquired abnormalities that may also
cause recurrent miscarriages. Some of these conditions may be surgically corrected
(ASRM, 2008).
2.4.3. Metabolic and Endocrine abnormalities
Diabetes, hypothyroidism, polycystic ovary syndrome (PCOS), luteal phase defect,
and obesity are classically associated with an increased risk of miscarriage (Shallal
2010). However, a number of designed studies have shown that neither polycystic
ovaries (PCO) nor high luteinizing hormone (LH) levels are a cause for recurrent
miscarriages (Clifford et al., 1996; Rai et al., 2000; Nardo et al., 2002)
![Page 30: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/30.jpg)
10
Chapter (2) Literature Review
2.4.4. Infectious causes
No infectious agent has been proven to cause RPL (Kruger et al., 2013). Some
serious infections can cause or increase the risk of single miscarriages. These include
toxoplasmosis, rubella, listeria and genital infection. But it is not clear whether
infection plays a role in recurrent miscarriage (The Miscarriage Association, 2011).
2.4.5. Environmental and life style causes
Cigarette smoking has been suggested to have an adverse effect on trophoblastic
function and is linked to an increased risk of sporadic pregnancy loss. Obesity has
also been shown to be associated with an increased risk of RPL in women who
conceive naturally. Other life-style habits such as cocaine use, alcohol consumption (3
to 5 drinks per week), and increased caffeine consumption ( > 3 cups of coffee) have
been associated with risk of miscarriage (ASRM, 2012).
2.4.6. Immune causes
Autoimmunity refers to an immune reaction of the body against substances that are
normally present in the body. Numerous studies have attempted to identify specific
autoantibodies associated with pregnancy loss (Kutteh and Odom, 2012).
Among the autoimmune factors, anti-phospholipid antibodies (APAs) have been
demonstrated to be the strongest risk factors for fetal loss, the prevalence of which
is as high as 40% in women with RPL. Other autoimmune antibodies implicated in
RPL are anti-nuclear antibodies (ANAs), anti-thyroid antibodies and anti-endothelial
cell antibodies (Ghosh et al., 2009).
![Page 31: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/31.jpg)
11
Chapter (2) Literature Review
2.4.7. Thrombophilic causes
Thrombophilia is defined as a tendency to develop thrombosis due to predisposing
hereditary and/or acquired risk factors. Although thrombosis may occur in both
veins and arteries, the term thrombophilia is usually considered in the context of
venous thromboembolism (VTE), since most of the well-defined thrombophilic
risk factors are commonly associated with thrombosis in venous blood vessels
(Sandra Margeti, 2014). Thrombophilia and its influence on pregnancy have been
studied for the past 50 years. Both inherited and acquired thrombophilia have been
associated with an increased risk of thrombo-embolism as well as an increased risk of
pregnancy loss and adverse obstetric outcomes (Dawood, 2013).
2.4.8. Unexplained causes
More than half of the couples who have investigations for recurrent miscarriage don’t
come out with an answer as to why they have miscarried (The Miscarriage
Association, 2011).
2.5. Thrombophilia
2.5.1. Definition of thrombophilia
Thrombophilia can be defined as a predisposition to form clots inappropriately.
The predisposition to form clots can arise from genetic factors, acquired changes in
the clotting mechanism, or, more commonly, an interaction between genetic and
acquired factors (Khan et al., 2006). Thrombophilias may be inherited or acquired, or
have components of both types (Foy and Moll, 2009).
![Page 32: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/32.jpg)
12
Chapter (2) Literature Review
2.5.2. Acquired thrombophilia
Acquired thrombophilia refers to a group of disorders that an individual is not born
with, but may develop throughout his or her life due to another illness or situation. An
example of acquired thrombophilia is the development of a lupus anticoagulant or
antiphospholipid antibody syndrome. Several authors underlined the role of the
antiphospholipid syndrome (APS) in the pathophysiology of RPL (D’Uva et al.,
2010). During APS, a large variety of autoantibodies also toward clotting factors,
such as factor XII, has been found (Jones et al., 2001; D’Uva et al., 2005). However, a
clear explanation of all involved processes on the roles of antiphospholipid antibodies
and of autoantibodies toward clotting factors is still a matter of discussion (D’Uva et
al., 2010). On the other hand, a role of increased maternal plasma levels of clotting
factor VIII and the risk of RPL has been reported (Dossenbach - Glaninger et al.,
2004).
2.5.3. Hereditary thrombophilia
Some of the inherited abnormalities of the anticoagulant mechanisms that operate in
plasma are established risk factors for venous thromboembolism. They include anti-
thrombin (AT), protein C (PC), and protein S (PS) deficiencies and the activated PC
(APC) resistance phenomenon attributable (or not) to the presence of the factor V
(FV) Leiden mutation which may be defined as a poor response of plasma to the
anticoagulant action of APC (Tripodi et al., 2001).
![Page 33: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/33.jpg)
13
Chapter (2) Literature Review
2.6. MTHFR mutations
Hyperhomocysteinemia can result from genetic or nutrient-related disturbances in
the trans-sulphuration and remethylation pathways of the homocysteine metabolism.
The enzyme 5,10-methylenetetrahydrofolate reductase (MTHFR) catalyzes the
reduction of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, the
predominant circulatory form of folate and the carbon donor for the remethylation of
homocysteine to methionine (Unfried et al., 2002).
Hyperhomocysteinemia can be seen with deficiencies in vitamins B6, B12, folic
acid, and methylenehydrofolate reductase (MTHFR). Several mutations in the
MTHFR gene (e.g., C677T and A1298C) can be a cause of mild to severe
hyperhomocysteinemia. Homozygosity for MTHFR mutations is a relatively common
cause of mildly elevated plasma homocysteine levels in the general population, often
occurring in association with low serum folate levels. Homozygosity for MTHFR
mutations is common worldwide with an estimated 10-25% prevalence among various
ethnic backgrounds. The risk of embryonic and fetal loss is increased if the MTHFR
gene mutation is combined with additional thrombophilic factors (Rozano-Gorelick et
al., 2009; Carbone and Rampersad, 2010).
![Page 34: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/34.jpg)
14
Chapter (2) Literature Review
2.7. Factor V polymorphisms.
2.7.1. Factor V gene
The gene for factor V is located on the first chromosome (1q23) (Fig. 2-1). It is
genomically related to the family of multi copper oxidases, and is homologous to
coagulation factor VIII. The gene spans 70 kb, consists of 25 exons, and the resulting
protein has a relative molecular mass of approximately 330kDa (Nazemi et al., 2013).
Fig. 2-1: Location of Factor V gene on chromosome 1
(Adopted from Genetic home Reference)
2.7.2. Factor V protein and its structure
The factor V protein is made primarily by cells in the liver. The protein circulates in
the bloodstream in an inactive form until the coagulation system is activated by an
injury that damages blood vessels. When coagulation factor V is activated, it interacts
with coagulation factor X. The active forms of these two coagulation factors (written
as factor Va and factor Xa, respectively) form a complex that converts an important
coagulation protein called prothrombin to its active form, thrombin. Thrombin then
converts a protein called fibrinogen into fibrin, which is the material that forms the
clot (Kane et al., 1982 ) (Fig. 2-2).
![Page 35: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/35.jpg)
15
Chapter (2) Literature Review
Fig. 2-2: The blood coagulation cascade
(Adopted from Makaryus et al., 2013)
![Page 36: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/36.jpg)
16
Chapter (2) Literature Review
2.7.3. Factor V (G1691A) polymorphism
Some people do not have the normal factor V protein. Instead, they have a different
form called factor V Leiden. This is caused by a change (mutation) in the gene for this
protein. The different allele that makes the factor V Leiden protein is inherited from
one or both parents (Hamilton Health Sciences, 2007).
Factor V Leiden (FVL) describes a G1691A nucleotide transition resulting in an
R506Q amino acid missense mutation. Early papers showed that the resulting factor V
protein was resistant to proteolysis by activated protein C (APC), (Fig. 2-3) and it is
now recognized that FVL accounts for 90% to 95% of cases of APC resistance. Factor
V resistance to APC has an incidence of 4.8% in the general population and is the
most common cause of inherited thrombosis, accounting for 40% to 50% of cases
(Rosendorff et al., 2007).
![Page 37: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/37.jpg)
17
Chapter (2) Literature Review
Fig. 2-3: Mechanism of Action of Factor V Leiden (Adopted from
http://www.med.illinois.edu/hematology/ptfacv2.htm)
![Page 38: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/38.jpg)
18
Chapter (2) Literature Review
2.7.4. VR2 (H1299R) polymorphism:
Another polymorphism in the Factor V gene, the His1299Arg polymorphism, has
been identified and linked to hereditary thrombophilia. This exon 13 polymorphism
was first described in 1996 (Lunghi et al., 1996).
The Arg1299 (R2) allele was reported to be more frequent in subjects with reduced
FV activity levels (De Visser et al., 2000). Another study reported that the R2 allele
was associated with a reduced sensitivity for activated protein C "APC" (Bernardi et
al., 1997).
2.7.5. Factor V Y1702C polymorphism
A novel FV gene mutation (5279 A/G) predicting a remarkable amino acid
substitution (Y1702C) in the A3 domain, is considered as a common cause of FV
deficiency in the Italian population, and the causative role of the FV Y1702C
mutation is supported by the absolute conservation of the affected residue in all three
A domains of FV and of homologous factor VIII and ceruloplasmin, and by the
disrupting structural effects of the Y1702C substitution (Castoldi et al., 2001).
![Page 39: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/39.jpg)
19
Chapter (2) Literature Review
2.8. Prothrombin gene (G20210A) mutation (factor II)
It was discovered in 1996 that a specific change in the genetic code causes the body to
produce too much of the prothrombin protein. Having too much prothrombin makes
the blood more likely to clot (Fig. 2-4). People with this condition are said to have
a prothrombin mutation, also called the prothrombin variant, prothrombin
G20210A, or a factor II mutation (Moll et al., 2004). Prothrombin gene mutation is
the second most common cause (after FVL) of inherited thrombophilia in the United
States. It is present in about 2% of Caucasians (Tsiolakidou and Koutroubakis, 2008).
Fig. 2-4: Mechanism of Action of Factor II
(Adopted Wikipedia)
![Page 40: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/40.jpg)
20
Chapter (2) Literature Review
2.8.1. Factor II gene
The F2 gene is located on the short (p) arm of chromosome 11 at position 11. More
precisely, the F2 gene is located from base pair 46,719,191 to base pair 46,739,505 on
chromosome 11(Fig. 2-5) (Genetic home Reference).
Fig. 2-5: Location of Factor II gene on chromosome 11
(Adopted from Genetic home Reference)
2.9. Association between factor V and factor II genes polymorphisms
and RPL.
Ulukufi et al., (2006) reported that the frequency of Factor V Leiden mutation
was significantly higher in the complicated pregnancy group as compared to the
normal group (23.3% vs. 7.5%) (p=0.04). On the other hand, no difference was
detected on the heterozygous MTHFR frequencies between the two groups.
However, 9% of the women with complicated pregnancies had homozygous
mutation and no woman was homozygous for MTHFR in the control group.
Prothrombin gene mutation was found in only one patient from the control group.
![Page 41: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/41.jpg)
21
Chapter (2) Literature Review
Torabi et al., (2009) showed that the prevalence of FV Leiden mutation in the
cases and the controls was 13% and 4%, respectively. The chances for recurrent
pregnancy losses were more than 3.5 times higher in individuals with this
polymorphism (OR: 3.586, 95% CI: 1.127–11.412). The frequencies of FV
A4070G and FV A5279G were 14% and 37% in the case and 4% and 7% in the
control groups, respectively and the chances for RPL were higher in cases with
these two polymorphisms. The proportion of cases with two or three mutations in
the gene in comparison with the controls, showed a significant correlation
between FV Leiden and FV A4070G polymorphisms. Statistical analysis of the
simultaneous effects of the three polymorphisms for RPL showed that evaluation
of FV A4070G and FV A5279G could help assess the chances of the three
mutations for RPL.
Ardestani1 et al., (2013) indicated that the frequency of the factor V Leiden
among cases was 2.5%, which was higher than controls (1.25%), but the
difference was not significant. No factor II G20210 mutation was found among
cases or controls.
Gawish (2013) investigated the frequencies of FVL and FII mutations in relation
to pregnancy loss stages and showed that FVL mutation ratio was high among
cases with early pregnancy loss (26%) followed by the late stage (25%) and
controls (1.4%) that was statistically significant. On the other hand FII mutation
ratio was high among cases with late pregnancy loss (50%) followed by early
(38%) and controls (1.4%) that also was statistically significant. The author
concluded that there is a strong association between the presence of thrombophilic
mutations related to FVL and FII genes among Saudi women.
Wolfa et al., (2003) concluded that FV Leiden mutation was significantly more
common in women with RPL (10%, p = 0.02) and infertility (19%, p = 0.0005) as
compared to controls (2%).
Motee et al., (2007) showed that the prevalence of FVL was significantly higher
in women with RPL in comparison with controls, particularly in the subgroup
with primary RPL, and there is an association between factor V Leiden mutation
and recurrent pregnancy loss.
![Page 42: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/42.jpg)
22
Chapter (2) Literature Review
Abu-Asab et al. (2011) analysis had failed to find a significant association
between FVL, FII, MTHFR; and RPL in either the first or second trimester. FVL
was significantly associated with fetal loss if the loss was a stillbirth.
Kazerooni et al., (2013) showed that hyperinsulinemia, hyperandrogenemia,
hypofibrinolysis, and hyperhomocysteinemia as well as APCR and factor V
Leiden mutations are associated with RPL in patients with PCOS.
Hussein et al., (2010) results provided evidence for a significant correlation
between recurrent miscarriages and Factor V mutation.
Abd Allah and Hassan (2014) instigated the presence of factor V Leiden
mutation in RPL and controls. Their result showed no significant difference
between the two group (8.6% of case vs. 6% of control).
2.10. Factor XI gene
Coagulation factor XI (FXI) is essential for normal function of the intrinsic pathway
of blood coagulation (Kong M et al., 2014). Genetic variants in the FXI gene are risk
factors for venous thrombosis among both Whites and Blacks (Austin et al., 2011).
Hitherto, there is no published studies on the relation between RPL and FXI
rs3756008 (A>T) polymorphism but significant association between this FXI
variation and ischemic stroke has been reported (Hanson et al., 2013).
2.10.1.Chromosomal location of factor XI gene
The FXI gene is located on the long (q) arm of chromosome 4 at position 35 (Fig. 2-6)
(Genetic home Reference).
![Page 43: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/43.jpg)
23
Chapter (2) Literature Review
Fig. 2-6: Location of Factor XI gene on chromosome 4
(Adopted from Genetic home Reference)
2.10.2 Function of factor XI
Factor XI (FXI) is the zymogen of an enzyme (FXIa) that contributes to hemostasis
by activating factor IX. Although bleeding associated with FXI deficiency is
relatively mild, there has been resurgence of interest in FXI because of studies
indicating its contribution to thrombosis and other processes associated with
dysregulated coagulation (Emsley et al., 2010).
Factor XI (FXI) deficiency was first described in the early 1950s. In contrast with the
well-characterized hemophilias, the bleeding disorder was mild, affected both
genders, and spontaneous haemorrhage was not a feature, with bleeding generally
related to surgery or trauma. The disorder is sometimes referred to as
haemophilia C (Gomez et al., 2008).
In terms of its association with pregnancy complications only one published report
was encountered (Dahm et al., 2012) where they found no significant effect of this
SNP on adverse pregnancy outcome. The same report however, showed that another
SNP change in factor XI (rs2289252) is associated with pregnancy-related venous
thrombosis.
![Page 44: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/44.jpg)
24
Chapter Three
Materials and Methods
![Page 45: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/45.jpg)
25
Chapter (3) Materials and methods
3.1. Materials
3.1.1. Chemicals and reagents
Chemicals and reagents used in this study are shown in Table (3-1). All chemicals
were of analytical and molecular biology grade.
Table 3-1: Chemicals and reagents
# Reagent Supplier
1. Wizard ® Genomic DNA Purification Kit Promega (Madison, USA)
2. PCR Go Taq® Green Master Mix Promega (Madison, USA)
3. Agarose Promega (Madison, USA)
4. PCR primers Hy.labs (Rehovot, Israel)
5. Rsal, AccI, MluCI Restrictions enzymes Biolabs (England)
6. Nuclease free water (Sigma USA).
7. Ethidium bromide Promega (Madison, USA)
8. Ethanol 70% (Sigma USA).
9. Absolute Isopropanol (Sigma USA).
![Page 46: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/46.jpg)
26
Chapter (3) Materials and methods
3.1.2. Instruments and Disposables
The present work was carried out in the Genetics lab at the Islamic University of
Gaza. The important instruments and disposables used in the present study are listed
in Table (3-2):
Table 3-2: Instruments and disposables
# Instrument Manufacturer
1. Thermal Cycler Biometra, Germany
2. Electrophoresis chambers and tanks (horizontal) BioRad, USA
3. Electrophoresis power supply BioRad, USA
4. Microcentrifuge Sanyo, UK
5. Microwave Oven L.G, Korea
6. Digital balance AE adam, USA
7. Freezer, refrigerator ORSO, pharml-spain
8. Micropipettes (0.1-2.5μl / 0.5-10μl / 5-50μl / 20-200μl / 100-1000μl) Dragon-lab, USA
9. Safety cabinet N-Biotek,Inc
10. Gel documentation system Vision, Scie-Plas Ltd, UK
11. Microfuge tubes for PCR - thin wall 0.2 mL, 1.5mL
capacity Labcon, USA
12. Nano-drop spectrophotometer Implen, Germany
13. EDTA tubes Hy. Labs. Israel
14. Disposable tips Labcon, USA
![Page 47: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/47.jpg)
27
Chapter (3) Materials and methods
3.1.3. PCR primers
All PCR primers are indicated from 5' to 3' end. Sense primers are marked with (F)
while antisense primers are marked with (R). The primer sequences were obtained
from published studies and are provided in (Table 3-3).
Table 3-3: Nucleotide sequence of the PCR primers
Gene Primer sequence Reference
Factor II
(G20210A)
Common 5’- TCTAGAAACAGTTGCCTGGCAG-3’ (Gawish et al,
2013) Mutant 5’- GCACTGGGAGCATTGAGGATT-3’
Normal 5'- GCACTGGGAGCATTGAGGATC-3'
Factor V
(G1691A)
Common 5'- CTTTCAGGCAGGAACAACACC-3' (Dajani et al,
2012) Mutant 5'- TGGACAAAATACCTGTATACCTT-3'
Normal 5'- GGACAAAATACCTGTATTGCTC-3'
Factor V
(A4070G)
F 5'-TGCTCCTTTATCTCCGAGGACC-3' (Torabi et al,
2009) R 5'-CTCTGGAGGAGTTGATGTTTGTCC-3'
Factor V
(A5279G)
F 5'-CTGTCGGGCTTGGGTCT-3' (Torabi et al,
2009) R 5'-GAAATAACCCCGACTCTTC-3'
FXI
rs3756008
(A<T)
F 5'-TTTGGTTTTCCAGTGAAGCA-3'
This study
R 5'-GTGCCAAGAATGGCTTTCA-3'
![Page 48: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/48.jpg)
28
Chapter (3) Materials and Methods
3.2. Study sample
3.2.1. Study design
The current study is a retrospective case-control study, in which women with RPL
were compared to women without any evidence of abortion.
3.2.2. Study location
Genetics lab.-Islamic University, Gaza strip.
3.2.3. Characteristics of the study sample
The study sample consisted of women from Gaza strip. The case group consisted of
200 women who had at least two or three unexplained RPL ≤20 weeks of gestation,
between 20-35 years old women, and their husbands are not their family relatives.
The control group consisted of 200 women who had at least two live births without
previous history of abortion, The control and case groups were matched in age and all
other possible characteristics. All study sample was recruited from the Genetics lab of
the Islamic university of Gaza.
![Page 49: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/49.jpg)
29
Chapter (3) Materials and Methods
3.2.4. Ethical considerations
Informed consent was taken from all the subjects who participated in the study. The
objective of the study was fully explained to all participants and their consent was
taken.
3.3. Methods
All polymorphisms were tested in the Genetics lab of the Islamic University.
3.3.1. Sample collection
About 3.0 ml of venous blood were drawn into sterile EDTA tubes and mixed gently,
under quality control and safety procedure. EDTA tube was used for genomic DNA
extraction.
3.3.2. DNA extraction
3.3.2.1. DNA purification
Genomic DNA was isolated from blood using Wizard Genomic DNA Purification Kit
(Promega, USA), according to the manufacturer's protocol.
![Page 50: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/50.jpg)
30
Chapter (3) Materials and Methods
3.3.2.2. Detection and quantitation of extracted DNA
The quality of the isolated DNA was determined by running 5 μl of each sample on
ethidium bromide stained 1.0% agarose gel. The DNA sample was then visualized on
a Gel documentation system. DNA concentration was measured using a nano-drop
spectrophotometer.
3.3.3. Genotyping
3.3.3.1. Primers reconstitution
The primers were reconstituted at 2.0 µmol concentration. Primer containers were
first centrifuged at 13,000 rpm for 3 minutes, and then reconstituted with ultra pure
water, vortexed and diluted by transfer of 5 µL of each reconstitute to a new clean
sterile labeled microfuge tube containing 45 µL of ultra pure water, to be at a final
concentration of 2.0 µmol.
3.3.3.2. Determination of factor II (G20210A) polymorphism
Factor II (G20210A) polymorphism was genotyped using PCR sequence-specific
primers (PCR-SSP), which uses two reactions with two sets of primers: one primer is
specific for each allele (allele-specific primer) and is paired with a second common
primer to control for PCR efficiency. The basis of this method is the reduction in the
efficiency of Taq polymerase to amplify DNA when there is a 3’ terminal nucleotide
mismatch between the target DNA and the allele-specific primer. The f II genotype is
identified by the presence or absence of DNA bands after gel electrophoresis of the
PCR products. This method is a relatively simple and inexpensive procedure for f II
genotyping.
3.3.3.2.1. PCR-SSP procedure for factor II (G20210A) polymorphism
Polymerase chain reaction (PCR) was carried out in a total volume of 20 μl. The
primers and lengths of PCR products are shown in (Table 3-4) and the reaction
components were as described in (Table 3-5).
![Page 51: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/51.jpg)
31
Chapter (3) Materials and Methods
Table 3-4: PCR primers and lengths of PCR products for factor II (G20210A)
polymorphism
Primer sequences PCR products size (bp)
Mutant 5’TGGACAAAATACCTGTATACCTT 3’ 340
Common-1 5’ TCTAGAAACAGTTGCCTGGCAG 3’
Normal 5’ GCACTGGGAGCATTGAGGATC 3’ 340
Table 3-5: PCR components for amplification of the factor II (G20210A)
Polymorphism
Reagent Volume (μ𝐥) Final concentration
Common primer 2 20 pmol
Mutant primer / Normal primer 2 20 pmol
Nuclease free water 4 -
PCR master mix (2X) 10 1X
DNA 2 100ng
Total 20
Microfuge tubes were then placed in a thermo cycler and PCR amplification was
carried out in the Hybrid Touch down PCR according to the program provided in
(Table 3-6).
Table 3-6: Thermocycler program for PCR amplification of the factor II
(G20210A) polymorphism
No. of cycles Temperature (ºC) Time
1 95 10 min
10
94 30 sec
60 30 sec
72 1 min
25
94 30 sec
55 30 sec
72 1 min
1 72 7min
![Page 52: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/52.jpg)
32
Chapter (3) Materials and Methods
3.3.3.3. Determination of factor V (G1691A) polymorphism
Factor V (G1691A) polymorphism was genotyped using PCR sequence-specific
primers (PCR-SSP), which uses two reactions with two sets of primers: one primer is
specific for each allele (allele-specific primer) and is paired with a second common
primer to control for PCR efficiency. The basis of this method is the reduction in the
efficiency of Taq polymerase to amplify DNA when there is a 3’ terminal nucleotide
mismatch between the target DNA and the allele-specific primer. The F V genotype is
identified by the presence or absence of DNA bands after gel electrophoresis of the
PCR products. This method is a relatively simple and inexpensive procedure for F V
genotyping.
3.3.3.3.1. PCR-SSP procedure for factor V (G1691A) polymorphism
Polymerase chain reaction (PCR) was carried out in a total volume of 20 μl. The
primers and lengths of PCR products are shown in (Table 3-7) and the reaction
components were as described in (Table 3-8).
Table 3-7: PCR primers and lengths of PCR products for Factor V (G1691A) polymorphism
Primer sequences PCR products size (bp)
Mutant 5’ GCACTGGGAGCATTGAGGATT 3’ 233
Common-1 5’ CTTTCAGGCAGGAACAACACC 3’
Normal 5’ GGACAAAATACCTGTATTGCTC 3’ 233
Table 3-8: PCR components for amplification of the Factor V (G1691A) Polymorphism
Reagent Volume (μ𝐥) Final concentration
Common primer 2 20 pmol
Mutant primer / Normal primer 2 20 pmol
Nuclease free water 4 -
PCR master mix (2X) 10 1X
DNA 2 100ng
Total 20
![Page 53: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/53.jpg)
33
Chapter (3) Materials and Methods
Microfuge tubes were then placed in a thermo cycler and PCR amplification was
carried out in the Hybrid Touch down PCR according to the program provided in
(Table 3-9).
Table 3-9: Thermocycler program for PCR amplification of the Factor V
(G1691A) polymorphism
No. of cycles Temperature (ºC) Time
1 95 10 min
10
94 30 sec
60 30sec
72 1 min
25
94 30 sec
55 30sec
72 1 min
1 72 7min
3.3.3.4. Determination of factor V (A4070G) Polymorphism
Polymorphism of factor V (A4070G) was genotyped using standard polymerase chain
reaction (PCR)/restriction fragment length polymorphism (RFLP) protocol (PCR
followed by digestion with restriction enzyme). The primers, lengths of PCR
products, related restriction enzymes, as well as digested bands are shown in (Table
3-10). PCR products were digested with restriction enzymes following the
manufacturer’s instructions.
Table 3-10: Primer sequences and restriction enzymes for Factor V (A4070G)
Polymorphism
Primer sequences PCR
products
Restriction
enzymes Digested bands
F:5’GCTCCTTTATCTCCGAGGACC3'
R:5'CTCTGGAGGAGTTGATGTTTGTCC3'
1613bp RsaI
A allele 1483+130bp
G allele 862+576+130bp
![Page 54: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/54.jpg)
34
Chapter (3) Materials and Methods
3.3.3.4.1. Factor V (A4070G) PCR-RFLP procedure:
3.3.3.4.1. 1. Polymerase Chain Reaction (PCR) for factor V (A4070G):
Polymerase chain reaction (PCR) was carried out in a total volume of 20 μl, the
reaction components were as described in (Table 3-11).
Table 3-11: PCR components for amplification of the factor V (A4070G)
Polymorphism
Reagent Volume (μl) Final concentration
Forward primer 2 20 pmol
Reverse primer 2 20 pmol
Nuclease free water 4 -
PCR mastermix 10 1X
DNA 2 100ng
Microfuge tubes were then placed in a thermocycler and PCR amplification was
performed according to the program provided in (Table 3-12).
Table 3-12: Thermocycler program for PCR amplification of the factor V
(A4070G) polymorphism.
No. of cycles Temperature (ºC) Time
1 95 5 min.
35
94 1min.
60 40 sec.
72 40 sec.
1 72 7 min.
![Page 55: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/55.jpg)
35
Chapter (3) Materials and Methods
3.3.3.4.1.2 Restriction Fragment Length Polymorphism (RFLP) by RsaI
restriction enzyme
RFLP of Factor V (A4070G) polymorphism was carried out in a reaction mixture in a
final volume of 20μl by mixing PCR product with 10X Buffer, nuclease free water
and the restriction endonuclease RsaI. The quantities and volumes were as shown in
(Table 3-13).
Table 3-13: The enzymatic digestion components of amplified Factor V
(A4070G) gene
Reagent Volume (μl) Final concentration
PCR product 10 3µg
10X Buffer 2 1X
Restriction endonuclease RsaI 0.5 1u/1 µg
Nuclease free water 7.5 -
Microfuge tubes were then placed in a thermocycler at 37ºC overnight to allow the
restriction endonuclease to digest the PCR product. Figure 3-1 shows the mechanism
of restriction endonuclease and Figure 3-2 shows the recognition site for RsaI
restriction enzyme.
![Page 56: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/56.jpg)
36
Chapter (3) Materials and Methods
Figure 3-1: The PCR-RFLP principle of detecting mutant and wild type alleles.
I. Heterozygote: four bands indicating that the PCR products were cut at
three site.
II. Homozygote for normal allele: two bands indicating that product was cut
at one site.
III. Homozygote for abnormal allele: three band indicating that the product
was cleaved at two site.
![Page 57: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/57.jpg)
37
Chapter (3) Materials and Methods
Figure 3-2: The recognition site for RsaI restriction enzyme
Digested PCR product was then electrophoresed on 3.0% agarose gel and was
visualized by ethidium bromide staining.
3.3.3.4.2. Agarose gel electrophoresis (3.0%)
1. Dried agarose gel (2.4 gm) was dissolved in 80 ml 1x Tirs-Acetate-EDTA buffer
(2M Tris base 1M Glacial Acetic Acid, 0.05 M EDTA) by heating.
2. Then 4.0μl Ethidium Bromide(10mg/ml) was added and mixed, the gel was casted
into a mold which was fitted with a well forming comb.
3. The agarose gel was submerged in electrophoresis buffer within a horizontal
electrophoresis apparatus.
4. After amplification, the PCR products and a DNA ladder size marker (Promega,
Madison, WI, USA) were loaded into the sample wells to aid in fragment size
determination.
5. PCR fragments were detected by size in the agarose gel.
6. Electrophoresis was performed by using Electrophoresis power supply (BioRad,
USA) at 70 volts for 40 min at room temperature, and the DNA bands were
visualized and documented using a UV trans-illuminator documentation system.
![Page 58: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/58.jpg)
38
Chapter (3) Materials and Methods
For factor V (A4070G) detection, a segment of chromosome 1 which contains the
base pair substitution A4070G was amplified using the primer set presented in Table
3-12 and the PCR product (1613) was digested using RsaI restriction enzyme which
cuts the wild allele into two segments (1483 bp and 130bp) but cuts the mutant allele
into three segments (862+576+130 bp) while the heterozygotes should produce four
bands (1483bp, 862bp, 576bp, 130bp).
3.3.3.5. Determination of factor V (A5279G) Polymorphism
Polymorphism of factor V (A5279G) was genotyped using standard polymerase chain
reaction (PCR)/restriction fragment length polymorphism (RFLP) protocol (PCR
followed by digestion with restriction enzyme). The primers, lengths of PCR
products, related restriction enzymes, as well as digested bands are shown in (Table
3-14). PCR products were digested with restriction enzymes following the
manufacturer’s instructions.
Table 3-14: Primer sequences and restriction enzyme for factor V (A5279G)
Polymorphism
Primer sequences PCR
products
Restriction
enzymes Digested bands
F:5’-CTGTCGGGCTTGGGTCT-3'
R:5-'GAAATAACCCCGACTCTTC-3'
120 AccI
A allele 120 bp
G allele 105+15 bp
3.3.3.5.1. Factor V (A5279G) PCR-RFLP procedure:
3.3.3.5.1. 1. Polymerase Chain Reaction (PCR) for Factor V (A5279G):
Polymerase chain reaction (PCR) was carried out in a total volume of 20 μl, the
reaction components were as described in (Table 3-15).
![Page 59: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/59.jpg)
39
Chapter (3) Materials and Methods
Table 3-15: PCR components for amplification of the factor V (A5279G)
Polymorphism
Reagent Volume (μl) Final concentration
Forward primer 2 20 pmol
Reverse primer 2 20 pmol
Nuclease free water 4 -
PCR mastermix 10 1X
DNA 2 100ng
Microfuge tubes were then placed in a thermocycler and PCR amplification was
started according to the program provided in (Table 3-16).
Table 3-16: Thermocycler program for PCR amplification of the factor V
(A5279G) polymorphism.
No. of cycles Temperature (ºC) Time
1 95 5 min.
35
94 1min.
62 40 sec.
72 40 sec.
1 72 7 min.
3.3.3.5.1.2 Restriction Fragment Length Polymorphism (RFLP) by AccI
restriction enzyme
RFLP of Factor V (A5279G) Polymorphism was carried out in a reaction mixture in a
final volume of 20μl by mixing PCR product with 10X Buffer, nuclease free water
and the restriction endonuclease AccI. The quantities and volumes were as shown in
(Table 3-17).
![Page 60: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/60.jpg)
40
Chapter (3) Materials and Methods
Table 3-17: The enzymatic digestion components of amplified factor V (A5279G)
Reagent Volume (μl) Final concentration
PCR product 10 3µg
10X Buffer 2 1X
Restriction endonuclease AccI 0.5 1u/1 µg
Nuclease free water 7.5 -
Microfuge tubes were then placed in a thermocycler at 37ºC overnight to allow the
restriction endonuclease to digest the PCR product. Figure 3-4 shows the mechanism
of restriction endonuclease and Figure 3-3 shows the recognition site for AccI
restriction enzyme.
Figure 3-3: The recognition site for AccI restriction enzyme
(M: A or C; K: G or T)
![Page 61: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/61.jpg)
41
Chapter (3) Materials and Methods
Figure 3-4: The PCR-RFLP principle of detecting mutant and wild type alleles
I. Heterozygote: three bands indicating that half of the PCR products
were cut (abnormal allele) and the other half weren't (normal allele).
II. Homozygote for normal allele: one band indicating that there was no
cleavage happened.
III. Homozygote for abnormal allele: two bands indicating that the
product was completely cleaved.
Digested PCR product was then electrophoresed on 3.0% agarose gel and
was visualized by ethidium bromide staining.
![Page 62: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/62.jpg)
42
Chapter (3) Materials and Methods
For factor V (A5279G) detection, a segment of chromosome 1 which contains the
base pair substitution A5279G was amplified using the primer set presented in Table
3-16 and the PCR product (120 bp) was restricted using AccI restriction enzyme
which cuts the mutnt allele into two segments (105 bp and 15 bp) but doesn't cut the
wild allele. Homozygous for the normal allele should yield one band (120 bp) while
the heterozygotes should produce three bands (120 bp, 105 bp, and 15 bp).
Homozygotes for the mutant allele should give two bands (105 bp and 15 bp).
3.3.3.6. Determination of factor XI rs3756008 (A>T) Polymorphism
Polymorphism of Factor XI rs3756008 (A>T) was genotyped using standard
polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP)
protocol (PCR followed by digestion with restriction enzyme). The primers, lengths
of PCR products, related restriction enzymes, as well as digested bands are shown in
(Table 3-18). PCR products were digested with restriction enzymes following the
manufacturer’s instructions.
Table 3-18: Primer sequences and restriction enzyme for factor XI rs3756008
(A>T) Polymorphism
Primer sequences PCR
products
Restriction
enzymes Digested bands
F:5’-TTTGGTTTTCCAGTGAAGCA-3'
R:5-'GTGCCAAGAATGGCTTTCA-3'
194 MluCI
A allele 194 bp
T allele 131+63 bp
3.3.3.6.1. Factor XI rs3756008 (A>T) PCR-RFLP procedure:
3.3.3.6.1. 1. Polymerase Chain Reaction (PCR) for factor XI rs3756008
(A>T):
Polymerase chain reaction (PCR) was carried out in a total volume of 20 μl, the
reaction components were as described in (Table 3-19).
![Page 63: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/63.jpg)
43
Chapter (3) Materials and Methods
Table 3-19: PCR components for amplification of the factor XI rs3756008
Polymorphism
Reagent Volume (μl) Final concentration
Forward primer 2 20 pmol
Reverse primer 2 20 pmol
Nuclease free water 4 -
PCR mastermix 10 1X
DNA 2 100ng
Microfuge tubes were then placed in a thermocycler and PCR amplification was
started according to the program provided in (Table 3-20).
Table 3-20: Thermocycler program for PCR amplification of the factor XI
rs3756008 polymorphism.
No. of cycles Temperature (ºC) Time
1 95 5 min.
35
94 1min.
62 40 sec.
72 40 sec.
1 72 7 min.
3.3.3.6.1.2 Restriction Fragment Length Polymorphism (RFLP) by MluCI
restriction enzyme
RFLP of Factor XI rs3756008 Polymorphism was carried out in a reaction mixture in
a final volume of 20μl by mixing PCR product with 10X Buffer, nuclease free water
and the restriction endonuclease MluCI. The quantities and volumes were as shown
in (Table 3-21).
![Page 64: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/64.jpg)
44
Chapter (3) Materials and Methods
Table 3-21: The enzymatic digestion components of amplified XI rs3756008
Reagent Volume (μl) Final concentration
PCR product 10 3µg
10X Buffer 2 1X
Restriction endonuclease MluCI 0.5 1u/1 µg
Nuclease free water 7.5 -
Microfuge tubes were then placed in a thermocycler at 37ºC overnight to allow the
restriction endonuclease to digest the PCR product. Figure 3-5 shows the mechanism
of restriction endonuclease and Figure 3-6 shows the recognition site for MluCI
restriction enzyme.
Figure 3-5: The recognition site for MluCI restriction enzyme
![Page 65: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/65.jpg)
45
Chapter (3) Materials and Methods
Figure 3-6: The PCR-RFLP principle of detecting mutant and wild type alleles
I. Heterozygote: three bands indicating that half of the PCR products
were cut (abnormal allele) and the other half weren't (normal allele).
II. Homozygote for normal allele: one band indicating that there was no
cleavage happened.
III. Homozygote for abnormal allele: two bands indicating that the
product was completely cleaved.
Digested PCR product was then electrophoresed on 3.0% agarose gel and
was visualized by ethidium bromide staining.
![Page 66: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/66.jpg)
46
Chapter (3) Materials and Methods
For factor XI rs3756008 detection, a segment of chromosome 4 which contains the
base pair substitution A<T was amplified using the primer set presented in Table 3-
20 and the PCR product (194 bp) was restricted using MluCI restriction enzyme
which cuts the mutant allele into two segments (131 bp and 63 bp) but doesn't cut the
wild allele. Homozygous for the normal allele should yield one band (194 bp) while
the heterozygotes should produce three bands (194 bp, 131 bp, and 63 bp).
Homozygotes for the mutant allele should give two bands (131 bp and 63 bp).
3.4 Statistical analysis
The Hardy-Weinberg equilibrium (HWE) equation was used to calculate the expected
genotype frequency. Difference between expected and observed genotypes was
assessed by X2 test. P-value less than 0.05 was considered statistically significant.
The frequencies of the alleles and genotypes were compared between patient and
control groups by the Chi square test when appropriate. The odds ratio (OR) and 95%
confidence interval (CI) were also estimated in order to test the relation between RPL
and the investigated polymorphisms.
![Page 67: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/67.jpg)
47
Chapter Four
Results
![Page 68: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/68.jpg)
48
Chapter (4) Results
4.1. PCR Genotyping results
The following figures are representative examples of the Factor V G1691A, FII
G20210A, factor V A4070G, factor V A5279G and FXI gene polymorphisms
investigated in this study.
Figures (4-1), (4-2), (4-3), (4-4), and (4-5) show representative PCR results for the
genotyping of the Factor V G1691A, FII G20210A, factor V A4070G, factor V
A5279G and FXI gene polymorphisms, respectively.
Fig 4-1: A photograph of ethidium bromide stained 3% agrarose gel showing the PCR-SSP
product for factor V G1691A polymorphisms, M= 50bp DNA ladder, sample 1 indicates a
homozygous GG, sample 2 indicates heterozygous GA, sample 3 indicates homozygous AA
and sample 4 indicates control.
A G A G A G A G
233bp
1
G/G
2
A/G
3
A/A
4
Negative
M
200
0 100 50
![Page 69: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/69.jpg)
49
Chapter (4) Results
Fig 4-2: A photograph of ethidium bromide stained 3% agrarose gel showing the PCR-SSP
product for factor II G20210A polymorphisms, M= 50bp DNA ladder, sample 1 indicates a
homozygouss GG, sample 2 indicates heterozygous GA, sample 3 indicates
control.
Fig 4-3: A photograph of ethidium bromide stained 3% agarose gel showing the RFLP-
PCR product for factor V A4070G polymorphism, M= 50bp DNA ladder, lane1 indicates a
heterozygous sample for GA, lane 2 indicates a homozygous AA and lane 3 indicates a
control.
M A G G A A G
100 50
200 340bp
1
G/G
2
A/G
3
Negative
576bp
130bp
M
1483bp
50bp 100bp
862bp
200bp
1
G/A
2
A/A
3
Negative
![Page 70: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/70.jpg)
50
Chapter (4) Results
Fig 4-4: A photograph of ethidium bromide stained 3% agarose gel showing the RFLP-
PCR product for factor V A5279G polymorphism, M= 50bp DNA ladder, lane1 indicates a
homozygous sample for GG, lane 2 indicates a heterozygous AG, lane 3 indicates a
homozygous for AA and lane 4 a indicates a control.
Fig 4-5: A photograph of ethidium bromide stained 3% agarose gel showing the RFLP-PCR
product for factor XI rs3756008 A<T polymorphism, M= 50bp DNA ladder, lane1 indicates a
heterozygous sample for AT, lane 2 indicates a homozygous for AA, lane 3 indicates a
homozygous for TT and lane 4 a indicates a control.
200bp
100bp
50bp
194bp 131bp
63bp
4
Negative
2
A/A
3
T/T
4
Negative
M
M 1
G/G
2
A/G
3
A/A
1
A/T
100bp 200bp 120bp
105bp 50bp
![Page 71: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/71.jpg)
51
Chapter (4) Results
4.2. Factor V (G1691A) gene polymorphism:
4.2.1. Genotype frequency of factor V (G1691A) polymorphism among
RPL patients and controls
Table (4 -1) and (Fig. 4-6) illustrate the genotype frequencies of the factor-V
G1691A gene polymorphism among RPL patients. The frequency of the wild type
GG was 80.5 %, the frequency of the heterozygote GA was 18.5% while, the
frequency of the homozygotes for the polymorphic allele AA was 1.0 % in RPL
women.
Table 4-1: Frequency of genotypes of Factor V (G1691A) polymorphism
among RPL patients
Genotype Frequency Percent %
AA 2 1.0
GA 37 18.5
GG 161 80.5
Total 200 100.0
Fig 4-6: Frequency of genotypes of factor V (G1691A) polymorphism among
RPL patients
0
10
20
30
40
50
60
70
80
90
1
18.5
80.5
AA
GA
GG
![Page 72: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/72.jpg)
52
Chapter (4) Results
Table (4 -2) and (Fig. 4-7) illustrate the frequencies of genotype of the factor-V
G1691A gene polymorphism among control women. The frequency of the wild type
GG was 90.0 %, the frequency of the heterozygotes (GA) was 9.5 % while, the
frequency of the homozygotes for the polymorphic allele AA was 0.5 %.
Table 4-2: Frequency of genotypes factor V G1691A polymorphism among
control women
Genotype Frequency Percent %
AA 1 0.5
GA 19 9.5
GG 180 90.0
Total 200 100.0
Fig 4-7: Frequency of genotypes of factor V (G1691A) polymorphism among
control women
0
10
20
30
40
50
60
70
80
90
0.05
9.5
90
AA
GA
GG
![Page 73: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/73.jpg)
53
Chapter (4) Results
Table (4-3) illustrates genotypes frequency, odds ratio (OR), 95% confidence
intervals (CI) and P value of factor V (G1691A) gene polymorphism among RPL
patients and controls. The statistical analysis of frequency of factor V (G1691A) gene
polymorphism among RPL patients and control showed that the difference was
significant for the GG and GA genotypes. The AA genotype, however, was not
significantly different between the two groups.
Table 4-3: Genotype frequency of factor V (G1691A) gene polymorphism among
RPL patients and controls.
G1691A
Genotype
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI)
P-value
GG 161(80.5%) 180 (90.0%) 0.46 (0.26 to 0.82) 0.01
GA 37(18.5%) 19 (9.5%) 2.16 (1.20 to 3.90) 0.01
AA 2 (1.0%) 1 (0.5%) 2.01 (0.18 to 22.35) 0.57
4.2.2. Alleles frequency of factor V (G1691A) polymorphism among RPL
patients and controls
Table (4-4) illustrates alleles frequency, odds ratio, 95% confidence intervals and P
value of factor V (G1691A) polymorphism among RPL patients and controls. The
statistical analysis of allele frequency of the factor V (G1691A) gene polymorphism
among RPL patients and controls showed that the difference was significant (P-value
= 0.01) between the two groups.
![Page 74: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/74.jpg)
54
Chapter (4) Results
Table 4-4: Alleles frequency factor V (G1691A) polymorphism among RPL
patients and controls
G1691A
allele
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI) P- value
G 359 (89.75%) 379 (94.75%)
2.06 (1.19 to 3.56) 0.0093
A 41 (10.25%) 21 (5.25%)
4.2.3. Hardy-Weinberg equilibrium in factor V (G1691A) gene
polymorphism
Frequency of major allele G (p) = 180x2 + 19x1/200x2 = 0.95
Frequency of minor allele A (q) = 1x2 + 19x1/200x2 = 0.05
p + q = 1
(p + q)2 = 1
P2 + 2pq + q
2
Expected genotype frequencies:
Genotype GG: p2 x200 = (0..95)
2 X 200 = 180.5
Genotype GA: 2pq x200 = 2X0.95X 0..05X 200 = 19
Genotype AA: q2 x200 = (0.05)
2X 200 = 0.5
Table (4-5) illustrates the observed and expected genotype frequencies of factor V
(G1691A) gene polymorphism in control women with P-value = 0.523. This shows
that there is no significant deviation from Hardy-Weinberg equilibrium, so the
distribution of Factor V (G1691A) genotypes are in Hardy-Weinberg equilibrium.
Table 4-5: Observed and expected genotype frequencies of factor V (G1691A)
polymorphism
GG GA AA
Observed genotype 180 19 1
Expected genotype 180.5 19 0.5
P- value = 0.523 Chi square: X2 = 0.406 with 1degrees of freedom
![Page 75: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/75.jpg)
55
Chapter (4) Results
4.3. Factor V (A4070G) gene polymorphism:
4.3.1. Genotype frequency of factor V (A4070G) polymorphism among
RPL patients and controls
Table (4 -6) and (Fig. 4-8) illustrate the genotype frequencies of the factor V A4070G
gene polymorphism among RPL patients. The frequency of the wild type AA was
86.5 %, the frequency of the heterozygote GA was 13.5% while, the frequency of the
homozygotes for the polymorphic allele GG was 0.0 % in RPL women.
Table 4-6: Frequency of genotypes of factor V (A4070G) polymorphism
among RPL patients
Genotype Frequency Percent %
GG 0 0.0
GA 27 13.5
AA 173 86.5
Total 200 100.0
Fig 4-8: Frequency of genotypes of factor V (A4070G) polymorphism among
RPL patients
0
10
20
30
40
50
60
70
80
90
0
13.5
86.5
GG
GA
AA
![Page 76: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/76.jpg)
56
Chapter (4) Results
Table (4 -7) and (Fig. 4-9) illustrate the frequencies of genotype of the factor V
A4070G gene polymorphism among control women. The frequency of the wild type
AA was 95.5 %, the frequency of the heterozygotes (GA) was 4.5 % while, the
frequency of the homozygotes for polymorphic allele GG was 0.0 %.
Table 4-7: Frequency of genotypes factor V A4070G polymorphism among
control women
Genotype Frequency Percent %
GG 0 0.0
GA 9 4.5
AA 191 95.5
Total 200 100.0
Fig 4-9: Frequency of genotypes of factor V (A4070G) polymorphism among
control women
0
10
20
30
40
50
60
70
80
90
100
0
4.5
95.5
GG
GA
AA
![Page 77: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/77.jpg)
57
Chapter (4) Results
Table (4-8) illustrates genotypes frequency, odds ratio (OR), 95% confidence
intervals (CI) and P value of factor V (A4070G) gene polymorphism among RPL
patients and controls. The statistical analysis of frequency of the Factor V (A4070G)
gene polymorphism among RPL patients and control showed that the difference was
significant in the two genotype AA, GA, and GG was not significant between the two
groups.
Table 4-8.: Genotype frequency of factor V (A4070G) gene polymorphism among
RPL patients and controls.
A4070G
Genotype
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI)
P-value
AA 173 (86.5%) 191 (95.5%) 0.302 (0.66 to 1.38) 0.003
GA 27 (13.5%) 9 (4.5%) 3.31 (1.52 to 7.24) 0.003
GG 0 (0.0%) 0 (0.0%) 1.00 (0.19 to 50.65) 1.000
4.3.2. Alleles frequency of factor V (A4070G) polymorphism among RPL
patients and controls
Table (4-9) illustrates alleles frequency, odds ratio, 95% confidence intervals and P
value of factor V (A4070G) polymorphism among RPL patients and controls. The
statistical analysis of allele frequency of the factor V (A4070G) gene polymorphism
among RPL patients and controls showed that the difference was significant
( P-value = 0.003) between the two groups.
![Page 78: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/78.jpg)
58
Chapter (4) Results
Table 4-9: Alleles frequency of factor V (A4070G) polymorphism among RPL
patients and controls
A4070G
allele
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI) P- value
A 373 (93.25%) 391 (97.75%)
3.14 (1.46 to 6.78) 0.003
G 27 (6.75%) 9 (2.25%)
4.3.3. Hardy-Weinberg equilibrium in factor V (A4070G) gene
polymorphism
Frequency of major allele A (p) = 191x2 + 9x1/200x2 = 0.9775
Frequency of minor allele G (q) = 0x2 + 9x1/200x2 = 0.0225
p + q = 1
(p + q)2 = 1
P2 + 2pq + q
2
Expected genotype frequencies:
Genotype AA: p2 x200 = (0.9775)
2 X 200 = 191.1
Genotype GA: 2pq x200 = 2X0.9775X 0..0225X 200 = 8.8
Genotype GG: q2 x200 = (0.0225)
2X 200 = 0.1
Table (4-10) illustrates the observed and expected genotype frequencies of factor V
(A4070G) gene polymorphism in control women with P-value = 0.744. This shows
that there is no significant deviation from Hardy-Weinberg equilibrium, so the
distribution of factor V (A4070G) genotypes are in Hardy-Weinberg equilibrium.
Table 4-10: Observed and expected genotype frequencies of factor V (A4070G)
polymorphism
AA GA GG
Observed genotype 191 9 0
Expected genotype 191.1 8.8 0.1
P- value = 0.744 Chi square: X2 = 0.106 with 1degrees of freedom
![Page 79: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/79.jpg)
59
Chapter (4) Results
4.4. Factor V (G1691A)/ Factor V (A4070G) gene polymorphism:
4.4.1. Genotype frequency of factor V (G1691A) and factor V
(A4070G) polymorphisms among RPL patients and controls
Table (4-11) and (Fig. 4-10) illustrate the genotype frequencies of the factor V
G1691A and A4070G gene polymorphism among RPL patients. The frequency of the
wild type GG/AA was 69.0 %, the frequency of the heterozygote GA was 30.0%
while, the frequency of the homozygotes for the polymorphic allele AA/GG was 1.0
% in RPL women.
Table 4-11: Frequency of genotypes of factor V (G1691A)and A4070G polymorphism among RPL patients
Genotype Frequency Percent %
AA/GG 2 1.0
GA 60 30.0
GG/AA 138 69.0
Total 200 100.0
Fig 4-10: Frequency of genotypes of factor V (G1691A) and A4070G
polymorphism among RPL patients
0
10
20
30
40
50
60
70
1
30
69
AA/GG
GA
GG/AA
![Page 80: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/80.jpg)
60
Chapter (4) Results
Table (4 -12) and (Fig. 4-11) illustrate the frequencies of factor V G1691A and
A4070G gene polymorphisms among control women. The frequency of the wild type
GG/AA was 86.0 %, the frequency of the heterozygotes (GA) was 13.5 % while, the
frequency of the homozygotes for polymorphic allele AA/GG was 0.5 %.
Table 4-12: Frequency of genotypes factor V G1691A and A4070G
polymorphism among control women
Genotype Frequency Percent %
AA/GG 1 0.5
GA 27 13.5
GG/AA 172 86.0
Total 200 100.0
Fig 4-11: Frequency of genotypes of factor V (G1691A) and A4070G
polymorphism among control women
0
10
20
30
40
50
60
70
80
90
0.05
13.5
86
AA/GG
GA
GG/AA
![Page 81: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/81.jpg)
61
Chapter (4) Results
Table (4-13) illustrates genotypes frequency, odds ratio (OR), 95% confidence
intervals (CI) and P value of the Factor V (G1691A) and A4070G gene polymorphism
among RPL patients and controls. The statistical analysis of frequency of the Factor V
(G1691A) and A4070G gene polymorphism among RPL patients and control showed
that the difference was significant in the two genotype GG/AA, GA, and AA/GG was
not significant between the two groups.
Table 4-13: Genotype frequency of factor V (G1691A)and A4070G gene
polymorphism among RPL patients and controls.
A4070G/
"G1691A"
Genotype
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI)
P-value
AA/GG 138 (69.0%) 172 (86.0%) 0.362 (0.22 to 0.59) 0.0001
GA 60 (30.0%) 27 (13.5%) 2.746 (1.66 to 4.55) 0.0001
GG/AA 2(1.0%) 1 (0.5%) 2.01 (0.18 to 22.35) 0.569
4.4.2. Alleles frequency of factor V (G1691A) and A4070G polymorphism
among RPL patients and controls
Table (4-14) illustrates alleles frequency, odds ratio, 95% confidence intervals and p
value of factor V (G1691A) and A4070G polymorphism among RPL patients and
controls. The statistical analysis of allele frequency of the factor V (G1691A) and
A4070G gene polymorphism among RPL patients and controls showed that the
difference was significant (p-value = 0.0002) between the two groups.
![Page 82: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/82.jpg)
62
Chapter (4) Results
Table 4-14: Alleles frequency of factor V (G1691A) and A4070G polymorphisms
among RPL patients and controls
A4070G/
"G1691A"
allele
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI) P- value
A and G 336(84.0%) 371 (92.75%)
0.410 (0.26 to 0.65) 0.0002
G and A 64 (16.0%) 29 (7.25%)
4.5. Independent effects of factor V (G1691A) and (A4070G)
polymorphisms
In order to verify whether both G1691A and A4070G polymorphisms are linked to
each other or independently affect the risk of RPL the three samples in which both
polymorphisms coexisted were excluded and the allele frequencies were recalculated.
The data presented in Tables (4-15) and (4-16) below showed that the frequency of
the minor allele of each of the two polymorphisms remained significantly different
between the RPL and control groups.
Table 4-15: Genotype frequency of FV variant "A4070G"and "G1691A" among
RPL patients and controls
A4070G/
"G1691A"
Genotype
Patient
N= 197
Controls
N=200 Odds Ratio (95% CI)
P-value
AA/GG 138
(70.05%) 172 (86.0%) 0.38 (0.23 to 0.63) 0.0002
GA 57 (28.93%) 27 (13.5%) 2.61 (1.57 to 4.34) 0.0002
GG/AA 2 (1.02%) 1 (0.5%) 2.04 (0.18 to 22.69) 0.56
![Page 83: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/83.jpg)
63
Chapter (4) Results
Table 4-16: Alleles frequency of the FV "A4070G "and "G1691A" SNP among
RPL patients and controls
A4070G/
"G1691A"
allele
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI) P- value
A/G 333(84.52%) 371 (92.75%)
2.34 (1.47 to 3.74) 0.0003
G/A 61 (15.48%) 29 (7.25%)
![Page 84: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/84.jpg)
64
Chapter (4) Results
4.6. Factor V (A5279G) gene polymorphism:
4. 6.1. Genotype frequency of factor V (A5279G) polymorphism among
RPL patients and controls
Table (4-17) and (Fig. 4-12) illustrate the genotype frequencies of factor V A5279G
gene polymorphism among RPL patients. The frequency of the wild type AA was
98.0 %, the frequency of the heterozygote GA was 1.5% and the frequency of the
homozygotes for the polymorphic allele GG was 0.5 % in RPL women.
Table 4-17: Frequency of genotypes of factor V (A5279G) polymorphism
among RPL patients
Genotype Frequency Percent %
GG 1 0.5
GA 3 1.5
AA 196 98.0
Total 200 100.0
Fig 4-12: Frequency of genotypes of factor V (A5279G) polymorphism among
RPL patients
0
10
20
30
40
50
60
70
80
90
100
0.5 1.5
98
GG
GA
AA
![Page 85: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/85.jpg)
65
Chapter (4) Results
Table (4 -18) and (Fig. 4-13) illustrate the frequencies of genotype of the factor V
A5279G gene polymorphism among control women. The frequency of the wild type
AA was 99.5 %, the frequency of the heterozygotes (GA) was 0.5 % while, the
frequency of the homozygotes for polymorphic allele GG was 0.0 %.
Table 4-18: Frequency of genotypes factor V A5279G polymorphism among
control women
Genotype Frequency Percent %
GG 0 0.0
GA 1 0.5
AA 199 99.5
Total 200 100.0
Fig 4-13: Frequency of genotypes of factor V (A5279G) polymorphism among
control women
0
10
20
30
40
50
60
70
80
90
100
0 0.5
99.5
GG
GA
AA
![Page 86: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/86.jpg)
66
Chapter (4) Results
Table (4-19) illustrates genotypes frequency, odds ratio (OR), 95% confidence
intervals (CI) and P value of factor V (A5279G) gene polymorphism among RPL
patients and controls. The statistical analysis of frequency of factor V (A5279G) gene
polymorphism among RPL patients and controls showed that the difference was not
significant in the three genotypes AA, GA, and GG between the two groups.
Table 4-19.: Genotype frequency of factor V (A5279G) gene polymorphism
among RPL patients and controls.
A5279G
Genotype
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI)
P-value
AA 196 (98.0%) 199 (99.5%) 0.246 (0.027 to 2.22) 0.211
GA 3(1.5%) 1 (0.5%) 3.03 (0.313 to 29.38) 0.339
GG 1 (0.5%) 0 (0.0%) 3.02 (0.122 to 74.46) 0.500
4.6.2. Alleles frequency of factor V (A5279G) polymorphism among RPL
patients and controls
Table (4-20) illustrates alleles frequency, odds ratio, 95% confidence intervals and P
value of factor V (A5279G) polymorphism among RPL patients and controls. The
statistical analysis of allele frequency of the factor V (A5279G) gene polymorphism
among RPL patients and controls showed that the difference was not significant
(P-value = 0.140) between the two groups.
![Page 87: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/87.jpg)
67
Chapter (4) Results
Table 4-20: Alleles frequency of factor V (A5279G) polymorphism among RPL
patients and controls
A5279G
allele
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI) P- value
A 395 (98.75%) 399 (99.75%)
0.198 (0.023 to 1.70) 0.140
G 5 (1.25%) 1 (0.25%)
4.6.3. Hardy-Weinberg equilibrium in Factor V (A5279G) gene
polymorphism
Frequency of major allele A (p) = 199x2 + 1x1/200x2 = 0.9975
Frequency of minor allele G (q) = 0x2 + 1x1/200x2 = 0.0025
p + q = 1
(p + q)2 = 1
P2 + 2pq + q
2
Expected genotype frequencies:
Genotype AA: p2 x200 = (0.9975)
2 X 200 = 199.00125
Genotype GA: 2pq x200 = 2X0.9975X 0..0025X 200 = .9975
Genotype GG: q2 x200 = (0.0025)
2X 200 = 0.00125
Table (4-21) illustrates the observed and expected genotype frequencies of factor V
(A5279G) gene polymorphism in control women with P-value = 0.971. This shows
that there is no significant deviation from Hardy-Weinberg equilibrium, so the
distribution of Factor V (A5279G) genotypes are in Hardy-Weinberg equilibrium.
Table 4-21: Observed and expected genotype frequencies of factor V (A5279G)
polymorphism
AA GA GG
Observed genotype 199 1 0
Expected genotype 199.00125 0.9975 0.0025
P- value = 0.971 Chi square: X2 = 0.00125 with 1degrees of freedom
![Page 88: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/88.jpg)
68
Chapter (4) Results
4.7. Factor II (G20210A) gene polymorphism:
4.7.1. Genotype frequency of factor II (G20210A) polymorphism among
RPL patients and controls
Table (4-22) and (Fig. 4-14) illustrate the genotype frequencies of factor II G20210A
gene polymorphism among RPL patients. The frequency of the wild type GG was
95.5 %, the frequency of the heterozygote GA was 4.5% while, the frequency of the
homozygotes for the polymorphic allele AA was 0.0 % in RPL women.
Table 4-22: Frequency of genotypes of factor II (G20210A) polymorphism
among RPL patients
Genotype Frequency Percent %
AA 0 0.0
GA 9 4.5
GG 191 95.5
Total 200 100.0
Fig 4-14: Frequency of genotypes of factor II (G20210A) polymorphism among
RPL patients
0
10
20
30
40
50
60
70
80
90
100
0
4.5
95.5
AA
GA
GG
![Page 89: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/89.jpg)
69
Chapter (4) Results
Table (4 -23) and (Fig. 4-15) illustrate the frequencies of genotypes of factor II
G20210A gene polymorphism among control women. The frequency of the wild type
GG was 98.5 %, the frequency of the heterozygotes (GA) was 1.5 % while, the
frequency of the homozygotes for polymorphic allele AA was 0.0 %.
Table 4-23: Frequency of genotypes factor II G20210A polymorphism among
control women
Genotype Frequency Percent %
AA 0 0.0
GA 3 1.5
GG 197 98.5
Total 200 100.0
Fig 4-15: Frequency of genotypes of factor II (G20210A) polymorphism among
control women
0
10
20
30
40
50
60
70
80
90
100
0 1.5
98.5
AA
GA
GG
![Page 90: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/90.jpg)
70
Chapter (4) Results
Table (4-24) illustrates genotypes frequency, odds ratio (OR), 95% confidence
intervals (CI) and P value of the Factor II (G20210A) gene polymorphism among
RPL patients and controls. The statistical analysis of frequency of factor II
(G20210A) gene polymorphism among RPL patients and controls showed that the
difference was not significant in the three genotype GG, GA, and AA between the two
groups.
Table 4-24: Genotype frequency of factor II (G20210A) gene polymorphism
among RPL patients and controls.
G20210A
Genotype
Patients
N= 200
Controls
N=200 Odds Ratio (95% CI)
P-value
GG 191 (95.5%) 197 (98.5%) 0.323 (0.086 to 1.212) 0.093
GA 9 (4.5%) 3 (1.5%) 3.094 (0.825 to 11.603) 0.093
AA 0 (0.0%) 0 (0.0%) 1.00 (0.019 to 50.65) 1.00
4.7.2. Alleles frequency of factor II (G20210A) polymorphism among RPL
patients and controls
Table (4-25) illustrates alleles frequency, odds ratio, 95% confidence intervals and P
value of factor II (G20210A) polymorphism among RPL patients and controls. The
statistical analysis of allele frequency of the factor II (G20210A) gene polymorphism
among RPL patients and controls showed that the difference was not significant (P-
value = 0.096) between the two groups.
![Page 91: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/91.jpg)
71
Chapter (4) Results
Table 4-25: Alleles frequency of factor II (G20210A) polymorphism among RPL
patients and controls
G20210A
allele
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI) P- value
G 391 (97.75%) 397 (99.25%)
3.05 (0.82 to 11.34) 0.097
A 9 (2.25%) 3 (0.75%)
4.7.3. Hardy-Weinberg equilibrium in factor II (G20210A) gene
polymorphism
Frequency of major allele G (p) = 197x2 + 3x1/200x2 = 0.9925
Frequency of minor allele A (q) = 0x2 + 3x1/200x2 = 0.0075
p + q = 1
(p + q)2 = 1
P2 + 2pq + q
2
Expected genotype frequencies:
Genotype GG: p2 x200 = (0..9925)
2 X 200 = 197.01
Genotype GA: 2pq x200 = 2X0.9925X 0..0075X 200 = 2.98
Genotype AA: q2 x200 = (0.0075)
2X 200 = 0.01
Table (4-26) illustrates the observed and expected genotype frequencies of factor II
(G20210A) gene polymorphism in control women with P-value = 0.915. This shows
that there is no significant deviation from Hardy-Weinberg equilibrium, so the
distribution of factor II (G20210A) genotypes are in Hardy-Weinberg equilibrium.
Table 4-26: Observed and expected genotype frequencies of Factor II (G20210A)
polymorphism
GG GA AA
Observed genotype 197 3 0
Expected genotype 197.01 2.98 0.01
P- value = 0.915 Chi square: X2 = 0.011with 1degrees of freedom
![Page 92: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/92.jpg)
72
Chapter (4) Results
4.8. Factor XI rs3756008 A< T gene polymorphism:
4.8.1. Genotype frequency of factor XI rs3756008 A< T polymorphism
among RPL patients and controls
Table (4 -27) and (Fig. 4-16) illustrate the genotype frequencies of the factor XI
rs3756008 A< T gene polymorphism among RPL patients. The frequency of the wild
type AA was 42.5 %, the frequency of the heterozygote AT was 57.0% while, the
frequency of the homozygotes for the polymorphic allele TT was 0.5 % in RPL
women.
Table 4-27: Frequency of genotypes of factor XI rs3756008 A< T polymorphism among RPL patients
Genotype Frequency Percent %
TT 1 0.5
TA 114 57.0
AA 85 42.5
Total 200 100.0
Fig 4-16: Frequency of genotypes of factor XI rs3756008 A< T polymorphism
among RPL patients
0
10
20
30
40
50
60
0.5
57
42.5
TT
AT
AA
![Page 93: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/93.jpg)
73
Chapter (4) Results
Table (4 -28) and (Fig. 4-17) illustrate the frequencies of genotypes of factor XI
rs3756008 A< T gene polymorphism among control women. The frequency of the
wild type AA was 51.5 %, the frequency of the heterozygotes (TA) was 48.5 % while,
the frequency of the homozygotes for polymorphic allele TT was 0.5 %.
Table 4-28: Frequency of genotypes factor XI rs3756008 A< T polymorphism
among control women
Genotype Frequency Percent %
TT 1 0.5
TA 96 48.5
AA 103 51.5
Total 200 100.0
Fig 4-17: Frequency of genotypes of factor XI rs3756008 A< T polymorphism
among control women
0
10
20
30
40
50
60
0.05
48
51.5
TT
TA
AA
![Page 94: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/94.jpg)
74
Chapter (4) Results
Table (4-29) illustrates genotypes frequency, odds ratio (OR), 95% confidence
intervals (CI) and P value of factor XI rs3756008 A< T gene polymorphism among
RPL patients and controls. The statistical analysis of frequency of factor XI
rs3756008 A< T gene polymorphism among RPL patients and control showed that the
difference was not significant in the three genotype AA, TA, and AA between the two
groups.
Table 4-29.: Genotype frequency of factor XI rs3756008 A< T gene
polymorphism among RPL patients and controls.
rs3756008
Genotype
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI)
P-value
AA 85 (42.5%) 103 (51.5%) 0.69 (0.46 to 0.03) 0.07
AT 114 (57.0%) 96 (48%) 1.44 (0.97 to 2.13) 0.07
TT 1 (0.5%) 1 (0.5%) 1.00 (0.06 to 16.09) 1.00
4.8.2. Alleles frequency of factor XI rs3756008 A< T polymorphism among
RPL patients and controls
Table (4-30) illustrates alleles frequency, odds ratio, 95% confidence intervals and P
value of factor XI rs3756008 A< T polymorphism among RPL patients and controls.
The statistical analysis of allele frequency of the factor XI rs3756008 A< T gene
polymorphism among RPL patients and controls showed that the difference was not
significant (P-value = 0.15) between the two groups.
![Page 95: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/95.jpg)
75
Chapter (4) Results
Table 4-30: Alleles frequency of factor XI rs3756008 A< T polymorphism among
RPL patients and controls
rs3756008
allele
Patient
N= 200
Controls
N=200 Odds Ratio (95% CI) P- value
A 284(71.0%) 302 (75.5%)
0.79 (0.58 to 1.09) 0.15
T 116 (29.0%) 98 (24.5%)
4.8.3. Hardy-Weinberg equilibrium in factor XI rs3756008 A< T gene
polymorphism
Frequency of major allele A (p) = 103x2 + 96x1/200x2 = 0.755
Frequency of minor allele T (q) = 1x2 + 96x1/200x2 = 0.245
Expected genotype frequencies:
Genotype AA: p2 x200 = (0.755)
2 X 200 = 144
Genotype GA: 2pq x200 = 2X0.755X 0..245X 200 = 74
Genotype GG: q2 x200 = (0.245)
2X 200 = 12
Table (4-31) illustrates the observed and expected genotype frequencies of Factor XI
rs3756008 A< T gene polymorphism in control women with P-value = 0.00003. This
shows that there is significant deviation from Hardy-Weinberg equilibrium, so the
distribution of Factor XI rs3756008 A< T genotypes are not in Hardy-Weinberg
equilibrium.
Table 4-31: Observed and expected genotype frequencies of factor XI rs3756008
A< T polymorphism
AA AT TT
Observed genotype 103 96 1
Expected genotype 114 74 12
P- value = 0.00003 Chi square: X2 = 17.69 with 1degrees of freedom
![Page 96: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/96.jpg)
76
Chapter Five
Discussion
![Page 97: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/97.jpg)
77
Chapter (5) Discussion
Recurrent miscarriage is defined as the occurrence of three or more consecutive
pregnancy losses during the first trimester (Marc Dhont, 2003), and accounts for
about 1-3% of clinically recognized pregnancy losses (Suryanarayana et al., 2006).
Despite extensive research to explain the causative effects of recurrent pregnancy loss
(RPL), about 50%-60% of RPLs are still idiopathic. Despite the increasing
prospective studies with sufficient power related to the association between various
thrombophilia and RPL, controversy still remains regarding screening for
thrombophilia in women with RPL. Therefore, routine screening is not cost-effective
and not justified. On the other hand, clinicians need guidelines for screening.
Guidelines regarding this issue should be prepared according to the frequency of
thrombophilic defects in the particular population. This study was designed to
investigate the association between RPL and common polymorphisms in factor V:
G1691A (R506Q; rs6025), H1299R (R2), Y1702C (rs118203907); factor II G20210A
(rs1799963), and factor XI rs3756008 (A>T) genes among women experiencing RPL
in Gaza strip-Palestin.
5.1. The study sample
Definitions of RPL have varied between studies. This study opted for defining RPL
as three or more miscarriages before 20 weeks of gestation in order to provide
comparable data. It has to be kept in mind, however, that miscarriages
in early
pregnancy might be etiologically different than those occurring early in the second
trimester. The results obtained in the majority of studies describing genetic
polymorphisms in RPL are conflicting. Many of the reported associations have not
been reproduced in later studies. This is partly due to the fact that the associations
may vary in different ethnic populations (reflecting the multifactorial nature of RPL
risk factor) and that results may be biased because of small sample sizes. This also
may be true in the present study. One reason for a small sample size is that RPL is
relatively uncommon, and may be as low as 1% in women.
![Page 98: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/98.jpg)
78
Chapter (5) Discussion
The Palestinian population that was the subject of this investigation, offered an
additional advantage, alcohol or drug use are irrelevant in the context of Palestinian
women in the reproductive age. Smoking role in RPL is not yet clearly defined, and
due to the extremely low rate of smoking among young Palestinian women, this usual
confounding environmental factor therefore is not arguable in this study.
5.2. Association between factor V: G1691A (R506Q; rs6025) gene
polymorphisms and RPL
The distribution of factor V G1691A genotypes in the control group is in Hardy-
Weinberg equilibrium as no significant deviation (P-value = 0.523) was recorded
between the observed and expected genotypes and this indicates that the genotypes of
this polymorphism are distributed randomly in our population.
The GG genotype was significantly more prevalent in the control women (90.0%) as
compared to the RPL patients (80.5%) with a P-value = 0.01. The GA genotype was
significantly less frequent in the control women (9.5%) relative to RPL patients
(18.5%) with a P-value = 0.01. The AA genotype was less prevalent in the control
women (0.5%) as compared to the RPL patients (1.0%), though this difference was
not significant (P-value = 0.57), see Table (4-3).
This study showed that the allele frequencies of factor V: G1691A also are
significantly different between RPL patients and controls (P-value = 0.0093). The
frequency of polymorphic A allele was more prevalent in RPL patients (10.25%) than
in controls (5.25%) and the wild type G allele was less prevalent in RPL patients
(89.75%) than in controls (94.75%), see Table(4-4). It can be inferred that this
documented RPL risk factor, factor V: G1691A is associated with and may represent
a risk factor for RPL in our population. The A-allele seems to significantly double the
risk for RPL (OR = 2.06; P = 0.0093).
Association between RPL and factor V: G1691A polymorphism observed in this
study is in agreement with the findings reported by many other investigators (e.g.,
![Page 99: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/99.jpg)
79
Chapter (5) Discussion
Wolfa et al., 2003; Ulukufi et al., 2006; Motee et al., 2007; Torabi et al., 2009;
Hussein et al., 2010; Gawish and Al-Khamees, 2013). In the contrary, other
investigators found no relation between this polymorphism and RPL (e.g., Abd Allah
and Hassan, 2014; Parand et al., 2013; Raziel et al., 2001). Interestingly, no G1691A
polymorphism was detected in Japanese women with RPL or the controls (Kobashi et
al., 2005).
These observations illustrate the populations and ethnic groups variations in terms of
type and frequency of alleles of polymorphic loci. This in turn influences the
association outcome between risk alleles and multifactorial traits such as RPL.
Another important difference between the various association studies is the sample
size (power of the study) particularly when the minor allele of the variant locus is low
in frequency. Small sample size would not reveal the significant association, if
present.
5.3. Association between factor V: H1299R (A4070G) gene
polymorphism and RPL
The distribution of factor V: A4070G, genotypes in the control group proved to be
in Hardy-Weinberg equilibrium as no significant deviation (P- value = 0.744) was
recorded between the observed and expected genotypes.
The AA genotype was more prevalent in the control women (95.5%) as compared to
the RPL patients (86.5%). This difference was statistically significant (P = 0.003).
The GA genotype was significantly less frequent in the control women (4.5%) relative
to RPL patients (13.5%) with a P-value = 0.003. The distribution of the GG genotype,
however, was not significantly different between the two groups (P = 1.0), see
Table(4-8).
![Page 100: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/100.jpg)
80
Chapter (5) Discussion
This study showed that the allele frequencies of factor V: A4070G also are
significantly different between RPL patients and controls (P = 0.003). The frequency
of polymorphic G allele was more prevalent in RPL patients (6.75%) than in controls
(2.25%) and the wild type A allele was less prevalent in RPL patients (93.25%) than
in controls (97.75%), see Table (4-9). It can be concluded that factor V: A4070G is
associated with RPL in our population and that the presence of the G-allele increases
the RPL risk more than three times (OR = 3.14; P = 0.003).
Investigations on association of this polymorphism with RPL have also yielded
variable results. Whereas Torabi et al. (2012) in Iran found a significant association
between FV:A4070G and RPL risk, Sotiriadis et al. (2007) observed no difference in
the prevalence of this polymorphism between RPL patients and controls. As discussed
above for factor V: G1691A polymorphism, the prominent cause for the conflicting
results lies in the genetic background differences of the investigated populations.
5.4. Association between factor V: Y1702C (A5279G) gene
polymorphism and RPL
The distribution of factor V: A5279G genotypes in the control group is in Hardy-
Weinberg equilibrium as no significant deviation (P = 0.971) was recorded between
observed and expected genotype frequencies.
The AA genotype was more prevalent in the control women (99.5%) as compared to
the RPL patients (98.0%), though this difference was not significant (P-value =
0.211). The GA genotype was less frequent in the control women (0.5%) relative to
RPL patients (1.5%) but this difference was not significant either (P-value = 0.339).
The GG genotype was present in comparable frequencies in both groups (P-value =
0.50), see Table (4-19).
Results of this study showed that the factor V: A5279G polymorphism was not
significantly different between RPL patients and the controls (all P values are > 0.05).
![Page 101: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/101.jpg)
81
Chapter (5) Discussion
The results also showed that the allele frequencies of factor V: A5279G are not
significantly different between RPL patients and controls (P-value = 0.140). The
frequency of polymorphic A allele was less prevalent in RPL patients (98.75%) as
compared to controls (99.75%) and the G allele was more prevalent in RPL patients
(1.25%) relative to controls (0.25%). See table (4-20). It can be inferred that the factor
V: A5279G does not represent a risk for RPL in our study population.
Association studies of this SNP with RPL also reported conflicting results. For
instance, Torabi et al. (2012) showed that the minor allele of A5279G is associated
with RPL whereas in the contrary Coulam et al. (2006) indicated lack of difference
between RPL and controls.
5.5. Independent effects of Factor V (G1691A) and (A4070G)
polymorphisms
After excluding the three samples in which both G1691A and A4070G
polymorphisms coexisted, the A4070G minor allele remained as a risk factor for RPL
with an odds ratio of (OR = 2.34; P = 0.0003), see Table (4-16)
showing that this variant itself is an independent risk factor. Therefore, we suggest
including this polymorphism in the thrombophilia workup of the RPL females.
![Page 102: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/102.jpg)
82
Chapter (5) Discussion
5.6. Association between factor II: (G20210A) gene polymorphism
and RPL
The distribution of factor II: G20210A genotypes in the control group is in Hardy-
Weinberg equilibrium as no significant deviation (P- value = 0.915) was recorded
between the observed and expected genotypes frequencies.
The GG genotype was more prevalent in the control women (98.5%) as compared to
the RPL patients (95.5%), but this difference did not reach significance (P-value =
0.093). The GA genotype was less frequent in the control women (1.5%) relative to
RPL patients (4.5%), though this difference was not significant (P-value = 0.093), see
Table (4-24). The AA genotype was not encountered in neither the control women nor
the RPL patients.
This study showed that the allele frequencies of factor II: G20210A also are not
significantly different between RPL patients and controls (P-value = 0.096). The
frequency of the polymorphic G allele was less prevalent in RPL patients (97.75%) as
compared to controls (99.25%). The A allele was more frequent in RPL patients
(2.25%) as compared to controls (0.75%), see Table (4-25). Therefore, factor II:
G20210A polymorphism seems not to be associated with RPL in the investigated
population. However, the low frequency of the minor A-allele of this polymorphism
may be the reason behind obscuring its association with RPL and increasing the
sample size further may bring about different results.
Still, lack of association between RPL and factor II: G20210A polymorphism
observed in this study is in agreement with the findings reported by (Ardestani1 et al.,
2013; Parand et al., 2013; Abu-Asab et al. 2011; Sotiriadis et al., 2007;
Hohlagschwandtner et al., 2003). On the other hand, other reports showed significant
association between this SNP and RPL risk (e.g., Gawish and Al-Khamees, 2013;
Mierla et al., 2012; Torabi et al., 2012; Martinelli et al., 2000; Brenner et al., 1999).
![Page 103: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/103.jpg)
83
Chapter (5) Discussion
5.7. Association between factor XI: rs3756008 (A>T) gene
polymorphism and RPL
The distribution of factor XI: rs3756008 (A>T) genotypes in the control group
deviated significantly from Hardy-Weinberg equilibrium (P-value = 0.00003). This
significant departure from Hardy-Weinberg equilibrium could be due to a yet
unidentified cause and deserves further investigation.
The AA genotype was more prevalent in the control women (51.5%) as compared to
the RPL patients (42.5%), though this difference was not significant (P-value = 0.07).
The AT genotype was less frequent in the control women (48.0%) relative to RPL
patients (57.0%) but this difference also was not significant (P-value = 0.07), see
Table(4-29). On the other hand, the TT genotype occurred with similar frequencies in
both the control women and the RPL patients.
The results for factor XI: rs3756008 (A>T) allele frequencies showed that there is no
significant difference between the RPL patients and the controls (P-value = 0.15). The
frequency of the major A allele was less prevalent in RPL patients (71.0%) than in
controls (75.5%) and that of the T allele was more prevalent in RPL patients (29.0%)
than in controls (24.5%), see Table(4-30). Therefore, it seems that this factor XI:
rs3756008 (A>T) polymorphism does not represent a risk for RPL in our study
population.
This polymorphism was tested because it has been highlighted among the gene
variants significantly associated with deep venous thrombosis (Bezemer et al., 2008).
In terms of its association with pregnancy complications only one published report
was encountered (Dahm et al., 2012) where they found no significant effect of this
SNP on adverse pregnancy outcome. The same report however, showed that another
SNP change in factor XI (rs2289252) is associated with pregnancy-related venous
thrombosis. We suggest testing the impact of this later SNP in our RPL patient.
![Page 104: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/104.jpg)
84
Chapter Six
Conclusion and
Recommendations
![Page 105: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/105.jpg)
85
Chapter (6) Conclusion and Recommendations
6.1. Conclusion
The present study focused on the polymorphisms in factor V: G1691A (R506Q;
rs6025), H1299R (R2), Y1702C (rs118203907); factor II G20210A (rs1799963), and
factor XI rs3756008 (A>T) in 200 Palestinian women in Gaza Strip suffering from
RPL as compared to 200 healthy women. The results of the study can be summarized
as follows:
The study showed that there is significant associations between factor V:
G1691A (R506Q; rs6025) and H1299R (R2) polymorphisms and RPL.
No significant association was observed between factor V Y1702C
(rs118203907); factor II G20210A (rs1799963), or factor XI rs3756008 (A>T)
polymorphisms and RPL.
The distribution of factor V: G1691A (R506Q; rs6025), H1299R (R2),
Y1702C (rs118203907); and factor II G20210A (rs1799963) polymorphisms
are in Hardy –Weinberg equilibrium, but factor XI rs3756008 (A>T) deviated
from HW equilibrium
![Page 106: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/106.jpg)
86
Chapter (6) Conclusion and Recommendations
6.2. Recommendations
1. Before ordering genetic testing for patients, it is essential to thoroughly
confirm the association between the tested factor and the disease. Especially
with respect to gene(s) polymorphism(s) and RPL. Studies in other people and
ethnic groups may not be applicable to the Gaza strip population.
2. Performing larger studies to confirm the lack of association between factor II
G20210A polymorphism and RPL in the Palestinian population.
3. Performing further studies to investigate the impact of other polymorphisms in
genes related to inherited thrombophilia in RPL cases.
4. Including the factor V: A4070G (H1299R) in the thrombophilia workup of
unexplained RPL cases in our population.
![Page 107: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/107.jpg)
87
1. References:
1. Abd Allah AM, Hassan FM. (2014). The frequency of factor V leiden
mutation among Sudanese pregnant women with recurrent miscarriage.
Journal of American Science; 10(9): 63-66.
2. Abu-Asab NS, Ayesh SK, Ateeq RO, Nassar SM, EL-Sharif WA. (2011).
Association of inherited thrombophilia with recurrent pregnancy loss in
Palestinian women. Obstetrics and Gynecology International; Article ID
689684, 6 pages doi:10.1155/2011/689684.
3. American Society for Reproduction Medicine; 2012.
4. Ardestani M, Nodushan H, Aflatoonian A, Ghasemi N, Sheikhha M. (2013).
Case control study of the factor V Leiden and factor II G20210A mutation
frequency in women with recurrent pregnancy loss. Iranian Journal of
Reproductive Medicine; 11(1): 61-64.
5. Austin H, De Staercke C, Lally C, Bezemer ID, Rosendaal FR, Hooper WC.
(2011). New gene variants associated with venous thrombosis: a replication
study in white and black Americans. Journal of Thrombosis and
Haemostasis; 9: 489–95.
6. Bernardi F, Faioni EM, Castoldi E, Lunghi B, Castaman G, Sacchi E,
Mannucci PM. (1997). A factor V genetic component differing from factor V
R506Q contributes to the activated protein C resistance phenotype. Blood; 90:
1552-1557.
7. Bezemer ID, Bare LA, Doggen CJ, Arellano AR, Tong C, Rowland CM,
Catanese J, Young BA, Reitsma PH, Devlin JJ & Rosendaal FR. (2008).
Gene variants associated with deep vein thrombosis. The Journal of the
Amercian Medical Association; 299: 1306-1314
8. Brenner B, Sarig G, Weiner Z, Younis J, Blumenfeld Z, Lanir N. (1999).
Thrombophilic polymorphisms are common in women with fetal loss without
apparent cause. Thrombosis and Haemostasis; 82(1): 6-9.
9. Carbone JF, Rampersad R. (2010). Prenatal screening for thrombophilia's :
indications and controversies. Clinics in Laboratory Medicine; 30: 747–760.
![Page 108: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/108.jpg)
88
10. Castoldi E, Lunghi B, Mingozzi F, Muleo G, Redaelli R, Mariani G, Bernardi
F. (2001) A missense mutation (Y1702C) in the coagulation factor V gene is
a frequent cause of factor V deficiency in the Italian population.
Haematologica; 86(6): 629-633.
11. Clifford K, Rai R, Watson H, Franks S, Regan L. (1996). Does suppressing
luteinising hormone secretion reduce the miscarriage rate? results of a
randomised controlled trial. British Medical Journal; 312: 1508-15011.
12. Coulam C B, Wallis D, Weinstein J, DasGupta D S, Jeyendran R S. (2008).
Comparison of thrombophilic gene mutations among patients experiencing
recurrent miscarriage and deep vein thrombosis. American Journal of
Reproductive Immunology; 60 (5): 426-431.
13. Coulam CB, Jeyendran RS, Fishel LA, Roussev R. (2006). Multiple
thrombophilic gene mutations rather than specific gene mutations are risk
factors for recurrent miscarriage American Journal of Reproductive
Immunology; 55: 360–368.
14. D’Uva M, Strina I, Mollo A, Ranieri A, De Placido G، Di Micco P. (2005).
Acquired factor XII deficiency in a woman with recurrent pregnancy loss:
working on a differential diagnosis in a single case. Journal of Translational
Medicine; 3(5): 43-48.
15. D’Uvaa M, Di Miccob P, Strinaa I, De Placidoa G. (2010). Recurrent
pregnancy loss and thrombophilia. (Review) Journal of Clinical Medicine
Research; 2: 18-22.
16. Dahm AEA, BezemerI D, Bergrem A, Jacobse AF, Jacobsen E M, Skretting
G, Rosendaal FR and Sandset P M.(2012). Candidate gene polymorphisms
and the risk for pregnancy-related venous thrombosis. British Journal of
Haematology; 157: 753–761.
17. Dajani R, Arafat A, Hakooz N, Al-Abbadi Z, Al-Motassem Yousef, El
Khateeb M, Quadan F. (2012). Polymorphisms in factor II and factor V
thrombophilia genes among Circassians in Jordan. Journal of Thrombosis
and Thrombolysis; 35: 83–89.
18. Dawood F. (2013). Pregnancy and Thrombophilia. Journal of Blood
Disorders Transfusion; 4(5): doi: 10.4172/2155-9864.1000164.
19. De Visser MCH, Guasch R M, Kamphuisen PW, Vos Hans L, Rosendaal F R,
Bertina R M. (2000). The HR2 haplotype of factor V: effects on factor V
![Page 109: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/109.jpg)
89
levels, normalized activated protein C sensitivity ratios and the risk of venous
thrombosis. Thrombosis and Haemostasis; 83: 577-582.
20. Dossenbach GA, van Trotsenburg M, Krugluger W, Dossenbach MR,
Oberkanins C, Huber J، Hopmeier P. (2004). Elevated coagulation factor VIII
and the risk for recurrent early pregnancy loss. Thrombosis and Haemostasis;
91: 694-699.
21. Emsley J, Paul A. McEwan, and Gailani D. (2010). Structure and function of
factor XI. Blood: 115 (13): 2569-2577.
22. Evans M. Recurrent pregnancy loss. Available from Huntington
reproductive in California: URL:
http://www.infertilityspecialist.com/recurrent_pregnancy_loss.htm (Accessed
on December, 2011).
23. Ford H B, Schust D J. (2009). Recurrent pregnancy loss: etiology, diagnosis,
and therapy. Review in Obstetrics and Gynecology; 2 (2): 76-83.
24. Foy P, Moll S.(2009). Thrombophilia:2009 Update. Current Medicine Group
LLC; 11: 114-128.
25. Gawish G, Al-Khamees O. (2013) Molecular characterization of factor V
leiden G1691A and prothrombin G20210A mutations in Saudi females with
recurrent pregnancy loss. Journal of Blood Disorders & Transfusion; 4: 165.
Doi: 10.4172/2155-9864.
26. Genetic Home Reference.
27. Ghosh K and Shetty S. (2009). Anti-phospholipid antibodies and other
immunological causes of recurrent foetal loss – a review of literature of
various therapeutic protocols. American Journal of Reproductive
Immunology; 62: 9-24.
28. Gomez K, and Maggs PB. (2008). Factor XI deficiency. Haemophilia, 14,
1183–1189.
29. Goodman CS, Coulam CB, Jeyendran RS, Acosta VA, Roumen R. (2006).
Which thrombophilic gene mutations are risk factors for recurrent pregnancy
loss? American Journal of Reproductive Immunology; 56 (4): 230– 236.
30. Hamilton Health Sciences; 2007.
31. Hanson E, Nilsson S, Jood K, Norrving B, Engström G, Blomstrand C,
Lindgren A, Melander O, Jern C. (2013). Genetic variants of coagulation
![Page 110: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/110.jpg)
90
factor XI show association with Ischemic stroke up to 70 years of age. Public
Library of Science ONE; 8(9): e75286.
32. Hohlagschwandtner M, Unfried G, Heinze G, Huber J, Nagele F, Tempfer C.
(2003). Combined thrombophilic polymorphisms in women with idiopathic
recurrent miscarriage, Fertility and Sterility; 79:1141-1148.
33. http://www.med.illinois.edu/hematology/ptfacv2.htm.
34. Hussein A S, Darwish H, Shelbayeha K. (2010). Association between factor
V leiden mutation and poor pregnancy outcomes among Palestinian women.
Thrombosis Research; 126: 78–82.
35. Jones DW, MacKie IJ, Gallimore MJ, Winter M. (2001). Antibodies to factor
XII and recurrent fetal loss in patients with the anti-phospholipid syndrome.
British Journal of Haematology; 113:550-552.
36. Kane WH, Mruk JS, Majerus PW. (1982). Activation of coagulation factor V
by a Platelet Protease. Journal of Clinical Investigation; 70(5): 1092–1100.
37. Kazerooni T, Ghaffarpasand F, Asadi N, Dehkhoda Z, Dehghankhalili M,
Kazerooni Y. (2013). Correlation between thrombophilia and recurrent
pregnancy loss in patients with polycystic ovary syndrome:a comparative
study. Journal of the Chinese Medical Association 76: e288.
38. Khan S, Dickerman J D. (2006). Hereditary thrombophilia. Thrombosis
Journal; 4:15. doi:10.1186/1477-9560-4-15.
39. Kobashi G, Kato EH, Morikawa M, Shimada S, Ohta K, et al. (2005)
MTHFR C677T Polymorphism and factor V leiden mutation are not
associated with recurrent spontaneous abortion of unexplained etiology in
Japanese women. Seminarine Thrombosis and Hemostasis; 31: 266-271.
40. Konecny F. (2009). Inherited trombophilic states and pulmonary embolism.
Journal of Research in Medical Sciences; 14 (1): 43-56.
41. Kong M, Kim Y, Lee C. (2014). Functional investigation of a venous
thromboembolism GWAS signal in a promoter. Molecular Biology Reports;
41(4): 2015-2019.
42. Kovalevsky G, Gracia R, Berlin JA, Sammel MD , Barnhar KT. (2004).
Evaluation of the Association between hereditary thrombophilias and
recurrent pregnancy loss. Archives of Internal Medicine; 164: 558-563.
![Page 111: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/111.jpg)
91
43. Kruger TF, van Niekerk EC, and Siebert I. (2013). An evidence-based
approach to recurrent pregnancy loss. South African Journal of obstetrics and
Gynacology; 19(3): 61-65.
44. Kujovich JL. (2004). Hormones and pregnancy: thromboembolic risks for
women. British Journal of Haematology; 126: 443–454.
45. Kupferminc MJ. (2003). Thrombophilia and pregnancy. reproductive Biology
and Endocrinology;1:111.
46. Kutteh W H, Odom L N. (2012). Evaluating recurrent pregnancy loss: The
role of autoimmune screening. Sexuality, Reproduction & Menopause
(SRM); 10(1): 11.
47. Lavigne G L, Nouvellon E C, Mercier E, Quere I, Dauzat M, Mares P,Gris J
C. (2005). The association between hereditary thrombophilias and pregnancy
loss.haematologica, 90: 1223-1230.
48. Ledingham MA, Thomson AJ, Young A, Macara LM, Greer IA, Norman JE.
(2000). Changes in the expression of nitric oxide synthase in the human
uterine cervix during pregnancy and parturition. Molecular Human
Reproduction.; 6: 1041-1048.
49. Lunghi B, lacoviello L, Gemmati D, Dilasio MG, Castoldi E, Pinotti M,
Castaman G, Redaelli R, Manani G, Marchetti G, Bernardi F. (1996).
Detection of new polymorphic markers in the factor V gene: Association with
factor V levels in plasma. Thrombosis and Haemostasis; 75: 45 -48.
50. Mahjoub T, Mtiraoui N, Tamim H, Hizem S, Finan RR, Nsiri B, and Almawi
WY. (2005). Association between adverse pregnancy outcomes and maternal
factor: factor V G1691A (leiden) and prothrombin G20210A genotypes in
women with a history of recurrent idiopathic miscarriages. American Journal
of Hematology; 80: 12–19.
51. Makaryus JN, Halperin JL, Lau JF. (2013). Oral anticoagulants in the
management of venous thromboembolism. Nature Reviews Cardiology; (10):
397-409
52. Makino A, Nakanishi T, Sugiura - Ogasawara M, Ozaki Y, Suzumori N,
Suzumori K. (2004). No association of C677T methylene tetrahydrofolate
reductase and an endothelial nitric oxide synthase polymorphism with
recurrent pregnancy loss. American Journal of Reproductive Immunology;
52: 60-66.
![Page 112: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/112.jpg)
92
53. Marc Dhont. (2003). Recurrent miscarriage. Current Women’s Health
Reports; 3: 361–366.
54. Margeti S. (2014). Laboratory investigation of thrombophilia .Journal of
Medical Biochemistry; 33: 28–46.
55. Martinelli I, Taioli E, Cetin I, et al. (2000). Mutations in coagulation factors
in women with unexplained late fetal loss. New England Journal of
Medicine; 343: 1015-1018.
56. Mierla D, Szmal C, Neagos D, Cretua R, Stoian V, Jardan D.
(2012).Association of prothrombin (A20210G) and factor V leiden (A506G)
with recurrent pregnancy loss. A Journal of Clinical Medicine; 7(3): 222-227.
57. Moll S, Elizabeth A. Varga. (2004). Prothrombin 20210 mutation (factor II
mutation), American Heart Association, Inc.
58. Motee M, Mohammad F, Al-Halabi M. (2007). Prevalence of factor V leiden
mutation and its relation with recurrent spontaneous pregnancy loss in a
group of Syrian women. Middle East Fertility Society Journal; 12(3): 179-
183.
59. Nardo LG, Rai R, Backos M, El-Gaddal S, Regan L. (2002). High serum
luteinizing hormone and testosterone concentrations do not predict pregnancy
outcome in women with recurrent miscarriage. Fertility and Sterility; 77:
348–352.
60. Nazemi A, Tolami HF, Navaderi M, Toulami S, Hondori MJ, Tameshkel
FS, Seyedinasab SR. (2013). Screening for mutations in 10 exons of the 5
coagulation factor gene in Gilan province thrombosis patients. Pelagia
Research Library. European Journal of Experimental Biology; 3(3): 589-592.
61. Parand A, Zolghadri J, Nezam M, Afrasiabi A, Haghpanah S, Karimi M.
(2013). Inherited thrombophilia and recurrent pregnancy loss. Iranian Red
Crescent Medical Journal; 15(12): e13708.
62. Pierpaolo Di Micco and Maristella D’Uva. (2009). Recurrent pregnancy loss
and thrombophilia. The Open Atherosclerosis & Thrombosis Journal; 2: 33-
35.
63. Prisco D, Ciuti G, Falciani M. (2005). Hemostatic changes in normal
pregnancy. Haematologica reports; 1(10): 1-5.
![Page 113: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/113.jpg)
93
64. Rai R, Backos M, Rushworth F, Regan L. (2000). Polycystic ovaries and
recurrent miscarriage – a reappraisal. Human Reproduction; 15: 612– 615.
65. Raziel A, Kornberg Y, Friedler S, Schachter M, Sela BA, et al. (2001).
Hypercoagulable thrombophilic defects and hyperhomocysteinemia in
patients with recurrent pregnancy loss. American Journal of Reproductive
Immunology; 45: 65-71.
66. Reddy BM and Meka A. (2006). Recurrent spontaneous abortions: An
overview of genetic and non-genetic backgrounds. International Journal of
Human Genetics; 6(2): 109-117.
67. Rosendorff A, Dorfman DM. (2007). Activated protein C resistance and
factor V leiden. Archives of Pathology and Laboratory Medicine; 131(6):
866-871.
68. Rozano G A, Papadakis E, Brenner B. (2009). Combined thrombophilia and
obstetric complications. The Open Atherosclerosis & Thrombosis Journal; 2:
38–41.
69. Saito S. (2009). The causes and treatment of recurrent pregnancy loss. Journal
of the Japan Medical Association; 52(2): 97–102.
70. Shallal SS. (2010). Immunochemical and genetic study on Iraqi women with
recurrent abortion. University of Baghdad.
71. Sharif F A. (2012). Structural chromosome abnormality in recurrent
pregnancy loss in Gaza strip: first experience. Islamic University Journal of
Natural and Engineering Studies; 20(1): 17-29.
72. Sibai BM, How HY, Stella CL. (2007). Thrombophilia in pregnancy whom to
screen, when to treat. Obg Management: 50-64.
73. Simpson J, Carson S. (2013). Genetic and nongenetic causes of pregnancy
loss. Global library of Women's Medicine; DOI 10.3843/GLOWM.10319.
74. Smith ML, Schust DJ. (2011). Endocrinology and recurrent early pregnancy
loss. Seminars in Reproductive Medicine; 29(6): 482-90.
75. Sotiriadis A, Vartholomatos G, Pavlou M, Kolaitis N, Dova L, Stefos T,
Paraskevaidis E, Kalantaridou SN. (2007). Combined thrombophilic
mutations in women with unexplained recurrent miscarriage. American
Journal of Reproductive Immunology; 57:133-141.
![Page 114: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/114.jpg)
94
76. Su M-T, Lin S-H, Chen Y-C, Kuo P-L. (2013). Genetic association studies of
ACE and PAI-1 genes in women with recurrent pregnancy loss: A systematic
review and meta-analysis. Thrombosis and Haemostasis; 109: 8–15.
77. Suryanarayana V, Rao L, Kanakavalli M, Padmalatha V, Deenadayal M,
Singh L. (2006). Recurrent early pregnancy loss and endothelial nitric oxide
synthase gene polymorphisms. Archives in Gynecology and Obstetrics.;
274(2): 119-124.
78. The Miscarriage Association; 2011.
79. Thornoton P, Douglas J. (2009). Coagulation in pregnancy. Best Practice &
Research Clinical Obstetrics and Gynaecology; 24: 339–352.
80. Torabi R, Zarei S, Zeraati H, Zarnani A, Akhondi M, Hadavi R, Shiraz E,
Jeddi-Tehrani M. (2012). Combination of thrombophilic gene polymorphisms
as a cause of increased the risk of recurrent fregnancy loss. Journal of
Reproduction and Infertility; 13: 89-94.
81. Torabi, Ostadkarampour, Mohammadzadeh, , Arefi, Keramatipour, Zarei,
Zeraati, Jeddi-Tehrani. (2009). The relationship between polymorphisms of
blood coagulation factor V gene and recurrent pregnancy losses. J Reprod
Infertil; 9(4): 305-316.
82. Tripodi A and Mannucci PM. (2001). Laboratory investigation of
thrombophilia. Clinical Chemistry; 47(9): 1597–1606.
83. Tsiolakidou G and Koutroubakis IE. (2008). Thrombosis and inflammatory
bowel disease-the role of genetic risk factors. World Journal of
Gastroenterology; 14(28): 4440–4444.
84. Ulukufi1 M, Ero⁄Lu2 Z, Yen‹El1 A, Toprak1 E, Kosova2 B, Turan1 O,
Ulukufi1 M. (2005). Frequency of factor V leiden (G1691A), prothrombin
(G20210A) and ethylenetetrahydrofolate reductase (C677T) genes mutations
in woman with adverse pregnancy outcome. Journal of the Turkish-German
Gynecological Association; 7(3): 195-201.
85. Unfried G, Griesmacher A, Weismu¨ ller W , Nagele F, Huber JC, and
Tempfer CB. (2002). The C677T polymorphism of the
methylenetetrahydrofolate reductase gene and idiopathic recurrent
miscarriage. The American College of Obstetricians and Gynecologists;
99(4): 614-619.
![Page 115: The Islamic University · polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-](https://reader033.vdocument.in/reader033/viewer/2022042300/5ecacdc76b9a5d558471b9cd/html5/thumbnails/115.jpg)
95
86. WHO. (2009). The International Committee for Monitoring Assisted
Reproductive Technology and the World Health Organization. Revised
Glossary on ART Terminology Human Reproduction; 24(11): 2683–2687.
87. Wolf C, Haubelt H, Pauer H, Hinney B, Cesar C, Legler T, Hellstern P,
Emons G, Zoll B, Köhler M. (2003). Recurrent pregnancy loss and its relation
to FV leiden, FII G20210A and polymorphisms of plasminogen activator and
plasminogen activator inhibitor. Pathophysiology of Haemostasis and
Thrombosis; 33: 134–137.