© 2008 The Authors

Doi: 10.1111/j.1742-7843.2008.00215.x

Journal compilation

© 2008 Nordic Pharmacological Society

. Basic & Clinical Pharmacology & Toxicology

,

103

, 25–30

Blackwell Publishing Ltd

Effects of Nitric Oxide Modulators on Cardiovascular Risk Factors in Mild Hyperhomocysteinaemic Rat Model

Meenakshi Sharma, Santosh Kr. Rai, Rakesh Kr. Tiwari, Manisha Tiwari and Ramesh Chandra

Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi, India

(Received September 18, 2007; Accepted November 8, 2007)

Abstract:

Hyperhomocysteinaemia is considered to be an independent risk factor in atherosclerosis. In the present article,we observed the effect of nitric oxide modulators on cardiovascular risk factors in mild hyperhomocysteinaemic rats. A ratmodel of mild hyperhomocysteinaemia was established by administering methionine (1 g/kg body weight, orally) for 4weeks. The other groups were concomitantly treated with sodium nitroprusside (SNP) and N

ω

-nitro-

l

-arginine (LNNA)during the induction of hyperhomocysteinaemia. Lipid profile, total antioxidant capacity and the level of homocysteineand NO

x

(nitrates and nitrites) was examined in serum at 0 and 4 weeks. Activity of 3-hydroxy-3-methylglutaryl-coenzymeA (HMG-CoA) reductase, the mRNA level of caveolin, P2 receptors and cardiovascular risk factors were also analysed.Stimulated lipid profile of rats by the treatment of methionine (1 g/kg body weight) reduced significantly by the treatmentof SNP with methionine. LNNA increased the level of cholesterol in aorta (P < 0.05

versus

group II). SNP significantlysuppressed the activity of HMG-CoA reductase. The mRNA levels of caveolin (P < 0.05), P2X (P < 0.05) and P2Y(P < 0.05) showed a significant decrease in rats administered with SNP. LNNA showed significant induction in the expressionof caveolin (P < 0.01) and P2Y (P < 0.01) expression. The level of P2X showed no remarkable change in animalstreated with LNNA and methionine both. These data conclude that nitric oxide modulators modulate the effect ofhyperhomocysteinaemia on the other cardiovascular risk factors and confirm the finding that nitric oxide plays an

important role in homocysteine-induced cardiovascular diseases.

Hyperhomocysteinaemia is a significant risk factor incardiovascular diseases like atherosclerosis. Extensive clinicalresearch has been performed showing a more tenuousrelationship between homocysteine-lowering treatment andcardiovascular end-points than the research communityexpected. The causality of hyperhomocysteinaemia in thecontext of atherosclerosis has therefore been doubted. One ofthe observed mechanism by which hyperhomocysteinaemiainitiated its effect is endothelial dysfunction [1,2]. The mostimportant and well-known endothelium-derived mediator thatis responsible for endothelium dysfunction is nitric oxide [3].Nitric oxide release by the endothelium regulates blood flow,inflammation and platelet aggregation, and consequentlyits disruption during endothelial dysfunction can decreaseplaque stability and encourage the formation of atheroscleroticlesions and thrombi [4].

There is some controversy as to the effects of hyperhomo-cysteinaemia on nitric oxide production: it has been shownthat hyperhomocysteinaemia both up-regulates [5] and down-regulates it [6]. From our previous

in vivo

studies on the effectof different doses of methionine in rats, we observed that nitricoxide level decreases in a dose-dependent manner [7]. The studiesby Zhang

et al

. also showed that high homocysteine levelin serum suppresses the nitric oxide released from the

endothelium [8]. Still, there is not much data for implicatingthe role of nitric oxide in hyperhomocysteinaemia that initiatedcardiovascular diseases. This particular study was designed toobserve the effect of supplementing the mild hyperhomo-cysteinaemic rats with exogenous nitric oxide modulators[sodium nitroprusside (SNP) and N

ω

-nitro-

l

-arginine (LNNA)].At low concentrations, nitric oxide has the potent inhibitory

effect on the oxidative modification of low-density lipoproteins(LDL) and protects against reactive oxygen species associateddamage, whereas high concentrations of nitric oxide may becytotoxic. Consequently, the peroxidant

versus

antioxidantactivity of nitric oxide depends highly on the relative concen-trations of the individuals reactants in the microenvironmentof the nitric oxide generation and the local flux of Thus,the level of vascular antioxidant potential has a great impacton the endothelial nitric oxide bioactivity [4]. Keeping this inview, we also investigated the effect of nitric oxide modulatorson oxidative stress.

In our previous study, we observed that hyperhomocystei-naemia initiated atherosclerosis by modulating the cholesterolbiosynthesis and by significantly inducing the level of othercardiovascular risk factors and markers, which play animportant role in initiating atherosclerosis [7]. In the presentstudy, the mild hyperhomocysteinaemic rat model wasprepared by treating the animals with methionine (1 g/kg bodyweight, orally) for 4 weeks and the effect of SNP (nitric oxidedonor) and LNNA (nitric oxide inhibitor) was observed onthis hyperhomocysteinaemia model. Preliminary studies shownthat the rats administered with SNP (1 mg/kg body weight,

Authors for correspondence: Meenakshi Sharma and RameshChandra, Dr. B. R. Ambedkar Center for Biomedical Research,University of Delhi, Delhi 110 007, India (fax (+)91-11-27666248,e-mail meenakshisha@gmail.com; acbrdu@hotmail.com).

O2− .

26

MEENAKSHI SHARMA

ET AL.

© 2008 The AuthorsJournal compilation

© 2008 Nordic Pharmacological Society.

Basic & Clinical Pharmacology & Toxicology

,

103

, 25–30

intraperitoneally) and LNNA (1 mg/kg body weight, intra-peritoneally) alone did not affect the serum homocysteinelevel, lipid profile, food and water intake (data not shown).

The lipid profile and nitric oxide level of all the groups wereexamined in serum, aorta and liver of rat. The effect of nitricoxide modulators on the serum level of resistin, C-reactiveprotein and cysteinyl-leukotrienes were also observed in the mildhyperhomocysteinaemic rat model. As caveolin and P2 receptorsplay an important role in cardiovascular diseases, the effect ofnitric oxide modulators on the mRNA levels in aorta of treatedrats was also investigated. Along with these parameters, thetotal antioxidant capacity in rats administered with methioninewas also observed to keep check on oxidative stress.

Materials and Methods

Animals.

Adult male rats of Wistar strain weighing 100–120 gwere used in the investigation. The rats were selected at random fromthe stock colony maintained in the animal house facility, Dr. B. R.Ambedkar Center for Biomedical Research, University of Delhi,Delhi, India. Animals were maintained in an air-conditioned roomwith free access to food and water. The room was maintained at25 ± 2

°

with natural day light and no light after 7 p.m. until morning.

Induction of hyperhomocysteinaemia.

Mild hyperhomocysteinaemiawas induced by daily administration of methionine (1 g/kg bodyweight, in saline solution orally) for 4 weeks. This model of mildhyperhomocysteinaemia resulted in mild elevation in serumhyperhomocysteinaemia level (10–13

μ

M/l) [7].

Experimental design.

Rats were divided into four groups of sixanimals each. The animals were fed with Gold Mohar rat feedsupplied by Brooke Bond India Ltd. The rats in group I was fed onlyrat chow and saline solution. The other groups were fed with 1 g/kgbody weight of methionine (orally dissolved in saline). Groups IIIand IV were fed with 1 mg/kg body weight (intraperitoneally) ofSNP and LNNA, respectively along with methionine. Blood sam-ples were collected from the retroorbital plexus for measurement ofserum homocysteine, total cholesterol (TC), triglyceride (TG),high-density lipoprotein (HDL), resistin, C-reactive protein andcysteinyl leukotrienes at time 0 and 4 weeks. The rats were fed theirrespective diets for 4 weeks. All the experiments were run in triplicates.The weights of the rats were recorded at 0 and 4 weeks. Theexperiments were designed and conducted in accordance withguidelines of Institutional Animals Ethics Committee.

Tissue preparation.

After a 12-hr overnight fast, animals wereanaesthetized at about 10 a.m. to minimize the diurnal variationduring cholesterol synthesis after overnight fast [9]. Blood wasdrawn from the retroorbital sinus using capillary tubes, into driedtest tubes. The serum was separated for biochemical estimations.Each group of rats was killed by decapitation. The thoracic aortaeand liver of these rats were rapidly and carefully dissected, collected,rinsed in ice-cold solution, and aorta was aliquoted for the extractionof total RNA. Liver samples were frozen at –80

°

for furtherbiochemical use [10]. Cytosolic and microsomal fraction of aortaand liver were prepared as described in the previous paper [

7

].

Biochemical estimations.

The levels of total cholesterol weredetermined using the method of Zlatkis

et al

. [11]. The levels oftriglycerides were determined by the method of Van Handel andZilversmith [12]. 3-Hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase activity was determined by the method ofVenugopala

et al

. [13]. The levels of serum oxidized LDL weremeasured by the method of Ahotupa

et al

. [14]. HDL levels weremeasured by the method of Grove [15]. Nitric oxide release was

determined spectrophotometrically by measuring accumulation ofnitrates and nitrites as described by Hortelano

et al

. [16]. Total anti-oxidant capacity was assessed by method of Korasevic

et al

. [17].

Estimation of cardiovascular risk factors.

C-Reactive protein wasanalysed by high-sensitive C-reactive protein enzyme immunoassaytest kit (Diagnostic Automation Inc., Calabasas, CA, USA). Serumresistin was measured using the murine enzyme immunoassay kitfrom Cayman Chemical Company (Ann Arbor, MI, USA). Serumcysteinyl leukotriene was measured using the enzyme immunoassaykit from Cayman Chemical Company.

Homocysteine estimation.

Homocysteine estimation was per-formed in serum using the high performance liquid chromatographysodium borohydride/monobromobimane (NaBH

4

/mBrB methodused NaBH

4

for reduction and mBrB for derivatization) essentiallyaccording to the method of Ubbink

et al

. with homocysteine as anexternal standard [18].

RNA isolation.

Total RNA was isolated from the aorta with Trizolreagent according to the manufacturer’s instructions. The amountof RNA was determined by measuring absorption at 260 nm. Qualitiesof RNA isolates were controlled by the 260/280 ratios and byelectrophoresis in denaturant 2% agarose gel [7].

Reverse transcription and polymerase chain reaction.

Two micro-grams of total RNA (2

μ

l) was reverse transcribed into cDNA usingRevertAid

TM

first strand cDNA synthesis kit (Fermentas Inc., Gaithers-burg, MD, USA). First strand cDNA was synthesized using oligo (dT)

18

primers and Moloney murine leukemia virus reverse transcriptase in20

μ

l reaction volume. Primers for P2X, P2Y, caveolin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from ProlabMarketing, New Dehli, India (table 1). Polymerase chain reaction (PCR)was performed in 20

μ

l reaction mixture containing 10

×

PCR buffer,2 mM MgCl

2

, 0.2 mM of each deoxynucleotide, 0.5

μ

m of each primer,0.625 units of

Taq

polymerase and nuclease-free water. Onemicrolitre of cDNA was used as a template in each PCR. Data wasnormalized to the GAPDH signal. The amplicons were resolved in 2%agarose gel containing ethidium bromide (1

μ

g/ml). The ethidiumbromide stained products were photographed and intensity of bandswere analysed on Alpha Imager

TM

2200 (Alpha Innotech Corporation,San Leandro, CA, USA). Experiments were performed on the aortasamples of all the animals. Each experiment was performed in duplicate.The means of the duplicates were used for subsequent calculations [19].

Densitometric and statistical analysis.

The intensities of bandsobtained from RT-PCR were estimated with Alpha Imager

TM

2200(Alpha Innotech Corporation). The values are expressed as mean ±S.E. The significance of difference between means of two groups wasobtained with one-way

anova

, Tukey–Kramer multiple comparisonstest, using GraphPad Prism 3.0 computer software (San Diego, CAUSA). P < 0.05 was considered to be statistically significant.

Table 1.

Sequences of polymerase chain reaction primers.

Gene Sequence (5′–3′)Product

length (bp)

GAPDH FP TTCACCACCATGGAGAAGGC 237RP GGCATGGACTGTGGTCATGA

Caveolin-2 FP CAGTCATGGCTCAGTTGCAT 198RP CTTCATTGCGGGTATCCTGT

P2X FP TGCAAAGGGAGGGTGTAGTC 215RP GGCACCATCAAGTGGATCTT

P2Y FP TAGCAGGCCAGTAAGGCTGT 206RP GCTTGGGTGGTATGTGGAGT

FP, forward primer; RP, reverse primer.

NITRIC OXIDE AND HYPERHOMOCYSTEINAEMIA

27

© 2008 The AuthorsJournal compilation

© 2008 Nordic Pharmacological Society.

Basic & Clinical Pharmacology & Toxicology

,

103

, 25–30

Results

Body weight.

The changes in the body weights of the rats of the experimentalgroups are shown in table 2. There was progressive increasein the body weight of all groups. No significant change inbody weight was found in animals of different groups.

Level of total homocysteine in serum.

The changes in serum total homocysteine level of the four experi-mental groups are summarized in table 2. Total homocysteinelevels showed a significant increase of ~81%, ~68% and ~67%in groups II, III and IV, respectively, as compared to group I.

Lipid profile.

After 4 weeks, the levels of serum, hepatic and aorta choles-terol increased by ~86% (P < 0.001), ~66% (P < 0.001) and~18% (P < 0.05) in group II as compared to group I, respectively.Administration of SNP along with methionine showed nosignificant change in serum and aorta cholesterol level ascompared to group I, but increased the hepatic cholesterollevel by ~16% (P < 0.05) as compared to group I. Theanimals treated with both LNNA and methionine showedincreased levels of serum, hepatic and aorta cholesterollevels by ~72% (P < 0.001), ~78% (P < 0.001) and ~30%(P < 0.01), respectively, as compared to group I (table 2).

After 4 weeks, the levels of serum, hepatic and aortatriglyceride increased by ~58% (P < 0.001), ~17% (P < 0.05)and ~52% (P < 0.001) in group II as compared to group I,respectively. Administration of SNP along with methionineincreased the levels of triglyceride in serum and hepatic by~51% (P < 0.0.001) and ~4%, respectively, and decreased theaorta triglyceride by ~11% as compared to group I. Thelevels of triglyceride in serum, hepatic and aorta increased

by ~2-fold (P < 0.001) and ~20% and ~28% (P < 0.01) ingroup IV as compared to group I (table 2).

The values of HDL decreased by ~30% (P < 0.01) in groupII. The level of serum HDL increased by ~13% (P < 0.05)and decreased by ~49% (P < 0.05) in groups III and IV,respectively, as compared to group I (table 2).

The concentrations of Ox-LDL increased by ~2-fold(P < 0.001) in group II as compared to saline-fed rats. Thelevel of Ox-LDL increased by ~73% (P < 0.01) group III ascompared to group I. Group IV showed ~2.5-fold increasein the level Ox-LDL as compared to group I (table 2).

Serum level of resistin, C-reactive protein and cysteinyl leukotrienes.

Group II showed ~72% (P < 0.001) increase in the levels ofresistin at 4 weeks as compared to group I, but group IIIshowed ~41% (P < 0.05) increase in the level of resistin ascompared to group I. Group IV showed ~76% increase inthe level of resistin as compared to group I (table 2).

The values of levels of C-reactive protein were increasedby ~48% (P < 0.01) in group II as compared to group I(saline-fed rats). Group III showed ~14% (P < 0.05) increasein the levels of C-reactive protein as compared to group II. GroupIV showed ~1-fold increase as compared to group I (table 2).

The levels of cysteinyl leukotrienes in group II showed a sig-nificant increase of ~68% (P < 0.001) as compared to group I.The group III showed ~13% (P < 0.05) increase as compared togroup I, but a significant an increase of ~72% (P < 0.001) in thelevels of cysteinyl leukotrienes was observed in group IV (table 2).

Effect on activity of HMG-CoA reductase.

The activity of HMG-CoA reductase was determined bycalculating the ratio of HMG to mevalonate. An increase inthe ratio of HMG/mevalonate is an indication of a decline

Table 2.

Effect on lipid profile, cardiovascular risk factors and oxidative stress.

Group I Group II Group III Group IV

Body weight gain (g/week) 11 ± 1.5 12 ± 2.0 11 ± 2.5 13 ± 1.0Homocysteine (μmol/l) 7.135 ± 0.8 12.98 ± 2.11 12.05 ± 1.11 11.89 ± 1.41

Serum cholesterol (mg/dl) 16.8 ± 1.0 31.4 ± 1.31 15.6 ± 1.05 28.9 ± 1.51

Cholesterol hepatic (mg/g wet tissue) 4.5 ± 0.03 7.5 ± 0.022 5.25 ± 0.085 8 ± 0.082

Aorta cholesterol (mg/g wet tissue) 0.411 ± 0.02 0.485 ± 0.011 0.24 ± 0.013,6 0.5350 ± 0.091,4

Serum triglyceride (mg/dl) 95.37 ± 10.3 150.86 ± 21.33 144.67 ± 11.63 271.86 ± 7.73,6

Triglyceride hepatic (mg/g wet hepatic) 29.010 ± 1.0 33.89 ± 1.81 30.34 ± 0.9ns 34.76 ± 1.11

Triglyceride aorta (mg/g wet aorta) 2.77 ± 0.7 4.20 ± 0.53 2.45 ± 0.76 2.55 ± 0.55

Serum HDL (mg/dl) 5.0 ± 0.4 3.5 ± 0.62 4.35 ± 0.34 2.56 ± 0.22,4

Serum Ox-LDL (μmol/l) 0.049 ± 0.003 0.15 ± 0.013 0.085 ± 0.015 0.167 ± 0.013

Cysteinyl leukotriene (pg/ml) 320 ± 25.3 540 ± 15.61 360 ± 13.1 550 ± 16.12,4

C-reactive protein (mg/l) 3.5 ± 0.1 5.2 ± 0.22 4.0 ± 0.14 7.1 ± 0.023,5

Resistin (pg/ml) 142 ± 21.0 246 ± 12.42 201 ± 11.01,4 251 ± 19.82

Ratio of HMG/mevalonate 4.28 2.81 ± 0.032 3.35 ± 0.714 2.73 ± 0.02ns

Increase/decrease in activity (%) 34↑ versus group I 19↓ versus group II 3↑ versus group II22↑ versus group I 33% versus group I

Nitric oxide level (nmol/ml) 4.41 ± 1.0 3.2 ± 0.31 5.6 ± 0.41,5 2.7 ± 0.22,4

Total antioxidant capacity (mmol/l) 1.23 ± 0.02 0.72 ± 0.072 0.84 ± 0.012,4 0.65 ± 0.13,5

Values are mean ± S.E. HDL, high-density lipoprotein; LDL, low-density lipoprotein; ns, not significant.1P < 0.05 as compared to group I; 2P < 0.01 as compared to group I; 3P < 0.001 as compared to group I; 4P < 0.05 as compared to group II;5P < 0.01 as compared to group II; 6P < 0.001 as compared to group II.

28

MEENAKSHI SHARMA

ET AL.

© 2008 The AuthorsJournal compilation

© 2008 Nordic Pharmacological Society.

Basic & Clinical Pharmacology & Toxicology

,

103

, 25–30

in HMG reductase activity. HMG-CoA reductase activitywas found to show ~34% (P < 0.01) increase in group II ascompared to group I. Group IV showed an increase of~36% in the activity of HMG-CoA reductase as comparedto group I, whereas group III showed an decrease of ~21%(P < 0.05) as compared to group II (table 2).

mRNA levels of caveolin protein.

Estimation of relative steady state mRNA levels for caveolindetermined by densitometric scanning is presented in fig. 1B and1E. The mRNA expression of group II was increased by ~10%(P < 0.05) as compared to rats fed a normal diet. Group IIIshowed ~10% (P < 0.05) decrease in the mRNA levels of caveolinas compared to group II. An induction of ~15% (P < 0.05) wasobserved in mRNA levels in group IV as compared to group II.

mRNA levels of P2Y and P2X receptors.

Estimation of relative steady state mRNA levels for P2Xand P2Y determined by densitometric scanning is presentedin fig. 1. The mRNA expression of P2Y showed significantinduction of ~29% (P < 0.01) in group II as compared togroup I. The mRNA expression showed a reduction of ~8%(P < 0.05) in group III and increase of ~47% (P < 0.001) ingroup IV as compared to group II (fig. 1C and 1F).

The mRNA levels of P2X in groups II increased by ~20%(P < 0.05) as compared to group I. Group III showed adecrease of ~9% (P < 0.05) in the mRNA levels as comparedto group II. No significant change was observed in group IVas compared group II (fig. 1D and 1G).

Total antioxidant capacity and nitric oxide levels.

At 4 weeks, total antioxidant capacity decreased by ~41%(P < 0.01) in group II as compared to saline-fed rats(table 2). Group III showed ~31% (P < 0.05) decrease in thetotal antioxidant capacity as compared to group I. Totalantioxidant capacity decreased by ~47% (P < 0.01) in groupIV as compared to group I.

Groups II showed ~27% (P < 0.05) decrease in the level ofNO

x

at 4 weeks, but a significant increase of ~27% (P < 0.01)was observed in group III as compared to group I. The levelsof NO

x

showed a decrease of ~38% (P < 0.05) in group IVas compared to group I (table 2).

Discussion

The precise mechanism by which homocysteine causes vas-cular disease is not fully understood but several mechanismshave been suggested. Cellular and animal studies [20,21]indicate reduction in bioavailability of endothelium derivednitric oxide by the high level of homocysteine. At this stageof nitric oxide deprivation in homocysteinemia, if the nitricoxide has been supplied from the exogenous source thatcould contribute as a treatment of the disease.

In agreement with previous findings, our results indicatedthat administration of

l

-methionine to normal male Wistar ratsdecreased the nitric oxide levels significantly in rats treated with1 g/kg body weight of

l

-methionine. Direct effect of nitric oxide

modulator whether it is nitric oxide donor or nitric oxideinhibitor, on hyperhomocysteinaemia has never been investigated.

Sodium nitroprusside is a potent hypotensive agent widelyused to control hypertension during surgery (especially heartbypasses), in hypertension emergencies and to improve heartfunction after myocardial infarction [22]. The vasoactiveeffect of SNP is believed to be due to its ability to release itsnitric oxide next to vascular wall and produce endothelium-independent vasodilation. Nitroprusside also releases cyanideions, which are converted in the liver to thiocyanate by theenzyme rhodanase, a reaction that requires a sulfur donor suchas thiosulfate. Thiocyanate is then excreted by the kidney.In the absence of sufficient thiosulfate, cyanide ions canquickly reach toxic levels [23]. This is the reason that weused a dose of 1 mg/kg body weight for SNP.

Fig. 1. mRNA levels of caveolin-2 (198 bp), P2X receptors (215 bp)and P2Y receptors (206 bp) in experimental animals treated withsodium nitroprusside (SNP) and LNNA along with methionine, byRT-PCR. (A) mRNA levels of GAPDH. (B) mRNA levels of caveolin-2. (C) mRNA levels of P2Y. (D) mRNA levels of P2X. (E) Comparisonof mRNA levels of caveolin-2 with respect to corresponding levelsof GAPDH (standard). (F) Comparison of mRNA levels of P2Ywith respect to corresponding levels of GAPDH (standard). (G)Comparison of mRNA levels of P2X with respect to correspondinglevels of GAPDH (standard). Lane 1, normal chow diet. Lane 2,orally administered with 1 g/kg body weight of methionine withnormal diet. Lane 3, orally administered with 1 g/kg body weight ofl-methionine along with SNP (1 mg/kg body weight). Lane 4, orallyadministered with 1 g/kg body weight of l-methionine alongwith N-nitroarginine 1 mg/kg body weight. Lane M, DNA ladder(100–1000 bp), integrated density values (IDV) of all the groupswere normalized with IDV of GAPDH (fig. 1A). Each treatment onrats was repeated three times and values represent means ± S.E.obtained from duplicate assays on every treatment. *P < 0.05 ascompared to group I, **P < 0.01 as compared to group I.

NITRIC OXIDE AND HYPERHOMOCYSTEINAEMIA

29

© 2008 The AuthorsJournal compilation

© 2008 Nordic Pharmacological Society.

Basic & Clinical Pharmacology & Toxicology

,

103

, 25–30

Racotta

et al

. observed that administration of sodiumnitroprusside (2 mg/kg body weight) to rats stimulated the foodand water intake [24]. No significant change was observed infood intake in rats administered with SNP (1 mg/kg body weight)(data not shown). Administration of SNP along with homo-cysteine maintains the reducing level of nitric oxide in serum.Furthermore, it also induced the total antioxidant capacity inanimals treated with homocysteine. However, the administra-tion of LNNA exaggerated the inhibitory effect of hyperhomo-cysteinaemia on the level of nitric oxide and total antioxidantcapacity. These results are in consistent with antioxidativeactivity of nitric oxide donors [23] and pro-oxidative activity ofhomocysteine [1]. Administration of LNNA acted to acceleratethe pro-oxidative activity of homocysteine. Although adminis-tration of SNP and LNNA along with homocysteine producedno significant effect on the level of total homocysteine, whenthe lipid profile was examined we found that concomitanttreatment of SNP with homocysteine significantly reducedthe level of cholesterol in serum, liver and aorta along withdecrease in triglyceride in aorta in animals administered withmethionine. The hyperhomocysteinaemia rats treated withLNNA showed no marked effect on serum and hepatic cho-lesterol and triglyceride level, whereas in aorta, cholesterollevel increased significantly. Khedara

et al

. observed thatsupplementation of LNNA with the normal diet inducedhypercholesterolaemia in rats by lowering the conversion ofcholesterol to bile acids [25]. The dose of LNNA (1 mg/kgbody weight) at which we have studied the effect did notproduce any effect on the level of cholesterol and triglyceridealone but in combination with methionine it showed induc-tion in the level of cholesterol and triglyceride.

Sodium nitroprusside inhibitory effect on lipid profile wasalso corroborated by the data on Ox-LDL. In our results, weobserved a remarkable increase in plasma-oxidized LDLlevels when normal male Wistar rats were administered with1 g/kg body weight of

l

-methionine. Homocysteine has beenknown to favour the formation of oxidized LDL [7]. Theadministration of SNP decreased the level of Ox-LDLwhereas no significant effect of LNNA on the Ox-LDL level.

Our previous investigation showed that hyperhomocystei-naemia increased the level of resistin, C-reactive proteins andcysteinyl leukotrienes. Concurrent treatment of SNP (nitricoxide donor) with methionine decreased the level of resistin,C-reactive protein and cysteinyl leukotrienes. This showsthat the level of nitric oxide plays a central role in the hyper-homocysteinaemia-induced cardiovascular diseases.

High concentrations of resistin were shown to inducevascular endothelial dysfunction and vascular smooth musclecell proliferation [26]. We have observed that concurrenttreatment of SNP (nitric oxide donor) and LNNA (nitricoxide inhibitor) with methionine produce no significanteffect on the level of resistin as compared to level of resistinin animals treated with methionine alone.

C-Reactive protein is a marker for inflammation that hasbeen reported to be a risk factor for myocardial infarction inmany studies [27]. High C-reactive protein is associated withincreased coronary heart disease the level of C-reactive protein

may ultimately represent an important therapeutic target inmanaging coronary artery disease. Fichtlscherer

et al

. observedthat elevated C-reactive protein serum levels are indicativeof a systemic inflammatory response are associated with ablunted systemic endothelial vasodilator function [28]. Animalstreated with methionine alone showed significant (P < 0.01)increase in the level of C-reactive protein but when methioninewas administered with SNP the level of C-reactive protein wentdown. We observed that LNNA along with methioninesignificantly increased (~36%) the level of C-reactive proteinas compared to group II. By comparing the level of C-reactiveprotein and nitric oxide in different groups, we found thatthe level of C-reactive protein is inversely proportional tothe level of nitric oxide in different groups. Our resultswere in accordance with other studies that showed that C-reactive protein caused a decrease in endothelial nitric oxidesynthase (eNOS) expression and bioactivity [29].

Leukotrienes are autocrine and paracrine eicosanoid lipidmediators derived from arachidonic acid by 5-lipoxygenase.During cysteinyl leukotriene interaction, they can stimulatepro-inflammatory activities such as endothelial cell adherenceand chemokine production by mast cells [30]. The level ofcysteinyl leukotrienes significantly increased (P < 0.05 versusgroup I) in methionine-treated rats. The administration ofSNP concurrently for 4 weeks during induction of hyper-homocysteinaemia, markedly reduced (P < 0.05 versus groupII) the level of cysteinyl leukotrienes. These data suggested thatto some extent cysteinyl leukotrienes also showed indirectrelationship with the level of nitric oxide, but the concomi-tant treatment of LNNA with methionine did not show anysignificant effect on the level of cysteinyl leukotrienes.

During our investigation, we have studied the effect of nitricoxide modulators on the effect of homocystiene on theexpression of P2 receptors. Our previous data showed thathyperhomocysteinaemia increased the mRNA level of P2Xas well as of P2Y in the aorta [7]. Concomitant treatment ofSNP with methionine suppressed the mRNA level, at a smallbut statistically significant level. Therefore, these effects ofSNP also make its contribution in cardioprotective effect.LNNA potentiated the effect of homocysteine on themRNA level of P2Y receptors. Treatment of LNNA did notshow significant effect on the mRNA level of P2X receptors.

Caveolin forms oligomers and associates with cholesterol andsphingolipids in certain areas of the cell membrane of cells,and causes the formation of caveolae. Caveolae are sometimesconsidered a subset of lipid rafts. Exposure of endothelial cellsto LDL cholesterol was shown to lead to the up-regulation ofcaveolin abundance and to be paralleled by an increase incaveolin–eNOS complex formation [31], thereby preventingboth basal and agonist-stimulated nitric oxide production. Theseobservations provided some clues to a new pathogenic mecha-nism linking hypercholesterolaemia and endothelial dysfunction.

We have observed in our study that administration of 1 g/kgbody weight of methionine to rats increased the mRNAlevel of caveolin by ~14% (P < 0.05 versus group I) with ~30%decrease in serum nitric oxide level. The administration of SNPconcurrently with methionine treatment decreased the mRNA

30 MEENAKSHI SHARMA ET AL.

© 2008 The AuthorsJournal compilation © 2008 Nordic Pharmacological Society. Basic & Clinical Pharmacology & Toxicology, 103, 25–30

level of caveolin by ~10% (P < 0.05 versus group II) and ~75%increase in the nitric oxide level. LNNA along with methionineincreased the caveolin mRNA level by ~15% (P < 0.01 versusgroup II) whereas the nitric oxide level decreased by ~16%(P < 0.05 versus group II). The exact mechanism of action ofSNP and LNNA on caveolin–eNOS complex can be studiedby further deep investigation in this particular matter.

To conclude, the present study confirms the fact thatnitric oxide plays an important and central role in hyper-homocysteinaemia-initiated cardiovascular diseases as evidentfrom the results that nitric oxide modulators can modulatethe effect of hyperhomocysteinaemia. The unique feature ofthe present study is that nitric oxide donor (SNP) increasedthe nitric oxide level in body and directly or indirectlyaffected the other cardiovascular risk factors induced bymild hyperhomocysteinaemia. Concomitant treatment ofnitric oxide inhibitor (LNNA) for 4 weeks during the inductionof hyperhomocysteinaemia potentiated the adverse effect ofhomocysteine on cardiovascular risk factors. The elucidation ofthe precise mechanism of pharmacological effect of SNP andLNNA on hyperhomocysteinaemia needs further investigation.

AcknowledgementsThe authors wish to thank Prof Vani Brahmachari for

her valuable suggestions. The authors wish to acknowledgethe financial support received from the Department ofScience and Technology, Delhi, India. The facilities providedby Dr. B. R. Ambedkar Center for Biomedical Research,University of Delhi, India, are gratefully acknowledged.

References

1 Tyagi N, Moshal KS, Tyagi SC. Mechanisms of homocysteineinduced oxidative stress. Am J Physiol Heart Circ Physiol2005;289:2649–56.

2 Lang D, Kredan MB, Moat SJ, Hussain SA, Powell CA,Bellamy MF et al. Homocysteine-induced inhibition ofendothelium-dependent relaxation in rabbit aorta: role forsuperoxide anions. Arterioscler Thromb Vasc Biol 2000;20:422–7.

3 Laufs U. Beyond lipid lowering: effects of statins on endothelialnitric oxide. Eur J Clin Pharmacol 2003;58:719–31.

4 Rekka EA, Chrysselis MC. Nitric oxide in atherosclerosis. MiniRev Med Chem 2002;2:585–93.

5 Upchurch GR, Welch G, Fabian A, Freedman J, Johnson J,Keaney J et al. Stimulation of endothelial nitric oxide productionby homocysteine. Atherosclerosis 1997;132:177–85.

6 De Groote MA, Testerman T, Xu Y, Stauffer G, Fang FC.Homocysteine antagonism of nitric oxide-related cytostasis inSalmonella typhimurium. Science 1996;272:414–7.

7 Sharma M, Rai S K, Tiwari M, Chandra R. Effect of hyper-homocysteinemia on cardiovascular risk factors and initiationof atherosclerosis in Wistar rats. Eur J Pharmacol 2007;574:49–60.

8 Zhang X, Li H, Jin H, Ebin Z, Brodsky S, Goligorsky SM.Effects of homocysteine on endothelial nitric oxide production.Am J Physiol Renal Physiol 2000;279:F671–8.

9 Jurevics H., Hostettler J, Barrett C, Morell P, Toews AD.Diurnal and dietary-induced changes in cholesterol synthesiscorrelate with levels of mRNA for HMG-CoA reductase. JLipid Res 2000;41:1048–53.

10 Bligh EG, Dyer WJ. A rapid method of total lipid extractionand purification. Can J Biochem Physiol 1959;37:911–7.

11 Zlatkis A, Zak B, Boyle AJ. A new method for the direct deter-mination of serum cholesterol. J Lab Clin Invest 1953;41:486–92.

12 Vanhandel E, Zilversmit DB. Micromethod for the direct deter-mination of serum triglycerides. J Lab Clin Invest 1957;50:152–7.

13 Venugopala RA, Ramakrishanan S. Indirect assessment ofhydroxymethylglutaryl-CoA reductase (NADPH). Clin Chem1975;21:1523–5.

14 Ahotupa M, Ruutu M, Mantyla E. Simple methods of quantifyingoxidation products and antioxidant potential of low densitylipoproteins. Clin Chem 1996;29:139–44.

15 Grove TH. Effect of reagent pH on determination of highdensity lipoprotein cholesterol by precipitation with sodiumphosphotungustate-magnesium. Clin Chem 1979;25:560–4.

16 Hortelano S, Dewez B, Genaro AM, Daiz-Guerra MJ, Bosca L.Nitric oxide is released in regenerating liver after partial hepatectomy.Hepatology 1995;21:776–86.

17 Koracevic D, Koracevic G, Djordjevic V, Andrejevic S, Cosic V.Methods for the measurement of antioxidant activity in humanfluids. J Clin Pathol 2001;54:356–61.

18 Ubbink JB, Hayward Vermaak WJ, Bissbort S. Rapid highperformance liquid chromatographic assay for total homocysteinelevels in human serum. J Chromotagraphy 1991;565:441–6.

19 Baba MI, Kaul D, Grover A. Importance of blood cellular genomicprofile in coronary heart diseases, J Biomed Sci 2006;13:17–26.

20 Stamler JS, Osborn JA, Jaraji O, Rabbani LE, Mullins M,Singel D et al. Adverse effects of homocysteine are modulatedby endothelium-derived relaxing factor and related oxides ofnitrogen. J Clin Invest 1993;91:308–18.

21 Lentz SR, Sobey CG, Piegors DJ, Bhopatkar MY, Faraci FM,Malinow MR et al. Vascular dysfunction in monkeys with diet-induced hyperhomocysteinemia. J Clin Invest 1996;98:24–9.

22 Siegel P, Maraca PP, Green JR. Sodium nitroprusside in thesurgical treatment of cerebral aneurysms and arteriovenousmalformations. Br J Anaesth 1971;43:790–5.

23 Duan XW, You YLG, Su XG, Qu HX, Joyce DC, Jiang YM.Influence of the nitric oxide donor, sodium nitroprusside, onlipid peroxidation and anti-oxidant activity in pericarp tissue oflongan fruit. J Hortic Sci Biotechnol 2007; 82:467–73.

24 Racotta R, Soto-Mora LM, Piñón M, Quevedo L. Some partic-ularities of sodium nitroprusside stimulatory effects on food intake.Life Sci 2001;69:659–68.

25 Khedara A, Goto T, Kayashita J, Kato N. Hypercholesterolemiceffect in rats of a dietary addition of the nitric oxide synthaseinhibitor, L-Nω nitroarginine, by less synthesis of bile acids. BiosciBiotechnol Biochem 1998;62:773–7.

26 Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR,Wright CM. The hormone resistin links obesity to diabetes.Nature 2001;409:307–12.

27 Han KH, Hong KH, Park JH, Ko J, Kang DH, Choi KJ et al.C-Reactive protein promotes monocyte chemoattractant protein-1-mediated chemotaxis through up-regulating CC chemokine receptor2 expression in human monocytes. Circulation 2004;109:2566–71.

28 Fichtlscherer S, Rosenberger G, Walter DH, Breuer S, DimmelerS, Zeiher AM. Elevated C-reactive protein levels and impairedendothelial vasoreactivity in patients with coronary artery disease.Circulation 2000;102:1000–6.

29 Venugopal SK, Devaraj S, Yuhanna I, Shaul P, Jialal I. Demonstra-tion that C-reactive protein decreases eNOS expression and bioactiv-ity in human aortic endothelial cells. Circulation 2002;106:1439–41.

30 Helgadottir A, Manolescu A, Thorleifsson G. The gene encoding5-lipoxygenase activating protein confers risk of myocardialinfarction and stroke. Nat Genet 2004;36:233–9.

31 Sbaa E, Fre´rart F, Feron O. The double regulation of endothelialnitric oxide synthase by caveolae and caveolin: a paradox solvedthrough the study of angiogenesis. Trends Cardiovasc Med2005;15:157–62.