dr. sunita grover

8/13/2019 Dr. Sunita Grover

1/34

Efficacy of Indian Probiotic Culturesfficacy of Indian Probiotic CulturesSunita Grover, Ph.DMolecular Biology Unit

Dairy Microbiology Divisionairy Microbiology DivisionNational Dairy Research Institute


2/34

Outline of presentationutline of presentation Probiotics entr in India

Status of probiotics at global level Need for Indigenous probiotics

o e o po en a omar ers or screen ngand selection of potential strains

Initiative for Develo in Indi enousProbiotics of Indian origin at NDRI, Karnal(DBT)

Perspective Conclusion

20.2.2009 2ILSI-India


3/34

Probiotics the New Nutraceutical Starsd knter in Indian Market An old concept, with a new attitude

global market

- Dairy based probiotic foods / drinks (>

50%)

Probiotics gaining a foothold in India



4/34

Status of probiotic cultures at Global leveltatus of probiotic cultures at Global level L. rhamnosus GG (Valio)

L. caseiShirota (Yakult)

L. plantarum 299v (Probi AB) L. johnsoniiLa7 (Nestle)

.

L. acidophilus NCFM (Nestle)

L. caseistrain DN-114001 (Danisco) .

L. rhamnosus 271 (Probi AB)

L. casei (Chr Hansen)

L. acido hilus La1

VSL#3 (4 Lactobacillus spp.; 4 Bifidobacterium spp. and onestreptococcus) (CD Pharma)



5/34

Efficacy / Prospects of probiotic strainsfficacy / Prospects of probiotic strains Widely studied strains world wide

c en ca y proven pro o cs

Clinical trials conducted for their efficacy However, results are debatable

Several factors are known to

influence this benefit

Timing of probiotic delivery

Prophylactic, empiric or therapeutic

Specific strain of bacteria

Various secreted components can modulate activityQuantity of bacteria

Method of administration



6/34

Major Issues for use in Indian populationf p p Data in Indian population lacking ?

Poor adhesion /colonization and shorttransit period in the Indian gut due toeren gu eco ogy an oo a s

Conditioning effect critical for

Non-availability of established / Novel

functions to demonstrate their efficacy



7/34

Why Need for Indigenous probiotics ?y N f g p Better colonization / adhesion potential

onger rans me

Health promoting functions of probiotics highlystrain and host s ecific

High incidences of diarrhoeal diseases and other

gastric disorders in Infants and immuno-

Probiotics as potential Immuno-modulators Healthy guts

n an pro o c s ra ns m g e e er su e oIndian gut due to longer transit time, colonization /biofilm formations and conditioning effect



8/34

Initiative for Developing Indigenous Probioticsf di i i N l T)f Indian origin at NDRI, Karnal DBT) More than one hundred cultures of indigenous

Lactobacilli of human origin isolated and studied fore r pro o c a r u es an co on za on po en a s

Tested for a battery of in vitro tests for culture shorts ng

Selection of promising cultures based on strong

colonization and in vitro probiotic attributes



9/34

Selection of promising cultures based on in vitroprobiotic attributesrobiotic attributes

H 1.5 pH 2.0

Bile 1.5% Bile 2.0%



10/34

PepsinLysozyme

2

4

6

8

10

cellcount(log

cfu/ml)

0

0h 8.585 8.301 8.9201 8.7447 8.5965 8.672 8.2218

1h 8.0412 8.4471 8.7626 8.231 8.2304 7.4471 8.284

Lp

5276Lp9 Lp72 Lp75 Lp77 Lp91 Ldch4

Cell surface hydrophobicity Anti-oxidant



11/34

Adhesion of Lactobacilli 109 cfu/ml for 2 hrs) to humanadenocarcinomal cell linesdenocarcinomal cell lines

Caco2 cell line:

HT-29 cell line:

L. plantarum(Lp91)L. plantarum(Lp5276)L. plantarum(LpVS)

L. plantarum(Lp91)

L. plantarum(LpVS)

L. plantarum(Lp5276)



12/34

Role of Biomarkers for selection of probioticsole of Biomarkers for selection of probiotics Selection of a proven probiotic strain extremely

crucial for application in clinical trials and product

Potential biomarkers need to be developed forscreenin and selection of robiotic strains


13/34

Expression of bacterial and host genes during transition inGIT of human that can be used as potential biomarkers forfunctionalityMUC 2

functionality

Probiotics atp operonroEL

-

IL-10

IL-4 bsh gene

groES

dnaK

hsp70Surface proteins of bacteria

Ma A

IL-6

Cox1

-

sp

urvA

dps

Msr

Mub

CnBp

Fbp

TNF-

-

Human epithelial cells

Small intestine

-

dlt operon

eps operon

IL-1

IL-2

IL-8

Digestive system

Cox2



14/34

Quantification of BSH activity by modified ninhydrin assay6

ivity

l) P


15/34

Anti-Hypercholesterolemic effect of Lp-91

Duration of treatment:- 21 days

Lp91 Lp21

TC 17.2 9.1

)

Total Cholesterol Triglyceride HDL LDL

. .

LDL 35.5 13.5HDL 47.8 14.4

80

100

120

le(m

g/dL

Diet without Lp-91P


16/34


17/34



18/34

Cell surface proteins as probiotic markersf lor colonization Mucus Binding Protein (MBP)

Collagen Binding Protein (CBP)

-

LTA



19/34

M 1 2 3 4 5 6 7 8 9 10M 1 2 3 4 5 6 7 8 9 10M 1 2 3 4 5 6M 1 2 3 4 5 6

250 bp

405 bp200bp

100bp250 bp

405 bp200bp

100bpFig. Multiplex PCR with primer pairsLBLMA1 /R-

161 and MubD1_F87/ MubD1_R0.5

p250 bp200bp

400bp

Fig. Multiplex PCR with primer pairsLBLMA1 /R-

161 and MubD1_F87/ MubD1_R0.5

p250 bp200bp

400bp

Fig. Multiplex PCR forL. plantarum with primer pairs LBLMA1

/R-161 and MubD1_F87/ MubD1_R0.5Lanes: M-100 bp DNA ladder; 1-Lp10; 2-Lp20; 3-Lp75; 4-Lp76;

5-Lp77; 6-Lp5276; 7-Lps2; 8-Lp44; 9-Lp45; 10-Lp68

Fig. Multiplex PCR forL. plantarum with primer pairs LBLMA1

/R-161 and MubD1_F87/ MubD1_R0.5Lanes: M-100 bp DNA ladder; 1-Lp10; 2-Lp20; 3-Lp75; 4-Lp76;

5-Lp77; 6-Lp5276; 7-Lps2; 8-Lp44; 9-Lp45; 10-Lp68

Lanes: M-100 bp marker;

1-2- Genus specific PCR product of Lp9,Lp91

3-4- Mub specific PCR product with primer

MubD1_F87/ MubD1_R0.5 of Lp9,Lp91

5-6-Multiplex PCR with both primer for Lp9,Lp91 .

Lanes: M-100 bp marker;

1-2- Genus specific PCR product of Lp9,Lp91

3-4- Mub specific PCR product with primer

MubD1_F87/ MubD1_R0.5 of Lp9,Lp91

5-6-Multiplex PCR with both primer for Lp9,Lp91 .

M 1 2 3 4 5 6 7M 1 2 3 4 5 6 7PCR Assays405 bp

250 bp200bp

400bp 405 bp250 bp200bp

400bp

PCR Assays

Fig. Multiplex PCR forL. casei , L. acidophilus and

Bifidoacterium bifidum with primer pairs LBLMA1 /R-161 and

MubD1_F87/ MubD1_R0.5

- - - -

Fig. Multiplex PCR forL. casei , L. acidophilus and

Bifidoacterium bifidum with primer pairs LBLMA1 /R-161 and

MubD1_F87/ MubD1_R0.5

- - - -- - . - . - .

J13; 4-L. casei 17; 5-L. casei S3; 6- LA1 (standard); 7- BB12

(Bifidobacerium bifidum)

- - . - . - .

J13; 4-L. casei 17; 5-L. casei S3; 6- LA1 (standard); 7- BB12

(Bifidobacerium bifidum)



20/34

M 1 2 3 4 5 6 7M 1 2 3 4 5 6 7

1.6 kb

M 1 2 3 4 5 6 7

1.6 kb500bp

1.5kb

M 1 2 3 4 5 6 7

1.6 kb500bp

1.5kb

1kb1kb

Fig. Multiplex PCR for Lp9 with primer pairs LBLMA1/R-161

and MubN_F0.93/ MubN_R165

Fig. Multiplex PCR for Lp9 with primer pairs LBLMA1/R-161

and MubN_F0.93/ MubN_R165

F g. Mub P R w th pr mer pa r mubN_F .

MubN_R1.65

Lanes: M-250 bp DNA ladder; 1-L. brevis (standard);

2-Lp9; 3-Lp91; 4-Lp72; 5-Lp-77; 6-Lp10; 7-Lp20

F g. Mub P R w th pr mer pa r mubN_F .

MubN_R1.65

Lanes: M-250 bp DNA ladder; 1-L. brevis (standard);

2-Lp9; 3-Lp91; 4-Lp72; 5-Lp-77; 6-Lp10; 7-Lp20

Lanes: M- Supermix DNA ladder;

1-2-(1:0.5 ratio of Genus and Mub primers);

3-4- (1:1 ratio of Genus and Mub primers);5-6- (0.5:1 ratio of Genus and Mub primers);

7- 1kb DNA ladder (Chromous)

Lanes: M- Supermix DNA ladder;

1-2-(1:0.5 ratio of Genus and Mub primers);

3-4- (1:1 ratio of Genus and Mub primers);5-6- (0.5:1 ratio of Genus and Mub primers);

7- 1kb DNA ladder (Chromous)

M1 1 2 3 4 5 6 7 8 9 10 11 12 13 M2

1.6 kb

M1 1 2 3 4 5 6 7 8 9 10 11 12 13 M2

1.6 kbPCR Assays 250 bp

100bp

500bp

.

250 bp100bp

500bp

.

Fig. Multiplex PCR forL. plantarum isolates with primer pairs LBLMA1/ R-

161 and MubN_F0.93/ MubN_R165

Lanes: M1-500 bp DNA ladder; 1-L. brevis (standard); 2-Lp5276 (standard); 3-

Lp9; 4-Lp10; 5-Lp20; 6-Lp21; 7-Lp72; 8-Lp75; 9-Lp76; 10-Lp77; 11-Lp90; 12-

Fig. Multiplex PCR forL. plantarum isolates with primer pairs LBLMA1/ R-

161 and MubN_F0.93/ MubN_R165

Lanes: M1-500 bp DNA ladder; 1-L. brevis (standard); 2-Lp5276 (standard); 3-

Lp9; 4-Lp10; 5-Lp20; 6-Lp21; 7-Lp72; 8-Lp75; 9-Lp76; 10-Lp77; 11-Lp90; 12-

- - - -- - - -



21/34

Potential Biomarkers for Selection of Probiotics againstifi dipecific diseases

Probiotics Highly strain and host specific

(Specific health promoting functions)

Inflammatory diseases, IBD, Crohns disease, Ulcerative

colitis consti ation etc.

Gastro-intestinal disease

Cancers colon, bladder etc. ,

Allergies rhinitis

Respiratory tract diseases pneumonia etc.

Liver diseases Hypertension, obesity etc.



22/34

Development of DM2 and CVD throughid i i fl dxidative-inflammatory cascade

20.2.2009 ILSI-India 32


23/34

Evaluation of the evidence - Preclinicalditudies

Too simplistic to mimic human systems Im ortant to screen strain characteristics

Important to understand mechanisms

vivo)

Cannot be used for roof of efficac

Excellent for safety



24/34

Evaluation of the evidence - linical tudiesvaluation of the evidence Human target population RDBPCT :

cornerstone of efficacy in humanstudies

Phase I, II and III

Critical Data analysis

Post market surveillance studies



25/34

Identification of probiotics a pre-requisite

Identification at strain level very important False claims / labeling spurious products

Molecular based identification more reliable at

genus, species and strain level

House keeping genes (rpo, tuf etc.)

Lb. casei (13), Lb. paracasei (4), Lb.fermentum (25), Lb.

plantarum (26), Lb. delbrueckii (2), Lb.rhamnosus(2),Lb.reuteri(4) and Lb. acidophilus (2)



26/34

Nucleotide sequence of unique RAPD band ofLb casei with primer OPBB-02 >OPBB-02

CACTGGCTGGGAAGGCACCGAGTTGTATGTTCAGCTAGTTCCGGAAGGCAAATTTGAAGGTGACACGTTAAATCCGTATTTTCTGATCA

GACATTCTCGCTGAAGATTGGCAACTTGTTGACGCATGATAGCAT

TCGATTTTAGCGGCAAAACGGTTGTTGTGACTGGTGCGGCATCG

GGAATCGGCGCGGCTCAGGCAGCGGCGTTTACAGCAGCTGGTGCACGGGTTATTGGCGTCGATCTTCAGCCGATGACTGGGCTAGCC

GTCACCATTCAGGCAGATGTCAGTAAGGCCGCGACAGCAGAAA

ACATCGTTCGTGACTATGCGCCCGACATTGTCTGCAACACGGCG

AACCTGGCAGCACATTCTTGATGTTGATCTCACCAGCCAGT

>probe1

- -



27/34

Probiotics : Few Questions which remainl dnresolved

Selection of probiotic culture what should be the criteria todefine the most ideal probiotic strain for a specific disease

Monostrain vs multistrain ? Will cell free extracts work ? Quantity and quality of probiotic needed for desired effect ? Which Probiotics remain viable in GI tract ? How long do they remain in the gut to be effective? The best target site in pathogenesis of a particular disease for

Cell lines / cell culture and Animal models Lack of correlation (In vitroversus in vivoassays) e.g. in vitro

evaluation of adhesion using cell lines do not account for complex

Probiotic safety ? Clinical trials on human subjects for validating health benefits



28/34

Points to ponderoints to ponder Probiotic definition or selection criteria should include:

y o genera e an mmune response

In vitro assays to show that probiotics activate immune cells Does in vitro screening based on acid and bile predict in vivo

survival ca acit other stresses like oxidative nutrientlimitation, antimicrobial components etc. might influence?)

Selection of probiotics on the basis of Adhesion potential using

in vitro assays is being debated ? Can not be extrapolated to GIT

Host defense systems

Competition for nutrients and space with commensals

Mucosal shedding

Peristaltic flow that continuously washes GIT Hence, extrapolation of these findings to clinical applicationsrequires caution

20.2.2009 ILSI-india 36


29/34

Current problems with probiotics in Indiaurrent problems with probiotics in India Extravagant claims without research

S ecific s ecies and strain effects

Lack of good manufacturing practices Quality assurance Label vs content

Viability of bacterial species

Validated biomarkers for assessing function and

activit Identification needs to be done using molecular

tools

16S rRNA

FISH No specific guidelines currently



30/34

Desired Interventions from Indianierspective

A comprehensive database on Indian probiotic cultures, their diversity,

disease mitigation need to be generated as a National priority

Indian gut a rich habitat of diversified microbiota (gut ecology - food

by metagenomic approaches

High probability of biodiversity amongst probiotic strains from

Initiatives for mining the complete genome of promising Indian strainsand the functional genes associated with novel physiological function

Search for Novel probiotic strains (Lactobacilli and Bifidobacteria)with specific physiological functions in the gut using comparativegenomics, Transcriptomics, Proteomics approaches etc.



31/34

Contdontd Identification of potential Biomarkers for evaluating functionality of

probiotics because greatest challenge concerns functionality ofrobiotics to stren then health claims robiotics confer on host

health

Development of consortia of proven strains for ethnic dairy based

Biosafety evaluation of selected probiotics and appropriate

validation of health claims through clinical trials in target human

Efforts should be made to conduct clinical trials in Indian populationfor comprehensive evaluation of the efficacy of the Indian probiotic

established western cultures to prove their efficacy



32/34

Time for a paradigm shiftime for a paradigm shift

substrate which enhances a specific

ene c a ac er a ns ea o ry ng

to eliminate the pathogen ?



33/34

Conclusiononclusion Thy Food Shall Be Thy Remedy

Disease can be: Prevented

Mitigated

Treated Appropriate Choice of :

Clinical proven probiotics

We need to continue rigorous evaluation ofassumptions and hypothesis to discover

nove pro o cs



34/34

Acknowledgementcknowledgement ILSI - India

Department of Biotechnology, Govt. of India,

Director, NDRI

Dr. V. K. Batish, Prof. and Head, DM Division

Raj Kumar, Ph.D student a es umar, . s u en

Ashok, SRF

,


dr. sunita grover

Documents