edinburgh research explorer · 2017-01-28 · wi, kabuusu, rm, ferguson, h, del pozo, j, eldar, a...
TRANSCRIPT
Edinburgh Research Explorer
Detection of Tilapia Lake Virus (TiLV) in Clinical Samples byCulturing and Nested RT-PCR
Citation for published version:Kembou Tsofack, JE, Zamostiano, R, Watted, S, Berkowitz, A, Rosenbluth, E, Mishra, N, Briese, T, Lipkin,WI, Kabuusu, RM, Ferguson, H, Del Pozo, J, Eldar, A & Bacharach, E 2016, 'Detection of Tilapia Lake Virus(TiLV) in Clinical Samples by Culturing and Nested RT-PCR', Journal of Clinical Microbiology.https://doi.org/10.1128/JCM.01808-16
Digital Object Identifier (DOI):10.1128/JCM.01808-16
Link:Link to publication record in Edinburgh Research Explorer
Document Version:Peer reviewed version
Published In:Journal of Clinical Microbiology
General rightsCopyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s)and / or other copyright owners and it is a condition of accessing these publications that users recognise andabide by the legal requirements associated with these rights.
Take down policyThe University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorercontent complies with UK legislation. If you believe that the public display of this file breaches copyright pleasecontact [email protected] providing details, and we will remove access to the work immediately andinvestigate your claim.
Download date: 18. Jun. 2020
1
Detection of Tilapia Lake Virus (TiLV) in Clinical Samples by Culturing and 1
Nested RT-PCR 2
3
4 Japhette Esther Kembou Tsofack,a Rachel Zamostiano,a Salsabeel Watted,b Asaf 5
Berkowitz,b Ezra Rosenbluth,b Nischay Mishra,c Thomas Briese,c W. Ian Lipkin,c 6
Richard M. Kabuusu,d Hugh Ferguson,d Jorge del Pozo,e Avi Eldar,b# Eran 7
Bacharacha#. 8
Department of Cell Research and Immunology, The George S. Wise Faculty of Life Sciences, 9
Tel Aviv University, Tel Aviv 69978, Israela; Fish Diseases Laboratory, The Kimron Veterinary 10
Institute, Bet Dagan 50250, Israelb; Nir-David Laboratory, Department of Fisheries, Nir David 11
10803, Israelc; Center for Infection and Immunity, Mailman School of Public Health, 12
Columbia University, New York, New York, USAc; Marine Medicine Program, Pathobiology, 13
School of Veterinary Medicine, St. George’s University, Grenada, West Indiesd; Royal (Dick) 14
School of Veterinary Studies, University of Edinburgh, Scotlande. 15
16
Running head: TiLV detection. 17
Key words: virus, TiLV, Tilapia, diagnosis, PCR. 18
#Corresponding author: Prof. Eran Bacharach, Department of Cell Research and 19
Immunology, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel 20
Aviv 69978, Israel. Tel.: (+)972-3-640-7692; Fax: (+)972-3-642-2046. e-Mail: 21
#Co-corresponding author: Dr. Avi Eldar, Fish Diseases laboratory, The Kimron 23
Veterinary Institute, Bet Dagan 50250, Israel. Tel.: (+)972-3-968-1760; Fax: (+)972-24
3-968-1702. e-Mail: [email protected]. 25
JCM Accepted Manuscript Posted Online 14 December 2016J. Clin. Microbiol. doi:10.1128/JCM.01808-16Copyright © 2016, American Society for Microbiology. All Rights Reserved.
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
2
ABSTRACT 26
27
Tilapia are an important group of farmed fish that serve as a significant protein 28
source, worldwide. In recent years, substantial mortality of wild tilapia has been 29
observed in the Sea of Galilee and in commercial ponds in Israel and Ecuador. We 30
have identified the etiological agent of these mass die-offs as a novel orthomyxo-like 31
virus and named it tilapia lake virus (TiLV). Here we provide conditions for efficient 32
isolation, culturing and quantification of the virus, including the use of susceptible 33
fish cell lines. Moreover, we describe a sensitive nested RT-PCR assay, allowing the 34
rapid detection of TiLV in fish organs. This assay revealed, for the first time, the 35
presence of TiLV in diseased Colombian tilapia, indicating a wider distribution of this 36
emerging pathogen and stressing the risk that TiLV poses for the global tilapia 37
industry. Overall, the described procedures should provide the tilapia aquaculture 38
industry important tools for the detection and containment of this pathogen. 39
40
41
INTRODUCTION 42
43
Tilapines, a generic term for edible fish belonging to the family Cichlidae, are fast 44
growers, efficient food convertors and relatively disease-resistant. These assets render 45
them most suitable for farming; indeed, tilapines are one of the most significant 46
groups of farmed fish worldwide and serve as an important protein source, especially 47
in developing countries (1-6). Common ectoparasites and the few bacterial pathogens 48
of tilapines are well controlled by pharmacotherapy. Few viral diseases have been 49
reported for tilapia and these are of limited impact (7-9). 50
51
Recently, a novel RNA virus termed Tilapia Lake Virus (TiLV) has been identified 52
and recovered from episodes of massive mortalities of wild and pond-cultured tilapia 53
all over Israel (10). High mortalities were also observed in naïve tilapia, exposed to an 54
isolate of TiLV (10). Tilapia mortality, suspected of having a viral etiology, has also 55
been described in Ecuador (11, 12). Although variations in pathological presentation 56
have been described (where lesions were focused in the central nervous system or in 57
the liver, in Israel or Ecuador, respectively), sequencing the whole genome of TiLV 58
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
3
revealed that tilapia in the two countries were infected with almost identical viruses 59
(4). This analysis also revealed that this pathogen is a novel orthomyxo-like virus with 60
a 10-segment, negative-sense RNA genome (4). Segment 1 contains an open reading 61
frame (ORF) with weak sequence homology to the polymerase subunit (PB1) of 62
influenza C virus, while the other nine segments showed no homology to other 63
viruses. 64
65
TiLV outbreaks are characterized by high mortalities and economical losses (10, 11) 66
and no vaccines against TiLV are currently available. Thus, there is a great need for 67
the implementation of prompt control measures: culling of infected stocks, setting 68
quarantine, restricting trades and control of possible vectors. This calls for 69
development of fast and sensitive detection methods and improved culturing 70
techniques. Here we show that the presently available reverse transcription (RT)-PCR 71
assay (10), although highly specific, is of limited sensitivity when applied to clinical 72
samples. Accordingly, we now describe a highly sensitive, nested RT-PCR assay for 73
TiLV detection from clinical specimens. In addition, TiLV-sensitive cell lines, other 74
than the reported E-11 cells (10), are described and the optimal parameters for TiLV 75
culturing are defined. 76
77
78
MATERIALS AND METHODS 79
80
Cell cultures and infection of cells with TiLV. E-11 (13), TO-2 (14), OmB (15) and 81
TmB (16) cells were grown in Leibovitz (L-15) medium (Gibco, USA), supplemented 82
with 10% inactivated FCS (Gibco), L-glutamine (300 mg/liter), HEPES (pH 7.3; 1%), 83
penicillin (40 U/ml), streptomycin (40 µg/ml), and Nystatin (5 µg/ml). Primary brain 84
cells were prepared and grown as described before (10). For TiLV infections, E-11 85
monolayers in 25cm2 flasks (~90% confluence, washed twice with PBS before 86
infection) were incubated with TiLV preparations at 25 °C for 1 h; cells were then 87
washed with PBS and incubated at 25 °C in L-15 medium (supplemented with 10% 88
FCS) and monitored for CPE for up to 14 days. TO-2, OmB and TmB cells were 89
infected with TiLV as described for E-11 cells (see below). 90
91
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
4
Quantification of temperature-dependent TiLV growth. E-11 cell line and cultures 92
of primary tilapia brain cell (10) (90% confluency in 24-well plates) were infected 93
with TiLV [isolate 4/2011, (10); 103.6 TCID50/well] and incubated at 15, 20, 25 or 30 94
°C for up to 19 days. Cells were harvested at the indicated days post-infection and 95
lysed by three freeze-thaw cycles. Total RNA was extracted with peqGOLD Trifast 96
(Peqlab; 30-2010) and levels of TiLV and cellular β-actin RNAs were quantified by 97
quantitative RT-PCR (qRT-PCR). Reverse transcription was performed using Verso 98
1-step RT-PCR ReddyMix kit (Thermo, Lithuania; AB-1454/LD/A); complemented 99
with primers specified below. Quantification was accomplished by real-time PCR 100
using the ABsolute Blue qPCR SYBR Green Rox Mix (Thermo scientific; AB-101
4163/A) according the manufacturer’s instructions with the following specifications: 102
each reaction contained 3 µl cDNA; TiLV-specific primers [ME1 103
5'GTTGGGCACAAGGCATCCTA3' and clone 7450/150R/ME2 104
5'TATCACGTGCGTACTCGTTCAGT3', 300 nM each, amplifying a 250-bp 105
fragment (10)]; annealing and extension were performed at 60 °C for 1 min. To detect 106
β-actin RNA, we used the primers described in (17) (F β-actin 107
5'GGGTCAGAAAGACAGCTACGTT3' and R β-actin 108
5'CTCAGCTCGTTGTAGAAGGTGT3', amplifying 143 bp fragment). Continuous 109
fluorescence measurements were achieved with StepOne apparatus (Applied 110
Biosystems). Positive and negative controls consisted of TiLV cDNA and no-template 111
control, respectively. Relative quantification (RQ) was calculated according to (18) 112
with the StepOne software (Applied Biosystems). 113
114
Quantification of TiLV growth by end-point dilution assays. E-11, TmB or OmB 115
cell lines were cultured in 96-well plates in 100µl/well of Leibovitz (L-15) medium 116
(Gibco, USA), supplemented with 10% inactivated fetal calf serum (FCS, Gibco, 117
USA). Serial dilutions of TiLV were prepared in the above serum-supplemented 118
medium and 100 µl from each dilution were added to each well (~ 80% confluency). 119
Altogether, 10 wells of each cell line were infected for each dilution. The 120
development of CPE was monitored on a daily basis through 14 days post-infection, 121
when cultures were washed with PBS and stained with crystal 122
violet/formaldehyde/methanol solution. TCID50 values were calculated by the method 123
of Reed and Muench (19). 124
125
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
5
RT- PCR and quantitative PCR (qPCR). To establish a control for building a RT-126
PCR for detection of TiLV sequences, a 491 bp long PCR fragment, derived from 127
TiLV clone 7450 (GenBank Accession No. KJ605629), was amplified with primers 128
'Nested ext-1' (5'TATGCAGTACTTTCCCTGCC3') and 'Nested ext-2' 129
(5'TTGCTCTGAGCAAGAGTACC3') (10). The resulting fragment was cloned into 130
pJET1.2/blunt (Thermo Fisher Scientific), which was purified, serially diluted and 131
used (at various known concentrations) as a template for PCR. For these reactions, the 132
following pairs of primers were used: Nested ext-1 and Nested ext-2 (amplifying the 133
491 bp fragment in a reaction called 'external PCR'); 'ME1' 134
(5'GTTGGGCACAAGGCATCCTA3') and '7450/150R/ME2' 135
(5'TATCACGTGCGTACTCGTTCAGT3') (10), amplifying a 250 bp fragment, 136
embedded in the above sequence (in a reaction called 'internal PCR'); or combination 137
of these two pairs in a nested PCR reaction. For the external or internal PCR reactions 138
(15 µl each), the Verso 1-step RT-PCR ReddyMix kit (Thermo, Lithuania; AB-139
1454/LD/A) was used with 200 nM (final concentration) of each of the above primers 140
and without the enhancer (DNase). Amplification steps included: 1 cycle of 50 °C, 15 141
min (to mimic the reverse transcription step); 1 cycle of 95 °C, 2 min; 25 cycles of 95 142
°C, 60 s / 60°C, 60 s / 72 °C, 60 s and 1 cycle of 72 °C, 7 min. For nested PCR, 3 µl 143
of the external reaction were re-amplified by a PCR reaction (total of 15 µl) of 2X 144
ReddyMix PCR Master Mix (Thermo Scientific; AB-0575/DC/LD/A), using primers 145
ME1 and 7450/150R/ME2 (each at a final concentration of 200 nM). Amplification 146
steps were as above but without the 50 °C, 15 min step. PCR products were separated 147
in a 1% agarose gel by electrophoresis. 148
149
The above external and internal PCR reactions of the plasmid dilutions were also 150
quantified by qPCR, using the Fast SYBR Green Master Mix (Applied Biosystems, 151
4385612) and the cognate set of primers described above (final concentration of 500 152
nM of each primer, per reaction). To quantify the nested PCR by qPCR, the external 153
PCR reaction was performed with the Verso 1-step RT-PCR ReddyMix kit, as 154
described above; 1 µl of this reaction was then re-amplified with the Fast SYBR 155
Green Master Mix, using primers ME1 and 7450/150R/ME2 (500 nM each). For all 156
qPCR reactions the following steps were used: 1 cycle of 95ºC, 20 s; 40 cycles of 157
95ºC, 3 s / 60ºC, 30 s. Fluorescence was monitored with StepOnePlus apparatus 158
(Applied Biosystems). Ct values were calculated by the StepOne software. 159
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
6
160
TiLV RNA detection by nested RT-PCR. Total RNA was extracted from cell 161
cultures, or from liver organs (preserved in RNAlater reagent; QIAGEN; 76104), with 162
EZ-RNA Total RNA Isolation Kit (Biological Industries; 20-400-100) according to 163
the manufacturer's instructions. Reverse transcription and first round (external) PCR 164
were performed using Verso 1-step RT-PCR ReddyMix kit (Thermo, Lithuania; AB-165
1454/LD/A), essentially according to the manufacturer's instructions but with the 166
following modifications: total volume of the reaction was15 µl, with primers 'Nested 167
ext-1' and 'Nested ext-2' (see above; 200 nM each). Thermal cycling program 168
included: a cDNA synthesis step (50 °C, 15 min); an inactivation step (95 °C, 2 min); 169
a denaturation step (95 °C, 30 s); 25 cycles of annealing (60 °C, 30 s) - extension (72 170
°C, 1 min); and a final extension step (72 °C, 7 min). 3 µl from the first round PCR 171
were then subjected to re-amplification by a second (nested) PCR of 2X ReddyMix 172
PCR Master Mix (Thermo Scientific; AB-0575/DC/LD/A), essentially according to 173
the manufacturer's instructions but with the following modifications: total volume of 174
the reaction was 15 µl, using primers ME1 and 7450/150R/ME2 (see above; 200 nM 175
each). Thermal cycling program included: an initial denaturation step (95 °C, 2 min); 176
35 cycles of denaturation (95 °C, 1 min) - annealing (60 °C, 1 min) - extension (72 177
°C, 1 min); and a final extension step (72 °C, 5 min). PCR products were analyzed by 178
electrophoresis in 1% agarose gels. 179
180
Amplification of Nervous Necrosis virus (NNV) RNA. RT-PCR was used to 181
amplify NNV RNA with conditions described above for TiLV RNA, using EZ-RNA 182
Total RNA Isolation Kit and Verso 1-step RT-PCR ReddyMix kit, but with primers 183
F1 (5’GGATTTGGACGTGCGACCAA3') and VR3 184
(5'TGGATCAGGCAGGAAGC3') and annealing temperature of 54 °C. The length of 185
the amplified product is 254 bp (20). 186
187
Processing of clinical samples. Brain samples were collected in Israel between 2011 188
and 2013, from pond-raised tilapia (Oreochromis niloticus x Oreochromis aureus 189
hybrids), suspected to have been infected with TiLV. Brains from two ornamental 190
African cichlids, grown in an ornamental fish breeding farm and which showed 191
symptoms of TiLV infection, were also included in this study. Samples from mid-192
2012 onwards were processed immediately upon arrival; earlier samples were 193
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
7
processed from archived materials (whole fish) stored at -80 0C. Negative control fish 194
were collected from fish ponds with no apparent disease. 195
196
Brains were removed aseptically, pooled (2-3 samples from each outbreak; except 197
from the two samples of ornamental fish that were processed separately) and split into 198
two tubes. The first aliquot was used for RNA extraction and subsequent PCR 199
reactions as described above. The second aliquot was utilized for virus isolation and 200
was manually homogenized with 9 volumes of phosphate-buffered saline (PBS) 201
solution and centrifuged at 3000 x g for 10 min; supernatants were filtered through 202
0.22 μm membrane filters (Starsdet, Germany) and 200 μl were used to infect E-11 203
monolayers as specified below. For Sample No. 12, E-11 cells that were incubated 204
with brain homogenates and that showed no CPE, were freeze-thawed, and 200 µl of 205
cleared extract was used to infect naïve E-11 cells. This procedure was repeated once 206
more till a clear CPE was observed. 207
208
Liver samples, diagnosed histopathologically as having lesions typical of syncytial 209
hepatitis (11), were collected from clinically sick fish, from Ecuador and Columbia. 210
Control livers were collected from unexposed, healthy tilapia (Oreochromis niloticus), 211
reared in St. George’s University, Grenada. All liver samples were preserved in 212
RNAlater reagent (QIAGEN; 76104). 213
214
RESULTS 215
216
Temperature-dependent viral growth. Being ectotherms (and cultured at 16-32 0C 217
range) (21), tilapia potentially may be infected over a relatively wide range of 218
temperatures; yet, the effect of temperature on TiLV replication and thus, on its 219
isolation, has not been studied. Hence, TiLV growth at various temperatures was 220
evaluated by infecting monolayers of E-11 and primary tilapia brain cells, with 221
subsequent incubation at various temperatures (15, 20, 25 and 30 0C) for up to 19 222
days. Infection was quantified by qRT-PCR reactions, measuring TiLV RNA 223
expression levels, with TiLV specific primers. Viral RNA levels were normalized to 224
cellular β-actin mRNA levels [Relative Quantification (RQ); Fig. 1 and Materials and 225
Methods]. In E-11 cells, the maximum increase in TiLV RNA levels was observed at 226
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
8
25 0C at day 9 post-infection (RQ = 1328; Fig. 1A). Higher (30 0C) or lower (20 0C) 227
temperatures resulted in reduced TiLV RNA levels (RQ = 191 and 490, respectively, 228
day 9 post-infection). At 15 0C, TiLV RNA production was dramatically reduced (RQ 229
= 35; day 9 post-infection) and reached maximal levels at day 15 post-infection. In 230
infected primary tilapia brain cells, 25 0C was also the optimal temperature for TiLV 231
replication (Fig. 1B); yet this replication peaked only at day 14 post-infection and 232
reached much lower levels (about 12%), compared to the one in E-11 cells. 233
Altogether, E-11 cells at 25 0C provide optimal conditions for TiLV replication, thus 234
all isolations from clinical samples (see below) were carried out under these 235
conditions. 236
237
Quantification of TiLV growth in tilapia cell lines. In our former study (10), eight 238
established fish cell lines were tested for their permissiveness to TiLV infection and 239
only E-11 cells were found suitable for this purpose. We now extended this analysis to 240
three additional tilapia cell lines, derived from ovary [TO-2; (14)], brain [OmB; (15)] 241
and bulbus arteriosus [TmB; (16)]. Initial qualitative analyses revealed that OmB and 242
TmB, but not TO-2, support TiLV replication (data not shown). We next compared 243
the use of the permissive cell lines (E-11, OmB and TmB) in the quantification of 244
TiLV infection by endpoint dilution assays. The cell lines were infected with dilutions 245
of the virus, CPE was monitored for 14 days and TCID50 values were calculated. The 246
results of three independent experiments are shown in Table 1. All three cell lines 247
showed comparable sensitivities to TiLV infection. Yet, E-11 cultures were superior 248
because the CPE development was clearly detected in a relative short time (~4, 6 or 8 249
days post-infection for E-11, TmB or OmB, respectively). OmB cells also provided 250
convenient way to monitor CPE at longer time post-infection (~14 days), as 251
uninfected cells remained attached as monolayers while infected cultures completely 252
detached at this time point. TmB cells were sensitive to TiLV-induced CPE, yet we 253
found that detecting CPE in this line was more difficult compared to the other lines 254
because TmB cells did not support the formation of clear plaques and only a portion 255
of the infected cells detached from the plate over time. 256
257
Sensitivity and specificity of TiLV detection by PCR. A sensitive RT-PCR 258
detection method for TiLV is required for rapid and accurate diagnosis of this threat 259
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
9
to tilapine aquaculture. We have described TiLV detection by RT-PCR (10); however, 260
assays were not optimized. To optimize this procedure, we first prepared a standard 261
curve for this assay. Specifically, a 491 bp long PCR fragment, derived from TiLV 262
clone 7450 (GenBank Accession No. KJ605629) (10), was cloned into a plasmid and 263
dilutions of the resulting plasmid DNA were used in the following PCR/gel 264
electrophoresis (Fig. 2A) and qPCR (Fig. 2B) reactions. Different sets of primers were 265
used to amplify either the 491 bp fragment ('external PCR'; Fig. 2A, Upper Panel) or 266
an internal 250 bp fragment ('internal PCR'; Fig. 2A, Middle Panel). Additional 267
reaction ('nested PCR'; Fig. 2A, Lower Panel) consisted of the external PCR, 268
combined with the internal PCR (Materials and Methods). This analysis showed that 269
as expected, the external and internal PCR reactions were less sensitive than the 270
nested PCR: the highest dilution in which the TiLV sequence was clearly detected by 271
the external or the internal PCR reactions was 10-6 (Fig. 2A, Lane 2, Upper and 272
Middle Panels); relating to detection of ~70,000 TiLV copies. The nested PCR 273
showed much higher sensitivity, enabling the detection of as low as 7 copies of TiLV 274
sequence (Fig. 2A, Lane 6, Lower Panel). Amplification of the above diluted plasmid 275
DNA by qPCR also demonstrated the higher sensitivity of the nested PCR over the 276
non-nested PCR reactions as much lower threshold cycle (Ct) values were obtained 277
for the former reaction (Fig. 2B). Of note, the detection limit of the nested qPCR (70 278
copies, Fig. 2B), was higher than that of the nested PCR (7 copies, Fig. 2A). These 279
differences likely result from the different reagents and conditions used for these two 280
types of reactions (Materials and Methods). 281
282
The specificity of the developed nested PCR was further demonstrated by the 283
amplification of TiLV sequences from cDNAs that were prepared from TiLV-infected 284
E-11 cells; but not from negative samples composed of cDNAs of NNV-infected, or 285
naïve E-11 cells (Fig. 2C). 286
287
TiLV detection in diseased tilapia from Israel. Based on the optimal conditions for 288
TiLV growth and detection defined above, we next set out to isolate TiLV from 289
clinical specimens obtained from 13 different outbreaks between 2011 and 2013 in 290
nine different commercial farms, distributed over Israel (Galilee, Jordan valley and 291
Mediterranean coastal areas). In all these outbreaks, diseased fish showed typical 292
symptoms related to TiLV infection (10). Brain samples were obtained from 293
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
10
commercial pond-raised tilapia for human consumption (Oreochromis niloticus x 294
Oreochromis aureus hybrids; Specimens No. 1-11, Table 2), and ornamental African 295
cichlids (Specimens No. 12 and 13, Table 2). Brain was chosen for these analyses 296
because this tissue is relatively confined and susceptible to TiLV infection (10). The 297
brains were homogenized (pools of 2-3 brains for each outbreak for Samples No. 1-298
11; Samples No. 12 and 13, each consisted of a single brain) and added to E-11 cells, 299
cultured at 25 0C. This procedure resulted in the appearance of CPE at 5 to 6 days 300
post-inoculation, in 12 out of the 13 cases (Table 2). For Specimen No. 12, two 301
additional passages in E-11 cell cultures were required before CPE became apparent 302
(Materials and Methods). No CPE was observed for a negative control group, 303
consisting of 15 fish that were collected from ponds showing mortalities due to either 304
environmental conditions (low oxygen levels or high ammonia concentrations) or 305
other infectious diseases (i.e. streptococci) (data not shown). 306
307
The above 13 brain tissues were also tested for the presence of TiLV sequences by the 308
internal and nested PCR reactions described above. For this, total RNA was extracted 309
from portions of the brains, reverse transcribed using random primers and PCR 310
amplified with TiLV-specific primers (Materials and Methods). The internal PCR 311
detected TiLV sequences in only three samples (23%), in contrast to the nested PCR 312
that detected the virus in 12 samples (92%, Table 2). The amplification of TiLV 313
sequences was also verified by sequencing the PCR products (data not shown). None 314
of the negative controls scored positive when examined by the nested PCR, further 315
demonstrating the specificity of this assay (data not shown). 316
317 TiLV detection in diseased tilapia from South America. To further examine the 318
developed nested RT-PCR, we applied it to detect TiLV RNA in liver samples, 319
preserved in RNAlater reagent, that were taken from South American tilapia, showing 320
signs of syncytial hepatitis (11, 12), or from healthy controls. This test was performed 321
in a blinded way using the following procedure: the presence or absence of TiLV 322
RNA in the samples was tested by RT-PCR (12), in St. George’s University, Grenada. 323
The samples were then coded and shipped, preserved in an RNAlater reagent, to Tel 324
Aviv University, where RNA was extracted and nested RT-PCR was performed 325
without knowing the samples' identities. Fig. 3A shows the results of this procedure 326
for Ecuadorian samples: six examined samples scored positive (Lanes 1-6) while six 327
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
11
samples scored negative (Lanes 7-12). This fully matched the classification made of 328
the samples, before shipment. 329
330
Tilapia with syncytial hepatitis were also observed in farms in Colombia and liver 331
samples were examined for the presence of TiLV RNA, as above. This analysis 332
revealed that out of the six samples that were scored positive for TiLV, four samples 333
also scored positive after their shipment (Fig. 3B, Lanes 1-4), while the two other 334
samples scored negative (Fig. 3B, Lanes 5-6). This discrepancy likely resulted from 335
the degradation of TiLV RNA in these samples. Indeed, attempts to amplify TiLV 336
RNA from these two samples using different sets of primers that were derived from 337
another segment of TiLV genome, failed too (data not shown). For the negative 338
samples, no PCR products were observed (Fig 3B, Lanes 7-12). 339
340
Overall, these results demonstrate that the developed nested RT-PCR can be applied 341
for detection of TiLV strains in Israel and South America and suggest that preserved 342
material can be analyzed too. Importantly, these results further show for the first time 343
that TiLV is present also in tilapia farmed in Colombia, and confirm the global 344
distribution of this newly recognized pathogen. 345
346
DISCUSSION 347
348
TiLV, a recently identified pathogen, causes recurrent outbreaks in wild and cultured 349
tilapia. These outbreaks are characterized by significant mortality and morbidity, 350
resulting in massive losses to tilapia industry both in Israel and South America (4, 10-351
12). Thus, efficient methods for TiLV isolation and detection are required. 352
353
Temperature is the first parameter that we examined for optimization of TiLV 354
culturing, since outbreaks of viral diseases of fish are typically temperature-dependent 355
(22). Of note, the temperature at which a disease occurs does not necessarily reflect 356
the optimal temperature for the in vitro growth of the cognate pathogen. For example, 357
deadly outbreaks of viral hemorrhagic septicemia (VHS) in farmed Japanese flounder, 358
caused by viral hemorrhagic septicemia virus (VHSV), occurred when water 359
temperatures were between 8 and 15 °C, while the isolated VHSV strain replicated 360
most rapidly at 20 °C (23). Similarly, spring viremia of carp (SVC), caused by 361
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
12
spring viremia of carp virus (SVCV), occurs with high mortalities at water 362
temperatures of 10 to 17 °C, while the optimum temperature for the in vitro 363
replication of SVCV is 20 °C (24). In the case of TiLV, the broad range of water 364
temperature (~ 24 to 33 °C) that occurs during the hot season (May to October) (10), 365
calls for determination of the optimal temperature for efficient virus growth, in vitro. 366
Our results (Fig. 1) clearly demonstrate that 25 0C allows maximal growth of TiLV. 367
368
We also determined TiLV growth in several types of fish cells. When comparing 369
primary tilapia brain cells to E-11 cells, TiLV replication generated much higher viral 370
RNA in the latter cells, despite the fact that E-11 cells are derived from the snakehead 371
fish (Ophicephalus striatus) (13, 25) - a freshwater perciform fish (family 372
Channidae), which is distant from tilapines (family Cichlidae). Our present study 373
identified two additional tilapia cell lines that support TiLV growth: the OmB; (15) or 374
TmB (16) cells, derived from tilapia brain or bulbus arteriosus, respectively. In 375
respect to CPE development, E-11 and OmB were superior compared to TmB. 376
Plaques where readily detected in E-11 cells, whereas TiLV-infected OmB cultures 377
were characterized by almost complete detachment from the plate. Thus, E-11 cells 378
are convenient for plaque assays and OmB cultures are useful in end-point dilution 379
(TCID50) assays. E-11 cells, which are derived from a species distant from the natural 380
host, should also be useful in studies involving TiLV attenuation. Yet, E-11 cells also 381
produce the snakehead retrovirus (SnRV) (13) and this may hamper the development 382
of pure vaccine strains for TiLV. Since OmB and TmB cells are SnRV-free (our 383
unpublished results), these cells should be useful in generating pure TiLV strains. 384
385
We demonstrated that TiLV culturing is a sensitive method for detection of the virus. 386
Yet, this methodology is time consuming and labor intensive; thus, it is inadequate 387
when prompt and accurate control measures are required (i.e. culling of infected 388
stocks). Hence, we developed RT-PCR-based techniques that are fast and sensitive. 389
We demonstrated that the nested RT-PCR protocol, described here, detects only few 390
molecules of TiLV genome and can be applied in detecting TiLV RNA in fresh and 391
preserved organs of diseased fish. The protocol is based on amplification of consensus 392
regions that were identified by analyzing high-throughput sequencing data, obtained 393
from TiLV samples collected in Israel and Ecuador. This analysis revealed high 394
sequence homology between the Israeli and Ecuadorian samples across TiLV genome 395
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
13
(4) and thus, all TiLV segments can be used as templates in RT-PCR reactions. The 396
four primers used in our protocol are derived from Segment 3 of the Israeli isolate of 397
TiLV (4, 10). Three primers (Nested ext-1, Nested ext-2 and ME1) fully match 398
sequences of TiLV obtained from 12 Ecuadorian samples. The fourth primer 399
(7450/150R/ME2) fully matches eight of the 12 Ecuadorian samples, but has a single 400
mismatch in its second position, compared to the other four samples (sequences of the 401
latter contain a G instead of an A). This 5' mismatch should not interfere with 402
amplification and the described set of primers readily amplified TiLV sequences from 403
samples obtained from disease outbreaks in both Israel and Ecuador. Moreover, the 404
power of this RT-PCR-based assay was exemplified when it detected TiLV in organs 405
of diseased tilapia, obtained from yet another country - Colombia. 406
407
This is the first report of TiLV occurrence in Colombian aquaculture, which adds to 408
the reports of TiLV outbreaks in Israel and Ecuador. This substantiates TiLV as an 409
emerging pathogen and highlights the risk that TiLV poses for the global tilapia 410
industry. The methods described here should detect the virus through early onset of 411
TiLV infection, assisting its containment. 412
413
ACKNOWLEDGEMENTS 414
415
We thank Prof. Dietmar Kueltz (University of California, Davis) for generously 416
providing the OmB and TmB cell lines, and Prof. Ronit Sarid (Bar-Ilan University) 417
for providing the TO-2 cell line. We are indebted to Dr. Marina Eyngor (Kimron 418
Veterinary Institute) for her technical assistance. This work was supported by a 419
United States-Israel Binational Agricultural Research & Development Fund (BARD) 420
grant (BARD IS-4583-13) and by the Israel Ministry of Agriculture & Rural 421
Development Chief Scientist Office (grant 847-0389-14). J.E.K.T. is supported by a 422
fellowship from the Manna Center Program in Food Safety and Security at Tel Aviv 423
University. 424
425
E.B., A.E., N.M., T.B., and W.I.L. have applied for patents in the fields of TiLV 426
diagnostics and vaccines. 427
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
14
REFERENCES 428
1. FOA. 2010. Cultured aquatic species information programme, Oreochromis niloticus 429 (Linnaeus, 1758). on Food and Agriculture Organization of the United Nations, Rome, 430 Italy. http://www.fao.org/fishery/culturedspecies/Oreochromis_niloticus/en. 431
2. FOA. 2010. Fisheries and Aquaculture Department. Species fact sheets: 432 Oreochromis niloticus (Linnaeus, 1758), on Food and Agriculture Organization of the 433 United Nations, Rome, Italy. http://www.fao.org/ffishery/species/3217/en. 434
3. FOA. 2014. The state of world fisheries and aquaculture, on Food and Agriculture 435 Organization of the United Nations, Rome, Italy. http://www.fao.org/3/a-436 i3720e/index.html. 437
4. Bacharach E, Mishra N, Briese T, Zody MC, Kembou Tsofack JE, Zamostiano R, 438 Berkowitz A, Ng J, Nitido A, Corvelo A, Toussaint NC, Abel Nielsen SC, Hornig M, 439 Del Pozo J, Bloom T, Ferguson H, Eldar A, Lipkin WI. 2016. Characterization of a 440 Novel Orthomyxo-like Virus Causing Mass Die-Offs of Tilapia. MBio 7. 441
5. Gomna A. 2011. The role of tilapia in food security of fishing villages in niger state, 442 nigeria. African Journal of Food, Agriculture, Nutrition and Development 11:5561-443 5572. 444
6. Cleasby N, Schwarz AM, Phillips M, Paul C, Pant J, Oeta J, Pickering T, Meloty A, 445 Laumani M, Kori M. 2014. The socio-economic context for improving food security 446 through land based aquaculture in Solomon Islands: A pen-urban case study. Marine 447 Policy 45:89-97. 448
7. Bigarre L, Cabon J, Baud M, Heimann M, Body A, Lieffrig F, Castric J. 2009. Outbreak 449 of betanodavirus infection in tilapia, Oreochromis niloticus (L.), in fresh water. J Fish 450 Dis 32:667-673. 451
8. McGrogan DG, Ostland VE, Byrne PJ, Ferguson HW. 1998. Systemic disease 452 involving an iridovirus-like agent in cultured tilapia, Oreochromis niloticus L. – a case 453 report. Journal of Fish Diseases 21:149-152. 454
9. Shlapobersky M, Sinyakov MS, Katzenellenbogen M, Sarid R, Don J, Avtalion RR. 455 2010. Viral encephalitis of tilapia larvae: primary characterization of a novel herpes-456 like virus. Virology 399:239-247. 457
10. Eyngor M, Zamostiano R, Kembou Tsofack JE, Berkowitz A, Bercovier H, Tinman S, 458 Lev M, Hurvitz A, Galeotti M, Bacharach E, Eldar A. 2014. Identification of a novel 459 RNA virus lethal to tilapia. Journal of Clinical Microbiology 52:4137-4146. 460
11. Ferguson HW, Kabuusu R, Beltran S, Reyes E, Lince JA, del Pozo J. 2014. Syncytial 461 hepatitis of farmed tilapia, Oreochromis niloticus (L.): a case report. J Fish Dis 462 37:583-589. 463
12. Del-Pozo J, Mishra N, Kabuusu R, Cheetham S, Eldar A, Bacharach E, Lipkin WI, 464 Ferguson HW. 2016. Syncytial Hepatitis of Tilapia (Oreochromis niloticus L.) is 465 Associated With Orthomyxovirus-Like Virions in Hepatocytes. Vet Pathol 466 doi:10.1177/0300985816658100. 467
13. Iwamoto T, Nakai T, Mori K, Arimoto M, Furusawa I. 2000. Cloning of the fish cell 468 line SSN-1 for piscine nodaviruses. Dis Aquat Organ 43:81-89. 469
14. Chen SN, Shi SC, Ueno Y, Kou GH. 1983. A cell line derived from Tilapia ovary. Fish 470 Pathology 18:13-18. 471
15. Gardell AM, Qin Q, Rice RH, Li J, Kultz D. 2014. Derivation and osmotolerance 472 characterization of three immortalized tilapia (Oreochromis mossambicus) cell lines. 473 PLoS One 9:e95919. 474
16. Lewis DH, Marks JE. 1985. Microcultures of Sarotherodon mossambicus (Peters) 475 cells: their use in detecting fish viruses. Journal of Fish Diseases 8:477-478. 476
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
15
17. Hassanin AAI, Kaminishi Y, Osman MMM, Abdel-Wahad ZH, El-Kady MAH, Itakura 477 T. 2009. Development and application of a real-time quantitative PCR assay for 478 determining expression of benzo-apyrene- Inducible cytochrome P450 1A in Nile 479 tilapia (Oreochromis niloticus). African Journal of Biotechnology 8:6588-6595. 480
18. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-481 time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 482
19. Reed LJ, Muench H. 1938. A simple method of estimating fifty percent endpoints. 483 The American Journal of Tropical Medicine and Hygiene 27:493–497. 484
20. Ucko M, Colorni A, Diamant A. 2004. Nodavirus infections in Israeli mariculture. J 485 Fish Dis 27:459-469. 486
21. El-Sayed A-FM. 2006. Tilapia culture. CABI Pub., Wallingford, UK ; Cambridge, MA. 487 22. Le Morvan C, Troutaud D, Deschaux P. 1998. Differential effects of temperature on 488
specific and nonspecific immune defences in fish. J Exp Biol 201:165-168. 489 23. Isshik T, Nishizawa T, Kobayashi T, Nagano T, Miyazaki T. 2001. An outbreak of 490
VHSV (viral hemorrhagic septicemia virus) infection in farmed Japanese flounder 491 Paralichthys olivaceus in Japan. Dis Aquat Organ 47:87-99. 492
24. Ahne W, Bjorklund HV, Essbauer S, Fijan N, Kurath G, Winton JR. 2002. Spring 493 viremia of carp (SVC). Dis Aquat Organ 52:261-272. 494
25. Frerichs GN, Morgan D, Hart D, Skerrow C, Roberts RJ, Onions DE. 1991. 495 Spontaneously productive C-type retrovirus infection of fish cell lines. J Gen Virol 72 496 ( Pt 10):2537-2539. 497
498
499
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
16
FIGURE LEGENDS 500
501
Figure 1. TiLV replication at different temperatures. E-11 (A) and primary brain 502
(B) cultures in 24-well plates were infected with TiLV and incubated at the indicated 503
temperatures. Total RNA was extracted from infected cells at the indicated time 504
points postinfection and TiLV and cellular β-actin RNA levels were quantified by 505
qRT-PCR. The results show the relative quantification (RQ) of TiLV RNA levels, 506
relative to β-actin RNA levels (means of duplicates ± standard deviations). 507
Figure 2. Sensitivity and specificity of PCR, nested PCR and qPCR in the 508
amplification of TiLV. (A) Ten-fold dilutions of a plasmid containing a 491 bp long 509
PCR fragment, derived from TiLV clone 7450 (GenBank Accession No. KJ605629), 510
were subjected to PCR with primers, amplifying either a 491 bp (Upper Panel) or 250 511
bp (Middle Panel) fragments. A nested PCR, using the above two sets of primers was 512
also performed (Lower Panel). Lanes 1 to 9 show the PCR products for 10-5 to 10-13 513
dilutions range, respectively, separated on a 1% agarose gel by electrophoresis. The 514
PCR reaction that amplified the 10-10 dilution (Lane 6) contained 7 copies of TiLV 515
sequence. (B) qPCR reactions were also applied to the dilutions and primer pairs 516
described in (A). The values of the threshold cycle (Ct) were plotted against 517
calculated TiLV copies and trendlines were added using Excel software. Reactions 518
were run in triplicates and only the linear range is shown. (C) cDNAs of TiLV-519
infected E-11 cells (Lane 1), Naïve E-11 cells (Lane 2) or NNV-infected E-11 cells 520
(Lane 3) were subjected to Nested PCR with TiLV-specific primers as in (A), to 521
detect TiLV sequences. Amplification of TiLV sequences from the plasmid described 522
in (A) was used as a positive control (Lane 4). Amplification reaction with no DNA 523
template served as a negative control (Lane 5). The absence or presence of NNV 524
sequences in cDNAs, prepared from naïve (Lane 6) or NNV-infected (Lane 7) E-11 525
cells, respectively, was confirmed by PCR with NNV-specific primers. M, denotes 526
size markers. 527
528
Figure 3. Detection of TiLV RNA in preserved tilapia livers from Ecuador and 529
Columbia. Nested RT-PCR was used to determine the presence or absence of TiLV 530
RNA in liver samples, preserved in RNAlater reagent. (A) Samples from Ecuador of 531
diseased (Lanes 1-6) or healthy fish (Lanes 7-12). Reaction with no RNA served as a 532
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
17
negative control (Lane 13). (B) Samples from Columbia of diseased (Lanes 1-6) or 533
healthy fish (Lanes 7-12). M marks DNA size markers. 534
535
TABLES 536
537
TABLE 1. aComparison of TCID50 values for three TiLV-susceptible cell lines 538
Cell Lines
Experiment No. E-11 TmB OmB
1 3.2x105 5x105 1.6x105
2 4x106 4x105 5x105
3 1.6x105 2x105 1.6x105 aThe same stock of TiLV (grown in E-11 cells) was quantified in three independent 539
endpoint dilution assays. Values are in TCID50/ml. 540
541
TABLE 2. TiLV detection in clinical specimens by culturing, RT-PCR and 542
nested RT-PCR. 543
Specimen No. Location aCPE RT-PCR Nested RT-PCR
1 Farm 1, Galilee + + +
2 Farm 1, Galilee + - +
3 Farm 2, Jordan
Valley
+ - +
4 Farm 2, Jordan
Valley
+ - +
5 Farm 3, Jordan
Valley
+ + +
6 Farm 4, Jordan
Valley
+ + +
7 Farm 4, Jordan
Valley
+ - +
8 Farm 5, Jordan
Valley
+ - +
9 Farm 6, Coastal + - +
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
18
region
10 Farm 7, Jordan
Valley
+ - +
11 Farm 8, Galilee + - -
12 Farm 9, Jordan
Valley
b+ - +
13 Farm 9, Jordan
Valley
+ - +
% Positives 100 23 92 aCPE was detected in E-11 cells, incubated with the brain specimens. 544 bCPE visible only after two additional passages on E-11 cell cultures. 545
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from
on January 27, 2017 by UN
IVE
RS
ITY
OF
ED
INB
UR
GH
http://jcm.asm
.org/D
ownloaded from