the islamic university · polymorphisms in factor-v g1691a, factor-v h1299r (a4070g), factor-v...

The Islamic University – Gaza

Research and Postgraduate Affairs

Faculty of Science

Biological Sciences Master Program

Medical Technology

غزة -الجبمعت االسالميت

شئىن البحث العلمي والذراسبث العليب

كليت العلىم

بروبمج مبجيستير العلىم الحيبتيت

طبيت تحبليل

Polymorphisms in the clotting Factors II, V and XI

Genes and Risk of Recurrent Pregnancy Loss

in Gaza Strip

By:

Mohammed Jamel Ashour

Supervisor:

Prof. Dr. Fadel A. Sharif

A Thesis Submitted in partial fulfillment for the degree of

Master of Science in Biological Sciences – Medical Technology

2015-1436

I

Polymorphisms in Factors II, V and XI Genes and Risk of

Recurrent Pregnancy Loss in Gaza Strip

Abstract

Background:

Recurrent miscarriage is defined as the occurrence of three or more consecutive

pregnancy losses during the first trimester, and accounts for about 1-3% of clinically

recognized pregnancy losses. Despite extensive research to explain the causative

effects of recurrent pregnancy loss (RPL), about 50%-60% of RPLs are still

idiopathic. Despite the increasing prospective studies with sufficient power related to

the association between various thrombophilias and RPL, controversy still remains

regarding screening for thrombophilia in women with RPL.

Objective:

To investigate the association between recurrent pregnancy loss (RPL) and common

polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C

(A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes in Gaza strip-

Palestine.

Methods:

This study is an association study with a case-control design. Using molecular

biological techniques, the factor-V G1691A, factor-V H1299R (A4070G), factor-V

Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T)

polymorphisms were determined for 200 women who had at least three consecutive

abortions and 200 controls without a previous history of abortion.

II

Results:

The factor V: G1691A is associated with and may represent a risk factor for RPL in

our population. The A-allele seems to significantly double the risk for RPL (OR =

2.06; P = 0.0093). Factor V: A4070G is also associated with RPL in our population

with the G-allele increasing the RPL risk more than three times (OR = 3.14; P =

0.003). Factor V: A5279G was not significantly different between RPL patients and

controls (P-value = 0.140). Factor II: G20210A also did not significantly differ

between RPL patients and controls (P-value = 0.096). Factor XI: rs3756008 (A>T)

allele frequencies showed that there is no significant difference between the RPL

patients and the controls (P-value = 0.15). After excluding the three samples in which

both G1691A and A4070G polymorphisms coexisted, the A4070G minor allele

remained as a risk factor for RPL with an odds ratio of (OR = 2.34; P = 0.0003),

implicating that A4070G represent an independent risk factor for RPL.

Conclusion:

The study showed that there is significant associations between factor V: G1691A

(R506Q; rs6025) and H1299R (R2) polymorphisms and RPL. No significant

association was observed between Y1702C (rs118203907); factor II G20210A

(rs1799963), and factor XI rs3756008 (A>T) polymorphisms and RPL.

Key words: Factor V: G1691A, H1299R (R2), Y1702C (rs118203907), factor II

G20210A (rs1799963), factor XI rs3756008 (A>T) , polymorphism, Recurrent

pregnancy loss.

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=118203907


III

العالقت بيه التعذد الشكلي في جيىبث عىامل التجلط الثبوي والخبمس والحبدي عشر وخطر

االجهبض المتكرر في قطبع غزة

الملخص

و زو خاله األشهش اىزالرت األوىى. او امزش خخبىت شاث رالرتبفقذا اىحو عشف اإلجهبض اىخنشس :مقذمت

عيى اىشغ أبحبد نزفت ىششح اربس و % حبالث فقذا اىحو اىزبخت سششب3-1االجهبض حىاى

. عيى اىشغ صبدة اىسبب هىىتال حضاه ج االجهبض٪ 05-٪ 05اىسببت ىفقذا اىحو اىخنشس، حىاى

، اىجذه ب صاه قبئب بشأ اىنشف ع االجهبض اىخنشساىخخزش و اىعذذ عىاو ب حىه اىعالقتاىذساسبث

اىخعشف عيى اىعالقت ب . وقذ ح حص هز اىذساست بغشضاىيىاح جهض اىخخزش ف اىسبء عىاو

ب اىخعذد اىشني ف جبث عىاو اىخجيظ اىزب واىخبس واىحبدي عشش ف قطبع غضة واىخنشس االجهبض

ف قطبع غضة اىفيسط االجهبض اىخنشساىسبء حعب

اىعالقت ب اىخعذد اىشني ف جبث عىاو اىخجيظ اىزب واىخبس واىحبدي عشش وخطش دساست الهذف:

االجهبض اىخنشس ف قطبع غضة

ىزالد شاث خخبىت عبج االجهبضاشاة 200ح فحص حيل االخخالفبث اىجت ف لطرق المستخذمت:ا

اشأة ى حن حعب اإلجهبض اىخنشس وح رىل ببسخخذا حقبث 200ف اىزيذ األوه اىحو وقىسج بـ

اىبىىىجب اىجضئت.

ف اىعبو اىخبس بخطىسة حذود االجهبض اىخنشس G1691Aهشث اىخبئج اسحببط اىظ ظأ الىتبئج:

اىظ ومزىل اسحبظ(. P =5.55.3؛ OR =6.50أىو ضبعف اىخطش )-Aجخعب حذ بذو أ

A4070G ،أ وجىد حذع االجهبض اىخنشسG- أىو ضذ خطش االجهبض اىخنشس أمزش رالد

خخيف بشنو مبش ب شضى ى اىعبو اىخبس A5279G (:. اىظ: P =5.553؛ OR =3.13شاث )

خخيف ى اىعبو اىزب أضب G20210A(. اىظ: 5.135قت = -P)واىعت اىضببطت االجهبض اىخنشس

اىظ (. وقذ أظهشث اىذساست أضب ا5.5.0قت = -P) واىعت اىضببطتمزشا ب شضى االجهبض اىخنشس

rs3756008 (A >T اىعبو اىحبدي عشش ) واىعت اىضببطت فشق مبش ب اىشضى ى شنو (P راث

أىو زو A4070G بق A4070Gواألشنبه G1691A(. بعذ اسخبعبد اىعبث اىزالد اىخ 5.10اىقت =

(.P =5.5553؛ OR =6.33عبو خطش ىالجهبض اىخنشس ع سبت احخبالث )

G1691A :اىعبو اىخبس االبط راث دالىت إحصبئت ب عالقت أ هبك اىذساست وأظهشث الخالصت:

(R506Q ؛rs6025) وH1299R (R2) راث دالىت إحصبئت عذ وجىد عالقت و االجهبض اىخنشس وقذ ىىحع

اىظ و، اىعبو اىزب G20210A (rs1799963) واىظ؛ اىعبو اىخبس Y1702C اىظ ب

rs3756008 اىحبدي عشش عبو اى (A> T) واالجهبض اىخنشس

.

اىعبو اىخبس، اىزب، اىحبدي عشش ، ابط ، االجهبض اىخنشس ، قطبع غضة . كلمبث مفتبحيت:

IV

Dedication

To all of them I dedicate this work, fulfillment and recognition.

The Spirit of my father and mother

My lovely wife who supported me

My children: Baraa and Nema

who are proud of me, and insisted that their mother should achieve this

dream.

All my wonderful brothers and sisters,

for their endless love and support

My teachers, friends, great family and wife’s family

All Palestinian people,

who are steadfast and patient on the beloved land of Palestine and

all Palestinian people all over the world

V

Acknowledgements

I am grateful to Allah, who granted me life, power, peace and courage to finish this

study.

I would like to express my thanks to Prof. Fadel A. sharif, the supervisor of the

study, who did not spare any effort to overcome all the difficulties aroused during the

theoretical and practical parts and for his constructive scientific advice.

I am grateful for Islamic University especially for Department of Biological science

program. I would like also to express my sincere gratitude to all members of genetic

lab in the medical technology department in particular Mr. Shadi Al- Ashi.

My deep and sincere appreciations are also to Mr. Mohammed Jaber and Miss

Amany Al Hindi for their encouragement, continuous support.

My special deep and sincere gratitude to my children (Baraa and Nema ), who

endure my busy life every day.

My deepest love to my brothers, sisters, friends, my family, my wife's family for their

encouragement, continuous support and help.

Finally, profuse thanks, love and appreciations to my gorgeous wife Aida Zuhair

Al Massri , who remained by my side every day by her knowledge, support and

effort. My deepest thanks go to her.

VI

Table of Contents

Abstract (English)................................................................................................ I

Abstract (Arabic).............................................................................................. III

Dedication......................................................................................................... IV

Acknowledgements .......................................................................................... V

Table of Contents ............................................................................................... VI

List of Figures .................................................................................................... XI

List of Tables ..................................................................................................... XIII

Abbreviations ....................................................................................................XVII

Chapter One: Introduction

1.1. Overview................................................................................................... 2

1.2. Proplem..................................................................................................... 3

1.3. Overall objective............................................................................ 3

1.4. Specific objectives................................................................................ 4

1.5. Significance of the study................................................................ 5

Chapter Two: Literature Review

2.1. Physiological changes in pregnancy.................................................................. 7

2.2. Pregnancy loss.................................................................................................... 8

2.3. Recurrent pregnancy loss.................................................................................. 8

2.4. Causes of recurrent pregnancy loss.................................................................. 9

2.4.1. Genetic / chromosomal causes........................................................................ 9

2.4.2. Anatomic / Uterine abnormalities.................................................................. 9

2.4.3. Metabolic and Endocrine abnormalities......................................................... 9

2.4.4. Infectious causes............................................................................................. 10

2.4.5. Environmental and life style causes................................................................ 10

2.4.6. Immune causes................................................................................................ 10

2.4.7. Thrombophilic causes..................................................................................... 11

2.4.8. Unexplained causes........................................................................................ 11

2.5. Thrombophilia................................................................................................... 11

2.5.1. Definition of thrombophilia........................................................................... 11

2.5.2. Acquired thrombophilia................................................................................ 12

VII

2.5.3. Hereditary thrombophilia............................................................................... 12

2.6. MTHFR mutation ………............................................................................... 13

2.7. Factor V polymorphisms…………… ......................................................... 14

2.7.1. Factor V gene …………………….. ........................................................ 14

2.7.2. Factor V protein and its structure---------------------------------------------

2.7.3. Factor V (G1691A) polymorphism---------------------------------------

2.7.4 VR2 (H1299R) polymorphism..................................................................

14

16

18

2.7.5 Factor V Y1702C polymorphism………………………………………….. 18

2.8. Prothrombin gene (G20210A) mutation (factor II)………………………… 19

2.8.1. Factor II gene…………………………………………............................... 20

2.9. Association between factor V and factor II genes polymorphisms and RPL

………………………………………………………………………………………..

2.10. Factor XI gene …………………………………………………..................................................

20

22

2.10.1. Chromosomal location of Factor XI gene……………………………. 22

2.10.2. Function of factor XI ................................................................................... 23

VIII

Chapter Three: Materials and Methods

3.1. Materials.................................................................................................................... 25

3.1.1. Chemicals and reagents..............................................................................................25

3.1.2. Instruments and Disposables......................................................................................26

3.1.3. PCR primers..............................................................................................................27.

3.2. Study sample......................................................................................................................28

3.2.1. Study design......................................................................................................................28

3.2.2. Study location...................................................................................................................28

3.2.3. Characteristics of the study sample……. .............................................................28

3.2.4. Ethical considerations............................................................................................... 29

3.3. Methods..........................................................................................................................29

3.3.1. Sample collection......................................................................................................29.

3.3.2. DNA extraction.........................................................................................................29.

3.3.2.1. DNA purification..................................................................................................29

3.3.2.2. Detection and quantitation of extracted DNA.......................................................30

3.3.3. Genotyping........................................................................................................................30

3.3.3.1. Primers reconstitution...........................................................................................30

3.3.3.2. Determination of factor II (G20210A) Polymorphism.......................................30

3.3.3.2.1. - PCR-SSP procedure for factor II (G20210A) polymorphism......................30

3.3.3.3. Determination of factor V (G1691A) Polymorphism…………………………32

3.3.3.3.1. PCR-SSP procedure for factor V (G1691A) polymorphism……………….32

3.3.3.4. Determination of factor V (A4070G) Polymorphism………………………….33

3.3.3.4.1. Factor V (A4070G) PCR-RFLP procedure......................................................34

3.3.3.4.1.1. Polymerase Chain Reaction (PCR) for factor V (A4070G).....................34

3.3.3.4.1.2.Restriction Fragment Length Polymorphism (RFLP) by RsaI restriction

enzyme……………………………………………………………………………………35

3.3.3.4.2. Agarose gel electrophoresis (3.0%)…………………………………………..37

3.3.3.5. Determination of factor V (A5279G) polymorphism……………………………38

3.3.3.5.1. Factor V (A5279G) PCR-RFLP procedure…………………………………….38

3.3.3.5.1.1. Polymerase Chain Reaction (PCR) for factor V (A5279G)………………..38

IX

3.3.3.5.1.2. Restriction Fragment Length Polymorphism (RFLP) by AccI restriction

enzyme……………………………………………………………………………………39

3.3.3.6. Determination of factor XI rs3756008 (A>T) polymorphism…………………..42

3.3.3.6.1. Factor XI rs3756008 (A>T) PCR-RFLP procedure………………………….42

3.3.3.6.1. 1. Polymerase Chain Reaction (PCR) for factor XI rs3756008 (A>T)………42

3.3.3.6.1.2 Restriction Fragment Length Polymorphism (RFLP) by MluCI restriction

enzyme…………………………………………………………………………………….43

3.4 Statistical analysis………………………………………………………………46

Chapter Four: Results

4.1. PCR Genotyping results...............................................................................................48

4.2. Factor V (G1691A) gene polymorphism...................................................................51.

4.2.1. Genotype frequency of factor V (G1691A) polymorphism among RPL patients and

controls……………………………………………………………………………………..51

4.2.2. Alleles frequency of factor V (G1691A) polymorphism among RPL patients and

controls………………………………………….………………………………………….53

4.2.3. Hardy-Weinberg equilibrium in factor V (G1691A) gene polymorphism………...54

4.3. Factor V (A4070G) gene polymorphism……………………..……………………55

4.3.1. Genotype frequency of factor V (A4070G) polymorphism among RPL patients and

controls…………………………………………………………………………………….55

4.3.2. Alleles frequency of factor V (A4070G) polymorphism among RPL patients and

controls……………………….…………………………………………………………….57

4.3.3. Hardy-Weinberg equilibrium in factor V (A4070G) gene polymorphism…..….....58

4.4. Factor V (G1691A)/ Factor V (A4070G) gene polymorphism…………………….59

4.4.1. Genotype frequency of factor V (G1691A) and Factor V (A4070G) polymorphisms

among RPL patients and controls…………………………….……………………………59

4.4.2. Alleles frequency of factor V (G1691A) and A4070G polymorphism among RPL

patients and controls……………………………………………………………………….61

4.5. Independent effects of factor V (G1691A) and (A4070G)

polymorphisms….…………………………………………………………………..62

4.6. Factor V (A5279G) gene polymorphism…………………………………………..64

4. 6.1. Genotype frequency of the factor V (A5279G) polymorphism among RPL patients

and controls………………………………………………………………………………..64

X

4.6.2. Alleles frequency of factor V (A5279G) polymorphism among RPL patients and

controls………………………………………..……………………………………………66

4.6.3. Hardy-Weinberg equilibrium in factor V (A5279G) gene polymorphism………..67

4.7. Factor II (G20210A) gene polymorphism…………………………..…………….68

4.7.1. Genotype frequency of factor II(G20210A) polymorphism among RPL patients

and controls…………………………….……………………………………….……68

4.7.2. Alleles frequency of factor II (G20210A) polymorphism among RPL patients and

controls………………………………………………………………………………70

4.7.3. Hardy-Weinberg equilibrium in factor II (G20210A) gene polymorphism……….71

4.8. Factor XI rs3756008 A< T gene polymorphism………………………….………..72

4.8.1. Genotype frequency of factor XI rs3756008 A< T polymorphism among RPL

patients and controls………………..……………………………………………………..72

4.8.2. Alleles frequency of factor XI rs3756008 A< T polymorphism among RPL patients

and controls………………………………………………….……………………………..74

4.8.3. Hardy-Weinberg equilibrium in factor XI rs3756008 A< T gene polymorphism…75

Chapter Five: Discussion

5.1. The study sample….......................................................................................................77

5.2. Association between factor V: G1691A (R506Q; rs6025) gene polymorphisms and

RPL…………………………………………………………………………………………78

5.3. Association between factor V: H1299R (A4070G) gene polymorphism and RPL……79

5.4. Association between factor V: Y1702C (A5279G) gene polymorphism and RPL……80

5.5. Independent effects of Factor V (G1691A) and (A4070G) polymorphisms…………..81

5.6. Association between factor II: (G20210A) gene polymorphism and RPL..…………...82

5.7. Association between factor XI: rs3756008 (A>T) gene polymorphism and RPL…….83

Chapter Six: Conclusion and Recommendations

6.1. Conclusion......................................................................................................................85

6.2. Recommendations..........................................................................................................86

Chapter Seven: References

References............................................................................................................................87

XI

List of Figures

Fig. 2-1: Location of factor V gene on chromosome 1……………………………. 14

Fig. 2-2: The blood clotting cascade…………………. ……………….……..…… 15

Fig. 2-3:

Fig. 2-4:

Mechanism of Action of Factor V leiden………………………………

Mechanism of action of factor II ………………………………………... 17

19

Fig. 2-5: Location of factor II gene on chromosome 11…………………………. 20

Fig. 2-6:

Location of factor XI gene on chromosome 4…………………………..

23

Fig. 3-1: The PCR-RFLP principle of detecting mutant and wild type alleles……. 35

Fig. 3-2: The recognition site for RsaI restriction enzyme …………………… 36

Fig. 3-3: The recognition site for AccI restriction enzyme …………………….. 39

Fig. 3-4: The PCR-RFLP principle of detecting mutant and wild type alleles 40

Fig. 3-5: The recognition site for MluCI restriction enzyme ………………… 43

Fig. 3-6: The PCR-RFLP principle of detecting mutant and wild type

alleles………………………………………………………………..... 44

Fig. 4-1:

A photograph of ethidium bromide stained 3% agrarose gel showing the

PCR-SSP product for factor V G1691A polymorphisms …..………….

47

Fig. 4-2: A photograph of ethidium bromide stained 3% agrarose gel showing the

PCR-SSP product for factor II G20210A polymorphisms…………….. 48

Fig. 4-3: A photograph of ethidium bromide stained 3% agarose gel showing the

RFLP-PCR product for factor V A4070G polymorphism…………….. 48


RFLP-PCR product for factor V A5279G polymorphism……………… 49


RFLP-PCR product for factor XI rs3756008 A<T polymorphism…..…. 49

Fig. 4-6:

Frequency of genotypes of factor V (G1691A) polymorphism among

RPL patients--------------------------------------------------

50

XII

Fig. 4-7:

Frequency of genotypes of factor V (G1691A) polymorphism among

control women-----------------------------------------------------

51

Fig. 4-8:

Frequency of genotypes of factor V (A4070G) polymorphism among

RPL patients…………………………………………………….

54

Fig. 4-9:


control women………………………………………………….

55

Fig.4-10 Frequency of genotypes of factor V (G1691A)and A4070G

polymorphism among RPL patients--------------------------------------- 58

Fig.4-11

Frequency of genotypes of factor V (G1691A)and A4070G

polymorphism among control women------------------------------------

59

Fig.4-12


RPL patients…………………………………………………..

63

Fig.4-13


control women……………………………………………….

64

Fig.4-14

Frequency of genotypes of factor II (G20210A) polymorphism among

RPL patients-------------------------------------------------------

67

Fig.4-15

Frequency of genotypes of factor II (G20210A) polymorphism among

control women……………………………………………….

68

Fig.4-16 Frequency of genotypes of factor XI rs3756008 A< T polymorphism

among RPL patients …………………………………. 71

Fig.4-17

Frequency of genotypes of factor XI rs3756008 A< T polymorphism

among control women……………

72

XIII

List of Tables

Table

3-1: Chemicals and reagents…………………....................................................... 24

Table

3-2:

Instruments and disposables………………………………………………….

25

Table

3-3: Nucleotide sequence of the PCR primers…………………………………… 26

Table

3-4:

PCR primers and lengths of PCR products for factor II (G20210A)

polymorphism………………………………………………………………

30

Table

3-5:

PCR components for amplification of the factor II (G20210A)

Polymorphism……………………………………………………………… 30

Table

3-6:

Thermocycler program for PCR amplification of the factor II (G20210A)

polymorphism……………………………………………………………..

30

Table

3-7:

PCR primers and lengths of PCR products for factor V (G1691A) polymorphism……………………………………………………………….

31

Table

3-8:

PCR components for amplification of the factor V (G1691A)

Polymorphism……………………………………………………………......

31

Table

3-9:

Thermocycler program for PCR amplification of the factor V (G1691A) polymorphism……………………………………………………….

32

Table

3-10:

Primer sequences and restriction enzymes for factor V (A4070G)

Polymorphism…………………………………………………………….. 32

Table

3-11:

PCR components for amplification of the factor V (A4070G)

Polymorphism………………………………………………………………

33

Table

3-12:

Thermocycler program for PCR amplification of the factor V (A4070G)

polymorphism…………………………………………………

33

Table

3-13:

The enzymatic digestion components of amplified factor V (A4070G)

gene………………………………………………………………………… 34

Table

3-14:

Primer sequences and restriction enzyme for factor V (A5279G)

Polymorphism………………………………………………………………

37

Table

3-15:

PCR components for amplification of the factor V (A5279G)

Polymorphism……………………………………………………………….

38

Table

3-16:

Thermocycler program for PCR amplification of the factor V (A5279G)

polymorphism…………………………………………………...

38

Table

3-17:

The enzymatic digestion components of amplified factor V (A5279G)

39

XIV

Table

3-18:

Primer sequences and restriction enzyme for factor XI rs3756008 (A>T)

Polymorphism…………………………………………………………….

41

Table

3-19:

PCR components for amplification of factor XI rs3756008

Polymorphism……………………………………………………………

42

Table

3-20:

Thermocycler program for PCR amplification of the factor XI rs3756008

polymorphism………………………………………………..

42

Table

3-21: The enzymatic digestion components of amplified XI rs3756008 43

Table

4-1:

Frequency of genotypes of factor V (G1691A) polymorphism among RPL

patients…………………………………………………….

50

Table

4-2:

Frequency of genotypes of factor V G1691A polymorphism among control

women……………………………………………………………

51

Table

4-3:

Genotype frequency of factor V (G1691A) gene polymorphism among RPL

patients and controls…………………………………………………. 52

Table

4-4:

Alleles frequency of factor V (G1691A) polymorphism among RPL

patients and controls………………………………………………………..

53

Table

4-5:

Observed and expected genotype frequencies of factor V (G1691A)

polymorphism………………………………………………………………. 53

Table

4-6:

Frequency of genotypes of factor V (A4070G) polymorphism among RPL

patients………………………………………………………..

54

Table

4-7:

Frequency of genotypes of factor V A4070G polymorphism among control

women…………………………………………………………… 55

Table

4-8:

Genotype frequency of factor V (A4070G) gene polymorphism among RPL

patients and controls………………………………………………… 56

Table

4-9:

Alleles frequency of Factor V (A4070G) polymorphism among RPL

patients and controls……………………………………………………….

57

Table

4-10:

Observed and expected genotype frequencies of factor V (A4070G)

polymorphism………………………………………………………………

57

Table

4-11:

Frequency of genotypes of Factor V (G1691A)and A4070G polymorphism

among RPL patients ……………………………………… 58

Table

4-12:

Frequency of genotypes of factor V G1691A and A4070G polymorphism

among control women………………………………………………………

59

Table

4-13:

Genotype frequency of factor V (G1691A) and A4070G gene

polymorphism among RPL patients and controls……………………….

60

XV

Table

4-14:

Alleles frequency of factor V (G1691A) and A4070G polymorphism among

RPL patients and controls………………………………………………….

61

Table

4-15:

Genotype frequency of FV variant "A4070G"and "G1691A" among RPL

patients and controls…………………………………………….

61

Table

4-16:

Alleles frequency of the FV "A4070G "and "G1691A" SNPs among RPL

patients and controls……………………………………………………..

62

Table

4-17:

Frequency of genotypes of factor V (A5279G) polymorphism among RPL

patients…………………………………………………..

63

Table

4-18:

Frequency of genotypes of factor V A5279G polymorphism among control

women……………………………………………………….

64

Table

4-19:

Genotype frequency of factor V (A5279G) gene polymorphism among RPL

patients and controls ……………………………………………… 65

Table

4-20:

Alleles frequency of factor V (A5279G) polymorphism among RPL

patients and controls……………………………………………………..

66

Table

4-21:


polymorphism…………………………………………………………….

66

Table

4-22:

Frequency of genotypes of factor II (G20210A) polymorphism among RPL

patients………………………………………………….

67

Table

4-23:

Frequency of genotypes of factor II G20210A polymorphism among control

women……………………………………………………….

68

Table

4-24:

Genotype frequency of factor II (G20210A) gene polymorphism among

RPL patients and controls………………………………………..

69

Table

4-25:

Alleles frequency of factor II (G20210A) polymorphism among RPL

patients and controls ……………………………………………………. 70

Table

4-26:

Observed and expected genotype frequencies of factor II (G20210A)

polymorphism …………………………………………………………… 70

Table

4-27:

Frequency of genotypes of Factor XI rs3756008 A< T polymorphism

among RPL patients……………………………………..

71

Table

4-28:

Frequency of genotypes of factor XI rs3756008 A< T polymorphism among

control women…………………………………………………….

72

XVI

Table

4-29:

Genotype frequency of factor XI rs3756008 A< T gene polymorphism

among RPL patients and controls…………………………………………

73

Table

4-30:

Alleles frequency of factor XI rs3756008 A< T polymorphism among RPL

patients and controls ……………………………………………….. 74

Table

4-31:


polymorphism…………………………………………………………….

75

XVII

Abbreviations APC activated protein C

APS antiphospholipid syndrome

ASRM American Society for Reproductive Medicine

bp base pair

CI Confidence interval

DNA deoxyribonucleic acid

EDTA ethyelenediaminetetraacetic acid

F forward

FVL Factor V leiden

LH luteinizing hormone

LPD Luteal phase defect

MTHFR methylenehydrofolate reductase

OR Odds ratio

PAI-1 Plasminogen activator inhibitor-1

PCOS polycystic ovarian syndrome

PCR polymerase chain reaction

PCR-RFLP polymerase chain reaction- restriction fragment length polymorphism

PCR-SSP polymerase chain reaction- sequence- specific primers

R reverse

RCOG Royal College of Obstetricians and Gynaecologists

RM recurrent miscarriage

RPL recurrent pregnancy loss

rs Reference sequence

SNPs single nucleotide polymorphisms

TORCH Toxoplasmosis, rubella, cytomegalovirus, chlamydia, herpes

VTE venous thromboembolism

WHO World Health Organization

1

Chapter One

Introduction

2

Chapter (1) Introduction

1.1 Overview

Normal pregnancy is associated with major changes in many aspects of

homeostasis all contributing to maintain placental function during pregnancy and to

prevent excessive bleeding during delivery (Prisco et al., 2005).

Recurrent pregnancy loss (RPL) is defined as three or more consecutive pregnancy

losses before the 24th week of gestation (WHO, 2009), however, two or more losses

were also considered in some studies (Abu-Asab et al., 2011). RPL is a devastating

problem, particularly to Palestinian families who are fond of having large families

(Sharif, 2012).

RPL has many possible causes that can be categorized as genetic abnormalities,

hormonal and metabolic disorders, uterine anatomic abnormalities, infectious causes,

immune disorders and thrombophilic disorders (Sharif, 2012). However, more than

50% of the RPL cases remain unexplained (Kovalevsky et al., 2004).

Thrombophilia can be defined as a predisposition to form clots inappropriately.

Thrombotic events are increasingly recognized as a significant source of mortality and

morbidity (Khan and Dickerman, 2006) and women with thrombophilia have been

shown to be at an increased risk of pregnancy loss and possibly other serious obstetric

complications (Kujovich, 2004).

Reasons for clotting of the placental vessels include both acquired and inherited

thrombophilia. Both inherited and combined inherited / acquired thrombophilias are

common, with more than 15% of the white population carrying an inherited

thrombophilic mutation (Ford and Schust, 2009).

3


The most common cause of acquired thrombophilia is antiphospholipid antibodies.

Inherited thrombophilias, on the other hand, can result from gene mutations. Inherited

thrombophilia is further grouped into; inherited defects of coagulation (e.g., Factor V

von Leiden, Factor II Prothrombin, Fibrinogen, Factor XIII), inherited defects of

fibrinolysis (e.g., Plasminogen activator inhibitor-1(PAI-1)), inherited defects of

enzymatic pathway in relation to development of venous thromboembolism (VTE)

and inherited defects of platelets and thrombosis (Human Platelet Antigen-1HPA; also

Known as Integrin beta-3), Methylene tetrahydrofolate reductase “MTHFR”)

(Konecny, 2009).

Inherited thrombophilias are associated with recurrent miscarriage and this

association has been shown to be manifested by total number of mutations rather than

the specific genes involved (Coulam et al., 2006).

1.2 Problem

Recurrent pregnancy loss (RPL) is a worldwide clinical and stressful problem that

has been studied tremendously but the causes and treatment have not been fully

resolved. No unequivocal cause is currently available for more than half of the cases

suffering from RPL (Ledingham et al., 2000; Makino et al., 2004).

1.3 Overall objective

To investigate the relation between recurrent pregnancy loss (RPL) and common

polymorphisms in factor-V G1691A, factor-V H1299R (A4070G), factor-V Y1702C

(A5279G), factor-II G20210A, and factor-XI rs3756008 (A>T) genes.

4


1.4 Specific Objectives

To investigate the association between G1691A, H1299R, Y1702C

polymorphisms in factor V gene and (RPL).

To investigate the association between G20210A polymorphism in factor II

gene and (RPL).

To investigate the association between rs3756008 (A>T) polymorphism in

factor XI gene and (RPL).

To determine the frequency of factor-V G1691A, factor-V H1299R

(A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI

rs3756008 (A>T) polymorphisms in our population.

To develop appropriate recommendations regarding the investigated

polymorphisms and the risk of RPL.

5


1.5 Significance of the study

This study is the first of its kind in Gaza strip and was conducted in order to

determine the incidence of polymorphisms in factor-V G1691A, factor-V H1299R

(A4070G), factor-V Y1702C (A5279G), factor-II G20210A, and factor-XI rs3756008

(A>T) genes and to determine the possible association between those polymorphisms

and RPL. The results of the study may help physicians in Gaza Strip to manage RPL

associated with inherited thrombophilia.

6

Chapter Two

Literature Review

7

Chapter (2) Literature Review

2.1. Physiological changes in pregnancy

Pregnancy is ahypercoagulable state (Kupfermic, 2003). There are several

physiological changes that occur in pregnancy that synergistically create a

hypercoagulable state and thus a tendency to clot (Dawood, 2013). Because

pregnancy is a hypercoagulable state, thrombophilia may raise the risk of

thromboembolism during gestation or postpartum (Sibai et al., 2007).

There is a demonstrable increase in the concentrations of hemostatic components such

as von Willebrand factor, factors V, VII, factor X and a dramatic increase is usually

observed in factor VIII C. Increases in the levels of fibrinogen factors II, VII, X and

XII may also be as high as 20-200%. In contrast, endogenous anticoagulant levels

increase minimally. While levels of antithrombin III and protein C remain constant

there is a fall in the free and total protein S antigen (Dawood, 2013).

Normal pregnancy is associated with changes in the coagulation and fibrinolytic

system of hemostasis. These include a decrease in platelet count, increases in a

number of clotting factors, a decrease in anticoagulant factor, protein S, a significant

fall in the activity of activated protein C and inhibition of fibrinolysis. These changes

that result in a state of hypercoagulability are likely due to hormonal changes and

increase the risk of thromboembolism (Prisco et al., 2005; Thornton and Douglas,

2009). A fine balance between coagulation and fibrinolysis is critical in early

pregnancy (Su et al., 2013).

Several studies have demonstrated an association between the presence of

a thrombophilic disorder and adverse obstetric complications such as placental

abruption, stillbirth, preeclampsia and recurrent miscarriage. The hypothesis is that

the pre-existence of a thrombophilic disorder exaggerates the physiologically induced

state of hypercoagulation causing microthrombi that disrupt the uteroplacental

perfusion (Dawood, 2013).

8


2.2. Pregnancy loss

According to the Royal College of Obstetricians and Gynaecologists (RCOG)

Green-top Guideline No. 17, a miscarriage can be defined as the spontaneous

loss of a pregnancy before the fetus has reached viability at 24 weeks. This

includes all pregnancy losses from the time of conception until 23 completed

weeks of gestation (Kruger et al., 2013).

Miscarriage occurs in approximately 15% of all pregnancies (Saito, 2009).

Pregnancy losses were classified as early (5–12 weeks) and late (13–30 weeks)

(Mahjoub et al., 2005).

2.3. Recurrent pregnancy loss

The American Society for Reproductive Medicine defines RPL as two or more

failed pregnancies, which have been documented by either ultrasound or

histopathological examination (Kruger et al., 2013).

Recurrent pregnancy loss (RPL) represents a major health problem with two-

three or more losses in up to 5% of women of reproductive age and is actually

one of the most common causes of female infertility (Pierpaolo et al., 2009).

Clinical studies indicate that the risk of another miscarriage after 3 consecutive

pregnancy losses is 30-45%. Furthermore, without any workup or treatment, the

chance of a successful live birth in a couple with a history of RPL and no previous

live birth is 55-60%. If the couple has a history of RPL and has had at least one

previous normal pregnancy, the chance of a subsequent live birth is 70%. These

percentages are based on studies of young women, and it is important to keep in mind

that the miscarriage rate increases with age (Evans, 2012).

9


2.4. Causes of recurrent pregnancy loss

There are several causes for recurrent pregnancy loss that are identifiable and

understood by medical science. However, in many couples the cause of RPL remains

unexplained (Lavigne et al., 2005; Ford and Schust, 2009).

2.4.1. Genetic / chromosomal causes

Embryonic chromosomal abnormalities (structural and numerical) may account

for 30 - 57% of miscarriages. Research has shown that the risk of aneuploidy

increases as the number of previous miscarriages increases. Parental chromosomal

rearrangements are the cause of RPL in 3 - 5% of couples. The most common

abnormalities are balanced reciprocal or Robertsonian translocations (Kruger et al.,

2013).

2.4.2. Anatomic / Uterine abnormalities

Congenital uterine abnormalities have been associated most often with second

trimester pregnancy loss. However, 10-15 % of women with recurrent early

pregnancy loss have congenital uterine abnormalities (Reddy et al., 2006). Congenital

uterine abnormalities include a double uterus, uterine septum, and a uterus in which

only one side has formed. Asherman’s syndrome (scar tissue in the uterine cavity),

uterine fibroids, and possibly uterine polyps are acquired abnormalities that may also

cause recurrent miscarriages. Some of these conditions may be surgically corrected

(ASRM, 2008).

2.4.3. Metabolic and Endocrine abnormalities

Diabetes, hypothyroidism, polycystic ovary syndrome (PCOS), luteal phase defect,

and obesity are classically associated with an increased risk of miscarriage (Shallal

2010). However, a number of designed studies have shown that neither polycystic

ovaries (PCO) nor high luteinizing hormone (LH) levels are a cause for recurrent

miscarriages (Clifford et al., 1996; Rai et al., 2000; Nardo et al., 2002)

10


2.4.4. Infectious causes

No infectious agent has been proven to cause RPL (Kruger et al., 2013). Some

serious infections can cause or increase the risk of single miscarriages. These include

toxoplasmosis, rubella, listeria and genital infection. But it is not clear whether

infection plays a role in recurrent miscarriage (The Miscarriage Association, 2011).

2.4.5. Environmental and life style causes

Cigarette smoking has been suggested to have an adverse effect on trophoblastic

function and is linked to an increased risk of sporadic pregnancy loss. Obesity has

also been shown to be associated with an increased risk of RPL in women who

conceive naturally. Other life-style habits such as cocaine use, alcohol consumption (3

to 5 drinks per week), and increased caffeine consumption ( > 3 cups of coffee) have

been associated with risk of miscarriage (ASRM, 2012).

2.4.6. Immune causes

Autoimmunity refers to an immune reaction of the body against substances that are

normally present in the body. Numerous studies have attempted to identify specific

autoantibodies associated with pregnancy loss (Kutteh and Odom, 2012).

Among the autoimmune factors, anti-phospholipid antibodies (APAs) have been

demonstrated to be the strongest risk factors for fetal loss, the prevalence of which

is as high as 40% in women with RPL. Other autoimmune antibodies implicated in

RPL are anti-nuclear antibodies (ANAs), anti-thyroid antibodies and anti-endothelial

cell antibodies (Ghosh et al., 2009).

11


2.4.7. Thrombophilic causes

Thrombophilia is defined as a tendency to develop thrombosis due to predisposing

hereditary and/or acquired risk factors. Although thrombosis may occur in both

veins and arteries, the term thrombophilia is usually considered in the context of

venous thromboembolism (VTE), since most of the well-defined thrombophilic

risk factors are commonly associated with thrombosis in venous blood vessels

(Sandra Margeti, 2014). Thrombophilia and its influence on pregnancy have been

studied for the past 50 years. Both inherited and acquired thrombophilia have been

associated with an increased risk of thrombo-embolism as well as an increased risk of

pregnancy loss and adverse obstetric outcomes (Dawood, 2013).

2.4.8. Unexplained causes

More than half of the couples who have investigations for recurrent miscarriage don’t

come out with an answer as to why they have miscarried (The Miscarriage

Association, 2011).

2.5. Thrombophilia

2.5.1. Definition of thrombophilia

Thrombophilia can be defined as a predisposition to form clots inappropriately.

The predisposition to form clots can arise from genetic factors, acquired changes in

the clotting mechanism, or, more commonly, an interaction between genetic and

acquired factors (Khan et al., 2006). Thrombophilias may be inherited or acquired, or

have components of both types (Foy and Moll, 2009).

12


2.5.2. Acquired thrombophilia

Acquired thrombophilia refers to a group of disorders that an individual is not born

with, but may develop throughout his or her life due to another illness or situation. An

example of acquired thrombophilia is the development of a lupus anticoagulant or

antiphospholipid antibody syndrome. Several authors underlined the role of the

antiphospholipid syndrome (APS) in the pathophysiology of RPL (D’Uva et al.,

2010). During APS, a large variety of autoantibodies also toward clotting factors,

such as factor XII, has been found (Jones et al., 2001; D’Uva et al., 2005). However, a

clear explanation of all involved processes on the roles of antiphospholipid antibodies

and of autoantibodies toward clotting factors is still a matter of discussion (D’Uva et

al., 2010). On the other hand, a role of increased maternal plasma levels of clotting

factor VIII and the risk of RPL has been reported (Dossenbach - Glaninger et al.,

2004).

2.5.3. Hereditary thrombophilia

Some of the inherited abnormalities of the anticoagulant mechanisms that operate in

plasma are established risk factors for venous thromboembolism. They include anti-

thrombin (AT), protein C (PC), and protein S (PS) deficiencies and the activated PC

(APC) resistance phenomenon attributable (or not) to the presence of the factor V

(FV) Leiden mutation which may be defined as a poor response of plasma to the

anticoagulant action of APC (Tripodi et al., 2001).

13


2.6. MTHFR mutations

Hyperhomocysteinemia can result from genetic or nutrient-related disturbances in

the trans-sulphuration and remethylation pathways of the homocysteine metabolism.

The enzyme 5,10-methylenetetrahydrofolate reductase (MTHFR) catalyzes the

reduction of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, the

predominant circulatory form of folate and the carbon donor for the remethylation of

homocysteine to methionine (Unfried et al., 2002).

Hyperhomocysteinemia can be seen with deficiencies in vitamins B6, B12, folic

acid, and methylenehydrofolate reductase (MTHFR). Several mutations in the

MTHFR gene (e.g., C677T and A1298C) can be a cause of mild to severe

hyperhomocysteinemia. Homozygosity for MTHFR mutations is a relatively common

cause of mildly elevated plasma homocysteine levels in the general population, often

occurring in association with low serum folate levels. Homozygosity for MTHFR

mutations is common worldwide with an estimated 10-25% prevalence among various

ethnic backgrounds. The risk of embryonic and fetal loss is increased if the MTHFR

gene mutation is combined with additional thrombophilic factors (Rozano-Gorelick et

al., 2009; Carbone and Rampersad, 2010).

14


2.7. Factor V polymorphisms.

2.7.1. Factor V gene

The gene for factor V is located on the first chromosome (1q23) (Fig. 2-1). It is

genomically related to the family of multi copper oxidases, and is homologous to

coagulation factor VIII. The gene spans 70 kb, consists of 25 exons, and the resulting

protein has a relative molecular mass of approximately 330kDa (Nazemi et al., 2013).

Fig. 2-1: Location of Factor V gene on chromosome 1

(Adopted from Genetic home Reference)

2.7.2. Factor V protein and its structure

The factor V protein is made primarily by cells in the liver. The protein circulates in

the bloodstream in an inactive form until the coagulation system is activated by an

injury that damages blood vessels. When coagulation factor V is activated, it interacts

with coagulation factor X. The active forms of these two coagulation factors (written

as factor Va and factor Xa, respectively) form a complex that converts an important

coagulation protein called prothrombin to its active form, thrombin. Thrombin then

converts a protein called fibrinogen into fibrin, which is the material that forms the

clot (Kane et al., 1982 ) (Fig. 2-2).

http://en.wikipedia.org/wiki/Gene

http://en.wikipedia.org/wiki/First_chromosome

http://en.wikipedia.org/wiki/Multicopper_oxidase

15


Fig. 2-2: The blood coagulation cascade

(Adopted from Makaryus et al., 2013)

16


2.7.3. Factor V (G1691A) polymorphism

Some people do not have the normal factor V protein. Instead, they have a different

form called factor V Leiden. This is caused by a change (mutation) in the gene for this

protein. The different allele that makes the factor V Leiden protein is inherited from

one or both parents (Hamilton Health Sciences, 2007).

Factor V Leiden (FVL) describes a G1691A nucleotide transition resulting in an

R506Q amino acid missense mutation. Early papers showed that the resulting factor V

protein was resistant to proteolysis by activated protein C (APC), (Fig. 2-3) and it is

now recognized that FVL accounts for 90% to 95% of cases of APC resistance. Factor

V resistance to APC has an incidence of 4.8% in the general population and is the

most common cause of inherited thrombosis, accounting for 40% to 50% of cases

(Rosendorff et al., 2007).

17


Fig. 2-3: Mechanism of Action of Factor V Leiden (Adopted from

http://www.med.illinois.edu/hematology/ptfacv2.htm)

18


2.7.4. VR2 (H1299R) polymorphism:

Another polymorphism in the Factor V gene, the His1299Arg polymorphism, has

been identified and linked to hereditary thrombophilia. This exon 13 polymorphism

was first described in 1996 (Lunghi et al., 1996).

The Arg1299 (R2) allele was reported to be more frequent in subjects with reduced

FV activity levels (De Visser et al., 2000). Another study reported that the R2 allele

was associated with a reduced sensitivity for activated protein C "APC" (Bernardi et

al., 1997).

2.7.5. Factor V Y1702C polymorphism

A novel FV gene mutation (5279 A/G) predicting a remarkable amino acid

substitution (Y1702C) in the A3 domain, is considered as a common cause of FV

deficiency in the Italian population, and the causative role of the FV Y1702C

mutation is supported by the absolute conservation of the affected residue in all three

A domains of FV and of homologous factor VIII and ceruloplasmin, and by the

disrupting structural effects of the Y1702C substitution (Castoldi et al., 2001).

19


2.8. Prothrombin gene (G20210A) mutation (factor II)

It was discovered in 1996 that a specific change in the genetic code causes the body to

produce too much of the prothrombin protein. Having too much prothrombin makes

the blood more likely to clot (Fig. 2-4). People with this condition are said to have

a prothrombin mutation, also called the prothrombin variant, prothrombin

G20210A, or a factor II mutation (Moll et al., 2004). Prothrombin gene mutation is

the second most common cause (after FVL) of inherited thrombophilia in the United

States. It is present in about 2% of Caucasians (Tsiolakidou and Koutroubakis, 2008).

Fig. 2-4: Mechanism of Action of Factor II

(Adopted Wikipedia)

http://circ.ahajournals.org/search?author1=Stephan+Moll&sortspec=date&submit=Submit

20


2.8.1. Factor II gene

The F2 gene is located on the short (p) arm of chromosome 11 at position 11. More

precisely, the F2 gene is located from base pair 46,719,191 to base pair 46,739,505 on

chromosome 11(Fig. 2-5) (Genetic home Reference).

Fig. 2-5: Location of Factor II gene on chromosome 11


2.9. Association between factor V and factor II genes polymorphisms

and RPL.

Ulukufi et al., (2006) reported that the frequency of Factor V Leiden mutation

was significantly higher in the complicated pregnancy group as compared to the

normal group (23.3% vs. 7.5%) (p=0.04). On the other hand, no difference was

detected on the heterozygous MTHFR frequencies between the two groups.

However, 9% of the women with complicated pregnancies had homozygous

mutation and no woman was homozygous for MTHFR in the control group.

Prothrombin gene mutation was found in only one patient from the control group.

http://ghr.nlm.nih.gov/chromosome/11

21


Torabi et al., (2009) showed that the prevalence of FV Leiden mutation in the

cases and the controls was 13% and 4%, respectively. The chances for recurrent

pregnancy losses were more than 3.5 times higher in individuals with this

polymorphism (OR: 3.586, 95% CI: 1.127–11.412). The frequencies of FV

A4070G and FV A5279G were 14% and 37% in the case and 4% and 7% in the

control groups, respectively and the chances for RPL were higher in cases with

these two polymorphisms. The proportion of cases with two or three mutations in

the gene in comparison with the controls, showed a significant correlation

between FV Leiden and FV A4070G polymorphisms. Statistical analysis of the

simultaneous effects of the three polymorphisms for RPL showed that evaluation

of FV A4070G and FV A5279G could help assess the chances of the three

mutations for RPL.

Ardestani1 et al., (2013) indicated that the frequency of the factor V Leiden

among cases was 2.5%, which was higher than controls (1.25%), but the

difference was not significant. No factor II G20210 mutation was found among

cases or controls.

Gawish (2013) investigated the frequencies of FVL and FII mutations in relation

to pregnancy loss stages and showed that FVL mutation ratio was high among

cases with early pregnancy loss (26%) followed by the late stage (25%) and

controls (1.4%) that was statistically significant. On the other hand FII mutation

ratio was high among cases with late pregnancy loss (50%) followed by early

(38%) and controls (1.4%) that also was statistically significant. The author

concluded that there is a strong association between the presence of thrombophilic

mutations related to FVL and FII genes among Saudi women.

Wolfa et al., (2003) concluded that FV Leiden mutation was significantly more

common in women with RPL (10%, p = 0.02) and infertility (19%, p = 0.0005) as

compared to controls (2%).

Motee et al., (2007) showed that the prevalence of FVL was significantly higher

in women with RPL in comparison with controls, particularly in the subgroup

with primary RPL, and there is an association between factor V Leiden mutation

and recurrent pregnancy loss.

22


Abu-Asab et al. (2011) analysis had failed to find a significant association

between FVL, FII, MTHFR; and RPL in either the first or second trimester. FVL

was significantly associated with fetal loss if the loss was a stillbirth.

Kazerooni et al., (2013) showed that hyperinsulinemia, hyperandrogenemia,

hypofibrinolysis, and hyperhomocysteinemia as well as APCR and factor V

Leiden mutations are associated with RPL in patients with PCOS.

Hussein et al., (2010) results provided evidence for a significant correlation

between recurrent miscarriages and Factor V mutation.

Abd Allah and Hassan (2014) instigated the presence of factor V Leiden

mutation in RPL and controls. Their result showed no significant difference

between the two group (8.6% of case vs. 6% of control).

2.10. Factor XI gene

Coagulation factor XI (FXI) is essential for normal function of the intrinsic pathway

of blood coagulation (Kong M et al., 2014). Genetic variants in the FXI gene are risk

factors for venous thrombosis among both Whites and Blacks (Austin et al., 2011).

Hitherto, there is no published studies on the relation between RPL and FXI

rs3756008 (A>T) polymorphism but significant association between this FXI

variation and ischemic stroke has been reported (Hanson et al., 2013).

2.10.1.Chromosomal location of factor XI gene

The FXI gene is located on the long (q) arm of chromosome 4 at position 35 (Fig. 2-6)

(Genetic home Reference).

http://ghr.nlm.nih.gov/chromosome/4

23


Fig. 2-6: Location of Factor XI gene on chromosome 4


2.10.2 Function of factor XI

Factor XI (FXI) is the zymogen of an enzyme (FXIa) that contributes to hemostasis

by activating factor IX. Although bleeding associated with FXI deficiency is

relatively mild, there has been resurgence of interest in FXI because of studies

indicating its contribution to thrombosis and other processes associated with

dysregulated coagulation (Emsley et al., 2010).

Factor XI (FXI) deficiency was first described in the early 1950s. In contrast with the

well-characterized hemophilias, the bleeding disorder was mild, affected both

genders, and spontaneous haemorrhage was not a feature, with bleeding generally

related to surgery or trauma. The disorder is sometimes referred to as

haemophilia C (Gomez et al., 2008).

In terms of its association with pregnancy complications only one published report

was encountered (Dahm et al., 2012) where they found no significant effect of this

SNP on adverse pregnancy outcome. The same report however, showed that another

SNP change in factor XI (rs2289252) is associated with pregnancy-related venous

thrombosis.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Emsley%20J%5BAuthor%5D&cauthor=true&cauthor_uid=20110423

24

Chapter Three

Materials and Methods

25

Chapter (3) Materials and methods

3.1. Materials

3.1.1. Chemicals and reagents

Chemicals and reagents used in this study are shown in Table (3-1). All chemicals

were of analytical and molecular biology grade.

Table 3-1: Chemicals and reagents

# Reagent Supplier

1. Wizard ® Genomic DNA Purification Kit Promega (Madison, USA)

2. PCR Go Taq® Green Master Mix Promega (Madison, USA)

3. Agarose Promega (Madison, USA)

4. PCR primers Hy.labs (Rehovot, Israel)

5. Rsal, AccI, MluCI Restrictions enzymes Biolabs (England)

6. Nuclease free water (Sigma USA).

7. Ethidium bromide Promega (Madison, USA)

8. Ethanol 70% (Sigma USA).

9. Absolute Isopropanol (Sigma USA).

26


3.1.2. Instruments and Disposables

The present work was carried out in the Genetics lab at the Islamic University of

Gaza. The important instruments and disposables used in the present study are listed

in Table (3-2):

Table 3-2: Instruments and disposables

# Instrument Manufacturer

1. Thermal Cycler Biometra, Germany

2. Electrophoresis chambers and tanks (horizontal) BioRad, USA

3. Electrophoresis power supply BioRad, USA

4. Microcentrifuge Sanyo, UK

5. Microwave Oven L.G, Korea

6. Digital balance AE adam, USA

7. Freezer, refrigerator ORSO, pharml-spain

8. Micropipettes (0.1-2.5μl / 0.5-10μl / 5-50μl / 20-200μl / 100-1000μl) Dragon-lab, USA

9. Safety cabinet N-Biotek,Inc

10. Gel documentation system Vision, Scie-Plas Ltd, UK

11. Microfuge tubes for PCR - thin wall 0.2 mL, 1.5mL

capacity Labcon, USA

12. Nano-drop spectrophotometer Implen, Germany

13. EDTA tubes Hy. Labs. Israel

14. Disposable tips Labcon, USA

27


3.1.3. PCR primers

All PCR primers are indicated from 5' to 3' end. Sense primers are marked with (F)

while antisense primers are marked with (R). The primer sequences were obtained

from published studies and are provided in (Table 3-3).

Table 3-3: Nucleotide sequence of the PCR primers

Gene Primer sequence Reference

Factor II

(G20210A)

Common 5’- TCTAGAAACAGTTGCCTGGCAG-3’ (Gawish et al,

2013) Mutant 5’- GCACTGGGAGCATTGAGGATT-3’

Normal 5'- GCACTGGGAGCATTGAGGATC-3'

Factor V

(G1691A)

Common 5'- CTTTCAGGCAGGAACAACACC-3' (Dajani et al,

2012) Mutant 5'- TGGACAAAATACCTGTATACCTT-3'

Normal 5'- GGACAAAATACCTGTATTGCTC-3'

Factor V

(A4070G)

F 5'-TGCTCCTTTATCTCCGAGGACC-3' (Torabi et al,

2009) R 5'-CTCTGGAGGAGTTGATGTTTGTCC-3'

Factor V

(A5279G)

F 5'-CTGTCGGGCTTGGGTCT-3' (Torabi et al,

2009) R 5'-GAAATAACCCCGACTCTTC-3'

FXI

rs3756008

(A<T)

F 5'-TTTGGTTTTCCAGTGAAGCA-3'

This study

R 5'-GTGCCAAGAATGGCTTTCA-3'

28

Chapter (3) Materials and Methods

3.2. Study sample

3.2.1. Study design

The current study is a retrospective case-control study, in which women with RPL

were compared to women without any evidence of abortion.

3.2.2. Study location

Genetics lab.-Islamic University, Gaza strip.

3.2.3. Characteristics of the study sample

The study sample consisted of women from Gaza strip. The case group consisted of

200 women who had at least two or three unexplained RPL ≤20 weeks of gestation,

between 20-35 years old women, and their husbands are not their family relatives.

The control group consisted of 200 women who had at least two live births without

previous history of abortion, The control and case groups were matched in age and all

other possible characteristics. All study sample was recruited from the Genetics lab of

the Islamic university of Gaza.

29


3.2.4. Ethical considerations

Informed consent was taken from all the subjects who participated in the study. The

objective of the study was fully explained to all participants and their consent was

taken.

3.3. Methods

All polymorphisms were tested in the Genetics lab of the Islamic University.

3.3.1. Sample collection

About 3.0 ml of venous blood were drawn into sterile EDTA tubes and mixed gently,

under quality control and safety procedure. EDTA tube was used for genomic DNA

extraction.

3.3.2. DNA extraction

3.3.2.1. DNA purification

Genomic DNA was isolated from blood using Wizard Genomic DNA Purification Kit

(Promega, USA), according to the manufacturer's protocol.

30


3.3.2.2. Detection and quantitation of extracted DNA

The quality of the isolated DNA was determined by running 5 μl of each sample on

ethidium bromide stained 1.0% agarose gel. The DNA sample was then visualized on

a Gel documentation system. DNA concentration was measured using a nano-drop

spectrophotometer.

3.3.3. Genotyping

3.3.3.1. Primers reconstitution

The primers were reconstituted at 2.0 µmol concentration. Primer containers were

first centrifuged at 13,000 rpm for 3 minutes, and then reconstituted with ultra pure

water, vortexed and diluted by transfer of 5 µL of each reconstitute to a new clean

sterile labeled microfuge tube containing 45 µL of ultra pure water, to be at a final

concentration of 2.0 µmol.

3.3.3.2. Determination of factor II (G20210A) polymorphism

Factor II (G20210A) polymorphism was genotyped using PCR sequence-specific

primers (PCR-SSP), which uses two reactions with two sets of primers: one primer is

specific for each allele (allele-specific primer) and is paired with a second common

primer to control for PCR efficiency. The basis of this method is the reduction in the

efficiency of Taq polymerase to amplify DNA when there is a 3’ terminal nucleotide

mismatch between the target DNA and the allele-specific primer. The f II genotype is

identified by the presence or absence of DNA bands after gel electrophoresis of the

PCR products. This method is a relatively simple and inexpensive procedure for f II

genotyping.

3.3.3.2.1. PCR-SSP procedure for factor II (G20210A) polymorphism

Polymerase chain reaction (PCR) was carried out in a total volume of 20 μl. The

primers and lengths of PCR products are shown in (Table 3-4) and the reaction

components were as described in (Table 3-5).

31


Table 3-4: PCR primers and lengths of PCR products for factor II (G20210A)

polymorphism

Primer sequences PCR products size (bp)

Mutant 5’TGGACAAAATACCTGTATACCTT 3’ 340

Common-1 5’ TCTAGAAACAGTTGCCTGGCAG 3’

Normal 5’ GCACTGGGAGCATTGAGGATC 3’ 340

Table 3-5: PCR components for amplification of the factor II (G20210A)

Polymorphism

Reagent Volume (μ𝐥) Final concentration

Common primer 2 20 pmol

Mutant primer / Normal primer 2 20 pmol

Nuclease free water 4 -

PCR master mix (2X) 10 1X

DNA 2 100ng

Total 20

Microfuge tubes were then placed in a thermo cycler and PCR amplification was

carried out in the Hybrid Touch down PCR according to the program provided in

(Table 3-6).

Table 3-6: Thermocycler program for PCR amplification of the factor II

(G20210A) polymorphism

No. of cycles Temperature (ºC) Time

1 95 10 min

10

94 30 sec

60 30 sec

72 1 min

25

94 30 sec

55 30 sec

72 1 min

1 72 7min

32


3.3.3.3. Determination of factor V (G1691A) polymorphism

Factor V (G1691A) polymorphism was genotyped using PCR sequence-specific

primers (PCR-SSP), which uses two reactions with two sets of primers: one primer is

specific for each allele (allele-specific primer) and is paired with a second common

primer to control for PCR efficiency. The basis of this method is the reduction in the

efficiency of Taq polymerase to amplify DNA when there is a 3’ terminal nucleotide

mismatch between the target DNA and the allele-specific primer. The F V genotype is

identified by the presence or absence of DNA bands after gel electrophoresis of the

PCR products. This method is a relatively simple and inexpensive procedure for F V

genotyping.

3.3.3.3.1. PCR-SSP procedure for factor V (G1691A) polymorphism

Polymerase chain reaction (PCR) was carried out in a total volume of 20 μl. The

primers and lengths of PCR products are shown in (Table 3-7) and the reaction

components were as described in (Table 3-8).

Table 3-7: PCR primers and lengths of PCR products for Factor V (G1691A) polymorphism

Primer sequences PCR products size (bp)

Mutant 5’ GCACTGGGAGCATTGAGGATT 3’ 233

Common-1 5’ CTTTCAGGCAGGAACAACACC 3’

Normal 5’ GGACAAAATACCTGTATTGCTC 3’ 233

Table 3-8: PCR components for amplification of the Factor V (G1691A) Polymorphism

Reagent Volume (μ𝐥) Final concentration

Common primer 2 20 pmol

Mutant primer / Normal primer 2 20 pmol


PCR master mix (2X) 10 1X

DNA 2 100ng

Total 20

33


Microfuge tubes were then placed in a thermo cycler and PCR amplification was

carried out in the Hybrid Touch down PCR according to the program provided in

(Table 3-9).

Table 3-9: Thermocycler program for PCR amplification of the Factor V

(G1691A) polymorphism


1 95 10 min

10

94 30 sec

60 30sec

72 1 min

25

94 30 sec

55 30sec

72 1 min

1 72 7min

3.3.3.4. Determination of factor V (A4070G) Polymorphism

Polymorphism of factor V (A4070G) was genotyped using standard polymerase chain

reaction (PCR)/restriction fragment length polymorphism (RFLP) protocol (PCR

followed by digestion with restriction enzyme). The primers, lengths of PCR

products, related restriction enzymes, as well as digested bands are shown in (Table

3-10). PCR products were digested with restriction enzymes following the

manufacturer’s instructions.

Table 3-10: Primer sequences and restriction enzymes for Factor V (A4070G)

Polymorphism

Primer sequences PCR

products

Restriction

enzymes Digested bands

F:5’GCTCCTTTATCTCCGAGGACC3'

R:5'CTCTGGAGGAGTTGATGTTTGTCC3'

1613bp RsaI

A allele 1483+130bp

G allele 862+576+130bp

34


3.3.3.4.1. Factor V (A4070G) PCR-RFLP procedure:

3.3.3.4.1. 1. Polymerase Chain Reaction (PCR) for factor V (A4070G):

Polymerase chain reaction (PCR) was carried out in a total volume of 20 μl, the

reaction components were as described in (Table 3-11).

Table 3-11: PCR components for amplification of the factor V (A4070G)

Polymorphism

Reagent Volume (μl) Final concentration

Forward primer 2 20 pmol

Reverse primer 2 20 pmol


PCR mastermix 10 1X

DNA 2 100ng

Microfuge tubes were then placed in a thermocycler and PCR amplification was

performed according to the program provided in (Table 3-12).

Table 3-12: Thermocycler program for PCR amplification of the factor V

(A4070G) polymorphism.


1 95 5 min.

35

94 1min.

60 40 sec.

72 40 sec.

1 72 7 min.

35


3.3.3.4.1.2 Restriction Fragment Length Polymorphism (RFLP) by RsaI

restriction enzyme

RFLP of Factor V (A4070G) polymorphism was carried out in a reaction mixture in a

final volume of 20μl by mixing PCR product with 10X Buffer, nuclease free water

and the restriction endonuclease RsaI. The quantities and volumes were as shown in

(Table 3-13).

Table 3-13: The enzymatic digestion components of amplified Factor V

(A4070G) gene


PCR product 10 3µg

10X Buffer 2 1X

Restriction endonuclease RsaI 0.5 1u/1 µg

Nuclease free water 7.5 -

Microfuge tubes were then placed in a thermocycler at 37ºC overnight to allow the

restriction endonuclease to digest the PCR product. Figure 3-1 shows the mechanism

of restriction endonuclease and Figure 3-2 shows the recognition site for RsaI

restriction enzyme.

36


Figure 3-1: The PCR-RFLP principle of detecting mutant and wild type alleles.

I. Heterozygote: four bands indicating that the PCR products were cut at

three site.

II. Homozygote for normal allele: two bands indicating that product was cut

at one site.

III. Homozygote for abnormal allele: three band indicating that the product

was cleaved at two site.

37


Figure 3-2: The recognition site for RsaI restriction enzyme

Digested PCR product was then electrophoresed on 3.0% agarose gel and was

visualized by ethidium bromide staining.

3.3.3.4.2. Agarose gel electrophoresis (3.0%)

1. Dried agarose gel (2.4 gm) was dissolved in 80 ml 1x Tirs-Acetate-EDTA buffer

(2M Tris base 1M Glacial Acetic Acid, 0.05 M EDTA) by heating.

2. Then 4.0μl Ethidium Bromide(10mg/ml) was added and mixed, the gel was casted

into a mold which was fitted with a well forming comb.

3. The agarose gel was submerged in electrophoresis buffer within a horizontal

electrophoresis apparatus.

4. After amplification, the PCR products and a DNA ladder size marker (Promega,

Madison, WI, USA) were loaded into the sample wells to aid in fragment size

determination.

5. PCR fragments were detected by size in the agarose gel.

6. Electrophoresis was performed by using Electrophoresis power supply (BioRad,

USA) at 70 volts for 40 min at room temperature, and the DNA bands were

visualized and documented using a UV trans-illuminator documentation system.

38


For factor V (A4070G) detection, a segment of chromosome 1 which contains the

base pair substitution A4070G was amplified using the primer set presented in Table

3-12 and the PCR product (1613) was digested using RsaI restriction enzyme which

cuts the wild allele into two segments (1483 bp and 130bp) but cuts the mutant allele

into three segments (862+576+130 bp) while the heterozygotes should produce four

bands (1483bp, 862bp, 576bp, 130bp).

3.3.3.5. Determination of factor V (A5279G) Polymorphism

Polymorphism of factor V (A5279G) was genotyped using standard polymerase chain

reaction (PCR)/restriction fragment length polymorphism (RFLP) protocol (PCR

followed by digestion with restriction enzyme). The primers, lengths of PCR

products, related restriction enzymes, as well as digested bands are shown in (Table

3-14). PCR products were digested with restriction enzymes following the


Table 3-14: Primer sequences and restriction enzyme for factor V (A5279G)

Polymorphism


products

Restriction


F:5’-CTGTCGGGCTTGGGTCT-3'

R:5-'GAAATAACCCCGACTCTTC-3'

120 AccI

A allele 120 bp

G allele 105+15 bp

3.3.3.5.1. Factor V (A5279G) PCR-RFLP procedure:

3.3.3.5.1. 1. Polymerase Chain Reaction (PCR) for Factor V (A5279G):



39


Table 3-15: PCR components for amplification of the factor V (A5279G)

Polymorphism





PCR mastermix 10 1X

DNA 2 100ng


started according to the program provided in (Table 3-16).

Table 3-16: Thermocycler program for PCR amplification of the factor V

(A5279G) polymorphism.


1 95 5 min.

35

94 1min.

62 40 sec.

72 40 sec.

1 72 7 min.

3.3.3.5.1.2 Restriction Fragment Length Polymorphism (RFLP) by AccI

restriction enzyme

RFLP of Factor V (A5279G) Polymorphism was carried out in a reaction mixture in a

final volume of 20μl by mixing PCR product with 10X Buffer, nuclease free water

and the restriction endonuclease AccI. The quantities and volumes were as shown in

(Table 3-17).

40


Table 3-17: The enzymatic digestion components of amplified factor V (A5279G)


PCR product 10 3µg

10X Buffer 2 1X

Restriction endonuclease AccI 0.5 1u/1 µg




of restriction endonuclease and Figure 3-3 shows the recognition site for AccI

restriction enzyme.

Figure 3-3: The recognition site for AccI restriction enzyme

(M: A or C; K: G or T)

41


Figure 3-4: The PCR-RFLP principle of detecting mutant and wild type alleles

I. Heterozygote: three bands indicating that half of the PCR products

were cut (abnormal allele) and the other half weren't (normal allele).

II. Homozygote for normal allele: one band indicating that there was no

cleavage happened.

III. Homozygote for abnormal allele: two bands indicating that the

product was completely cleaved.

Digested PCR product was then electrophoresed on 3.0% agarose gel and

was visualized by ethidium bromide staining.

42


For factor V (A5279G) detection, a segment of chromosome 1 which contains the

base pair substitution A5279G was amplified using the primer set presented in Table

3-16 and the PCR product (120 bp) was restricted using AccI restriction enzyme

which cuts the mutnt allele into two segments (105 bp and 15 bp) but doesn't cut the

wild allele. Homozygous for the normal allele should yield one band (120 bp) while

the heterozygotes should produce three bands (120 bp, 105 bp, and 15 bp).

Homozygotes for the mutant allele should give two bands (105 bp and 15 bp).

3.3.3.6. Determination of factor XI rs3756008 (A>T) Polymorphism

Polymorphism of Factor XI rs3756008 (A>T) was genotyped using standard

polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP)

protocol (PCR followed by digestion with restriction enzyme). The primers, lengths

of PCR products, related restriction enzymes, as well as digested bands are shown in

(Table 3-18). PCR products were digested with restriction enzymes following the


Table 3-18: Primer sequences and restriction enzyme for factor XI rs3756008

(A>T) Polymorphism


products

Restriction


F:5’-TTTGGTTTTCCAGTGAAGCA-3'

R:5-'GTGCCAAGAATGGCTTTCA-3'

194 MluCI

A allele 194 bp

T allele 131+63 bp

3.3.3.6.1. Factor XI rs3756008 (A>T) PCR-RFLP procedure:

3.3.3.6.1. 1. Polymerase Chain Reaction (PCR) for factor XI rs3756008

(A>T):



43


Table 3-19: PCR components for amplification of the factor XI rs3756008

Polymorphism





PCR mastermix 10 1X

DNA 2 100ng


started according to the program provided in (Table 3-20).

Table 3-20: Thermocycler program for PCR amplification of the factor XI

rs3756008 polymorphism.


1 95 5 min.

35

94 1min.

62 40 sec.

72 40 sec.

1 72 7 min.

3.3.3.6.1.2 Restriction Fragment Length Polymorphism (RFLP) by MluCI

restriction enzyme

RFLP of Factor XI rs3756008 Polymorphism was carried out in a reaction mixture in

a final volume of 20μl by mixing PCR product with 10X Buffer, nuclease free water

and the restriction endonuclease MluCI. The quantities and volumes were as shown

in (Table 3-21).

44


Table 3-21: The enzymatic digestion components of amplified XI rs3756008


PCR product 10 3µg

10X Buffer 2 1X

Restriction endonuclease MluCI 0.5 1u/1 µg




of restriction endonuclease and Figure 3-6 shows the recognition site for MluCI

restriction enzyme.

Figure 3-5: The recognition site for MluCI restriction enzyme

45


Figure 3-6: The PCR-RFLP principle of detecting mutant and wild type alleles

I. Heterozygote: three bands indicating that half of the PCR products

were cut (abnormal allele) and the other half weren't (normal allele).

II. Homozygote for normal allele: one band indicating that there was no

cleavage happened.

III. Homozygote for abnormal allele: two bands indicating that the

product was completely cleaved.

Digested PCR product was then electrophoresed on 3.0% agarose gel and

was visualized by ethidium bromide staining.

46


For factor XI rs3756008 detection, a segment of chromosome 4 which contains the

base pair substitution A<T was amplified using the primer set presented in Table 3-

20 and the PCR product (194 bp) was restricted using MluCI restriction enzyme

which cuts the mutant allele into two segments (131 bp and 63 bp) but doesn't cut the

wild allele. Homozygous for the normal allele should yield one band (194 bp) while

the heterozygotes should produce three bands (194 bp, 131 bp, and 63 bp).

Homozygotes for the mutant allele should give two bands (131 bp and 63 bp).

3.4 Statistical analysis

The Hardy-Weinberg equilibrium (HWE) equation was used to calculate the expected

genotype frequency. Difference between expected and observed genotypes was

assessed by X2 test. P-value less than 0.05 was considered statistically significant.

The frequencies of the alleles and genotypes were compared between patient and

control groups by the Chi square test when appropriate. The odds ratio (OR) and 95%

confidence interval (CI) were also estimated in order to test the relation between RPL

and the investigated polymorphisms.

47

Chapter Four

Results

48

Chapter (4) Results

4.1. PCR Genotyping results

The following figures are representative examples of the Factor V G1691A, FII

G20210A, factor V A4070G, factor V A5279G and FXI gene polymorphisms

investigated in this study.

Figures (4-1), (4-2), (4-3), (4-4), and (4-5) show representative PCR results for the

genotyping of the Factor V G1691A, FII G20210A, factor V A4070G, factor V

A5279G and FXI gene polymorphisms, respectively.

Fig 4-1: A photograph of ethidium bromide stained 3% agrarose gel showing the PCR-SSP

product for factor V G1691A polymorphisms, M= 50bp DNA ladder, sample 1 indicates a

homozygous GG, sample 2 indicates heterozygous GA, sample 3 indicates homozygous AA

and sample 4 indicates control.

A G A G A G A G

233bp

1

G/G

2

A/G

3

A/A

4

Negative

M

200

0 100 50

49

Chapter (4) Results

Fig 4-2: A photograph of ethidium bromide stained 3% agrarose gel showing the PCR-SSP

product for factor II G20210A polymorphisms, M= 50bp DNA ladder, sample 1 indicates a

homozygouss GG, sample 2 indicates heterozygous GA, sample 3 indicates

control.

Fig 4-3: A photograph of ethidium bromide stained 3% agarose gel showing the RFLP-

PCR product for factor V A4070G polymorphism, M= 50bp DNA ladder, lane1 indicates a

heterozygous sample for GA, lane 2 indicates a homozygous AA and lane 3 indicates a

control.

M A G G A A G

100 50

200 340bp

1

G/G

2

A/G

3

Negative

576bp

130bp

M

1483bp

50bp 100bp

862bp

200bp

1

G/A

2

A/A

3

Negative

50

Chapter (4) Results

Fig 4-4: A photograph of ethidium bromide stained 3% agarose gel showing the RFLP-

PCR product for factor V A5279G polymorphism, M= 50bp DNA ladder, lane1 indicates a

homozygous sample for GG, lane 2 indicates a heterozygous AG, lane 3 indicates a

homozygous for AA and lane 4 a indicates a control.

Fig 4-5: A photograph of ethidium bromide stained 3% agarose gel showing the RFLP-PCR

product for factor XI rs3756008 A<T polymorphism, M= 50bp DNA ladder, lane1 indicates a

heterozygous sample for AT, lane 2 indicates a homozygous for AA, lane 3 indicates a

homozygous for TT and lane 4 a indicates a control.

200bp

100bp

50bp

194bp 131bp

63bp

4

Negative

2

A/A

3

T/T

4

Negative

M

M 1

G/G

2

A/G

3

A/A

1

A/T

100bp 200bp 120bp

105bp 50bp

51

Chapter (4) Results

4.2. Factor V (G1691A) gene polymorphism:

4.2.1. Genotype frequency of factor V (G1691A) polymorphism among

RPL patients and controls

Table (4 -1) and (Fig. 4-6) illustrate the genotype frequencies of the factor-V

G1691A gene polymorphism among RPL patients. The frequency of the wild type

GG was 80.5 %, the frequency of the heterozygote GA was 18.5% while, the

frequency of the homozygotes for the polymorphic allele AA was 1.0 % in RPL

women.

Table 4-1: Frequency of genotypes of Factor V (G1691A) polymorphism

among RPL patients

Genotype Frequency Percent %

AA 2 1.0

GA 37 18.5

GG 161 80.5

Total 200 100.0

Fig 4-6: Frequency of genotypes of factor V (G1691A) polymorphism among

RPL patients

0

10

20

30

40

50

60

70

80

90

1

18.5

80.5

AA

GA

GG

52

Chapter (4) Results

Table (4 -2) and (Fig. 4-7) illustrate the frequencies of genotype of the factor-V

G1691A gene polymorphism among control women. The frequency of the wild type

GG was 90.0 %, the frequency of the heterozygotes (GA) was 9.5 % while, the

frequency of the homozygotes for the polymorphic allele AA was 0.5 %.

Table 4-2: Frequency of genotypes factor V G1691A polymorphism among

control women


AA 1 0.5

GA 19 9.5

GG 180 90.0

Total 200 100.0

Fig 4-7: Frequency of genotypes of factor V (G1691A) polymorphism among

control women

0

10

20

30

40

50

60

70

80

90

0.05

9.5

90

AA

GA

GG

53

Chapter (4) Results

Table (4-3) illustrates genotypes frequency, odds ratio (OR), 95% confidence

intervals (CI) and P value of factor V (G1691A) gene polymorphism among RPL

patients and controls. The statistical analysis of frequency of factor V (G1691A) gene

polymorphism among RPL patients and control showed that the difference was

significant for the GG and GA genotypes. The AA genotype, however, was not

significantly different between the two groups.

Table 4-3: Genotype frequency of factor V (G1691A) gene polymorphism among

RPL patients and controls.

G1691A

Genotype

Patient

N= 200

Controls

N=200 Odds Ratio (95% CI)

P-value

GG 161(80.5%) 180 (90.0%) 0.46 (0.26 to 0.82) 0.01

GA 37(18.5%) 19 (9.5%) 2.16 (1.20 to 3.90) 0.01

AA 2 (1.0%) 1 (0.5%) 2.01 (0.18 to 22.35) 0.57

4.2.2. Alleles frequency of factor V (G1691A) polymorphism among RPL

patients and controls

Table (4-4) illustrates alleles frequency, odds ratio, 95% confidence intervals and P

value of factor V (G1691A) polymorphism among RPL patients and controls. The

statistical analysis of allele frequency of the factor V (G1691A) gene polymorphism

among RPL patients and controls showed that the difference was significant (P-value

= 0.01) between the two groups.

54

Chapter (4) Results

Table 4-4: Alleles frequency factor V (G1691A) polymorphism among RPL


G1691A

allele

Patient

N= 200

Controls

N=200 Odds Ratio (95% CI) P- value

G 359 (89.75%) 379 (94.75%)

2.06 (1.19 to 3.56) 0.0093

A 41 (10.25%) 21 (5.25%)

4.2.3. Hardy-Weinberg equilibrium in factor V (G1691A) gene

polymorphism

Frequency of major allele G (p) = 180x2 + 19x1/200x2 = 0.95

Frequency of minor allele A (q) = 1x2 + 19x1/200x2 = 0.05

p + q = 1

(p + q)2 = 1

P2 + 2pq + q

2

Expected genotype frequencies:

Genotype GG: p2 x200 = (0..95)

2 X 200 = 180.5

Genotype GA: 2pq x200 = 2X0.95X 0..05X 200 = 19

Genotype AA: q2 x200 = (0.05)

2X 200 = 0.5

Table (4-5) illustrates the observed and expected genotype frequencies of factor V

(G1691A) gene polymorphism in control women with P-value = 0.523. This shows

that there is no significant deviation from Hardy-Weinberg equilibrium, so the

distribution of Factor V (G1691A) genotypes are in Hardy-Weinberg equilibrium.

Table 4-5: Observed and expected genotype frequencies of factor V (G1691A)

polymorphism

GG GA AA

Observed genotype 180 19 1

Expected genotype 180.5 19 0.5

P- value = 0.523 Chi square: X2 = 0.406 with 1degrees of freedom

55

Chapter (4) Results

4.3. Factor V (A4070G) gene polymorphism:

4.3.1. Genotype frequency of factor V (A4070G) polymorphism among


Table (4 -6) and (Fig. 4-8) illustrate the genotype frequencies of the factor V A4070G

gene polymorphism among RPL patients. The frequency of the wild type AA was

86.5 %, the frequency of the heterozygote GA was 13.5% while, the frequency of the

homozygotes for the polymorphic allele GG was 0.0 % in RPL women.

Table 4-6: Frequency of genotypes of factor V (A4070G) polymorphism

among RPL patients


GG 0 0.0

GA 27 13.5

AA 173 86.5

Total 200 100.0

Fig 4-8: Frequency of genotypes of factor V (A4070G) polymorphism among

RPL patients

0

10

20

30

40

50

60

70

80

90

0

13.5

86.5

GG

GA

AA

56

Chapter (4) Results

Table (4 -7) and (Fig. 4-9) illustrate the frequencies of genotype of the factor V

A4070G gene polymorphism among control women. The frequency of the wild type

AA was 95.5 %, the frequency of the heterozygotes (GA) was 4.5 % while, the

frequency of the homozygotes for polymorphic allele GG was 0.0 %.

Table 4-7: Frequency of genotypes factor V A4070G polymorphism among

control women


GG 0 0.0

GA 9 4.5

AA 191 95.5

Total 200 100.0


control women

0

10

20

30

40

50

60

70

80

90

100

0

4.5

95.5

GG

GA

AA

57

Chapter (4) Results


intervals (CI) and P value of factor V (A4070G) gene polymorphism among RPL

patients and controls. The statistical analysis of frequency of the Factor V (A4070G)

gene polymorphism among RPL patients and control showed that the difference was

significant in the two genotype AA, GA, and GG was not significant between the two

groups.

Table 4-8.: Genotype frequency of factor V (A4070G) gene polymorphism among

RPL patients and controls.

A4070G

Genotype

Patient

N= 200

Controls


P-value

AA 173 (86.5%) 191 (95.5%) 0.302 (0.66 to 1.38) 0.003

GA 27 (13.5%) 9 (4.5%) 3.31 (1.52 to 7.24) 0.003

GG 0 (0.0%) 0 (0.0%) 1.00 (0.19 to 50.65) 1.000

4.3.2. Alleles frequency of factor V (A4070G) polymorphism among RPL



value of factor V (A4070G) polymorphism among RPL patients and controls. The

statistical analysis of allele frequency of the factor V (A4070G) gene polymorphism

among RPL patients and controls showed that the difference was significant

( P-value = 0.003) between the two groups.

58

Chapter (4) Results

Table 4-9: Alleles frequency of factor V (A4070G) polymorphism among RPL


A4070G

allele

Patient

N= 200

Controls


A 373 (93.25%) 391 (97.75%)

3.14 (1.46 to 6.78) 0.003

G 27 (6.75%) 9 (2.25%)

4.3.3. Hardy-Weinberg equilibrium in factor V (A4070G) gene

polymorphism

Frequency of major allele A (p) = 191x2 + 9x1/200x2 = 0.9775

Frequency of minor allele G (q) = 0x2 + 9x1/200x2 = 0.0225

p + q = 1

(p + q)2 = 1

P2 + 2pq + q

2


Genotype AA: p2 x200 = (0.9775)

2 X 200 = 191.1

Genotype GA: 2pq x200 = 2X0.9775X 0..0225X 200 = 8.8

Genotype GG: q2 x200 = (0.0225)

2X 200 = 0.1


(A4070G) gene polymorphism in control women with P-value = 0.744. This shows


distribution of factor V (A4070G) genotypes are in Hardy-Weinberg equilibrium.

Table 4-10: Observed and expected genotype frequencies of factor V (A4070G)

polymorphism

AA GA GG


Expected genotype 191.1 8.8 0.1


59

Chapter (4) Results

4.4. Factor V (G1691A)/ Factor V (A4070G) gene polymorphism:

4.4.1. Genotype frequency of factor V (G1691A) and factor V

(A4070G) polymorphisms among RPL patients and controls

Table (4-11) and (Fig. 4-10) illustrate the genotype frequencies of the factor V

G1691A and A4070G gene polymorphism among RPL patients. The frequency of the

wild type GG/AA was 69.0 %, the frequency of the heterozygote GA was 30.0%

while, the frequency of the homozygotes for the polymorphic allele AA/GG was 1.0

% in RPL women.

Table 4-11: Frequency of genotypes of factor V (G1691A)and A4070G polymorphism among RPL patients


AA/GG 2 1.0

GA 60 30.0

GG/AA 138 69.0

Total 200 100.0

Fig 4-10: Frequency of genotypes of factor V (G1691A) and A4070G

polymorphism among RPL patients

0

10

20

30

40

50

60

70

1

30

69

AA/GG

GA

GG/AA

60

Chapter (4) Results

Table (4 -12) and (Fig. 4-11) illustrate the frequencies of factor V G1691A and

A4070G gene polymorphisms among control women. The frequency of the wild type

GG/AA was 86.0 %, the frequency of the heterozygotes (GA) was 13.5 % while, the

frequency of the homozygotes for polymorphic allele AA/GG was 0.5 %.

Table 4-12: Frequency of genotypes factor V G1691A and A4070G

polymorphism among control women


AA/GG 1 0.5

GA 27 13.5

GG/AA 172 86.0

Total 200 100.0

Fig 4-11: Frequency of genotypes of factor V (G1691A) and A4070G

polymorphism among control women

0

10

20

30

40

50

60

70

80

90

0.05

13.5

86

AA/GG

GA

GG/AA

61

Chapter (4) Results


intervals (CI) and P value of the Factor V (G1691A) and A4070G gene polymorphism

among RPL patients and controls. The statistical analysis of frequency of the Factor V

(G1691A) and A4070G gene polymorphism among RPL patients and control showed

that the difference was significant in the two genotype GG/AA, GA, and AA/GG was

not significant between the two groups.

Table 4-13: Genotype frequency of factor V (G1691A)and A4070G gene

polymorphism among RPL patients and controls.

A4070G/

"G1691A"

Genotype

Patient

N= 200

Controls


P-value

AA/GG 138 (69.0%) 172 (86.0%) 0.362 (0.22 to 0.59) 0.0001

GA 60 (30.0%) 27 (13.5%) 2.746 (1.66 to 4.55) 0.0001

GG/AA 2(1.0%) 1 (0.5%) 2.01 (0.18 to 22.35) 0.569

4.4.2. Alleles frequency of factor V (G1691A) and A4070G polymorphism

among RPL patients and controls

Table (4-14) illustrates alleles frequency, odds ratio, 95% confidence intervals and p

value of factor V (G1691A) and A4070G polymorphism among RPL patients and

controls. The statistical analysis of allele frequency of the factor V (G1691A) and

A4070G gene polymorphism among RPL patients and controls showed that the

difference was significant (p-value = 0.0002) between the two groups.

62

Chapter (4) Results

Table 4-14: Alleles frequency of factor V (G1691A) and A4070G polymorphisms


A4070G/

"G1691A"

allele

Patient

N= 200

Controls


A and G 336(84.0%) 371 (92.75%)

0.410 (0.26 to 0.65) 0.0002

G and A 64 (16.0%) 29 (7.25%)

4.5. Independent effects of factor V (G1691A) and (A4070G)

polymorphisms

In order to verify whether both G1691A and A4070G polymorphisms are linked to

each other or independently affect the risk of RPL the three samples in which both

polymorphisms coexisted were excluded and the allele frequencies were recalculated.

The data presented in Tables (4-15) and (4-16) below showed that the frequency of

the minor allele of each of the two polymorphisms remained significantly different

between the RPL and control groups.

Table 4-15: Genotype frequency of FV variant "A4070G"and "G1691A" among


A4070G/

"G1691A"

Genotype

Patient

N= 197

Controls


P-value

AA/GG 138

(70.05%) 172 (86.0%) 0.38 (0.23 to 0.63) 0.0002

GA 57 (28.93%) 27 (13.5%) 2.61 (1.57 to 4.34) 0.0002

GG/AA 2 (1.02%) 1 (0.5%) 2.04 (0.18 to 22.69) 0.56

63

Chapter (4) Results

Table 4-16: Alleles frequency of the FV "A4070G "and "G1691A" SNP among


A4070G/

"G1691A"

allele

Patient

N= 200

Controls


A/G 333(84.52%) 371 (92.75%)

2.34 (1.47 to 3.74) 0.0003

G/A 61 (15.48%) 29 (7.25%)

64

Chapter (4) Results

4.6. Factor V (A5279G) gene polymorphism:

4. 6.1. Genotype frequency of factor V (A5279G) polymorphism among


Table (4-17) and (Fig. 4-12) illustrate the genotype frequencies of factor V A5279G

gene polymorphism among RPL patients. The frequency of the wild type AA was

98.0 %, the frequency of the heterozygote GA was 1.5% and the frequency of the

homozygotes for the polymorphic allele GG was 0.5 % in RPL women.

Table 4-17: Frequency of genotypes of factor V (A5279G) polymorphism

among RPL patients


GG 1 0.5

GA 3 1.5

AA 196 98.0

Total 200 100.0


RPL patients

0

10

20

30

40

50

60

70

80

90

100

0.5 1.5

98

GG

GA

AA

65

Chapter (4) Results

Table (4 -18) and (Fig. 4-13) illustrate the frequencies of genotype of the factor V

A5279G gene polymorphism among control women. The frequency of the wild type

AA was 99.5 %, the frequency of the heterozygotes (GA) was 0.5 % while, the

frequency of the homozygotes for polymorphic allele GG was 0.0 %.

Table 4-18: Frequency of genotypes factor V A5279G polymorphism among

control women


GG 0 0.0

GA 1 0.5

AA 199 99.5

Total 200 100.0


control women

0

10

20

30

40

50

60

70

80

90

100

0 0.5

99.5

GG

GA

AA

66

Chapter (4) Results


intervals (CI) and P value of factor V (A5279G) gene polymorphism among RPL

patients and controls. The statistical analysis of frequency of factor V (A5279G) gene

polymorphism among RPL patients and controls showed that the difference was not

significant in the three genotypes AA, GA, and GG between the two groups.

Table 4-19.: Genotype frequency of factor V (A5279G) gene polymorphism

among RPL patients and controls.

A5279G

Genotype

Patient

N= 200

Controls


P-value

AA 196 (98.0%) 199 (99.5%) 0.246 (0.027 to 2.22) 0.211

GA 3(1.5%) 1 (0.5%) 3.03 (0.313 to 29.38) 0.339

GG 1 (0.5%) 0 (0.0%) 3.02 (0.122 to 74.46) 0.500

4.6.2. Alleles frequency of factor V (A5279G) polymorphism among RPL



value of factor V (A5279G) polymorphism among RPL patients and controls. The

statistical analysis of allele frequency of the factor V (A5279G) gene polymorphism

among RPL patients and controls showed that the difference was not significant

(P-value = 0.140) between the two groups.

67

Chapter (4) Results

Table 4-20: Alleles frequency of factor V (A5279G) polymorphism among RPL


A5279G

allele

Patient

N= 200

Controls


A 395 (98.75%) 399 (99.75%)

0.198 (0.023 to 1.70) 0.140

G 5 (1.25%) 1 (0.25%)

4.6.3. Hardy-Weinberg equilibrium in Factor V (A5279G) gene

polymorphism


Frequency of minor allele G (q) = 0x2 + 1x1/200x2 = 0.0025

p + q = 1

(p + q)2 = 1

P2 + 2pq + q

2


Genotype AA: p2 x200 = (0.9975)

2 X 200 = 199.00125

Genotype GA: 2pq x200 = 2X0.9975X 0..0025X 200 = .9975

Genotype GG: q2 x200 = (0.0025)

2X 200 = 0.00125


(A5279G) gene polymorphism in control women with P-value = 0.971. This shows


distribution of Factor V (A5279G) genotypes are in Hardy-Weinberg equilibrium.

Table 4-21: Observed and expected genotype frequencies of factor V (A5279G)

polymorphism

AA GA GG




68

Chapter (4) Results

4.7. Factor II (G20210A) gene polymorphism:

4.7.1. Genotype frequency of factor II (G20210A) polymorphism among


Table (4-22) and (Fig. 4-14) illustrate the genotype frequencies of factor II G20210A

gene polymorphism among RPL patients. The frequency of the wild type GG was

95.5 %, the frequency of the heterozygote GA was 4.5% while, the frequency of the

homozygotes for the polymorphic allele AA was 0.0 % in RPL women.

Table 4-22: Frequency of genotypes of factor II (G20210A) polymorphism

among RPL patients


AA 0 0.0

GA 9 4.5

GG 191 95.5

Total 200 100.0

Fig 4-14: Frequency of genotypes of factor II (G20210A) polymorphism among

RPL patients

0

10

20

30

40

50

60

70

80

90

100

0

4.5

95.5

AA

GA

GG

69

Chapter (4) Results

Table (4 -23) and (Fig. 4-15) illustrate the frequencies of genotypes of factor II

G20210A gene polymorphism among control women. The frequency of the wild type

GG was 98.5 %, the frequency of the heterozygotes (GA) was 1.5 % while, the

frequency of the homozygotes for polymorphic allele AA was 0.0 %.

Table 4-23: Frequency of genotypes factor II G20210A polymorphism among

control women


AA 0 0.0

GA 3 1.5

GG 197 98.5

Total 200 100.0

Fig 4-15: Frequency of genotypes of factor II (G20210A) polymorphism among

control women

0

10

20

30

40

50

60

70

80

90

100

0 1.5

98.5

AA

GA

GG

70

Chapter (4) Results


intervals (CI) and P value of the Factor II (G20210A) gene polymorphism among

RPL patients and controls. The statistical analysis of frequency of factor II

(G20210A) gene polymorphism among RPL patients and controls showed that the

difference was not significant in the three genotype GG, GA, and AA between the two

groups.

Table 4-24: Genotype frequency of factor II (G20210A) gene polymorphism

among RPL patients and controls.

G20210A

Genotype

Patients

N= 200

Controls


P-value

GG 191 (95.5%) 197 (98.5%) 0.323 (0.086 to 1.212) 0.093

GA 9 (4.5%) 3 (1.5%) 3.094 (0.825 to 11.603) 0.093

AA 0 (0.0%) 0 (0.0%) 1.00 (0.019 to 50.65) 1.00

4.7.2. Alleles frequency of factor II (G20210A) polymorphism among RPL



value of factor II (G20210A) polymorphism among RPL patients and controls. The

statistical analysis of allele frequency of the factor II (G20210A) gene polymorphism

among RPL patients and controls showed that the difference was not significant (P-

value = 0.096) between the two groups.

71

Chapter (4) Results

Table 4-25: Alleles frequency of factor II (G20210A) polymorphism among RPL


G20210A

allele

Patient

N= 200

Controls


G 391 (97.75%) 397 (99.25%)

3.05 (0.82 to 11.34) 0.097

A 9 (2.25%) 3 (0.75%)

4.7.3. Hardy-Weinberg equilibrium in factor II (G20210A) gene

polymorphism

Frequency of major allele G (p) = 197x2 + 3x1/200x2 = 0.9925

Frequency of minor allele A (q) = 0x2 + 3x1/200x2 = 0.0075

p + q = 1

(p + q)2 = 1

P2 + 2pq + q

2


Genotype GG: p2 x200 = (0..9925)

2 X 200 = 197.01

Genotype GA: 2pq x200 = 2X0.9925X 0..0075X 200 = 2.98

Genotype AA: q2 x200 = (0.0075)

2X 200 = 0.01

Table (4-26) illustrates the observed and expected genotype frequencies of factor II

(G20210A) gene polymorphism in control women with P-value = 0.915. This shows


distribution of factor II (G20210A) genotypes are in Hardy-Weinberg equilibrium.

Table 4-26: Observed and expected genotype frequencies of Factor II (G20210A)

polymorphism

GG GA AA



P- value = 0.915 Chi square: X2 = 0.011with 1degrees of freedom

72

Chapter (4) Results

4.8. Factor XI rs3756008 A< T gene polymorphism:

4.8.1. Genotype frequency of factor XI rs3756008 A< T polymorphism


Table (4 -27) and (Fig. 4-16) illustrate the genotype frequencies of the factor XI

rs3756008 A< T gene polymorphism among RPL patients. The frequency of the wild

type AA was 42.5 %, the frequency of the heterozygote AT was 57.0% while, the

frequency of the homozygotes for the polymorphic allele TT was 0.5 % in RPL

women.

Table 4-27: Frequency of genotypes of factor XI rs3756008 A< T polymorphism among RPL patients


TT 1 0.5

TA 114 57.0

AA 85 42.5

Total 200 100.0

Fig 4-16: Frequency of genotypes of factor XI rs3756008 A< T polymorphism

among RPL patients

0

10

20

30

40

50

60

0.5

57

42.5

TT

AT

AA

73

Chapter (4) Results

Table (4 -28) and (Fig. 4-17) illustrate the frequencies of genotypes of factor XI

rs3756008 A< T gene polymorphism among control women. The frequency of the

wild type AA was 51.5 %, the frequency of the heterozygotes (TA) was 48.5 % while,

the frequency of the homozygotes for polymorphic allele TT was 0.5 %.

Table 4-28: Frequency of genotypes factor XI rs3756008 A< T polymorphism

among control women


TT 1 0.5

TA 96 48.5

AA 103 51.5

Total 200 100.0

Fig 4-17: Frequency of genotypes of factor XI rs3756008 A< T polymorphism

among control women

0

10

20

30

40

50

60

0.05

48

51.5

TT

TA

AA

74

Chapter (4) Results


intervals (CI) and P value of factor XI rs3756008 A< T gene polymorphism among

RPL patients and controls. The statistical analysis of frequency of factor XI

rs3756008 A< T gene polymorphism among RPL patients and control showed that the

difference was not significant in the three genotype AA, TA, and AA between the two

groups.

Table 4-29.: Genotype frequency of factor XI rs3756008 A< T gene

polymorphism among RPL patients and controls.

rs3756008

Genotype

Patient

N= 200

Controls


P-value

AA 85 (42.5%) 103 (51.5%) 0.69 (0.46 to 0.03) 0.07

AT 114 (57.0%) 96 (48%) 1.44 (0.97 to 2.13) 0.07

TT 1 (0.5%) 1 (0.5%) 1.00 (0.06 to 16.09) 1.00

4.8.2. Alleles frequency of factor XI rs3756008 A< T polymorphism among



value of factor XI rs3756008 A< T polymorphism among RPL patients and controls.

The statistical analysis of allele frequency of the factor XI rs3756008 A< T gene

polymorphism among RPL patients and controls showed that the difference was not

significant (P-value = 0.15) between the two groups.

75

Chapter (4) Results

Table 4-30: Alleles frequency of factor XI rs3756008 A< T polymorphism among


rs3756008

allele

Patient

N= 200

Controls


A 284(71.0%) 302 (75.5%)

0.79 (0.58 to 1.09) 0.15

T 116 (29.0%) 98 (24.5%)

4.8.3. Hardy-Weinberg equilibrium in factor XI rs3756008 A< T gene

polymorphism


Frequency of minor allele T (q) = 1x2 + 96x1/200x2 = 0.245


Genotype AA: p2 x200 = (0.755)

2 X 200 = 144

Genotype GA: 2pq x200 = 2X0.755X 0..245X 200 = 74

Genotype GG: q2 x200 = (0.245)

2X 200 = 12

Table (4-31) illustrates the observed and expected genotype frequencies of Factor XI

rs3756008 A< T gene polymorphism in control women with P-value = 0.00003. This

shows that there is significant deviation from Hardy-Weinberg equilibrium, so the

distribution of Factor XI rs3756008 A< T genotypes are not in Hardy-Weinberg

equilibrium.

Table 4-31: Observed and expected genotype frequencies of factor XI rs3756008

A< T polymorphism

AA AT TT


Expected genotype 114 74 12


76

Chapter Five

Discussion

77

Chapter (5) Discussion

Recurrent miscarriage is defined as the occurrence of three or more consecutive

pregnancy losses during the first trimester (Marc Dhont, 2003), and accounts for

about 1-3% of clinically recognized pregnancy losses (Suryanarayana et al., 2006).

Despite extensive research to explain the causative effects of recurrent pregnancy loss

(RPL), about 50%-60% of RPLs are still idiopathic. Despite the increasing

prospective studies with sufficient power related to the association between various

thrombophilia and RPL, controversy still remains regarding screening for

thrombophilia in women with RPL. Therefore, routine screening is not cost-effective

and not justified. On the other hand, clinicians need guidelines for screening.

Guidelines regarding this issue should be prepared according to the frequency of

thrombophilic defects in the particular population. This study was designed to

investigate the association between RPL and common polymorphisms in factor V:

G1691A (R506Q; rs6025), H1299R (R2), Y1702C (rs118203907); factor II G20210A

(rs1799963), and factor XI rs3756008 (A>T) genes among women experiencing RPL

in Gaza strip-Palestin.

5.1. The study sample

Definitions of RPL have varied between studies. This study opted for defining RPL

as three or more miscarriages before 20 weeks of gestation in order to provide

comparable data. It has to be kept in mind, however, that miscarriages

in early

pregnancy might be etiologically different than those occurring early in the second

trimester. The results obtained in the majority of studies describing genetic

polymorphisms in RPL are conflicting. Many of the reported associations have not

been reproduced in later studies. This is partly due to the fact that the associations

may vary in different ethnic populations (reflecting the multifactorial nature of RPL

risk factor) and that results may be biased because of small sample sizes. This also

may be true in the present study. One reason for a small sample size is that RPL is

relatively uncommon, and may be as low as 1% in women.


78


The Palestinian population that was the subject of this investigation, offered an

additional advantage, alcohol or drug use are irrelevant in the context of Palestinian

women in the reproductive age. Smoking role in RPL is not yet clearly defined, and

due to the extremely low rate of smoking among young Palestinian women, this usual

confounding environmental factor therefore is not arguable in this study.

5.2. Association between factor V: G1691A (R506Q; rs6025) gene

polymorphisms and RPL

The distribution of factor V G1691A genotypes in the control group is in Hardy-

Weinberg equilibrium as no significant deviation (P-value = 0.523) was recorded

between the observed and expected genotypes and this indicates that the genotypes of

this polymorphism are distributed randomly in our population.

The GG genotype was significantly more prevalent in the control women (90.0%) as

compared to the RPL patients (80.5%) with a P-value = 0.01. The GA genotype was

significantly less frequent in the control women (9.5%) relative to RPL patients

(18.5%) with a P-value = 0.01. The AA genotype was less prevalent in the control

women (0.5%) as compared to the RPL patients (1.0%), though this difference was

not significant (P-value = 0.57), see Table (4-3).

This study showed that the allele frequencies of factor V: G1691A also are

significantly different between RPL patients and controls (P-value = 0.0093). The

frequency of polymorphic A allele was more prevalent in RPL patients (10.25%) than

in controls (5.25%) and the wild type G allele was less prevalent in RPL patients

(89.75%) than in controls (94.75%), see Table(4-4). It can be inferred that this

documented RPL risk factor, factor V: G1691A is associated with and may represent

a risk factor for RPL in our population. The A-allele seems to significantly double the

risk for RPL (OR = 2.06; P = 0.0093).

Association between RPL and factor V: G1691A polymorphism observed in this

study is in agreement with the findings reported by many other investigators (e.g.,

79


Wolfa et al., 2003; Ulukufi et al., 2006; Motee et al., 2007; Torabi et al., 2009;

Hussein et al., 2010; Gawish and Al-Khamees, 2013). In the contrary, other

investigators found no relation between this polymorphism and RPL (e.g., Abd Allah

and Hassan, 2014; Parand et al., 2013; Raziel et al., 2001). Interestingly, no G1691A

polymorphism was detected in Japanese women with RPL or the controls (Kobashi et

al., 2005).

These observations illustrate the populations and ethnic groups variations in terms of

type and frequency of alleles of polymorphic loci. This in turn influences the

association outcome between risk alleles and multifactorial traits such as RPL.

Another important difference between the various association studies is the sample

size (power of the study) particularly when the minor allele of the variant locus is low

in frequency. Small sample size would not reveal the significant association, if

present.

5.3. Association between factor V: H1299R (A4070G) gene

polymorphism and RPL

The distribution of factor V: A4070G, genotypes in the control group proved to be

in Hardy-Weinberg equilibrium as no significant deviation (P- value = 0.744) was

recorded between the observed and expected genotypes.

The AA genotype was more prevalent in the control women (95.5%) as compared to

the RPL patients (86.5%). This difference was statistically significant (P = 0.003).

The GA genotype was significantly less frequent in the control women (4.5%) relative

to RPL patients (13.5%) with a P-value = 0.003. The distribution of the GG genotype,

however, was not significantly different between the two groups (P = 1.0), see

Table(4-8).

80


This study showed that the allele frequencies of factor V: A4070G also are

significantly different between RPL patients and controls (P = 0.003). The frequency

of polymorphic G allele was more prevalent in RPL patients (6.75%) than in controls

(2.25%) and the wild type A allele was less prevalent in RPL patients (93.25%) than

in controls (97.75%), see Table (4-9). It can be concluded that factor V: A4070G is

associated with RPL in our population and that the presence of the G-allele increases

the RPL risk more than three times (OR = 3.14; P = 0.003).

Investigations on association of this polymorphism with RPL have also yielded

variable results. Whereas Torabi et al. (2012) in Iran found a significant association

between FV:A4070G and RPL risk, Sotiriadis et al. (2007) observed no difference in

the prevalence of this polymorphism between RPL patients and controls. As discussed

above for factor V: G1691A polymorphism, the prominent cause for the conflicting

results lies in the genetic background differences of the investigated populations.

5.4. Association between factor V: Y1702C (A5279G) gene


The distribution of factor V: A5279G genotypes in the control group is in Hardy-

Weinberg equilibrium as no significant deviation (P = 0.971) was recorded between

observed and expected genotype frequencies.


the RPL patients (98.0%), though this difference was not significant (P-value =

0.211). The GA genotype was less frequent in the control women (0.5%) relative to

RPL patients (1.5%) but this difference was not significant either (P-value = 0.339).

The GG genotype was present in comparable frequencies in both groups (P-value =

0.50), see Table (4-19).

Results of this study showed that the factor V: A5279G polymorphism was not

significantly different between RPL patients and the controls (all P values are > 0.05).

81


The results also showed that the allele frequencies of factor V: A5279G are not


frequency of polymorphic A allele was less prevalent in RPL patients (98.75%) as

compared to controls (99.75%) and the G allele was more prevalent in RPL patients

(1.25%) relative to controls (0.25%). See table (4-20). It can be inferred that the factor

V: A5279G does not represent a risk for RPL in our study population.

Association studies of this SNP with RPL also reported conflicting results. For

instance, Torabi et al. (2012) showed that the minor allele of A5279G is associated

with RPL whereas in the contrary Coulam et al. (2006) indicated lack of difference

between RPL and controls.

5.5. Independent effects of Factor V (G1691A) and (A4070G)

polymorphisms

After excluding the three samples in which both G1691A and A4070G

polymorphisms coexisted, the A4070G minor allele remained as a risk factor for RPL

with an odds ratio of (OR = 2.34; P = 0.0003), see Table (4-16)

showing that this variant itself is an independent risk factor. Therefore, we suggest

including this polymorphism in the thrombophilia workup of the RPL females.

82


5.6. Association between factor II: (G20210A) gene polymorphism

and RPL

The distribution of factor II: G20210A genotypes in the control group is in Hardy-

Weinberg equilibrium as no significant deviation (P- value = 0.915) was recorded

between the observed and expected genotypes frequencies.

The GG genotype was more prevalent in the control women (98.5%) as compared to

the RPL patients (95.5%), but this difference did not reach significance (P-value =

0.093). The GA genotype was less frequent in the control women (1.5%) relative to

RPL patients (4.5%), though this difference was not significant (P-value = 0.093), see

Table (4-24). The AA genotype was not encountered in neither the control women nor

the RPL patients.

This study showed that the allele frequencies of factor II: G20210A also are not


frequency of the polymorphic G allele was less prevalent in RPL patients (97.75%) as

compared to controls (99.25%). The A allele was more frequent in RPL patients

(2.25%) as compared to controls (0.75%), see Table (4-25). Therefore, factor II:

G20210A polymorphism seems not to be associated with RPL in the investigated

population. However, the low frequency of the minor A-allele of this polymorphism

may be the reason behind obscuring its association with RPL and increasing the

sample size further may bring about different results.

Still, lack of association between RPL and factor II: G20210A polymorphism

observed in this study is in agreement with the findings reported by (Ardestani1 et al.,

2013; Parand et al., 2013; Abu-Asab et al. 2011; Sotiriadis et al., 2007;

Hohlagschwandtner et al., 2003). On the other hand, other reports showed significant

association between this SNP and RPL risk (e.g., Gawish and Al-Khamees, 2013;

Mierla et al., 2012; Torabi et al., 2012; Martinelli et al., 2000; Brenner et al., 1999).

83


5.7. Association between factor XI: rs3756008 (A>T) gene


The distribution of factor XI: rs3756008 (A>T) genotypes in the control group

deviated significantly from Hardy-Weinberg equilibrium (P-value = 0.00003). This

significant departure from Hardy-Weinberg equilibrium could be due to a yet

unidentified cause and deserves further investigation.


the RPL patients (42.5%), though this difference was not significant (P-value = 0.07).

The AT genotype was less frequent in the control women (48.0%) relative to RPL

patients (57.0%) but this difference also was not significant (P-value = 0.07), see

Table(4-29). On the other hand, the TT genotype occurred with similar frequencies in

both the control women and the RPL patients.

The results for factor XI: rs3756008 (A>T) allele frequencies showed that there is no

significant difference between the RPL patients and the controls (P-value = 0.15). The

frequency of the major A allele was less prevalent in RPL patients (71.0%) than in

controls (75.5%) and that of the T allele was more prevalent in RPL patients (29.0%)

than in controls (24.5%), see Table(4-30). Therefore, it seems that this factor XI:

rs3756008 (A>T) polymorphism does not represent a risk for RPL in our study

population.

This polymorphism was tested because it has been highlighted among the gene

variants significantly associated with deep venous thrombosis (Bezemer et al., 2008).

In terms of its association with pregnancy complications only one published report

was encountered (Dahm et al., 2012) where they found no significant effect of this

SNP on adverse pregnancy outcome. The same report however, showed that another

SNP change in factor XI (rs2289252) is associated with pregnancy-related venous

thrombosis. We suggest testing the impact of this later SNP in our RPL patient.

84

Chapter Six

Conclusion and

Recommendations

85

Chapter (6) Conclusion and Recommendations

6.1. Conclusion

The present study focused on the polymorphisms in factor V: G1691A (R506Q;

rs6025), H1299R (R2), Y1702C (rs118203907); factor II G20210A (rs1799963), and

factor XI rs3756008 (A>T) in 200 Palestinian women in Gaza Strip suffering from

RPL as compared to 200 healthy women. The results of the study can be summarized

as follows:

The study showed that there is significant associations between factor V:

G1691A (R506Q; rs6025) and H1299R (R2) polymorphisms and RPL.

No significant association was observed between factor V Y1702C

(rs118203907); factor II G20210A (rs1799963), or factor XI rs3756008 (A>T)

polymorphisms and RPL.

The distribution of factor V: G1691A (R506Q; rs6025), H1299R (R2),

Y1702C (rs118203907); and factor II G20210A (rs1799963) polymorphisms

are in Hardy –Weinberg equilibrium, but factor XI rs3756008 (A>T) deviated

from HW equilibrium




86

Chapter (6) Conclusion and Recommendations

6.2. Recommendations

1. Before ordering genetic testing for patients, it is essential to thoroughly

confirm the association between the tested factor and the disease. Especially

with respect to gene(s) polymorphism(s) and RPL. Studies in other people and

ethnic groups may not be applicable to the Gaza strip population.

2. Performing larger studies to confirm the lack of association between factor II

G20210A polymorphism and RPL in the Palestinian population.

3. Performing further studies to investigate the impact of other polymorphisms in

genes related to inherited thrombophilia in RPL cases.

4. Including the factor V: A4070G (H1299R) in the thrombophilia workup of

unexplained RPL cases in our population.

87

1. References:

1. Abd Allah AM, Hassan FM. (2014). The frequency of factor V leiden

mutation among Sudanese pregnant women with recurrent miscarriage.

Journal of American Science; 10(9): 63-66.

2. Abu-Asab NS, Ayesh SK, Ateeq RO, Nassar SM, EL-Sharif WA. (2011).

Association of inherited thrombophilia with recurrent pregnancy loss in

Palestinian women. Obstetrics and Gynecology International; Article ID

689684, 6 pages doi:10.1155/2011/689684.

3. American Society for Reproduction Medicine; 2012.

4. Ardestani M, Nodushan H, Aflatoonian A, Ghasemi N, Sheikhha M. (2013).

Case control study of the factor V Leiden and factor II G20210A mutation

frequency in women with recurrent pregnancy loss. Iranian Journal of

Reproductive Medicine; 11(1): 61-64.

5. Austin H, De Staercke C, Lally C, Bezemer ID, Rosendaal FR, Hooper WC.

(2011). New gene variants associated with venous thrombosis: a replication

study in white and black Americans. Journal of Thrombosis and

Haemostasis; 9: 489–95.

6. Bernardi F, Faioni EM, Castoldi E, Lunghi B, Castaman G, Sacchi E,

Mannucci PM. (1997). A factor V genetic component differing from factor V

R506Q contributes to the activated protein C resistance phenotype. Blood; 90:

1552-1557.

7. Bezemer ID, Bare LA, Doggen CJ, Arellano AR, Tong C, Rowland CM,

Catanese J, Young BA, Reitsma PH, Devlin JJ & Rosendaal FR. (2008).

Gene variants associated with deep vein thrombosis. The Journal of the

Amercian Medical Association; 299: 1306-1314

8. Brenner B, Sarig G, Weiner Z, Younis J, Blumenfeld Z, Lanir N. (1999).

Thrombophilic polymorphisms are common in women with fetal loss without

apparent cause. Thrombosis and Haemostasis; 82(1): 6-9.

9. Carbone JF, Rampersad R. (2010). Prenatal screening for thrombophilia's :

indications and controversies. Clinics in Laboratory Medicine; 30: 747–760.

88

10. Castoldi E, Lunghi B, Mingozzi F, Muleo G, Redaelli R, Mariani G, Bernardi

F. (2001) A missense mutation (Y1702C) in the coagulation factor V gene is

a frequent cause of factor V deficiency in the Italian population.

Haematologica; 86(6): 629-633.

11. Clifford K, Rai R, Watson H, Franks S, Regan L. (1996). Does suppressing

luteinising hormone secretion reduce the miscarriage rate? results of a

randomised controlled trial. British Medical Journal; 312: 1508-15011.

12. Coulam C B, Wallis D, Weinstein J, DasGupta D S, Jeyendran R S. (2008).

Comparison of thrombophilic gene mutations among patients experiencing

recurrent miscarriage and deep vein thrombosis. American Journal of

Reproductive Immunology; 60 (5): 426-431.

13. Coulam CB, Jeyendran RS, Fishel LA, Roussev R. (2006). Multiple

thrombophilic gene mutations rather than specific gene mutations are risk

factors for recurrent miscarriage American Journal of Reproductive

Immunology; 55: 360–368.

14. D’Uva M, Strina I, Mollo A, Ranieri A, De Placido G، Di Micco P. (2005).

Acquired factor XII deficiency in a woman with recurrent pregnancy loss:

working on a differential diagnosis in a single case. Journal of Translational

Medicine; 3(5): 43-48.

15. D’Uvaa M, Di Miccob P, Strinaa I, De Placidoa G. (2010). Recurrent

pregnancy loss and thrombophilia. (Review) Journal of Clinical Medicine

Research; 2: 18-22.

16. Dahm AEA, BezemerI D, Bergrem A, Jacobse AF, Jacobsen E M, Skretting

G, Rosendaal FR and Sandset P M.(2012). Candidate gene polymorphisms

and the risk for pregnancy-related venous thrombosis. British Journal of

Haematology; 157: 753–761.

17. Dajani R, Arafat A, Hakooz N, Al-Abbadi Z, Al-Motassem Yousef, El

Khateeb M, Quadan F. (2012). Polymorphisms in factor II and factor V

thrombophilia genes among Circassians in Jordan. Journal of Thrombosis

and Thrombolysis; 35: 83–89.

18. Dawood F. (2013). Pregnancy and Thrombophilia. Journal of Blood

Disorders Transfusion; 4(5): doi: 10.4172/2155-9864.1000164.

19. De Visser MCH, Guasch R M, Kamphuisen PW, Vos Hans L, Rosendaal F R,

Bertina R M. (2000). The HR2 haplotype of factor V: effects on factor V

89

levels, normalized activated protein C sensitivity ratios and the risk of venous

thrombosis. Thrombosis and Haemostasis; 83: 577-582.

20. Dossenbach GA, van Trotsenburg M, Krugluger W, Dossenbach MR,

Oberkanins C, Huber J، Hopmeier P. (2004). Elevated coagulation factor VIII

and the risk for recurrent early pregnancy loss. Thrombosis and Haemostasis;

91: 694-699.

21. Emsley J, Paul A. McEwan, and Gailani D. (2010). Structure and function of

factor XI. Blood: 115 (13): 2569-2577.

22. Evans M. Recurrent pregnancy loss. Available from Huntington

reproductive in California: URL:

http://www.infertilityspecialist.com/recurrent_pregnancy_loss.htm (Accessed

on December, 2011).

23. Ford H B, Schust D J. (2009). Recurrent pregnancy loss: etiology, diagnosis,

and therapy. Review in Obstetrics and Gynecology; 2 (2): 76-83.

24. Foy P, Moll S.(2009). Thrombophilia:2009 Update. Current Medicine Group

LLC; 11: 114-128.

25. Gawish G, Al-Khamees O. (2013) Molecular characterization of factor V

leiden G1691A and prothrombin G20210A mutations in Saudi females with

recurrent pregnancy loss. Journal of Blood Disorders & Transfusion; 4: 165.

Doi: 10.4172/2155-9864.

26. Genetic Home Reference.

27. Ghosh K and Shetty S. (2009). Anti-phospholipid antibodies and other

immunological causes of recurrent foetal loss – a review of literature of

various therapeutic protocols. American Journal of Reproductive

Immunology; 62: 9-24.

28. Gomez K, and Maggs PB. (2008). Factor XI deficiency. Haemophilia, 14,

1183–1189.

29. Goodman CS, Coulam CB, Jeyendran RS, Acosta VA, Roumen R. (2006).

Which thrombophilic gene mutations are risk factors for recurrent pregnancy

loss? American Journal of Reproductive Immunology; 56 (4): 230– 236.

30. Hamilton Health Sciences; 2007.

31. Hanson E, Nilsson S, Jood K, Norrving B, Engström G, Blomstrand C,

Lindgren A, Melander O, Jern C. (2013). Genetic variants of coagulation

http://www.bloodjournal.org/content/115/13

http://www.infertilityspecialist.com/recurrent_pregnancy_loss.htm

90

factor XI show association with Ischemic stroke up to 70 years of age. Public

Library of Science ONE; 8(9): e75286.

32. Hohlagschwandtner M, Unfried G, Heinze G, Huber J, Nagele F, Tempfer C.

(2003). Combined thrombophilic polymorphisms in women with idiopathic

recurrent miscarriage, Fertility and Sterility; 79:1141-1148.

33. http://www.med.illinois.edu/hematology/ptfacv2.htm.

34. Hussein A S, Darwish H, Shelbayeha K. (2010). Association between factor

V leiden mutation and poor pregnancy outcomes among Palestinian women.

Thrombosis Research; 126: 78–82.

35. Jones DW, MacKie IJ, Gallimore MJ, Winter M. (2001). Antibodies to factor

XII and recurrent fetal loss in patients with the anti-phospholipid syndrome.

British Journal of Haematology; 113:550-552.

36. Kane WH, Mruk JS, Majerus PW. (1982). Activation of coagulation factor V

by a Platelet Protease. Journal of Clinical Investigation; 70(5): 1092–1100.

37. Kazerooni T, Ghaffarpasand F, Asadi N, Dehkhoda Z, Dehghankhalili M,

Kazerooni Y. (2013). Correlation between thrombophilia and recurrent

pregnancy loss in patients with polycystic ovary syndrome:a comparative

study. Journal of the Chinese Medical Association 76: e288.

38. Khan S, Dickerman J D. (2006). Hereditary thrombophilia. Thrombosis

Journal; 4:15. doi:10.1186/1477-9560-4-15.

39. Kobashi G, Kato EH, Morikawa M, Shimada S, Ohta K, et al. (2005)

MTHFR C677T Polymorphism and factor V leiden mutation are not

associated with recurrent spontaneous abortion of unexplained etiology in

Japanese women. Seminarine Thrombosis and Hemostasis; 31: 266-271.

40. Konecny F. (2009). Inherited trombophilic states and pulmonary embolism.

Journal of Research in Medical Sciences; 14 (1): 43-56.

41. Kong M, Kim Y, Lee C. (2014). Functional investigation of a venous

thromboembolism GWAS signal in a promoter. Molecular Biology Reports;

41(4): 2015-2019.

42. Kovalevsky G, Gracia R, Berlin JA, Sammel MD , Barnhar KT. (2004).

Evaluation of the Association between hereditary thrombophilias and

recurrent pregnancy loss. Archives of Internal Medicine; 164: 558-563.

http://www.med.illinois.edu/hematology/ptfacv2.htm

http://www.ncbi.nlm.nih.gov/pubmed?term=Kong%20M%5BAuthor%5D&cauthor=true&cauthor_uid=24420855

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=24420855

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20C%5BAuthor%5D&cauthor=true&cauthor_uid=24420855

http://www.ncbi.nlm.nih.gov/pubmed/24420855

91

43. Kruger TF, van Niekerk EC, and Siebert I. (2013). An evidence-based

approach to recurrent pregnancy loss. South African Journal of obstetrics and

Gynacology; 19(3): 61-65.

44. Kujovich JL. (2004). Hormones and pregnancy: thromboembolic risks for

women. British Journal of Haematology; 126: 443–454.

45. Kupferminc MJ. (2003). Thrombophilia and pregnancy. reproductive Biology

and Endocrinology;1:111.

46. Kutteh W H, Odom L N. (2012). Evaluating recurrent pregnancy loss: The

role of autoimmune screening. Sexuality, Reproduction & Menopause

(SRM); 10(1): 11.

47. Lavigne G L, Nouvellon E C, Mercier E, Quere I, Dauzat M, Mares P,Gris J

C. (2005). The association between hereditary thrombophilias and pregnancy

loss.haematologica, 90: 1223-1230.

48. Ledingham MA, Thomson AJ, Young A, Macara LM, Greer IA, Norman JE.

(2000). Changes in the expression of nitric oxide synthase in the human

uterine cervix during pregnancy and parturition. Molecular Human

Reproduction.; 6: 1041-1048.

49. Lunghi B, lacoviello L, Gemmati D, Dilasio MG, Castoldi E, Pinotti M,

Castaman G, Redaelli R, Manani G, Marchetti G, Bernardi F. (1996).

Detection of new polymorphic markers in the factor V gene: Association with

factor V levels in plasma. Thrombosis and Haemostasis; 75: 45 -48.

50. Mahjoub T, Mtiraoui N, Tamim H, Hizem S, Finan RR, Nsiri B, and Almawi

WY. (2005). Association between adverse pregnancy outcomes and maternal

factor: factor V G1691A (leiden) and prothrombin G20210A genotypes in

women with a history of recurrent idiopathic miscarriages. American Journal

of Hematology; 80: 12–19.

51. Makaryus JN, Halperin JL, Lau JF. (2013). Oral anticoagulants in the

management of venous thromboembolism. Nature Reviews Cardiology; (10):

397-409

52. Makino A, Nakanishi T, Sugiura - Ogasawara M, Ozaki Y, Suzumori N,

Suzumori K. (2004). No association of C677T methylene tetrahydrofolate

reductase and an endothelial nitric oxide synthase polymorphism with

recurrent pregnancy loss. American Journal of Reproductive Immunology;

52: 60-66.

92

53. Marc Dhont. (2003). Recurrent miscarriage. Current Women’s Health

Reports; 3: 361–366.

54. Margeti S. (2014). Laboratory investigation of thrombophilia .Journal of

Medical Biochemistry; 33: 28–46.

55. Martinelli I, Taioli E, Cetin I, et al. (2000). Mutations in coagulation factors

in women with unexplained late fetal loss. New England Journal of

Medicine; 343: 1015-1018.

56. Mierla D, Szmal C, Neagos D, Cretua R, Stoian V, Jardan D.

(2012).Association of prothrombin (A20210G) and factor V leiden (A506G)

with recurrent pregnancy loss. A Journal of Clinical Medicine; 7(3): 222-227.

57. Moll S, Elizabeth A. Varga. (2004). Prothrombin 20210 mutation (factor II

mutation), American Heart Association, Inc.

58. Motee M, Mohammad F, Al-Halabi M. (2007). Prevalence of factor V leiden

mutation and its relation with recurrent spontaneous pregnancy loss in a

group of Syrian women. Middle East Fertility Society Journal; 12(3): 179-

183.

59. Nardo LG, Rai R, Backos M, El-Gaddal S, Regan L. (2002). High serum

luteinizing hormone and testosterone concentrations do not predict pregnancy

outcome in women with recurrent miscarriage. Fertility and Sterility; 77:

348–352.

60. Nazemi A, Tolami HF, Navaderi M, Toulami S, Hondori MJ, Tameshkel

FS, Seyedinasab SR. (2013). Screening for mutations in 10 exons of the 5

coagulation factor gene in Gilan province thrombosis patients. Pelagia

Research Library. European Journal of Experimental Biology; 3(3): 589-592.

61. Parand A, Zolghadri J, Nezam M, Afrasiabi A, Haghpanah S, Karimi M.

(2013). Inherited thrombophilia and recurrent pregnancy loss. Iranian Red

Crescent Medical Journal; 15(12): e13708.

62. Pierpaolo Di Micco and Maristella D’Uva. (2009). Recurrent pregnancy loss

and thrombophilia. The Open Atherosclerosis & Thrombosis Journal; 2: 33-

35.

63. Prisco D, Ciuti G, Falciani M. (2005). Hemostatic changes in normal

pregnancy. Haematologica reports; 1(10): 1-5.

93

64. Rai R, Backos M, Rushworth F, Regan L. (2000). Polycystic ovaries and

recurrent miscarriage – a reappraisal. Human Reproduction; 15: 612– 615.

65. Raziel A, Kornberg Y, Friedler S, Schachter M, Sela BA, et al. (2001).

Hypercoagulable thrombophilic defects and hyperhomocysteinemia in

patients with recurrent pregnancy loss. American Journal of Reproductive

Immunology; 45: 65-71.

66. Reddy BM and Meka A. (2006). Recurrent spontaneous abortions: An

overview of genetic and non-genetic backgrounds. International Journal of

Human Genetics; 6(2): 109-117.

67. Rosendorff A, Dorfman DM. (2007). Activated protein C resistance and

factor V leiden. Archives of Pathology and Laboratory Medicine; 131(6):

866-871.

68. Rozano G A, Papadakis E, Brenner B. (2009). Combined thrombophilia and

obstetric complications. The Open Atherosclerosis & Thrombosis Journal; 2:

38–41.

69. Saito S. (2009). The causes and treatment of recurrent pregnancy loss. Journal

of the Japan Medical Association; 52(2): 97–102.

70. Shallal SS. (2010). Immunochemical and genetic study on Iraqi women with

recurrent abortion. University of Baghdad.

71. Sharif F A. (2012). Structural chromosome abnormality in recurrent

pregnancy loss in Gaza strip: first experience. Islamic University Journal of

Natural and Engineering Studies; 20(1): 17-29.

72. Sibai BM, How HY, Stella CL. (2007). Thrombophilia in pregnancy whom to

screen, when to treat. Obg Management: 50-64.

73. Simpson J, Carson S. (2013). Genetic and nongenetic causes of pregnancy

loss. Global library of Women's Medicine; DOI 10.3843/GLOWM.10319.

74. Smith ML, Schust DJ. (2011). Endocrinology and recurrent early pregnancy

loss. Seminars in Reproductive Medicine; 29(6): 482-90.

75. Sotiriadis A, Vartholomatos G, Pavlou M, Kolaitis N, Dova L, Stefos T,

Paraskevaidis E, Kalantaridou SN. (2007). Combined thrombophilic

mutations in women with unexplained recurrent miscarriage. American

Journal of Reproductive Immunology; 57:133-141.

http://www.ncbi.nlm.nih.gov/pubmed?term=Smith%20ML%5BAuthor%5D&cauthor=true&cauthor_uid=22161461

http://www.ncbi.nlm.nih.gov/pubmed?term=Schust%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=22161461

94

76. Su M-T, Lin S-H, Chen Y-C, Kuo P-L. (2013). Genetic association studies of

ACE and PAI-1 genes in women with recurrent pregnancy loss: A systematic

review and meta-analysis. Thrombosis and Haemostasis; 109: 8–15.

77. Suryanarayana V, Rao L, Kanakavalli M, Padmalatha V, Deenadayal M,

Singh L. (2006). Recurrent early pregnancy loss and endothelial nitric oxide

synthase gene polymorphisms. Archives in Gynecology and Obstetrics.;

274(2): 119-124.

78. The Miscarriage Association; 2011.

79. Thornoton P, Douglas J. (2009). Coagulation in pregnancy. Best Practice &

Research Clinical Obstetrics and Gynaecology; 24: 339–352.

80. Torabi R, Zarei S, Zeraati H, Zarnani A, Akhondi M, Hadavi R, Shiraz E,

Jeddi-Tehrani M. (2012). Combination of thrombophilic gene polymorphisms

as a cause of increased the risk of recurrent fregnancy loss. Journal of

Reproduction and Infertility; 13: 89-94.

81. Torabi, Ostadkarampour, Mohammadzadeh, , Arefi, Keramatipour, Zarei,

Zeraati, Jeddi-Tehrani. (2009). The relationship between polymorphisms of

blood coagulation factor V gene and recurrent pregnancy losses. J Reprod

Infertil; 9(4): 305-316.

82. Tripodi A and Mannucci PM. (2001). Laboratory investigation of

thrombophilia. Clinical Chemistry; 47(9): 1597–1606.

83. Tsiolakidou G and Koutroubakis IE. (2008). Thrombosis and inflammatory

bowel disease-the role of genetic risk factors. World Journal of

Gastroenterology; 14(28): 4440–4444.

84. Ulukufi1 M, Ero⁄Lu2 Z, Yen‹El1 A, Toprak1 E, Kosova2 B, Turan1 O,

Ulukufi1 M. (2005). Frequency of factor V leiden (G1691A), prothrombin

(G20210A) and ethylenetetrahydrofolate reductase (C677T) genes mutations

in woman with adverse pregnancy outcome. Journal of the Turkish-German

Gynecological Association; 7(3): 195-201.

85. Unfried G, Griesmacher A, Weismu¨ ller W , Nagele F, Huber JC, and

Tempfer CB. (2002). The C677T polymorphism of the

methylenetetrahydrofolate reductase gene and idiopathic recurrent

miscarriage. The American College of Obstetricians and Gynecologists;

99(4): 614-619.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Tsiolakidou%20G%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Koutroubakis%20IE%5Bauth%5D

95

86. WHO. (2009). The International Committee for Monitoring Assisted

Reproductive Technology and the World Health Organization. Revised

Glossary on ART Terminology Human Reproduction; 24(11): 2683–2687.

87. Wolf C, Haubelt H, Pauer H, Hinney B, Cesar C, Legler T, Hellstern P,

Emons G, Zoll B, Köhler M. (2003). Recurrent pregnancy loss and its relation

to FV leiden, FII G20210A and polymorphisms of plasminogen activator and

plasminogen activator inhibitor. Pathophysiology of Haemostasis and

Thrombosis; 33: 134–137.

the islamic university · polymorphisms in factor-v g1691a, factor-v h1299r (a4070g), factor-v...

Documents