environmental signal integration by a modular and gate by j christopher anderson, christopher a...
TRANSCRIPT
![Page 1: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/1.jpg)
Environmental Signal Integration by a Modular AND
Gate
By J Christopher Anderson, Christopher A Voigt and Adam P Arkin
Presented by Alexandra Doolittle for 20.385
02.16.2010
![Page 2: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/2.jpg)
Hypothesis
• AND Gates can be used to integrate environmental information
• The AND gate is modular since promoters comprise both the inputs and output of the system
![Page 3: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/3.jpg)
The AND Gate
Input A- Promoter which controls the Transcription of T7 RNA Polymerase (mod - 2 amber STOP codons)
Input B- Promoter which controls the amber suppressor tRNA supD
Output - T7 RNA is synthesized and activates T7 promoter
![Page 4: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/4.jpg)
AND Gate to Translate T7 RNA Polymerase Resulting in GFP Expression
QuickTime™ and a decompressor
are needed to see this picture.
![Page 5: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/5.jpg)
Common Genetic Circuit Problem - Impedance Matching
Construct 1: GFP was produced in the absence of salicate. Rbs for PBAD was strong enough to produce T7 poly
Input T7 Poly
output GFP
![Page 6: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/6.jpg)
Saturation Mutation Library for PBAD
• Parental GGAGGAATTAACCATG• Libraryb NNNGGAATTAACCRTG• B9 CTAGGAATTAACCGTG• F11 AAAGGAATTAACCGTG• MgrB AAAGGAATTAACCATG• Salc TCAGGAGTCATCATTATTTATG
![Page 7: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/7.jpg)
B9 Characterization through Fluorimetry and Flow Cytommetry
A. Visualised 64 combinations of inducers through Fluorimetry
B. 1000 fold induction between on and off states.
QuickTime™ and a decompressor
are needed to see this picture.
![Page 8: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/8.jpg)
Transfer Function
• steady state response of the system as a function of the activity of the input promoters– Can understand how the input promoters affect the function– Black Box Model: levels of input output
• I1 and I2 represent PBAD and Psal
![Page 9: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/9.jpg)
Transfer Function Characterization for Each Promoter
• Currently - use mutation and screening to determine the best rbs strength
• Now- use the transfer function to determine the strength of rbs needed
QuickTime™ and a decompressor
are needed to see this picture.
![Page 10: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/10.jpg)
B9 Transfer Function Data Fit to determine a and b
• a = 50
• b = 3000
QuickTime™ and a decompressor
are needed to see this picture.
![Page 11: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/11.jpg)
Range of Output Possibilities
• B9 and F11 visualization of input strength to output
• Demonstrates the entire range of possibilities. – Movement of the
white box determined via rbs strength
QuickTime™ and a decompressor
are needed to see this picture.
![Page 12: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/12.jpg)
AND Gate Modularity
QuickTime™ and a decompressor
are needed to see this picture.
![Page 13: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/13.jpg)
Critique• Transfer Function - based on steady state.
Fails to take into account dynamic system responses.– Black Box model to simple.
• Cell characteristics could affect the response– Nutrient levels– Temperature– Phase of Growth
![Page 14: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/14.jpg)
Why Do We Care?
• Integrating multiple signals from the environment can increase sensing specificity.
• Can identify new environments where there is not a strong recognizable single symbol.
• The modularity allows the circuit to be attached to multiple inputs and outputs.
![Page 15: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/15.jpg)
Why Do We Care?
• Transfer function can be used to predict strength levels of the inputs to produce a functional system.
• Other potential Regulators:– Nonsense, missense and frameshift
regulators– riboregulators
![Page 16: Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle](https://reader036.vdocument.in/reader036/viewer/2022062517/56649f2b5503460f94c4567b/html5/thumbnails/16.jpg)
Going Farther.
• Beijing iGEM 2009 - Used the and gate to create conditional memory in ecoli
• Biosensors - respond to changes in the environment.
• A stop growth switch in cells when certain nutrients are lacking