dr. jeff baxter - lab testing standardization

1Proprietary & Confidential

Trich Laboratory Testing StandardizationTrichomonas foetus DNA testing

Proper & Confidential


ObjectivesTo build confidence in Trich testingTo increase consistency in test resultsTo minimize sample quality influence variablesTo minimize laboratory testing variablesTo reduce the burden and cost to man and beast

Trich Laboratory Testing Standardization



OpportunitiesVeterinarian sample collectionVeterinarian sample handling & shipment recommended by

LaboratoryLaboratory sample preparation methodLaboratory extract volume usedLaboratory Taq enzyme type usedLaboratory analysis threshold levelLaboratory use of IPC (Internal Positive Control)Laboratory use of USDA licensed kits Laboratory pooling of samples



4Proprietary & ConfidentialThe world leader in serving scienceProprietary & Confidential

Pooling of cultured samples and comparison of multistate laboratory workflows with the MagMAX sample preparation system and VetMAX quantitative polymerase chain reaction reagents for detection of Tritrichomonas foetus–colonized bullsLee EffingerLalitha PeddireddiMarilyn SimunichRichard OberstCatherine O’ConnellIvan Leyva-Baca

Oregon Department of Agriculture, Animal Health and Identification Division, Animal Health Laboratory, Salem, OR (Effinger) Department of Diagnostic Medicine/Pathobiology (Peddireddi), Kansas State University, Manhattan, KS Kansas State Veterinary Diagnostic Laboratory (Oberst), Kansas State University, Manhattan, KS Animal Health Laboratory, Idaho State Department of Agriculture, Boise, ID (Simunich) Animal Health and Food Safety Group at Life Technologies, Austin, TX (Leyva-Baca, O’Connell)

JVDI, 2014, Vol. 26(1) 72-87


http://vdi.sagepub.com/search?author1=Lee+Effinger&sortspec=date&submit=Submit

http://vdi.sagepub.com/search?author1=Lalitha+Peddireddi&sortspec=date&submit=Submit

http://vdi.sagepub.com/search?author1=Marilyn+Simunich&sortspec=date&submit=Submit

http://vdi.sagepub.com/search?author1=Richard+Oberst&sortspec=date&submit=Submit

http://vdi.sagepub.com/search?author1=Catherine+O%E2%80%99Connell&sortspec=date&submit=Submit

http://vdi.sagepub.com/search?author1=Ivan+Leyva-Baca&sortspec=date&submit=Submit


Study Background

2010 AAVLD parasitology committee

• Proposed a study to determine whether T. foetus samples can be pooled in order to reduce the costs for testing

• Lee Effinger from Oregon State Department of Agriculture led Experimental Design for the project

• Marilyn Simunich Idaho State Department of Agriculture served as Study Coordinator & Data Keeper

• The Life Technologies Animal Health & Food Safety Group agreed to support the study



Study Objectives

1. Determine the effect of pooling a single positive sample having various CT ranges with four negative samples (1:5). If a negative effect was seen, a 1:3 pooling study would then be conducted

2. Compare different sample preparation systems and various real-time PCR (feeder lab workflows) with the 5X MagMAXTM-pathogen RNA/DNA purification kit and amplification with VetMAXTM T. foetus reagents (Life Technologies workflow)

3. Assess the specificity of the VetMAXTM T. foetus reagents by sequencing all positive samples with CT values less than 38 and suspect sample CT values between 38 and less than 40 cycles



Materials and Methods

• Sample collection (Cultured Smegma Samples)• 5 Feeder labs provided 803 samples

• 1 on the West Coast

• 1 in the Southwest

• 1 in the Central States

• 2 in the South

• Each feeder lab ran their own protocol including sample preparation system and real-time PCR

1 Central Study lab (KSVDL) Sample preparation with MagMAXTM Real-time PCR with VetMAXTM T. foetus reagents



Cultured smegma samples provided by feeder labs

Sample Matrix

Source

# of positive

samples *

# of negative samples*

# of inconclusive samples *

Total samples

submitted

Cultured smegma samples

(A) 73 301 0 374

(B) 28 72 0 100

(C) 9 52 2 63

(D) 17 33 0 50

(F) 34 182 0 216

Total 161 640 2 803

* As reported by the feeder labs



Real Time PCR Parameters for Feeder Laboratories

Lab A Lab BLab C Herds

1-2Lab C Herds

3-6Lab D Lab F Study Lab

Final reaction volume(µL) 20 20 25 25 25 25 25

Vol. of T. foetus primer/probe per reaction (µL)

1 1 1 1 10.88/1.13-

F&R1

Volume of extract per reaction(µL) 4 4 8 8 5 5 8

Volume Master Mix (µL) 15 15 12.5 12.5 19 18.75 12.5

Primer/probe design McMillen McMillen Vet-Max Vet-Max Vet-MaxModified McMillen

Vet-Max

Taq usedUniversal

qPCRUniversal

qPCRqPCR MM qPCR MM

TaqMan Univ.MM

Absolute qPCR low rox

mixqPCR MM

Thermocycler AB 7500 AB 7500 Cepheid SC AB7500 AB7500 AB7500 AB7500Thermocycler mode Standard Standard Fast Standard StandardStage 1 temperature(°C) 95 95 95 95 50/95 95 95Stage 1 time (sec) 10 10 600 10 120/120 15 600Stage2 denaturation (°C) 95 95 95 97 95 95 95

Stage 2 denaturation time (sec) 15 15 15 2 20 15 15

Stage 2 annealing temp (°C) 55 55 55 55 60 60 55

Stage 2 annealing time (sec) 45 45 45 40 45 60 45

# cycles 40 40 40 40 40 45 40

Analysis threshold Fixed 2.0 Fixed 2.0

Control based threshold-10%

max TF/5% max Xeno

Control based threshold-10%

max TF/5% max Xeno

Fixed 0.2Control based threshold-

10% max TF/Xeno

Analysis baseline setting 3-15 3-15 autoPositive (Ct) <35 <35 <36 <36 <38 <37 <38

Suspect/Inconclusive(CT) 35-40 35-40 36-40 36-40 38-39 >37 38-40/Xeno 28.5-31.5

Negative(CT) >40 >40 >40 >40 >40 undetected Undetected/Xeno 28.5-31.5

Internal extraction control No No Yes <36 CT Yes <36 CT No Yes Yes CT = 28.5-31.5



Results: Individual Sample Testing

Study Lab Result / Feeder Lab Result

Sample Matrix

Lab Sourc

e

Sample preparati

on system

Pos/Pos

Pos/Neg

Pos/Inc

PresPos/Neg

Neg/Pos

Neg/Inc

Neg/Neg TotalPercent

agreement

Cultured smegma samples

A Boiling 71 5 0 1 2 0 295 374 97.9

B Boiling 21 10 0 0 7 0 62 100 83.0

C MagMax 9 2 2 0 0 0 50 63 96.7

D Boiling 17 4 0 1 0 0 28 50 90.0

F Qiagen 34 0 0 1 0 0 181 21 6 99.5

Results All labs Multiple 152 21 2 3 9 0 616 803 95.6

Order of the call = KSVDL Study Lab / Feeder LaboratoryPos = positive, Neg = negative, Inc = inconclusive, PresPos= presumptive positive

Study Lab Results vs. Feeder Lab Results



Conclusions Individual Testing

• 803 smegma samples were provided by feeder labs (FL)

• All the samples were tested by study laboratory with Life Technologies workflow systems:

• MagMAXTM

• VetMAXTM T. foetus reagents

• Agreement of 95.6% was reached with 768/803 samples between feeder labs and study lab

• Interestingly, Lab F reached almost 100% agreement using a different sample prep system and a modified McMillen’s assay

• Study laboratory (KSVDL) with LT protocol identified 24 more positives than the feeder laboratories. On retesting, one of the feeder labs missed 9 samples reported as positives.



Pooling Study

Laboratory ID

Positive Samples Available

Negative Samples Available

Negatives Needed

Deficit /Surplus of Negative Samples

A 77 297 308 -11

B 31 69 124 -55

C 13 50 52 -2

D 21 28 84 -56

F 34 181 136 +45

Total 176 625 704

Positives, presumptive positive and negative samples used from each lab for pooling



Pooling results

Sample ID*

Individual test CT

Pooled1:5 Test CT

Pooled1:3 Test CT

Study lab final call

Pooled 1:5 call

Pooled 1:3 call

1 C-6-11 35.05 Undetected Undetected Positive Negative Negative

2 A-40-5 35.20 37.83 37.86 Positive Positive Positive

3 A-39-2 35.41 35.93 34.82 Positive Positive Positive

4 F-1-7 35.43 35.43 35.53 Positive Positive Positive


6 C-1-23 35.93 35.75 35.82 Positive Positive Positive

7 B-8-4 36.02 34.91 35.59 Positive Positive Positive


10 A-27-9 36.36 Undetected Undetected Positive Negative Negative

9 B-4-1 36.45 Undetected Undetected Positive Negative Negative

11 C-6-10 37.20 Undetected 37.69 Positive Negative Positive

12 A-41-2 37.89 36.92 Not tested Positive Positive Not tested

13 C-4-5** 38.77 (ave of 4) Undetected Undetected Positive WFA* Negative Negative

14 C-6-15** 39.09 (ave of 3) Undetected Undetected Positive WFA Negative Negative

15 A-24-10** 39.12 (ave of 2) Undetected UndetectedSuspect Positive

WFANegative Negative

Effect of pooling for T. foetus samples with CT>35 after individual testing

*WFA: Suspect workflow A; ** samples confirmed T. foetus by sequencing



Pooling results

1:5 Pools• 1:5 pooling of positive samples with a CT of 35 and below were all

detected• Only 3 of 9 positive samples with CTs between 36-39.9 were detected

in 1:5 pools• Pooling at 1:5 missed 4% (7/176) of T. foetus positive samples

1:3 Pools• Only 8 of 15 positive samples with CTs between 36-39.9 were

detected in the 1:3 pools• 1:3 pooling missed 3.5% (6/176) of T. foetus positive samples



Sequencing primer design for nested PCR

(R-TFSM-primer)

(O-F-TFSM-Primer) (M13-I-F-TFSM-Primer)

(M-13-R-TFSM-primer)

TTAGCTTTCTTT GCGA T. foetus

TTAGCTAACAAT GCGA S. moskowitzi

Primers for Nested PCR Abbreviation Primer Sequence

Forward outer forward primer

(O-F-TFSM-Primer) CCTTAGGCAATGGATGTCTTGGC

Reverse primer (R-TFSM-primer) GCGCAATGTGCATTCAAAG

M13 Forward Inner primer(M13-I-F-TFSM-Primer)

TGTAAAACGACGGCCAGTCTTACACGATGAAGAACGTTGC

M13 Reverse primer(M-13-R-TFSM-primer)

CAGGAAACAGCTATGACCGCGCAATGTGCATTCAAAG

GenBank: GQ254636.1 Simplicimonas moskowitziGenBank: AY349189.1 Tritrichomonas foetus



Sequencing results for 175 T. foetus positives

175/176 T. foetus positive samples, including three late risers, were confirmed T. foetus by DNA sequencing



Sensitivity, specificity, & predictive values of positive & negative results for all cultured smegma samples

Calculation Formula Result Result

% Sensitivity True Positives

True Positives + False Negatives X 100

175_ 175 + 0 x100

100%

% Specificity True Negatives

True Negatives + False Positives X 100

625___ 625 + 3 x100

99.52%

Predictive value of a

positive test

True Positives

True Positives + False Positives X 100

175__ 175 + 3 x100

98.31%

Predictive value of a

negative test

True Negatives

True Negatives + False Negatives X 100

625__ 625 + 0 x100

100%

* Calculations made after qPCR and sequence confirmation



Sequencing Results

• 175/176 positive samples by qPCR were able to be sequenced

• 1 sample (A-7-25) with a CT 33.95 was not able to be sequenced. • It is possible that there are point mutations in this positive sample in the

sequencing primer regions, which were designed based on a few T. foetus and a single S. moskowitzi sequences from GenBank

• Most importantly, none of the samples reported S. moskowitzi DNA sequences



Overall Study Results

• 95.6 % agreement was reached between Study Lab (KSVDL) using Life technologies MagMAXTM and VetMAXTM T. foetus reagents and the feeder laboratories

• 1:5 Pooling it is likely to miss 4% of the positives• 1:3 Pooling it is likely to miss 3.5% of the positives

• DNA sequencing• 175/176 positive samples were confirmed to be T. foetus, the 176th

sample could not be sequenced with the primers designed for this study



Acknowledgements

Lalitha Peddireddi, KSVDL – performed the study at KSVDLLee Effinger, ODA-Animal Health LaboratoryMarilyn Simunich, Idaho State Dept. of AgricultureCate O’Connell, Life TechnologiesMangkey Bounpheng, Texas Veterinary Medical Diagnostic LaboratoryDawn Bueschel, NMDA Veterinary Diagnostic ServicesMuthu Chengappa, Kansas State Veterinary Diagnostic LaboratoryAlfonso Clavijo, Texas Veterinary Medical Diagnostic LaboratoryKris A. Clothier, California Animal Health & Food Safety Lab SystemHemant K. Naikare, Texas Veterinary Medical Diagnostics LaboratoryJeff Zinza, Life TechnologiesMary Anne Williams, Life Technologies



ObjectivesTo build confidence in Trich testingTo increase consistency in test resultsTo minimize sample quality influence variablesTo minimize laboratory testing variablesTo reduce the burden and cost to man and beast




Trich Laboratory Testing StandardizationTrichomonas foetus DNA testing


dr. jeff baxter - lab testing standardization

Science

study proper confidential

foetus samples

positive samples

cycles proper confidential

laboratory testing variables

negative samples

total samples

ks animal health laboratory