Proc. Nati. Acad. Sci. USAVol. 89, pp. 11503-11507, December 1992Biochemistry

DNA binding and heteromerization of the Drosophila transcriptionfactor chorion factor 1/ultraspiracleANASTASIA M. KHOURY CHRISTIANSON*t, DENNIS L. KING*, EVIE HATZIVASSILIOU*, JORGE E. CASAS*,PAUL L. HALLENBECK§, VERA M. NIKODEM§, S. ALEX MITSIALIS¶, AND F. C. KAFATOS* II ***Department of Cellular and Developmental Biology, Harvard University, Cambridge, MA 02138; *Department of Biochemistry and lEvans Department ofClinical Research, The University Hospital and Department of Medicine, Boston University School of Medicine, Boston, MA 02118; §Genetics andBiochemistry Branch, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD 20892; and lCnstitute of Molecular Biology andBiotechnology, P.O. Box 1527, Heraklion 711 10, Crete, Greece

Contributed by F. C. Kafatos, August 19, 1992

ABSTRACT The Drosophila chorion factor 1/ultraspira-cle (CF1/USP) transcription factor, a homologue of the retin-oid X receptor, is a developmentally important member of thefamily of nuclear (steroid) hormone receptors. Using newlydeveloped monoclonal antibodies and a full-length bacteriallyproduced protein, we have studied in detail the in vitro DNA-binding properties of this factor and aspects of its distributionin vivo. During oogenesis, CF1/USP is present both in germ-line cells and in the somatic follicular epithelium. We havedetermined the optimal binding site of partially purifiled bac-terially produced CF1/USP by an in vitro selection procedureand also have characterized its binding to the follicular-specificchorion siS promoter. In vito this bacterially produced factoris unusual in binding to a single element ("half-site"); simul-taneous but noncoordinate binding to a second half-site ispossible if these repeated elements are organized in directorientation and spaced adequately. However, the factor inter-acts synergistically with several other nuclear hormone recep-tors: notably, it can form in vito heteromers with mammalianthyroid and retinoic acid receptors, binding to two half-sitesthat are organized in either direct or inverted orientation. Invivo the factor most probably functions as a heterodimer, butits partner(s) remains to be determined.

Steroid and other nuclear hormone receptors are a family ofligand-modulated transcription factors that regulate cell dif-ferentiation and development as well as homeostasis andreproduction (1, 2). These receptors bind to DNA promoteror enhancer motifs ("hormone response elements" or HRE),which typically contain two copies of short, receptor-specificsequences called "half-sites," oriented either as direct (e.g.,refs. 3-5) or as inverted (e.g., refs. 6 and 7) repeats. Althoughsome members of the family bind to HREs as homodimers,others can heterodimerize, potentially enhancing the range ofregulatory processes that can be served by a single HRE (8).

In Drosophila melanogaster, the paradigm for metazoangenetics, nine members of this family have been identified sofar, with strategic roles in embryogenesis, postembryonicdevelopment, and morphogenesis (2). We first cloned one ofthese factors by its binding to a potential HRE in the chorionsiS promoter and named it chorion factor 1 (CF1) (9); thisreceptor was also cloned independently by homology to theDNA-binding domain of vertebrate hormone receptors (10,11). This orphan receptor, CF1/USP, is encoded by theultraspiracle locus (usp) (10), a maternally and zygoticallyrequired gene with multiple functions in development (12).CF1/USP is most closely related to the subfamily of verte-brate retinoid X receptors (RXRs), suggesting that its ligandmight be a retinoid metabolite (13-15).

In our initial work (9), experiments using the chorion si5promoter and a bacterially produced protein fragment indi-cated that CF1/USP binds to a single half-site. We have nowconfirmed this unusual feature in detailed studies of thebinding properties of this factor in vitro. CF1/USP bindsmoderately strongly to a single HRE half-site; a secondhalf-site on the same DNA can be used simultaneously butnot cooperatively, provided it is present as a direct repeatwith sufficient spacing. In contrast, the factor is prone tointeract with other members of the family, and in vivo mostlikely it functions as heterodimers with one or more as yetunknown partners. Binding studies in vitro demonstrate thatthis fly factor can assemble on DNA with mammalian thyroidhormone receptor (THR) and retinoic acid receptor (RAR).

MATERIALS AND METHODSBacterial CF1/USP Preparations. Truncated CF1 (T-CF1)

was prepared as described (9). For production of CF1, agenomic DNA usp fragment [a gift from A. Oro (SalkInstitute)] (12) was subcloned into the phage T7-Escherichiacoli expression system (16). Host E. coli BL21 (DE3) wasused for protein production as described (17). CF1 waspartially purified on a phosphocellulose column. Details willbe described elsewhere.To prepare glutathione S-transferase fusion protein (GST-

CF1), pGST-CF1 was constructed by inserting a blunt-endedNde I/EcoRI fragment of pCF1 containing usp into blunt-ended pGEX-2T plasmid digested with BamHI. The fusionprotein was purified as described (18).Optimal Site Selection. The optimal binding site ofCF1 was

determined as described (19-21). A 60-base-pair (bp) oligo-nucleotide containing a completely random 20-bp region(CCGCTCGAGGATCCN20GAATTCCCGGGAAG) wasend-labeled to high specific activity with polynucleotidekinase and was used in electrophoretic mobility shift assay(EMSA) gels. Nontransformed bacterial extract was used inparallel as the negative control. The retarded complex ob-served by autoradiography was excised, and the DNA wasrecovered (21). A broad region ofthe gel slice was excised (10mm x 30 mm) to permit recovery of higher order complexes,and the DNA included therein was extracted and amplified byPCR with primers flanking the 20-bp degenerate region. ThisDNA was subjected to additional cycles of binding/EMSA

Abbreviations: CF1, chorion factor 1; T-CF1, truncated CF1; usp,ultraspiracle locus; CF1/USP, product of usp; HRE, hormoneresponse element; THR, thyroid hormone receptor; hTHR andrTHR, human and rat THR; RXR, retinoid X receptor; hRXR,human RXR; RAR, retinoic acid receptor; hRAR, human RAR;mAb, monoclonal antibodies; EMSA, electrophoretic mobility shiftassay; GST, glutathione S-transferase.tPresent address: DNX Corporation, 303 B College Road East,Princeton, NJ 08540.**To whom reprint requests should be addressed.

11503

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

11504 Biochemistry: Khoury Christianson et al.

purification/PCR amplification under progressively morestringent conditions (21). DNA recovered from the gel aftercycles 3 and 5 was subcloned into a plasmid, and independentclones were sequenced.

Antibody Detection ofUSP on EMSA Gels. Standard EMSAgels were run as described (9). The gel was electrotransferredonto stacked nitrocellulose and Zeta-Probe (Bio-Rad) mem-branes, allowing the protein to adhere to nitrocellulose whilethe DNA travels through to the Zeta-Probe membrane. Thenitrocellulose membrane was probed by antibodies. Detailsof this method will be described elsewhere.

Preparation of Nuclear Receptors Expressed in Cell Lines.The insert of plasmid pCF1 was subcloned into the expres-sion vector PCDNAI (Invitrogen, San Diego). Total extractsfrom COS cells transiently transfected by the resulting plas-mid were prepared as described by Kumar and Chambon (6).Control extracts were prepared from cells transfected withvector containing the CF1 insert in the anti-sense orientation.Extracts from COS cells expressing human RARa (hRARa),human RXRa (hRXRa), and human THR,8 (hTHRO) proteinswere a generous gift of J. Ladias (N.E. Deaconess Hospital).The human All apolipoprotein promoter sequence usedcorresponds to the AII-J region (22) and was a gift from C.Cladaras (Boston University). Nuclear extracts containinghigh levels of rTHRa were prepared from recombinant bac-ulovirus-infected Sf9 cells (23). The thyroid response elementused is a 72-bp HindIII-EcoRI restriction fragment preparedfrom plasmid pTK1AM3 containing the rat malic enzymeresponse element (23).Foikle Cell Staining. Ovarian follicles were rinsed-in Ring-

er's solution and fixed [4% methanol-free formaldehyde (Poly-sciences)/160mM KCl/40mM NaCl/4mM Na3EGTA/5 mMspermidine/2 mM spermine/30 mM Pipes, pH 7.4] for 10 minat room temperature. After a 10-min wash in PBST (PBScontaining 0.1% Triton X-100) they were incubated for 2 hrwith either AB1l or DH9 monoclonal antibody (mAb) super-natant. Follicles were then washed for 15-30 min in PBS andincubated for 1-2 hr with fluorescein-labeled, goat anti-mouseantibodies (Jackson ImmunoResearch) diluted 1:200 withPBS. After a final 15- to 30-min wash in PBS, whole mountsof follicles were prepared. Laser scanning confocal micros-copy was performed with the MRC 600 confocal head (Bio-Rad) mounted on a Zeiss Axioskop microscope.

RESULTSTools for Studying CF1/USP. usp clones were expressed

in bacteria, yielding three CF1/USP preparations that hence-forth will be abbreviated T-CF1, CF1, and GST-CF1 (Fig.1A). T-CF1 was obtained by expression of the original clone(9), which encodes 280 amino acid residues centered on theDNA-binding domain. CFl was obtained from a full-lengthclone that encodes 508 residues. GST-CF1 was identicalexcept that it was fused at its NH2 terminus with GST,permitting subsequent purification on glutathione-agarosebeads. Immunoblot (Western blot) analysis using mousemAbs to CF1 revealed that all three preparations werepolydisperse as a result of partial degradation (Fig. 1B). CF1fractions enriched in full-length product were obtained bygradient salt elution from a phosphocellulose column andwere used in most of the subsequent DNA binding studies.Comparative Western blot analysis permitted mapping of

the epitopes for two different mAbs. The DH9 mAb recog-nizes the extreme NH2 terminus of the CF1/USP protein: itdoes not bind to T-CF1, but, importantly, it binds to glu-tathione-selected GST-CF1 fragments of 28 kDa-merely 2kDa larger than the vector-encoded glutathione S-transferasealone. The NH2 terminus is nonconserved even amongRXR-type proteins (15), making DH9 an ideal tool for CF1/USP detection. For example, DH9 detects a single 55-kDa

__ _DNA "., -__(F

(iS I -CiI

- .. F-

1-3

.;- ot' -..;

1;-aid

-I)m rl/.zal

Tfleri/Z.iti

..... . . (,~~~~~~~~~. .I.

...

)1 {K;..

i

to ~ ~~~ so_

J A__. + |~fk

FIG. 1. (A) Schematic of the CF1/USP preparations. The zincfinger domain involved in DNA binding, a glycine- and serine-richdomain, and the ligand binding/dimerization domain are indicated.CF1 is the full-length bacterially produced CF1/USP protein (508residues, M55 kDa), GST-CF1 is the fusion protein of the full-lengthCF1 with glutathione S-transferase protein (-81 kDa), and T-CF1 isthe original truncated CF1 fragment (9). The region of the DH9epitope is shown by an underline, while the region of the AB11epitope is signified by three dots. (B) Specificity of anti-CF1 mAbpreparations. Bacterially expressed proteins GST-CF1 (lane 1),T-CF1 (lane 2), CF1 (lane 3), or D. melanogaster follicular nuclearextract (lane 4) were analyzed by Western blot with the indicatedmAbs [DH9 (Left) or AB11 (Right)] as probes. The fusion proteinGST-CF1 is indicated by an asterisk, and the full-length CF1, by anarrow. A dash indicates the lower size limit of detected degradationproducts. Note the absence of the DH9 epitope from T-CF1 (Left,lane 2). (C) Presence of CF1/USP in follicular epithelial nuclei ofboth D. melanogaster (Dm) (Upper) and D. virilis (Dv) (Lower).Stage 13 follicles were immunostained with mAb DH9 (Left) or mAbAB11 (Right). Note the presence of the protein in both species, asmonitored by the AB11 mAb (Upper Right and Lower Right), thepresence of the DH9 epitope in D. melanogaster (Upper Left), andits absence in D. virilis (Lower Left).

band in Western blots of nuclear extracts from a variety ofD.melanogaster cell types, including the follicular epithelium(Fig. 1B); in contrast, it does not recognize the correspondingcomponent of Drosophila virilis or the moth Bombyx mori.Fig. 1C shows immunostained follicles (stage 13) that confirmboth the specificity of DH9 for the D. melanogaster (asopposed to D. virilis) CF1/USP protein and the presence ofthat protein in the nuclei of the follicular epithelium. Stainingalso revealed the existence of the protein in germ-line nursecells as well as follicle cells from all other stages of oogenesis(data not shown). Comparable experiments have shown thatthe ABli mAb binds to the same 55-kDa CF1/USP protein;it recognizes an epitope that is shared by the D. virifis and B.mori homologues (data not shown) and maps in the region ofthe first zinc finger (Fig. 1A).

Binding to the Chorlon s15 Promoter. A 0.13-kbp fragmentof the D. melanogaster chorion si5 promoter was used forDNase I footprinting (DNase cleavage inhibition patterns)(9), methylation interference (method of refs. 21 and 24), andKMnO4 hydroxylation interference (25) studies ofthis factor.Both the CF1 and T-CF1 footprints encompassed the up-

Proc. Natl. Acad Sci. USA 89 (1992)

Proc. Nati. Acad. Sci. USA 89 (1992) 11505

..4

GAACAATTAGTGTATATAGGTr&MTTGTCCAGG* A d

-70 -60 -50

FIG. 2. Binding ofCF1/USP to the D. melanogaster chorion siSpromoter. The invariant chorion-specific hexamer is boxed. A regionof imperfect dyad symmetry is indicated by horizontal arrows andboldface letters. The limits of CF1 binding as detected by DNase Iprotection analysis are indicated by an overline, with dots definingthe maximum possible extent of the protected region. Bases impor-tant for binding as defined by methylation and hydroxylation inter-ference analyses are indicated by solid (strong effect) or open (weakeffect) arrowheads. Arrowheads above the sequence indicate con-tacts with the top strand (shown); those underneath indicate non-coding strand contacts. Note the absence of interference by modi-fication of the downstream half-site. Vertical arrows indicate DNaseI hypersensitive sites induced by CF1 binding.

stream but clearly not the downstream half-site of the im-perfect palindromic siS HRE, GGTCaCGTAAA~TITC-.Fig. 2 summarizes the results. The footprint is bracketed byhypersensitive sites at promoter positions -72 and -52, thelatter of which is located just upstream of the TGTCChalf-site. Methylation or hydroxylation at each nucleotideposition of the GGTCA half-site and at three neighboringpositions interfered with binding; there was no interferencefrom modification of the TGTCC half-site.

Optimal CF1 Binding Site. To characterize in more detailthe nucleotide requirements for CF1/USP binding to DNA,we used a binding-site-selection technique (19-21) based onthe polymerase chain reaction. The partially purified CF1preparation was mixed with a 60-bp oligonucleotide bearinga central, completely random 20-bp region (see Materials andMethods). Thirty-eight sequences from cycle 5 were exam-ined and showed remarkable agreement, indicating veryselective binding to a single half-site. Fig. 3 shows thealignment of the sequences and a table summarizing thetolerance for each base at each position. The optimal CF1binding sequence was the nonamer GGGGTCACG, whichencompasses the GGTCA half-site but differs in the first twopositions from the corresponding nonamer of the s15 pro-moter (TAGGTCACG). To verify this preference, an oligo-nucleotide encompassing the region of the siS binding site

FIFTH PCR CYCLE SEQUENCESGGGGTCACG AGAGGGTGCCA

G GGGGTCACG CCCCTCGTCCGGGGTCACG GGCCAGCCCGC

GGC GGGGTCACG TCCGAGGGGGGGTCACG GGGCCGCACTA

TGGC GGGGTCACG CGATTTGGGGGTCACG CCGCCAACACCGGGGTCACG CGTTAATCGCC

GG GGGGTCACG GCGCCGTATGCGACC GGGGTCACG GTGCC

GC GGGGTCACG TCCGGCCAGAGAGAGGCC GGGGTCACG CCTGCAGGTAG GGGGTCACG TG

GGGGTCACG GACCGGTGCCCGGGGTCACG GCCCGCCCCATGGGGTCACG GCCG&GCTGCCGGGGTCACT TCCCCGCCCCA

TGGAGCGGGC GGGGTCAGG GGGGGTCACC ATCCACGGGCA

GGAGAGTGGTC GGGGTCATCGGGGTCAAG ACGGGCCCCTGGGGGTCACA CAGCGCCACCA

GGATGCACGA GGGGTCACC AGGGGTCAAG GTCACGCTGCC

GT GGGGTCACC GCAGCTGCCGGGGTCACA GCTACAGCCAT

TA GGGGTCACC GCCGTTTCGTGGGCGGCA GGGGTCATG GG

GGGGTCAAC TGCGCGCCCCTGGGGTCATC CCTAGCTGCCCGGGGTGACA CTGGTGGCCCC

T GGGGTCAGC ATTACGTGCCGGGGTCATC GTACCGCCTCAGGGGTCATT CCATGCGACCAGGGGTCAAT CACCGGCCCCC

GGGGTC AAGGTCACG CTCCGGGGTTGTA TACCACCTCCT

A CAGGTCGCA AATTGTCCCC

(-36 to -84) and a variant (same size oligonucleotide) bear-ing the alternative nonamer were tested in parallel in theEMSA procedure with progressively lower protein concen-tration. Fig. 3 confirms that CF1 binds preferentially toGGGGTCACG by approximately a factor of 3 relative toTAGGTCACG.

Fig. 3 also shows that after only three cycles of selection,the consensus sequence was more permissive, GGGGT-CAC/tG/c, where lowercase letters signify alternate basepreference. A total of 71 cloned sequences showed good orreasonable matches to this consensus.

Binding to Mutad siS Promoters. In agreement with theabove results, both CF1 and T-CF1 binding to the siS HREwas disrupted by clustered substitutions eliminating theupstream half-site (Fig. 4, mutation c, lane 1) but wasinsensitive to loss of the downstream half-site (Fig. 4, mu-tation b, lane 2). EMSA patterns of these factor preparationsshared a major retarded band, but CF1 yielded additionallower-mobility bands that were enhanced with increasingcontent of long or full-length protein molecules. These bandswere also insensitive to loss of the downstream half-site.A single T -) A change at position -49 corrected the

imperfect symmetry of the siS HRE, resulting in a perfectpalindrome with two inverted GGTCA repeats separated bysix nucleotides (Fig. 4, PP, lane 4). This mutation did notsubstantially enhance the retarded EMSA bands or createadditional ones, suggesting that even with this correction, thesequence context or orientation of the downstream half-sitedoes not permit binding ofadditional CF1/USP molecules. Incontrast, two substitutions that together convert this invertedTGTCC half-site into a direct repeat, GGTCA, enhanced thebinding and led to the appearance ofa novel complex oflowermobility (Fig. 4, DR6, lane 5). This apparent tandem bindingof the factor was sensitive to spacing: it occurred on DR6,which has the normal 6-bp spacing between half-sites, but noton DR3, where the spacing is reduced to 3 bp (Fig. 4, lanes5 and 6, respectively). These results are consistent with theknown preference of RXRs for direct rather than invertedrepeats of proper spacing (26, 27). However, tandem bindingof CF1/USP did not appear to be cooperative, and the novelband was not as strong as those that correspond to binding ata single half-site, even when extensively purified CF1- wasused. Moreover, tandem binding on DR6 was at least as

THIRD CYCLEG G G G T C A C/t G/c

G QM3 f66 9 7 10 14 11 4A 15 25 1 2 1 0 AQ 11 12T 1 3 3 4 22 6 1 L 10C 4 6 3 4 0 8J 5 427 2.

68 71 71 71 71 71 71 71 68Sample Size

FMIFH CYCLEG G G G T C A C G/C

G MA 25 .Q01QQ0 3 5 5 .A 3 5 0 0 0 0 95 11 13T 0 0 0 0 MQQ 3 0 16 8C 3 0 0 0 0 0 &24

38 38 38 38 38 38 38 38 38Sample Size

I_-Z -< U <V

-04

FIG. 3. Characterization of the optimal CF1/USP binding site. (Left) Sequences of the central 20nucleotides of 38 independent clones containinghigh-affinity binding sites for CF1 after five cyclesofEMSA/PCR selection on a population containinga random 20-mer flanked by defined primer sites.(Right Upper) Tables showing the consensus se-quence of the optimal CF1 binding site, the percen-tile representation of each base at the indicatedposition, and the sample size of the independentclones used to derive these data after three or fivecycles of EMSA/PCR selection. (Right Lower)EMSA gel. Probes were oligonucleotides repre-senting a mutant variant of the si5 promoter con-taining the optimal nonamer GGGGTCACG (lanesGG) or the wild-type nonamer TAGGTCACG(lanes TA). The relative amounts of CF1 proteinused in lanes from left to right were 200 ng, 100 ng,and 50 ng. An asterisk indicates the main complexobserved, and arrowheads indicate complexes oflower mobility, probably due to less degraded pro-tein.

Biochemistry: Khoury Christianson et al.

11506 Biochemistry: Khoury Christianson et al.

-=kWt GAATCTCACAACAATTAGTGTATATAGGTCACGTAAATGTCCAGG CTAAAAG

AATT C'- '.>~~~~~~ATCTG

PP m

T-CFI CHl

2 3 4 5 6 1 2 3 4 5 6

*W~~~~~

FIG. 4. Binding of CF1/USP to mutant derivatives of the

regulatory region. (Upper) The sequence of the indicated mutants isrepresented under the wild-type (wt) siS promoter sequence. Mutantb contains clustered substitutions that destroy the right half of thepalindromic site. Mutant c contains substitutions in the conservedhexamer that destroy part of the left half of the palindrome. Themutation PP has a single substitution that makes the palindromeperfectly symmetrical. Mutant DR6 contains two point mutationsresulting in a direct repeat ofthe half-site with six bases in the spacerregion, while DR3 has a direct repeat with only 3 bases in the spacerregion. (Lower) EMSA analysis with bacterially produced CFl(Right) or T-CF1 (Left) and probes representing the wild-typesequence (lane 3) or mutants b (lane 1), c (lane 2), PP (lane 4), DR6(lane 5), and DR3 (lane 6). Open arrowheads indicate lower mobilitycomplexes probably due to CF1 species that if not full length areclose to it, and a dot indicates a complex due to extensivelyproteolyzed CF1. An arrow indicates a complex representing aputative dimeric form specific for the mutant DR6 probe.

prominent with T-CF1, despite the absence of the COOH-terminal half of the protein.

Heteromerizatlon. CF1/USP shows substantial conserva-tion with reference to vertebrate RXRs not only in theDNA-binding domain but also in the entire COOH-terminalhalf, including the putative high-affinity dimerization domain(15, 28). Since the vertebrate homologues are known toheterodimerize with THR, RAR, and vitamin D receptor (23,28-31), we explored the possibility that the Drosophilaprotein may also heterodimerize.We have shown that indeed CF1 can form complexes with

ratTHRa (rTHRa) and that this interaction cannot occur withT-CF1. When rTHRa was mixed with CF1 in the presence ofthe wild-type siS promoter, novel and strong bands of lowmobility appeared (Fig. SA). These bands were identified as

CF1-rTHRa-DNA complexes by Western blotting of theEMSA gels: while the bands seen with CF1 alone containCF1/USP, the novel complexes contained rTHRa as well asCF1/USP (Fig. 5, B and C). For these complexes to form withthe DNA, binding ofCF1 to the upstream half-site is essential,whereas DNA binding of rTHRa (to the downstream half-siteas shown by footprinting analysis) is helpful but nonessential(see Fig. 5D, C + Ta): the complexes were abundant with thewild-type sIS sequence (lane 1), reduced by the b mutation(lane 3), and totally absent with mutation c (lane 2). Similarlower mobility complexes were seen when the same factorswere used with a fragment ofthe malic enzyme promoter as theDNA target (data not shown).- Comparable experiments havealso shown heteromerization between CF1/USP and hTHR,or hRARa (Fig. SE). The heteromerization is specific, as it isnot observed between CF1/USP and hRXRa (Fig. SE). Theseheterocomplexes form both on the sIS HRE and on an

A BDNA ABl

1 2 4 5 1 2 3 4 5

9F

> *

*IiiiA

(janti-THRa

2 3 4 5

D C+Ta C-T1a FRARa RXRaE THRi

I2 12 2 I_ ;e 4 2 3 2 32

:

FiG. 5. Heteromerization of CF1/USP with mammalian nuclearreceptors. (A-C) Autoradiogram of an EMSA gel with a labeledoligonucleotide corresponding to the wild-type regulatory region ofthe siS promoter as probe (A) and Western blots ofthe same gel withantibodies directed against CF1 (mAb AB11) (B) or against THRa(C). The probe was incubated with CF1 protein produced in bacteria(lane 1), extract from Sf9 cells expressing rat THRa (lane 2), CF1plus rTIHRa (lane 3), CF1 plus control Sf9 cell extract (lane 4), orT-CF1 plus rTHRa (lane 5). Arrowheads and arrows are as in Fig. 4.(D) EMSA gels with oligonucleotide probes corresponding to thewild-type (lane 1), mutant c (lane 2), or mutant b (lane 3) derivativesof the sIS regulatory region. The probes were incubated with CF1protein in the presence of extracts from Sf9 cells expressing ratTHRa (lanes C+Ta) or in the presence ofcontrol Sf9 extracts (lanesC-Ta). (E) EMSA gels with an oligonucleotide probe correspondingto a regulatory region ofthe human apolipoprotein AII promoter. Theprobe was incubated with extracts from COS cells expressing CF1 orone of the indicated human nuclear receptor proteins. (E Left) CF1extract (lane 1), CF1 plus RARa (lane 2), RARa (lane 3), controlCOScell extract (lane 4), and RARa plus control COS cell extract (lane5). (E Center) RXRa (lane 1), RXRa plus CF1 (lane 2), and RXRaplus control COS cell extract (lane 3). (E Right) THROB (lane 1),THROB plus CF1 (lane 2), and THROB plus control COS cell extract(lane 3).

oligonucleotide encompassing a regulatory region of the hu-man apolipoprotein All promoter.

DISCUSSIONOvarian Distribution ofCF1/USP. It is impossible to prove

formally that any antibody is absolutely specific: it couldalways cross-react with an as yet unknown protein. Clearly,however, the DH9 mAb is extremely specific. Its bindingproperties to various CF1/USP preparations establish thatthis antibody recognizes an epitope very near the NH2terminus of the protein, probably within the first 14 residues.That sequence is effectively unique. In a search of a 20-million residue nonredundant protein data base, only twomarginal similarities were encountered with the first 19residues of USP/CF1 (identity of five contiguous residueswith Aplysia neuroactive polyproteins R15-1 and R15-2). TheNHrterminal sequence is not shared by the RXRs of verte-brates or B. mori (G. Tzertzinis, personal communication),and the epitope is absent from both the B. mori and the D.virilis homologues. Thus, the immunocytochemical staining

Proc. Nad. Acad. Sci. USA 89 (1992)

Proc. Natl. Acad. Sci. USA 89 (1992) 11507

of D. melanogaster follicles with DH9 (with D. virilis as anegative control) (Fig. 1C) effectively establishes that CF1/USP is present in the nuclei of follicular epithelial cellsthroughout oogenesis as well as in the germ-line nurse cells.A recent genetic and in situ hybridization study (12) docu-mented the high abundance ofusp RNA in the nurse cells butfor technical reasons could not establish unambiguouslywhether or not the RNA is present at lower levels in follicularepithelial cells. Our finding ofthe factor in follicular epithelialnuclei leaves open the possibility that CF1/USP may beinvolved directly in transcription of the siS chorion gene.DNA Binding of CF1/USP Alone. From the results pre-

sented, it is clear that bacterially produced CF1/USP canbind alone to a single HRE half-site. This property is unusual,although not unprecedented: nerve growth factor-inducedprotein (NGFI-B) also binds to a cognate DNA sequencebearing a single half-site (32). Although we cannot excludethe possibility that the CF1/USP binding species is dimeric,with one protein molecule making specific DNA contacts andthe other not, the ready formation of complexes with T-CF1(which lacks the probable dimerization domain) argues oth-erwise. Retarded bands of lower mobility form with thepartially purified full-length CF1 preparation, but comparisonof their mobilities with those of known dimers (THR, RAR)suggests that these bands probably are also monomeric.Whether they actually contain full-length CF1/USP orslightly degraded derivatives is as yet unknown.To form complexes bearing additional CF1/USP mole-

cule(s), it was necessary to convert the siS HRE into directrepeats spaced 6 bp apart. Even then the complexes did notappear to be cooperative; they also did not require theCOOH-terminal dimerization domain.

Heteromerization. In strong contrast to the resistance ofCF1/USP towards interacting with itself, we have obtainedunambiguous evidence that this factor can interact cooper-atively with three different mammalian hormone receptors toform complexes with target DNA. Strictly speaking theevidence is for protein heteromerization, but most likelythese complexes are heterodimers. This interaction is not anartifact of the siS HRE, since it is observed with threedifferent DNAs. At least in the case of siS, the heteromericDNA complexes with rTHRa require binding ofCF1/USP tothe DNA. These complexes also show a footprint, albeitweak, on the downstream half-site; moreover, they arereduced by disrupting this half-site, suggesting some specificinteraction between the DNA and the THRa partner. Cross-linking experiments indicate the formation of CF1-rTHRaheteromers even in the absence of DNA (data not shown).The spatial requirements for heteromerization appear to be

flexible: the complexes form not only on the wild-type si5HRE and its perfectly palindromic variant but also on DR3(which supports neither CF1/USP nor THRa homodimers);however, DR6 appears to be optimal for heteromerization.The observed heteromerization of fly and mammalian fac-

tors indicates that the pertinent features of RXRs have per-sisted through at least 500 million years of evolution, since thelast common ancestor ofinsects and vertebrates (29). This waspreviously hypothesized (27) and testifies to the functionalimportance of this RXR property. The advantages of Dro-sophila genetics should permit detailed analysis of the func-tional significance of heteromeric RXR interactions, once thefly partners of CF1/USP have been identified. If CF1/USPhas a function in siS expression it is likely to be permissive,since the protein is present in follicular nuclei long beforechoriogenesis. An unknown partner binding to the down-stream half-site may be involved in fine-tuning chorion geneexpression, since a mutation encompassing that site candisrupt the temporal specificity of si5 transcription (M. J.Conboy, B. D. Mariani and F.C.K., unpublished results).

Note Added in Proof. Recently, CF1/USP heteromerization, notablywith ecdysone receptors, has been observed by others (ref. 33; alsoM. R. Koelle, M. Arbeitman, and D. S. Hogness, personal com-munication).We are grateful to J. Gogos and G. Tzertzinis for discussions and

to M. Shea for T-CF1. We thank Drs. C. Cladaras, M. Hadzopoulou-Cladaras, and V. I. Zannis for discussions, generous supply ofreagents, and advice. Additionally, we thank S. Pedreira, B.Klumpar, and T. Chai for assistance. This work has been supportedby grants from the National Science Foundation and the NationalInstitutes of Health to F.C.K. and from the National Institutes ofHealth to S.A.M.; A.M.K.C. was supported by a National Institutesof Health postdoctoral fellowship.1. Segraves, W. A. (1991) Cell 67, 225-228.2. Oro, A. E., McKeown, M. & Evans, R. M. (1992) Curr. Opin.

Genet. Dev. 2, 269-274.3. Ladias, J. A. A. & Karathanasis, S. K. (1991) Science 251, 561-565.4. Mangelsdorf, D. J., Umesono, K., Kliewer, S. A., Borgmeyer, U.,

Ong, E. S. & Evans, R. M. (1991) Cell 66, 555-561.5. Wang, L.-H., Tsai, S. Y., Cook, R. G., Beattle, W. G., Tsai, M.-J.

& O'Malley, B. W. (1989) Nature (London) 340, 163-166.6. Kumar, V. & Chambon, P. (1988) Cell 55, 145-156.7. Tsai, S. Y., Carlstedt-Duke, J., Weigel, N. L., Dahlman, K., Gus-

tafsson, J.-A., Tsai, M.-J. & O'Malley, B. W. (1988) Cell 55,361-369.

8. Forman, B. M. & Samuels, H. H. (1990) New Biol. 2, 587-594.9. Shea, M. J., King, D. L., Conboy, M. J., Mariani, B. D. & Kafatos,

F. C. (1990) Genes Dev. 4, 1128-1140.10. Oro, A. E., McKeown, M. & Evans, R. M. (1990) Nature (London)

347, 298-301.11. Henrich, V. C., Sliter, T. J., Lubahn, D. B., MacIntyre, A. &

Gilbert, L. I. (1990) Nucleic Acids Res. 18, 4143-4148.12. Oro, A. E., McKeown, M. & Evans, R. M. (1992) Development

115, 449-462.13. Levin, A. A., Sturzenbecker, L. J., Kazmer, S., Bosakowski, T.,

Huselton, C., Allenby, G., Speck, J., Kratzeisen, C., Rosenberger,M., Lovey, A. & Grippo, J. F. (1992) Nature (London) 355, 359-361.

14. Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., Stein, R. B.,Eichele, G., Evans, R. M. & Thaller, C. (1992) Cell 68, 397-406.

15. Mangelsdorf, D. J., Borgmeyer, U., Heyman, R. A., Zhou, J. Y.,Ong, E. S., Oro, A. E., Kakizuka, A. & Evans, R. M. (1992) GenesDev. 6, 329-344.

16. Tabor, S. & Richardson, C. C. (1985) Proc. Natd. Acad. Sci. USA82, 1074-1078.

17. Studier, F. W., Rosenburg, A. H., Dunn, J. J. & Dubendorff, J. W.(1990) Methods Enzymol. 185, 60-131.

18. Smith, D. B. & Johnson, K. S. (1988) Gene 67, 31-40.19. Pollock, R. & Treisman, R. (1990) Nucleic Acids Res. 18, 6197-

6204.20. Blackwell, T. K. & Weintraub, H. (1990) Science 250, 1104-1110.21. Gogos, J. A., Hsu, T., Bolton, J. & Kafatos, F. C. (1992) Science

257, 1951-1955.22. Ladias, A. A. J., Hadzopoulou-Cladaras, M., Kardassis, D., Car-

dot, P., Cheng, J., Zannis, V. I. & Cladaras, C. (1992)J. Biol. Chem.267, 15849-15860.

23. Hallenbeck, P. L., Marks, M. S., Lippoldt, R. E., Ozato, K. &Nikodem, V. M. (1992) Proc. Natl. Acad. Sci. USA 89, 5572-5576.

24. Gogos, J. A., Tzertzinis, G. & Kafatos, F. C. (1991) Nucleic AcidsRes. 19, 1449-1453.

25. Truss, M., Chalepakis, G. & Beato, M. (1990) Proc. Natl. Acad. Sci.USA 87, 7180-7184.

26. Naar, A. M., Boutin, J.-M., Lipkin, S. M., Yu, V. C., Holloway,J. M., Glass, C. K. & Rosenfeld, M. G. (1991) Cell 65, 1267-1279.

27. Umesono, K., Murakami, K. K., Thompson, C. C. & Evans, R. M.(1991) Cell 65, 1255-1266.

28. Leid, M., Kastner, P., Lyons, R., Nakshatri, H., Saunders, M.,Zacharewski, T., Chen, J.-Y., Staub, A., Garnier, J.-M., Mader, S.& Chambon, P. (1992) Cell 68, 377-395.

29. Laudet, V., Hanni, C., Coll, J., Catzeflis, F. & St6helin, D. (1992)EMBO J. 11, 1003-1013.

30. Zhang, X.-K., Hoffmann, B., Tran, P. B.-V., Graupner, G. & Pfahl,M. (1992) Nature (London) 355, 441-446.

31. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J. & Evans, R. M.(1992) Nature (London) 355, 446-449.

32. Wilson, T. E., Paulsen, R. E., Padgett, K. A. & Milbrandt, J. (1992)Science 256, 107-110.

33. Yao, T.-P., Segraves, W. A., Oro, A. E., McKeown, M. & Evans,R. M. (1992) Cell 71, 63-72.

Biochemistry: Khoury Christianson et aL