e. coli 0157:h7: a new emerging disease n 1982: first recognized as pathogen n 1983: linked to...
TRANSCRIPT
![Page 1: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/1.jpg)
![Page 2: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/2.jpg)
E. coliE. coli 0157:H7: A New Emerging 0157:H7: A New Emerging DiseaseDisease
1982: First recognized as pathogen1982: First recognized as pathogen 1983: Linked to hemolytic uremic 1983: Linked to hemolytic uremic
syndromesyndrome 1990: Outbreak from drinking water1990: Outbreak from drinking water 1991: Outbreak from apple cider1991: Outbreak from apple cider 1993: Large outbreak from hamburgers1993: Large outbreak from hamburgers
![Page 3: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/3.jpg)
E. coli E. coli 0157:H7: Clinical 0157:H7: Clinical ManifestationsManifestations
ConditionCondition
Asymptomatic carriageAsymptomatic carriage
Nonbloody diarrheaNonbloody diarrhea
Hemorrhagic colitisHemorrhagic colitis
Hemolytic-uremic syndromeHemolytic-uremic syndrome
Complications of enteric infectionComplications of enteric infection
FrequencyFrequency
UnknownUnknown
10%10%
90%90%
10% <10 years10% <10 years
<5%<5%
Clin Infect Dis 1995;20:1
![Page 4: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/4.jpg)
Barium-enema Barium-enema showing showing
“thumbprinting” in “thumbprinting” in colon of child with colon of child with E. E.
colicoli O157:H7 O157:H7 hemorrhagic colitis, hemorrhagic colitis, due to edema and due to edema and
submucosal submucosal hemorrhagehemorrhage
N Engl J Med 1995;333:364
![Page 5: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/5.jpg)
Colonic biopsy from patient with Colonic biopsy from patient with E. E. colicoli O157:H7 infection O157:H7 infection
N Engl J Med 1995;333:364
Biopsy showing ischemic injury with superficial coagulative necrosis, mucosal hemorrhage, and an overlying inflammatory pseudomembrane
![Page 6: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/6.jpg)
Hemolytic Uremic SyndromeHemolytic Uremic Syndrome
Days to 2 weeks after gastroenteritisDays to 2 weeks after gastroenteritis Pallor, bruising, lethargyPallor, bruising, lethargy Anemia (Hgb=5-7 mg/dl), thrombocytopeniaAnemia (Hgb=5-7 mg/dl), thrombocytopenia Hematuria, acute renal failureHematuria, acute renal failure Death: 3%-5%Death: 3%-5% E. coli E. coli O157:H7 isolated from 96% of patients when O157:H7 isolated from 96% of patients when
culture performed within 6 days of onsetculture performed within 6 days of onset
![Page 7: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/7.jpg)
Pathogenesis of Pathogenesis of E. coli E. coli O157:H7 infectionO157:H7 infection
![Page 8: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/8.jpg)
Incidence of Incidence of E. coli E. coli O157:H7 infection,O157:H7 infection,United StatesUnited States
0
1
2
3
4
5C
ases
per
100
,000
<1 1-4 5-14 15-24 25-39 40-64 65+
Age (years)Source: CDCSource: CDC
![Page 9: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/9.jpg)
Outbreaks of Outbreaks of E. coli E. coli 0157:H70157:H7reported to CDC, 1982-1994reported to CDC, 1982-1994
VehicleVehicle
Ground beefGround beef
All beef + milkAll beef + milk
Water (drinking/swimming)Water (drinking/swimming)
Person-to-personPerson-to-person
UnknownUnknown
All outbreaksAll outbreaks
No. outbreaksNo. outbreaks
2222
2626
33
99
1919
6969
No. personsNo. persons
1,1371,137
1,2781,278
276276
243243
274274
2,3342,334Epidemiol Rev 1996;18:29
![Page 10: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/10.jpg)
Outbreaks of Outbreaks of E. coli E. coli 0157:H70157:H7reported to CDC, 1982-1994reported to CDC, 1982-1994
Epidemiol Rev 1996;18:29
0
5
10
15
20
25
30
1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994
![Page 11: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/11.jpg)
E. coli E. coli 0157:H7: Vehicles of 0157:H7: Vehicles of infectioninfection
Undercooked hamburgersUndercooked hamburgers Bovine manureBovine manure Contaminated water (e.g., lakes, water slides)Contaminated water (e.g., lakes, water slides) Alfalfa sproutsAlfalfa sprouts MayonaiseMayonaise Unpasteurized apple ciderUnpasteurized apple cider Unpasteurized milkUnpasteurized milk
![Page 12: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/12.jpg)
Epidemiol Rev 1996;18:29
E. coliE. coli 0157:H7 in food 0157:H7 in food
Present in any food w/bovine fecal contaminationPresent in any food w/bovine fecal contamination
Infectious dose: probably <5 organismsInfectious dose: probably <5 organisms
Present in 1%-2% of ground beef, pork, poultry, Present in 1%-2% of ground beef, pork, poultry,
lamb retail meat samples in Madison, WIlamb retail meat samples in Madison, WI
PresentPresent in about 10% of raw milk samples in about 10% of raw milk samples
![Page 13: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/13.jpg)
Geographic distribution of Geographic distribution of E. coli E. coli O157:H7O157:H7: : Total Number of Reported Cases, 1996Total Number of Reported Cases, 1996
![Page 14: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/14.jpg)
Cases of foodborne illness,Cases of foodborne illness,selected pathogens, 1995selected pathogens, 1995
PathogenPathogen
SalmonellaSalmonella
CampylobacterCampylobacter
E. coli E. coli O157:H7O157:H7
Clostridium perfringensClostridium perfringens
Listeria monocytogenesListeria monocytogenes
Staphylococcus aureusStaphylococcus aureus
CasesCases
696,000-3,840,000696,000-3,840,000
1,100,000-7,000,0001,100,000-7,000,000
8,000-16,0008,000-16,000
10,00010,000
928-1,767928-1,767
1,513,0001,513,000
DeathsDeaths
870-1,920870-1,920
110-511110-511
176-433176-433
100100
230-485230-485
454454
![Page 15: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/15.jpg)
Onset of Onset of E. coliE. coli O157:H7 infections and HUS, O157:H7 infections and HUS, Dec. 1, 1992-Feb. 28, 1993, Washington StateDec. 1, 1992-Feb. 28, 1993, Washington State
JAMA 1994;272:1349
Black bars indicate primary cases; shaded bars, secondary cases; and white bars, unclassified cases
631 cases reported (501 cult. confirmed)
Median age 8 45 cases of HUS, 3 died Median incubation 4 days Undercooked burgers at “chain A”,
58/64 restaurants had at least 1 case Burgers cooked 1 minute/side:
routinely associated with internal temp. <68.3 C
Molecular epidemiology: single clone
Click for larger pictureClick for larger picture
![Page 16: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/16.jpg)
E. coli E. coli 0157:H7 at the Washington 0157:H7 at the Washington County Fair, New York, 1999County Fair, New York, 1999
921 persons reported diarrhea921 persons reported diarrhea E. coli E. coli 0157:H7 isolated from 116 persons; 13 0157:H7 isolated from 116 persons; 13
coinfected with coinfected with Campylobacter jejuniCampylobacter jejuni 32 infected with 32 infected with C. jejuni C. jejuni alonealone 65 persons hospitalized, 11 children w/HUS65 persons hospitalized, 11 children w/HUS 2 deaths: 3 yo w/HUS and 79 yo w/HUS/TTP2 deaths: 3 yo w/HUS and 79 yo w/HUS/TTP Source: consumption of water from shallow Source: consumption of water from shallow
unchlorinated wellunchlorinated wellMMWR 1999;48:803
![Page 17: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/17.jpg)
Outbreak of Outbreak of EE.. coli coli O157:H7 Among O157:H7 Among ChildrenChildren A Associated With Farm Visits ssociated With Farm Visits – –
Montgomery County, PA, 2000Montgomery County, PA, 2000 September-November 2000: September-November 2000: Montgomery County Montgomery County
HD identified 51 persons HD identified 51 persons withwith diarrhea diarrhea <<10 days of 10 days of visiting a dairyvisiting a dairy farm (farm A)farm (farm A)
Age range 1-52 years (median: 4 years)Age range 1-52 years (median: 4 years) BBloody diarrhea (37%), fever (45%), vomiting loody diarrhea (37%), fever (45%), vomiting
(45%)(45%) 16 patients were hospitalized and eight developed 16 patients were hospitalized and eight developed
HUSHUSMMWR 2001;50:293MMWR 2001;50:293
![Page 18: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/18.jpg)
Outbreaks of Outbreaks of EE.. coli coli O157:H7 Among O157:H7 Among ChildrenChildren A Associated With Farm Visitsssociated With Farm Visits: :
Molecular EpidemiologyMolecular Epidemiology
IIsolates solates from patients from patients indistinguishable by PFGE indistinguishable by PFGE
All 216 cattle on Farm A cultured by rectal swabAll 216 cattle on Farm A cultured by rectal swab
– 28 (13%) positive for outbreak strain28 (13%) positive for outbreak strain
– Same strain isolated from railing surfaceSame strain isolated from railing surface
MMWR 2001;50:293MMWR 2001;50:293
![Page 19: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/19.jpg)
CDC Investigator Examines aCDC Investigator Examines aCalf at “Farm A”, Pennsylvania, 2000Calf at “Farm A”, Pennsylvania, 2000
MMWR 2001;50:293MMWR 2001;50:293
![Page 20: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/20.jpg)
Outbreaks of Outbreaks of EE.. coli coli O157:H7 Among O157:H7 Among ChildrenChildren A Associated With Farm Visitsssociated With Farm Visits: :
Case-Control Study of Risk FactorsCase-Control Study of Risk FactorsExposureExposure
Contact with cattle Contact with cattle
NailbitingNailbiting
Food from concessionFood from concession
Handwashing before eatingHandwashing before eating
MMWR 2001;50:293MMWR 2001;50:293
Odd ratio (95% CI)Odd ratio (95% CI)
10.9 (1.7-70.7) 10.9 (1.7-70.7)
2.5 (1.1-5.7)2.5 (1.1-5.7)
2.5 (1.1-5.7)2.5 (1.1-5.7)
0.2 (0.1-0.7)0.2 (0.1-0.7)
![Page 21: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/21.jpg)
Routine DNA Fingerprinting by Health Routine DNA Fingerprinting by Health Departments: Departments: E. coliE. coli O157:H7, Minnesota, O157:H7, Minnesota,
19951995
N Engl J Med 1997;337:388
![Page 22: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/22.jpg)
Patterns on Pulsed-Field Gel Electrophoresis Patterns on Pulsed-Field Gel Electrophoresis of of E. coliE. coli O157:H7 in Minnesota O157:H7 in Minnesota
N Engl J Med 1997;337:388
Lanes 1, 6, 10: Lanes 1, 6, 10: E. coli E. coli 0157:H7 standard0157:H7 standard
Lane 5: add. mole. wt. Lane 5: add. mole. wt. standardstandard
Lanes 2, 4, 7, 8: Lanes 2, 4, 7, 8: sporadic casessporadic cases
Lanes 3, 9: isolates Lanes 3, 9: isolates from single clusterfrom single cluster
![Page 23: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/23.jpg)
Routine DNA Fingerprinting by Health Routine DNA Fingerprinting by Health Departments: Departments: E. coliE. coli O157:H7, Minnesota, 1995 O157:H7, Minnesota, 1995
N Engl J Med 1997;337:388 Click for larger picture
![Page 24: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/24.jpg)
N Engl J Med 1997;337:388
Routine DNA Fingerprinting by Health Routine DNA Fingerprinting by Health Departments: Departments: E. coliE. coli O157:H7, Minnesota, 199 O157:H7, Minnesota, 19944
Click for larger picture
![Page 25: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/25.jpg)
Confirmed Confirmed E. coliE. coli O157:H7 outbreaks O157:H7 outbreaksin Minnesota, 1994 and 1995in Minnesota, 1994 and 1995
N Engl J Med 1997;337:388 Click for larger picture
![Page 26: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/26.jpg)
Molecular subtyping of Molecular subtyping of E. coliE. coli 0157:H7 0157:H7 has revolutionized population-based has revolutionized population-based
surveillance for this organism in surveillance for this organism in Minnesota. We now Minnesota. We now routinely subtyperoutinely subtype all all E. coliE. coli 0157:H7 isolates and consider this 0157:H7 isolates and consider this technique to be an technique to be an integral part of disease integral part of disease
prevention and controlprevention and control in our state. in our state.
Minnesota Department of HealthMinnesota Department of HealthN Engl J Med 1997;377:388N Engl J Med 1997;377:388
![Page 27: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/27.jpg)
The Colorado Department of Public Health The Colorado Department of Public Health recently identified an outbreak ofrecently identified an outbreak of E. coli E. coli
0157:H7 infection associated with . . .six lots of 0157:H7 infection associated with . . .six lots of Hudson foods frozen ground beef patties and Hudson foods frozen ground beef patties and burgers. On August 7, 1997, CDPHE’s public burgers. On August 7, 1997, CDPHE’s public health laboratory reported that 15 of 27 health laboratory reported that 15 of 27 E. coli E. coli
isolates submitted for isolates submitted for routine molecular routine molecular subtypingsubtyping since June 1 were characterized by since June 1 were characterized by
highly related PFGE patterns. . .highly related PFGE patterns. . .
CDCCDCMMWR 1997;46:777.MMWR 1997;46:777.
![Page 28: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/28.jpg)
PFGE PFGE patterns patterns of of Salmonella entericaSalmonella enterica sserotype erotype Typhimurium, Typhimurium, by by WeekWeek, M, Minnesotainnesota, , June June - -
S September 1995eptember 1995
N Engl J Med 2001;N Engl J Med 2001;344:189344:189
Click for larger picture
![Page 29: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/29.jpg)
Coordinated by CDCCoordinated by CDC NNational network of ational network of PH PH labs that performs labs that performs PFGEPFGE on on
foodborne foodborne bacteriabacteria– SalmonellaSalmonella serotype Typhimurium serotype Typhimurium– Escherichia coli Escherichia coli 0157:H70157:H7– Others plannedOthers planned
PPermits rapid comparison of ermits rapid comparison of PFGEPFGE patterns through patterns through electronic database at CDC electronic database at CDC
Pennsylvania Department of Health participatesPennsylvania Department of Health participates
www.cdc.gov/ncidod/dbmd/pulsenet/pulsenet.htm
![Page 30: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/30.jpg)
PreventionPrevention Surveillance for Surveillance for E. coli E. coli 0157:H7 and HUS0157:H7 and HUS Modernization of food inspectionModernization of food inspection Education of physiciansEducation of physicians Education of public Education of public
![Page 31: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/31.jpg)
Limitations of Pulsed-Field Gel Limitations of Pulsed-Field Gel ElectrophoresisElectrophoresis
Substantial intra-/inter-laboratory variation Substantial intra-/inter-laboratory variation Interpretation of banding patterns subjectiveInterpretation of banding patterns subjective Requires additional enzymes to prove “matches” Requires additional enzymes to prove “matches” Analyzing across gels difficultAnalyzing across gels difficult PFGE stored as large image files PFGE stored as large image files Requires isolation of the organismRequires isolation of the organism SlowSlow Ongoing, automated computer analysis difficultOngoing, automated computer analysis difficult
![Page 32: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/32.jpg)
Chain Termination DNAChain Termination DNASequencing (Sanger Method)Sequencing (Sanger Method)
A: New DNA synthesized as polymerase moves down template
DNA, away from primer
B: Nucleotides added untildideoxynucleotide incorporated.
C: Labeled primer
D: Labeled deoxynucleotides
E: Labeled dideoxynucleotidesClick for larger picture
![Page 33: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/33.jpg)
Multilocus Sequence Typing Multilocus Sequence Typing (MLST)(MLST)
Sequencing of multiple housekeeping genesSequencing of multiple housekeeping genes State of the art (human genome project)State of the art (human genome project) Objective: no need to compare banding patternsObjective: no need to compare banding patterns Standardization of methodsStandardization of methods Fully reproducibleFully reproducible Storage, transmission, analysis of ASCII filesStorage, transmission, analysis of ASCII files More appropriate for ongoing, automated computer analysisMore appropriate for ongoing, automated computer analysis Do not need to isolate organism in cultureDo not need to isolate organism in culture FastFast
![Page 34: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/34.jpg)
Sequence v. PFGE DataSequence v. PFGE Data
TTCGAATAAGCTTCCCTGAG
AAGCTTATTCGAAGGGACTC
![Page 35: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/35.jpg)
Serratia marcescensSerratia marcescens outbreak in a NICU outbreak in a NICU
Mar-Jul 1995, 23 casesMar-Jul 1995, 23 cases Mostly sepsis, 30% diedMostly sepsis, 30% died 2 simultaneous outbreaks2 simultaneous outbreaks Most strain “A”, 4 “E”Most strain “A”, 4 “E” Contamination between Contamination between
NICU (NICU (**) and 2 other ) and 2 other wards (wards (** ** andand *** ***))
Strain A isolatesStrain A isolates
** ** **** **** ** ****** **** **J Clin Microbiol 1996;34:3138J Clin Microbiol 1996;34:3138
![Page 36: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/36.jpg)
Cluster of Serogroup C Meningococcal Disease Associated With a Party
Case 1. 18-year-old male with headache, fever, nausea, vomiting on May 19, 1999. On May 20, presented with cardiopulmonary arrest and died. Blood cultures grew N. meningitidis.
Case 2. 20-year-old male presented with headache, back pain, and lethargy on May 21. Blood cultures positive for N. meningitidis.
Case 3. 21-year-old male, with headache, neck pain, vomiting, hypotension on May 25, 1999. Blood cultures positive for N. meningitidis
Common exposure: Attendance at a (wild!) party on May 14
S Med J, in pressS Med J, in press
![Page 37: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/37.jpg)
Cluster of Serogroup C Meningococcal Disease Associated With a Party: PFGE
Analaysis (SpeSpeII) 1 2 3 4 5 6 7 8 9 10 Lanes 1, 6, 10: lambda
ladder reference, lanes 2, 3, 4: N. meningitidis isolates from Cases 1, 2, and 3 respectively; lanes 5, 7, 8, 9: Group
C N. meningitidis control isolates from
1999S Med J, in pressS Med J, in press
![Page 38: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f1d5503460f94c33558/html5/thumbnails/38.jpg)
Routine Molecular Epidemiology for Routine Molecular Epidemiology for Enhanced Detection and Control of Enhanced Detection and Control of Foodborne OutbreaksFoodborne Outbreaks: : SummarySummary
Routine molecular subtyping of key pathogens of Routine molecular subtyping of key pathogens of public health importance leads to enhanced public health importance leads to enhanced detection of foodborne outbreaksdetection of foodborne outbreaks
Routine molecular subtyping should be an Routine molecular subtyping should be an integral part of public health surveillanceintegral part of public health surveillance
DNA sequence-based methods may eventually DNA sequence-based methods may eventually replace restriction enzyme-based methodsreplace restriction enzyme-based methods