e. coli 0157:h7: a new emerging disease n 1982: first recognized as pathogen n 1983: linked to...

38

Upload: ross-martin

Post on 04-Jan-2016

215 views

Category:

Documents


1 download

TRANSCRIPT

Page 1: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking
Page 2: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

E. coliE. coli 0157:H7: A New Emerging 0157:H7: A New Emerging DiseaseDisease

1982: First recognized as pathogen1982: First recognized as pathogen 1983: Linked to hemolytic uremic 1983: Linked to hemolytic uremic

syndromesyndrome 1990: Outbreak from drinking water1990: Outbreak from drinking water 1991: Outbreak from apple cider1991: Outbreak from apple cider 1993: Large outbreak from hamburgers1993: Large outbreak from hamburgers

Page 3: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

E. coli E. coli 0157:H7: Clinical 0157:H7: Clinical ManifestationsManifestations

ConditionCondition

Asymptomatic carriageAsymptomatic carriage

Nonbloody diarrheaNonbloody diarrhea

Hemorrhagic colitisHemorrhagic colitis

Hemolytic-uremic syndromeHemolytic-uremic syndrome

Complications of enteric infectionComplications of enteric infection

FrequencyFrequency

UnknownUnknown

10%10%

90%90%

10% <10 years10% <10 years

<5%<5%

Clin Infect Dis 1995;20:1

Page 4: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Barium-enema Barium-enema showing showing

“thumbprinting” in “thumbprinting” in colon of child with colon of child with E. E.

colicoli O157:H7 O157:H7 hemorrhagic colitis, hemorrhagic colitis, due to edema and due to edema and

submucosal submucosal hemorrhagehemorrhage

N Engl J Med 1995;333:364

Page 5: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Colonic biopsy from patient with Colonic biopsy from patient with E. E. colicoli O157:H7 infection O157:H7 infection

N Engl J Med 1995;333:364

Biopsy showing ischemic injury with superficial coagulative necrosis, mucosal hemorrhage, and an overlying inflammatory pseudomembrane

Page 6: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Hemolytic Uremic SyndromeHemolytic Uremic Syndrome

Days to 2 weeks after gastroenteritisDays to 2 weeks after gastroenteritis Pallor, bruising, lethargyPallor, bruising, lethargy Anemia (Hgb=5-7 mg/dl), thrombocytopeniaAnemia (Hgb=5-7 mg/dl), thrombocytopenia Hematuria, acute renal failureHematuria, acute renal failure Death: 3%-5%Death: 3%-5% E. coli E. coli O157:H7 isolated from 96% of patients when O157:H7 isolated from 96% of patients when

culture performed within 6 days of onsetculture performed within 6 days of onset

Page 7: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Pathogenesis of Pathogenesis of E. coli E. coli O157:H7 infectionO157:H7 infection

Page 8: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Incidence of Incidence of E. coli E. coli O157:H7 infection,O157:H7 infection,United StatesUnited States

0

1

2

3

4

5C

ases

per

100

,000

<1 1-4 5-14 15-24 25-39 40-64 65+

Age (years)Source: CDCSource: CDC

Page 9: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Outbreaks of Outbreaks of E. coli E. coli 0157:H70157:H7reported to CDC, 1982-1994reported to CDC, 1982-1994

VehicleVehicle

Ground beefGround beef

All beef + milkAll beef + milk

Water (drinking/swimming)Water (drinking/swimming)

Person-to-personPerson-to-person

UnknownUnknown

All outbreaksAll outbreaks

No. outbreaksNo. outbreaks

2222

2626

33

99

1919

6969

No. personsNo. persons

1,1371,137

1,2781,278

276276

243243

274274

2,3342,334Epidemiol Rev 1996;18:29

Page 10: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Outbreaks of Outbreaks of E. coli E. coli 0157:H70157:H7reported to CDC, 1982-1994reported to CDC, 1982-1994

Epidemiol Rev 1996;18:29

0

5

10

15

20

25

30

1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994

Page 11: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

E. coli E. coli 0157:H7: Vehicles of 0157:H7: Vehicles of infectioninfection

Undercooked hamburgersUndercooked hamburgers Bovine manureBovine manure Contaminated water (e.g., lakes, water slides)Contaminated water (e.g., lakes, water slides) Alfalfa sproutsAlfalfa sprouts MayonaiseMayonaise Unpasteurized apple ciderUnpasteurized apple cider Unpasteurized milkUnpasteurized milk

Page 12: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Epidemiol Rev 1996;18:29

E. coliE. coli 0157:H7 in food 0157:H7 in food

Present in any food w/bovine fecal contaminationPresent in any food w/bovine fecal contamination

Infectious dose: probably <5 organismsInfectious dose: probably <5 organisms

Present in 1%-2% of ground beef, pork, poultry, Present in 1%-2% of ground beef, pork, poultry,

lamb retail meat samples in Madison, WIlamb retail meat samples in Madison, WI

PresentPresent in about 10% of raw milk samples in about 10% of raw milk samples

Page 13: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Geographic distribution of Geographic distribution of E. coli E. coli O157:H7O157:H7: : Total Number of Reported Cases, 1996Total Number of Reported Cases, 1996

Page 14: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Cases of foodborne illness,Cases of foodborne illness,selected pathogens, 1995selected pathogens, 1995

PathogenPathogen

SalmonellaSalmonella

CampylobacterCampylobacter

E. coli E. coli O157:H7O157:H7

Clostridium perfringensClostridium perfringens

Listeria monocytogenesListeria monocytogenes

Staphylococcus aureusStaphylococcus aureus

CasesCases

696,000-3,840,000696,000-3,840,000

1,100,000-7,000,0001,100,000-7,000,000

8,000-16,0008,000-16,000

10,00010,000

928-1,767928-1,767

1,513,0001,513,000

DeathsDeaths

870-1,920870-1,920

110-511110-511

176-433176-433

100100

230-485230-485

454454

Page 15: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Onset of Onset of E. coliE. coli O157:H7 infections and HUS, O157:H7 infections and HUS, Dec. 1, 1992-Feb. 28, 1993, Washington StateDec. 1, 1992-Feb. 28, 1993, Washington State

JAMA 1994;272:1349

Black bars indicate primary cases; shaded bars, secondary cases; and white bars, unclassified cases

631 cases reported (501 cult. confirmed)

Median age 8 45 cases of HUS, 3 died Median incubation 4 days Undercooked burgers at “chain A”,

58/64 restaurants had at least 1 case Burgers cooked 1 minute/side:

routinely associated with internal temp. <68.3 C

Molecular epidemiology: single clone

Click for larger pictureClick for larger picture

Page 16: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

E. coli E. coli 0157:H7 at the Washington 0157:H7 at the Washington County Fair, New York, 1999County Fair, New York, 1999

921 persons reported diarrhea921 persons reported diarrhea E. coli E. coli 0157:H7 isolated from 116 persons; 13 0157:H7 isolated from 116 persons; 13

coinfected with coinfected with Campylobacter jejuniCampylobacter jejuni 32 infected with 32 infected with C. jejuni C. jejuni alonealone 65 persons hospitalized, 11 children w/HUS65 persons hospitalized, 11 children w/HUS 2 deaths: 3 yo w/HUS and 79 yo w/HUS/TTP2 deaths: 3 yo w/HUS and 79 yo w/HUS/TTP Source: consumption of water from shallow Source: consumption of water from shallow

unchlorinated wellunchlorinated wellMMWR 1999;48:803

Page 17: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Outbreak of Outbreak of EE.. coli coli O157:H7 Among O157:H7 Among ChildrenChildren A Associated With Farm Visits ssociated With Farm Visits – –

Montgomery County, PA, 2000Montgomery County, PA, 2000 September-November 2000: September-November 2000: Montgomery County Montgomery County

HD identified 51 persons HD identified 51 persons withwith diarrhea diarrhea <<10 days of 10 days of visiting a dairyvisiting a dairy farm (farm A)farm (farm A)

Age range 1-52 years (median: 4 years)Age range 1-52 years (median: 4 years) BBloody diarrhea (37%), fever (45%), vomiting loody diarrhea (37%), fever (45%), vomiting

(45%)(45%) 16 patients were hospitalized and eight developed 16 patients were hospitalized and eight developed

HUSHUSMMWR 2001;50:293MMWR 2001;50:293

Page 18: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Outbreaks of Outbreaks of EE.. coli coli O157:H7 Among O157:H7 Among ChildrenChildren A Associated With Farm Visitsssociated With Farm Visits: :

Molecular EpidemiologyMolecular Epidemiology

IIsolates solates from patients from patients indistinguishable by PFGE indistinguishable by PFGE

All 216 cattle on Farm A cultured by rectal swabAll 216 cattle on Farm A cultured by rectal swab

– 28 (13%) positive for outbreak strain28 (13%) positive for outbreak strain

– Same strain isolated from railing surfaceSame strain isolated from railing surface

MMWR 2001;50:293MMWR 2001;50:293

Page 19: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

CDC Investigator Examines aCDC Investigator Examines aCalf at “Farm A”, Pennsylvania, 2000Calf at “Farm A”, Pennsylvania, 2000

MMWR 2001;50:293MMWR 2001;50:293

Page 20: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Outbreaks of Outbreaks of EE.. coli coli O157:H7 Among O157:H7 Among ChildrenChildren A Associated With Farm Visitsssociated With Farm Visits: :

Case-Control Study of Risk FactorsCase-Control Study of Risk FactorsExposureExposure

Contact with cattle Contact with cattle

NailbitingNailbiting

Food from concessionFood from concession

Handwashing before eatingHandwashing before eating

MMWR 2001;50:293MMWR 2001;50:293

Odd ratio (95% CI)Odd ratio (95% CI)

10.9 (1.7-70.7) 10.9 (1.7-70.7)

2.5 (1.1-5.7)2.5 (1.1-5.7)

2.5 (1.1-5.7)2.5 (1.1-5.7)

0.2 (0.1-0.7)0.2 (0.1-0.7)

Page 21: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Routine DNA Fingerprinting by Health Routine DNA Fingerprinting by Health Departments: Departments: E. coliE. coli O157:H7, Minnesota, O157:H7, Minnesota,

19951995

N Engl J Med 1997;337:388

Page 22: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Patterns on Pulsed-Field Gel Electrophoresis Patterns on Pulsed-Field Gel Electrophoresis of of E. coliE. coli O157:H7 in Minnesota O157:H7 in Minnesota

N Engl J Med 1997;337:388

Lanes 1, 6, 10: Lanes 1, 6, 10: E. coli E. coli 0157:H7 standard0157:H7 standard

Lane 5: add. mole. wt. Lane 5: add. mole. wt. standardstandard

Lanes 2, 4, 7, 8: Lanes 2, 4, 7, 8: sporadic casessporadic cases

Lanes 3, 9: isolates Lanes 3, 9: isolates from single clusterfrom single cluster

Page 23: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Routine DNA Fingerprinting by Health Routine DNA Fingerprinting by Health Departments: Departments: E. coliE. coli O157:H7, Minnesota, 1995 O157:H7, Minnesota, 1995

N Engl J Med 1997;337:388 Click for larger picture

Page 24: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

N Engl J Med 1997;337:388

Routine DNA Fingerprinting by Health Routine DNA Fingerprinting by Health Departments: Departments: E. coliE. coli O157:H7, Minnesota, 199 O157:H7, Minnesota, 19944

Click for larger picture

Page 25: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Confirmed Confirmed E. coliE. coli O157:H7 outbreaks O157:H7 outbreaksin Minnesota, 1994 and 1995in Minnesota, 1994 and 1995

N Engl J Med 1997;337:388 Click for larger picture

Page 26: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Molecular subtyping of Molecular subtyping of E. coliE. coli 0157:H7 0157:H7 has revolutionized population-based has revolutionized population-based

surveillance for this organism in surveillance for this organism in Minnesota. We now Minnesota. We now routinely subtyperoutinely subtype all all E. coliE. coli 0157:H7 isolates and consider this 0157:H7 isolates and consider this technique to be an technique to be an integral part of disease integral part of disease

prevention and controlprevention and control in our state. in our state.

Minnesota Department of HealthMinnesota Department of HealthN Engl J Med 1997;377:388N Engl J Med 1997;377:388

Page 27: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

The Colorado Department of Public Health The Colorado Department of Public Health recently identified an outbreak ofrecently identified an outbreak of E. coli E. coli

0157:H7 infection associated with . . .six lots of 0157:H7 infection associated with . . .six lots of Hudson foods frozen ground beef patties and Hudson foods frozen ground beef patties and burgers. On August 7, 1997, CDPHE’s public burgers. On August 7, 1997, CDPHE’s public health laboratory reported that 15 of 27 health laboratory reported that 15 of 27 E. coli E. coli

isolates submitted for isolates submitted for routine molecular routine molecular subtypingsubtyping since June 1 were characterized by since June 1 were characterized by

highly related PFGE patterns. . .highly related PFGE patterns. . .

CDCCDCMMWR 1997;46:777.MMWR 1997;46:777.

Page 28: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

PFGE PFGE patterns patterns of of Salmonella entericaSalmonella enterica sserotype erotype Typhimurium, Typhimurium, by by WeekWeek, M, Minnesotainnesota, , June June - -

S September 1995eptember 1995

N Engl J Med 2001;N Engl J Med 2001;344:189344:189

Click for larger picture

Page 29: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Coordinated by CDCCoordinated by CDC NNational network of ational network of PH PH labs that performs labs that performs PFGEPFGE on on

foodborne foodborne bacteriabacteria– SalmonellaSalmonella serotype Typhimurium serotype Typhimurium– Escherichia coli Escherichia coli 0157:H70157:H7– Others plannedOthers planned

PPermits rapid comparison of ermits rapid comparison of PFGEPFGE patterns through patterns through electronic database at CDC electronic database at CDC

Pennsylvania Department of Health participatesPennsylvania Department of Health participates

www.cdc.gov/ncidod/dbmd/pulsenet/pulsenet.htm

Page 30: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

PreventionPrevention Surveillance for Surveillance for E. coli E. coli 0157:H7 and HUS0157:H7 and HUS Modernization of food inspectionModernization of food inspection Education of physiciansEducation of physicians Education of public Education of public

Page 31: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Limitations of Pulsed-Field Gel Limitations of Pulsed-Field Gel ElectrophoresisElectrophoresis

Substantial intra-/inter-laboratory variation Substantial intra-/inter-laboratory variation Interpretation of banding patterns subjectiveInterpretation of banding patterns subjective Requires additional enzymes to prove “matches” Requires additional enzymes to prove “matches” Analyzing across gels difficultAnalyzing across gels difficult PFGE stored as large image files PFGE stored as large image files Requires isolation of the organismRequires isolation of the organism SlowSlow Ongoing, automated computer analysis difficultOngoing, automated computer analysis difficult

Page 32: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Chain Termination DNAChain Termination DNASequencing (Sanger Method)Sequencing (Sanger Method)

A: New DNA synthesized as polymerase moves down template

DNA, away from primer

B: Nucleotides added untildideoxynucleotide incorporated.

C: Labeled primer

D: Labeled deoxynucleotides

E: Labeled dideoxynucleotidesClick for larger picture

Page 33: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Multilocus Sequence Typing Multilocus Sequence Typing (MLST)(MLST)

Sequencing of multiple housekeeping genesSequencing of multiple housekeeping genes State of the art (human genome project)State of the art (human genome project) Objective: no need to compare banding patternsObjective: no need to compare banding patterns Standardization of methodsStandardization of methods Fully reproducibleFully reproducible Storage, transmission, analysis of ASCII filesStorage, transmission, analysis of ASCII files More appropriate for ongoing, automated computer analysisMore appropriate for ongoing, automated computer analysis Do not need to isolate organism in cultureDo not need to isolate organism in culture FastFast

Page 34: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Sequence v. PFGE DataSequence v. PFGE Data

TTCGAATAAGCTTCCCTGAG

AAGCTTATTCGAAGGGACTC

Page 35: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Serratia marcescensSerratia marcescens outbreak in a NICU outbreak in a NICU

Mar-Jul 1995, 23 casesMar-Jul 1995, 23 cases Mostly sepsis, 30% diedMostly sepsis, 30% died 2 simultaneous outbreaks2 simultaneous outbreaks Most strain “A”, 4 “E”Most strain “A”, 4 “E” Contamination between Contamination between

NICU (NICU (**) and 2 other ) and 2 other wards (wards (** ** andand *** ***))

Strain A isolatesStrain A isolates

** ** **** **** ** ****** **** **J Clin Microbiol 1996;34:3138J Clin Microbiol 1996;34:3138

Page 36: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Cluster of Serogroup C Meningococcal Disease Associated With a Party

Case 1. 18-year-old male with headache, fever, nausea, vomiting on May 19, 1999. On May 20, presented with cardiopulmonary arrest and died. Blood cultures grew N. meningitidis.

Case 2. 20-year-old male presented with headache, back pain, and lethargy on May 21. Blood cultures positive for N. meningitidis.

Case 3. 21-year-old male, with headache, neck pain, vomiting, hypotension on May 25, 1999. Blood cultures positive for N. meningitidis

Common exposure: Attendance at a (wild!) party on May 14

S Med J, in pressS Med J, in press

Page 37: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Cluster of Serogroup C Meningococcal Disease Associated With a Party: PFGE

Analaysis (SpeSpeII) 1 2 3 4 5 6 7 8 9 10 Lanes 1, 6, 10: lambda

ladder reference, lanes 2, 3, 4: N. meningitidis isolates from Cases 1, 2, and 3 respectively; lanes 5, 7, 8, 9: Group

C N. meningitidis control isolates from

1999S Med J, in pressS Med J, in press

Page 38: E. coli 0157:H7: A New Emerging Disease n 1982: First recognized as pathogen n 1983: Linked to hemolytic uremic syndrome n 1990: Outbreak from drinking

Routine Molecular Epidemiology for Routine Molecular Epidemiology for Enhanced Detection and Control of Enhanced Detection and Control of Foodborne OutbreaksFoodborne Outbreaks: : SummarySummary

Routine molecular subtyping of key pathogens of Routine molecular subtyping of key pathogens of public health importance leads to enhanced public health importance leads to enhanced detection of foodborne outbreaksdetection of foodborne outbreaks

Routine molecular subtyping should be an Routine molecular subtyping should be an integral part of public health surveillanceintegral part of public health surveillance

DNA sequence-based methods may eventually DNA sequence-based methods may eventually replace restriction enzyme-based methodsreplace restriction enzyme-based methods