erhardt a, 1999

Mutations of the Core Promoter and Response to InterferonTreatment in Chronic Replicative Hepatitis B

ANDREAS ERHARDT,1 ULF REINEKE,1 DIRK BLONDIN,1 WOLFRAM HUBERT GERLICH,2 ORTWIN ADAMS,3

TOBIAS HEINTGES,1 CLAUS NIEDERAU,1 AND DIETER HAUSSINGER1

In chronic replicative hepatitis B the significance ofmutations in the basic core promoter (BCP), core upstreamregulatory sequences (CURS) and negative regulatory ele-ment (NRE) for response to interferon (IFN) is unknown. Asequence analysis of the NRE, CURS, BCP, and precoreregion was performed from sera of 96 patients with chronicreplicative hepatitis B (64 hepatitis B e antigen [HBeAg]-positive patients and 32 HBeAg-negative patients) treatedwith alfa-IFN (IFN-a). The overall sustained response (SR)rate to IFN was 30% with no significant difference betweenHBeAg-positive and HBeAg-negative patients. IFN respon-siveness correlated to hepatitis B virus (HBV)-DNA levels,hepatitis B surface antigen (HBsAg) levels, the number ofmutations in the complete BCP, especially nucleotide (nt)region 1753 to 1766 and mutations at nt 1762 and 1764. InHBeAg-positive hepatitis, SR to IFN was associated with ahigh number of mutations in the BCP (P F .04) and nucleotideregion 1753 to 1766 (P F .015) as well as mutations atnucleotide 1764 (P F .007). In HBeAg-negative hepatitis,SR to IFN correlated with a low number of mutations in theBCP (P F .04) and nucleotide region 1753 to 1766 (P F .02)and a wild-type sequence at nt 1764 (P F .003). Prediction ofIFN response was possible on the basis of nt 1764 in 77% ofHBeAg-positive patients and 78% of HBeAg-negative pa-tients. IFN response did not correlate with the occurrenceof the 1896 mutation, mutations in the CURS or NRE, diseaseduration, ethnic origin of the patient, alanine transaminase(ALT) levels and HBV genotype. Our data suggest that HBVgenome mutations located within the BCP are determinantsof a response to IFN therapy. (HEPATOLOGY 2000;31:716-725.)

Chronic hepatitis B virus (HBV) is one of the leadinginfectious diseases worldwide associated with high morbidityand mortality.1 Successful interferon (IFN) treatment im-proves the long-term clinical outcome.2 Only 30% to 40% ofhepatitis B e antigen (HBeAg)-positive and 10% to 50% ofHBeAg-negative patients are reported to respond to IFNmonotherapy. The aim of this study was to investigatemolecular viral parameters for prediction of IFN response.

Most studies so far have shown that for HBeAg-positivepatients low transaminase levels (alanine transaminase [ALT],200 U/L), high viral replication (HBV DNA .300 pg/mL),long duration of disease, and low inflammatory score in liverhistology2-4 are associated with low response rates to IFNtherapy. Furthermore, hepatitis delta virus (HDV) coinfec-tion, human immunodeficiency virus (HIV) coinfection, andchronic dialysis negatively influence IFN response in chronichepatitis B. The significance of the HBeAg status for thelong-term outcome after IFN therapy is still under debate. Ithas been reported that HBeAg-negative status is associatedwith a high relapse rate and a poor sustained response of 10%to IFN therapy.5-9 However, these data contrast with sustainedresponse rates of 25% to 50% in HBeAg-negative patients.10-14

Genetic viral factors have been poorly investigated for theireffect on the outcome of IFN therapy. As yet, attention hasfocused on the precore region, the G1896A mutation in theprecore region, and the core gene of HBV. The occurrence ofthe G1896A mutation, converting a tryptophane (TGG) intoa translational stop codon (TAG), has been reported to beassociated with a bad prognosis15-17 and a poor response toIFN therapy6 in replicative hepatitis B negative for HBeAg.However, the results are controversial.10-12,18,19 Mutations inthe polymerase gene play an important role for resistance tonucleoside analogues, but do not seem to have an effect onthe outcome of IFN therapy. Whether variations of the coregene affect the response to IFN is under discussion.20-22 As yetthe relevance of mutations of the HBV X gene and the corepromoter region for responsiveness to IFN has not beenevaluated.

The basic core promoter (BCP; at nucleotide [nt] region1742-1849), the core upstream regulatory sequences (CURS;at nt region 1643-1742), and the negative regulatory element(NRE; at nt region 1611-1634) are located mainly in the HBVX gene and play an important role in replication and hepatitisB core antigen/HBeAg formation. Formation of the 3.5-kbpregenome messenger RNA (mRNA), which serves for trans-lation of the core and polymerase proteins, and the precore/core mRNA for translation of HBeAg is controlled by the BCPand CURS. The NRE abolishes the function of the CURS andBCP (Fig. 1). Within these regions various mutations have

Abbreviations: HBV, hepatitis B virus; IFN, interferon; HBeAg, hepatitis B e antigen;ALT, alanine transaminase; HDV, hepatitis delta virus; HIV, human immunodeficiencyvirus; BCP, basic core promoter; nt, nucleotide; CURS, core upstream regulatorysequences; NRE, negative regulatory element; mRNA, messenger RNA; HBsAg, hepatitisB surface antigen; HCV, hepatitis C virus; PEI-U, Paul-Ehrlich-Institute units; PCR,polymerase chain reaction.

From the 1Department of Internal Medicine, Division of Gastroenterology, Hepatol-ogy, and Infectious Diseases, Heinrich-Heine-University of Dusseldorf, Dusseldorf,Germany; 2Institut fur Medizinische Virologie, Justus-Liebig-Universitat Giessen,Giessen, Germany; and 3Institut fur Medizinische Mikrobiologie und Virologie,Heinrich-Heine-University of Dusseldorf, Dusseldorf, Germany.

Received April 13, 1999; accepted November 24, 1999.Supported by the Deutsche Forschungsgemeinschaft (Gottfried W. Leibniz Prize to D.H.).Address reprint requests to: Andreas Erhardt, M.D., Klinik fur Gastroenterologie,

Hepatologie und Infektiologie, Heinrich-Heine-Universitat Dusseldorf, Moorenstr. 5,D-40225 Dusseldorf, Germany. E-mail: [email protected]; fax: (49) 211-9346842.

Copyright r 2000 by the American Association for the Study of Liver Diseases.0270-9139/00/3103-0023$3.00/0

716

been described affecting the precore start codon,23 the encap-sidation signal,24 and the core promoter region.25-28 The mostcommon of these nucleotide exchanges is a G1764A muta-tion, which is often associated with an A1762T mutation.27

The G1764A mutation is located within the BCP, upstream ofthe pregenome and precore/core mRNA initiation sites andmay thus be involved in transcriptional regulation.

To determine predictive parameters for responsiveness toIFN treatment, an assessment of clinical parameters and asequence analysis of the complete NRE, CURS, BCP, andprecore region was performed in 96 patients with chronicreplicative hepatitis B.

PATIENTS AND METHODS

Patients. Ninety-six patients treated with IFN between March1988 and December 1998 at our center were enrolled. All patientshad completed a post-treatment follow-up of at least 6 months andhad available pretreatment serum samples. Thirty-two of the 96patients had an HBeAg-negative replicative hepatitis B.

A patient was considered to have chronic replicative hepatitis B ifhepatitis B surface antigen (HBsAg) and HBV DNA were testedpositive at least twice over a 6-month interval. Determination ofHBeAg status was done by analysis of 2 different serum samplescollected 6 months apart. All patients but 2 had elevated serum ALTfor at least 6 months. None of the patients had markers of HDV,hepatitis C virus (HCV), or HIV infection. Patients were treated with3 3 5 or 3 3 6 million units IFN-a per week. Therapy was given for4 to 6 months. Three HBeAg-negative patients (11%) were initiallytreated with 2 million units IFN-a 3 times weekly preceded by ashort-term cortisone administration. Sustained response to IFN-awas defined as persistent loss of HBV DNA in a hybridization assayand normalization of ALT (,22 IU/mL for men and ,19 IU/mL forwomen at 25°C) after treatment cessation. In HBeAg-positivepatients seroconversion from HBeAg to HBe-antibody was furtherrequired. Patients without sustained response were defined asnonresponders.

Serological Tests. Markers of HBV (HBsAg, anti-HBs, HBeAg,anti-HBe) and HDV (anti-HDV) were tested by commercial immuno-assays (Abbott Laboratories, North Chicago, IL). For detection of

anti-HCV a commercial enzyme immunoassay (HCV 2nd generationELISA; Ortho Diagnostics, Raritan, NJ) was used. Anti-HIV wasdetected by a commercial enzyme immunoassay (Abbott Laborato-ries). Serum HBV DNA was determined by a commercial standardhybridization technique (Digene; Murex Diagnostika, Burgwedel,Germany).29

Quantitative Assay of HBsAg and HBeAg. Quantitative assay ofHBsAg was done by Laurell electrophoresis as described30 with thefollowing modifications. Glass slides (3 3 2 inches) were coatedwith 6 mL of 0.6% low-mr agarose containing 10,000 mIU/mLpolyvalent anti-HBs in Laurell’s buffer. Ten-microliter HBsAg sampleswere run for 12 hours at 5 mA per slide. The length of theprecipation arc was converted to µg HBsAg/mL using a calibrationcurve and a reference serum. Samples containing greater than 30µg/mL were tested in dilution. The detection limit was 0.2 µg/mL,and the variation coefficient was 15%. One WHO unit of HBsAgcorresponds approximately to 0.5 ng HBsAg. ‘‘Ng’’ units from otherinvestigators, which have been differently calibrated using partiallyinactive HBsAg, are usually higher. An accurate description of theassay can be obtained from W. H. Gerlich (Institut fur MedizinischeVirologie, Justus-Liebig-Universitat Giessen, Giessen, Germany).Quantitative assay of HBeAg was done of HBeAg-positive patients insuitable serum dilutions using the Axsym 2.0 quantitative HBeAgenzyme immunoassay (Abbott Diagnostics, Wiesbaden, Germany).Results were expressed in Paul-Ehrlich-Institute Units (PEI-U).

HBV-DNA Extraction and Amplification for Sequencing. All investi-gated serum samples were drawn before IFN treatment. HBV DNAwas extracted from 10 µL of serum using an alkaline extractionprocedure as described previously31 and amplified by polymerasechain reaction (PCR). PCR was performed on 4-µL DNA extract in a100-µL reaction containing (final concentration) 50 mmol/L KCl, 10mmol/L Tris-HCl, 1.5 mmol/L MgCl2, 200 mmol/L of each of the 4deoxynucleotide triphosphates (substitution of thymidine by uri-dine), 1 unit N-uracil-glycosylase (Boehringer Mannheim, Mann-heim, Germany), 5 units Taq polymerase (Perkin Elmer Cetus,Norwalk, CT) and 200 nmol/L of each of the external primers. Foramplification of the precore region 35 cycles were completed withdenaturation for 1 minute at 95°C, annealing at 60°C for 1 minute,elongation for 2 minutes at 72°C, and a final elongation step of 10minutes. Primers used were sense 103 (TGTAAAACGACGGCCAGT-

FIG. 1. Map of the X and precore/core gene. The nucleotide sequencewith the HNF (hepatocyte nuclearfactor), COUP (chicken ovary up-stream promoter) transcription fac-tor binding sites is indicated at thebottom. Abbreviations: DR, directrepeat; Enh, enhancer; e, encapsida-tion signal. Numbering according toEcoRI restriction site as 0.

HEPATOLOGY Vol. 31, No. 3, 2000 ERHARDT ET AL. 717

GCCCAAGGTCTTACATAAGAGGAC; nt region 1639-1663; nu-meration with EcoRI restriction site as nt 0) with an M13 sequence atthe 58 terminus and antisense 104 (AAAGTTTCCCACCTTAT-GAGTCCA; nt region 2483-2460). If necessary a seminested PCRwas performed under modified conditions using 5 µL of the firstround PCR, primer sense 103 and antisense 105 (CCGAGATT-GAGATCTTCTGCGACGCGGCGATTGAGACC; nt region 2437-2400) and 20 cycles. Uracil-N-glycosylase was omitted in theseminested protocol. For PCR amplification of the NRE, CURS, andBCP the above protocol was slightly modified. Sense primer was 106(TGTAAAACGACGGCCAGTAGCGCATGCGTGGAACC; nt region1229-1245) and antisense primer was 107 (nt region 1783-1765;CAGGAAACAGCTATGAGCAGCCTCCTAGTACAAAGA) both in-cluding an M13 sequence. Annealing temperature was 51°C. For aseminested protocol primer antisense 107 and sense 108 (CTCTGC-CGATCCATACTG; nt region 1256-1273) were used. PCR wasperformed twice to ensure reproducibility.

Sequencing. Amplified DNA was purified by filtration through100,000 MWG centrifugal filter units (Millipore, Eschborn, Ger-many). Sequencing was performed using M13 forward primer(GTAAAACGACGGCCAGT) and M13 reverse primer (CAGGAAA-CAGCTATGAC) by direct cycle sequencing with dye-labeled dideoxy-nucleotides according to the manufacturer’s instructions (PerkinElmer Cetus). After precipitation of the labeled reaction productssequence analysis was performed on a 6% polyacrylamide urea gelusing an automated laser sequence analyzer (Applied Biosystem373, Weiterstadt, Germany). A positive control was (pGEM-3Zf1)included in each run.

Sequence Analysis. The obtained HBV X gene sequences werecompared with HBV databank entries of known HBV genotype32

with the following accession numbers: D00329, D00330, D00331,D00630, D12980, D23677, D23678, D23679, D23684, L08805,L27106, M12906, M32138, M38454, M38605, M54923, V00866,V00867, V01460, X01587, X02496, X02763, X04615, X52939,X59795, X69798, X75656, X75657, X75658, X75663, X75664, andX75665. For alignments of DNA sequences and genotype analysisthe Lasergene Megalign software (DNAStar Inc., Madison, WI) wasused.

Statistical Analysis. Fisher’s exact test (two sided), Student’s t test,Mann-Whitney test, and logistic regression were used to analyze thedata. Statistical analyses were done by using the SPSS program(SPSS, Inc., Munich, Germany).

RESULTS

Clinical parameters and HBV-DNA sequence were investi-gated in 96 IFN-treated patients. Patients’ baseline clinicalcharacteristics are shown in Table 1. The distribution ofmutations is summarized in Table 2.

Sequence Analysis of NRE (1611-1634) and CURS (1643-1742).The NRE was well conserved among all virus strains up to ntposition 1630 with only 4 nt exchanges. Mutational hot spotswere found at nt position 1631, 1634, 1635, and 1638.Further mutations clustered at nt positions 1678, 1676, 1674,and 1719 (Table 2).

Sequence Analysis of the Precore Region (1814-1901). TheG1896A mutation was found in 53% (17 of 32) of HBeAg-negative patients but in only 1.6% (1 of 64) of HBeAg-positive patients (P , .0005) and was associated with aG1899A in 44% of cases (8 of 18).

Of the 15 patients not bearing the G1896A mutation, 2carried a point mutation at the precore initiation codonconverting a methionine into a leucine or threonine and thuspreventing precore transcription. Two further patients (pa-tients no. 19 and 18) had insertions of 1 or 2 additionaladenines at nt 1840 and nt leading to frameshifts. Patient no.23 carried a deletion of 8 nucleotides in the precore open

reading frame. On the amino acid level 2 patients alsodisplayed transition of an essential cysteine to phenylalanine(codon 23) near the signal peptidase cleavage site. Overall, 25of 32 HBeAg-negative patients (78%) had mutations at thenucleotide or amino acid level within the precore region,which could explain HBeAg negativity.

Sequence Analysis of the BCP Region (1742-1849). The basiccore promoter comprises 3 AT-rich regions, a part of aKunitz-like serine protease inhibitor region (nt 1764-1797),the direct repeat 1 (nt 1824-1834), the initiation sites of theprecore/core mRNA (nt 1790 6 1 and 1783/1784) andpregenome mRNA (nt 1818) (Fig. 1). A sequence alignmentis depicted in Figs. 2 and 3.

A G1764A mutation was found in 30% (29 of 96) ofpatients. Three further patients showed a G1764T exchange,2 patients had a deletion of 8 or 9 nucleotides around nt1764, and 1 patient had an insertion of 2 nucleotides. Thus, atotal of 36% of patients (35 of 96) had nucleotide exchangesat position 1764. HBeAg-negative patients showed a higherfrequency of the 1764 mutation (59%) than HBeAg-positivepatients (25%; P , .002). A mutant nt 1764 was associated in83% (29 of 35) of patients with an A1762T/G mutation (Table2) and in 44% (8 of 18) with a 1896 stop mutation. Patientswith cirrhosis carried mutations at nt 1764 (64%; 11 of 17)more often than patients without cirrhosis (28%; 21 of 75;P , .009). This correlation was also observed in the subgroupof HBeAg-positive patients (P , .009) but not in HBeAg-negative patients.

TABLE 1. Clinical Parameters

CharacteristicsAll

Patients

HBeAg-PositivePatients

HBeAg-NegativePatients

SignificanceHBeAg-

pos./neg.

Origin (low/highprevalence)

56/40 39/25 17/15 NS

Sex (m/f) 79/17 50/14 29/3 NSAge (yr)

Mean 6 SD: 38.5 6 1.4 36 6 1.7 43 6 2.2 P , .028Range: 18-68 18-68 20-67

DNA (Log pg/mL)Mean 6 SD: 2.96 6 0.1 3.35 6 0.09 2.2 6 0.19 P , .0005Range: 0-5.07 0-5.07 1-3.8

HBsAg (Log µg/mL)Mean 6 SD: 1.3 6 0.07 1.6 6 0.06 0.61 6 0.1 P , .0005Range: 0-2.6 0.57-2.54 21-1.5

HBeAg (Log PEIU/mL)

Mean 6 SD: — 2.9 6 0.11 —Range: — 0.2-4.01 —

Disease duration(mo)*

Mean 6 SD: 68 6 8.1 45 6 5.5 123 6 21 P , .0005Range: 6-396 6-180 12-396

ALT (U/L)Mean 6 SD: 115 6 11 104 6 13 137 6 18 NSRange: 8-713 8-713 29-451

Genotype A (%) 50 53 44 NSGenotype B (%) 4 6 0 NSGenotype C (%) 8 13 0 P , .05Genotype D (%) 38 28 56 P , .013Cirrhosis* (%) 19 11 35 P , .018

Abbreviation: NS, not significant.*Data on disease duration were available in 88 and on cirrhosis in 92

patients.

718 ERHARDT ET AL. HEPATOLOGY March 2000

An A1762T/G mutation was observed in 30% (29 of 96) ofpatients (Table 1). One additional patient had a deletion.Significantly higher frequencies of the A1762T/G mutationwere observed in HBeAg-negative patients than in HBeAg-positive patients (53% vs. 20%; P , .002).

The 3 AT-rich regions, which are thought to bind to RNApolymerase for initiating transcription, were affected differ-ently by mutations. Within the nt region 1789 to 1795 only 4mutations were noted, whereas the regions 1757 to 1762 and1752 to 1755 displayed more than 20 mutations. The Kunitzdomain–like sequence carried a variety of mutations, mostoften a G1764A. A mean of 1.7 nt exchanges per patient werefound within the Kunitz domain of HBeAg-negative patientscompared with 1.2 nt exchanges in HBeAg-positive patients(P . .3). The direct repeat 1 was completely conserved in allbut 2 viral strains (patients no. 9 and 69). Four HBeAg-negative patients (no. 14, 16, 17, and 23) but no HBeAg-positive patient carried an A to G mutation at the precoremRNA transcription initiation site (nt 1789).

Response to IFN. The overall sustained response rate to IFNtherapy was 30% (29 of 96) of patients. Sustained responserates between HBeAg-positive (23%; 15 of 64) and HBeAg-

negative patients (44%; 14 of 32) did not differ significantly.The mean follow-up of patients with a primary response was29 6 4 months (median 22 months; range 6-70 months). Inthe total population of HBeAg-positive and HBeAg-negativepatients HBV DNA and HBsAg correlated with response toIFN. Sustained responders had lower DNA levels (10E2.35 60.2 pg/mL) than nonresponders (10E3.2 6 0.1 pg/mL; P ,.0005) and lower levels of HBsAg (10E0.96 6 0.12 vs.10E1.4 6 0.09; P , .0005). There was a tendency for higherALT levels in responder patients compared with nonre-sponders (139 U/L vs. 105 U/L; P . .15) (Table 3). WhenHBeAg-positive and HBeAg-negative patients were examinedseparately, further predictive parameters could be distin-guished.

In HBeAg-positive patients, the sum of mutations in theBCP correlated with the response to IFN. Responder patientscarried more mutations (3.6 6 0.8) than nonresponderpatients (2.0 6 0.4; P , .04) in the BCP. Responders hadmore nucleotide exchanges in nt region 1753 to 1766compared with nonresponders (1.4 6 0.4 vs. 0.6 6 0.1; P ,.015). A correlation with IFN response was also found fornucleotide 1762 and 1764 (P , .008 and P , .007). Patientswith mutations at these nt positions had a better response toIFN than patients with a wild-type sequence. Patients withwild-type nt 1762 and 1764 had markedly higher HBV-DNAlevels than patients with mutations in these positions(10E3.5 6 0.1 pg/mL vs. 10E3.0 6 0.17 pg/mL; P , .04).

In HBeAg-negative patients compared with HBeAg-positivepatients, an inverse correlation between mutations in theBCP, nt region 1753 to 1766, nt 1762 and 1762, andresponsiveness to IFN therapy was found. HBeAg-negativenonresponders carried an average of 4.5 6 1.0 mutationswithin the BCP compared with 2.0 6 0.3 mutations inresponder patients (P , .04). Most of the mutations of theBCP clustered in nt region 1753 to 1766. The number ofmutations within this region correlated with IFN response. Inpatients with nonresponse the average number of mutationswas 3.0 6 0.4 compared with 1.0 6 0.4 in patients withsustained response (P , .02). Within nt region 1753 to 1766the nucleotide position 1764 was most significantly corre-lated with responsiveness to IFN therapy (P , .003). LowerDNA levels (10E1.7 6 0.35 pg/mL vs. 10E2.5 6 0.16 pg/mL;P , .017) were noticed in HBeAg-negative patients carryingwild-type nt 1764.

Using a logistic regression analysis HBV DNA, HBsAg, thenumber of mutations in the BCP, and the number of muta-tions in nt region 1753 to 1766 could be used for predictionof response to IFN (Fig. 4). As shown in Fig. 4, predictivevalues of 60% to 70% for a sustained response to IFN werefound for HBV-DNA levels of less than 10 pg/mL and HBsAglevels of less than 1 µg/mL in all patients irrespective ofHBeAg status. More than 10 nt mutations of the BCP inHBeAg-positive hepatitis and 1 or no mutation of the BCP inHBeAg-negative hepatitis allowed a correct positive predic-tion of sustained IFN response in 60% to 70%. A 70% to 80%correct prediction of nonresponse was possible on the basis ofless than 5 mutations in the BCP in HBeAg-positive hepatitisand more than 5 mutations in HBeAg-negative hepatitis.Response to IFN was predictable in 78% of patients (25 of 32)on the basis of nucleotide position 1764 in HBeAg-negativehepatitis. Seventy-seven percent of the patients with wild-type nt 1764 were responders (10 of 13). In contrast only21% (4 of 19) of the patients who displayed a mutation at

TABLE 2. Summary of Nucleotide Exchanges

Mutation

FrequencyHBeAg-Negative

FrequencyHBeAg-Positive Significance

Relevance andDistribution

G1899A 34% (11/32) 0% (0/64) P , .001 -Association with1896

G1896A 53% (17/32) 1.6% (1/64) P , .0005 -HBeAg negativity,precore stop

T1858C 22% (7/32) 53% (34/62) P , .004 -Stem loop formationG1764A/T 53% (17/32) 23% (15/64) P , .001 -IFN response?

59% (19/32)* 25% (16/64)* P , .002** -HBeAg negativity?-HNF4 binding-COUP TF binding

A1762T/G 50% (16/32) 20% (13/64) P , .004 -IFN response?53% (17/32)* 20% (13/64)* P , .002** -HBeAg negativity?

-HNF4 binding-COUP TF binding

G1757A 38% (12/32) 66% (42/64) P , .016 -HNF4 bindingT1753A/C 44% (14/32) 9% (6/64) P , .0005 -HNF4 bindingT1719G 41% (13/32) 69% (44/64) P , .015 -HNF3 binding

-Genotype A associa-tion

A1703C 38% (12/32) 53% (34/64) NS -Genotype A associa-tion

C1678T 44% (14/32) 17% (11/64) P , .006 -Genotype D associa-tion

T1676A 38% (12/32) 72% (46/64) P , .003 -Genotype A associa-tion

T1674C 38% (12/32) 55% (34/64) NS -Genotype A associa-tion

T1638C 38% (12/32) 59% (38/64) NS -Genotype A associa-tion

A1635G/T 41% (13/32) 36% (23/64) NS -Genotype D associa-tion

A1634G 41% (13/32) 72% (46/64) P , .005 -Genotype A associa-tion

T1631C 50% (16/32) 34% (22/62) NS -Genotype D associa-tion

NOTE. Mutations are shown if number .10.Abbreviations: COUP TF, chicken ovary upstream promoter transcription

factor; HNF, hepatocyte nuclear factor; NS, not significant.*Includes deletions and insertions.


nucleotide 1764 were sustained responders to IFN. In HBeAg-positive hepatitis a correct prediction of IFN response waspossible on the basis of nt 1762 and 1764 in 77% of cases each(49 of 64).

All other previously mentioned mutations (Table 2) withinthe precore region, the BCP, the CURS, or the NRE allowed noprediction of IFN response. No correlation to IFN responsewas seen for the G1896A mutation. Neither patients’ origin,sex, age, nor HBV genotype influenced IFN outcome. Therewas a tendency for higher ALT levels in responders, althoughstatistical significance was not reached (Table 3).

Quantification of HBsAg and HBeAg. HBeAg-positive patientshad higher HBsAg levels than HBeAg-negative patients

(10E1.6 6 0.06 vs. 10E0.6 6 0.12; P , .0005). Overall,patients with a 1764 or a 1762 mutation carried significantlyless HBsAg than patients without mutation (10E0.9 6 0.12vs. 10E1.5 6 0.08; p , 0.0005 and 10E0.85 6 1.4 vs.10E1.4 6 0.08; P , .0005). However when HBeAg-negativeand HBeAg-positive patients were considered separately (Table4) this correlation was only seen in HBeAg-positive patients(10E1.3 6 0.11 vs. 10E1.7 6 0.07; P , .02 and 10E1.3 60.14 vs. 1.65 6 0.06; P , .03).

HBeAg-positive patients with mutations at nt 1762 or 1764carried less HBeAg than patients with a wild-type nucleotide(10E2.4 6 0.32 vs. 10E3.05 6 0.11; P , .012 for nt 1762 and10E2.7 6 0.24 vs. 10E3.1 6 0.11; P , .004 for nt 1764).

=FIG. 3. DNA sequence of a part of the HBV basic core promoter region (nt 1741-1800) of HBeAg-positive patients. Alignment of the DNA (1)-strands of

64 HBeAg-positive patients (no. 33 to 96) in 58 to 38 direction. Nucleotide deletions are marked by a slash (/), nucleotide insertions are underlined. Consensussequence was established from HBV databank sequences.

FIG. 2. DNA sequence of a partof the HBV basic core promoterregion (nt 1741-1800) of HBeAg-negative patients. Alignment of theDNA (1)-strands of 32 HBeAg-negative patients (no. 1 to 32) in 58to 38 direction. Nucleotide deletionsare marked by a slash (/), nucleotideinsertions are underlined. Consen-sus sequence was established fromHBV databank sequences.


FIG. 4. Calculated predictive values (PV) for sustained response to IFN on the basis of logistic regression analysis. (A) PV depending on HBV DNA for allinvestigated patients (n 5 96). (B) PV depending on HBsAg for all investigated patients (n 5 96). (C) PV depending on mutations in the BCP inHBeAg-negative patients (n 5 64). (D) PV depending on mutations in the BCP in HBeAg-positive patients (n 5 32). (E) PV depending on mutations in ntregion 1753 to 1766 in HBeAg-negative patients (n 5 64). (F) PV depending on mutations in nt region1753 to 1766 in HBeAg-positive patients (n 5 32).


DISCUSSION

The relevance of mutations in the BCP, CURS, and NRE forresponse to IFN in chronic replicative hepatitis B was studiedin 96 IFN-treated patients.

Treatment with IFN resulted in an overall sustainedresponse rate of 30%, which is consistent with most studies.2

Sustained response rates did not differ significantly betweenHBeAg-positive patients (23%) and HBeAg-negative patients(44%). Most studies so far have shown poor long-termresponse rates of even less than 10% in HBeAg-negativehepatitis,5-9 but some studies reported response rates up to50%.10-12 The highly divergent response rates to IFN therapyfor HBeAg-negative hepatitis are difficult to explain. InHBeAg-positive hepatitis low HBV-DNA titers predict a favor-able response to IFN.2 Lower HBV-DNA titers have beenreported for HBeAg-negative patients compared with HBeAg-positive patients and were also seen in our HBeAg-negativepatients (Table 1). This may explain the good response ratefor HBeAg-negative patients compared with HBeAg-positivepatients.

A correlation with IFN responsiveness was found for HBVDNA levels, HBsAg levels, mutations at nt 1762 and nt 1764,the number of mutations within the nucleotide region 1753to 1766, and mutations within the complete BCP. LowHBV-DNA and HBsAg levels were positive predictors for asustained response to IFN independent of HBeAg status.Mutations at nt 1762 and 1764, the number of mutationswithin the nucleotide region 1753 to 1766, and the BCPexhibited opposite effects on IFN responsiveness in HBeAg-positive and HBeAg-negative patients. In HBeAg-negativepatients a sustained response was associated with a wild-typent 1762 and 1764 and a low number of mutations in the ntregion 1753 to 1766 and the BCP whereas in HBeAg-positivepatients a sustained response to IFN was associated with amutated nt 1762 and 1764 and a high number of mutations inthe BCP and nt region 1753 to 1766.

These divergent effects of promoter mutations may beexplained by different functions of the basic core promoter(Fig. 5) on transcription of precore mRNA and pregenomeRNA.33 Translation of precore mRNA yields HBeAg, which isknown to induce immunotolerance,34 whereas pregenome

TABLE 3. Clinical and Molecular Parameters for Predictionof IFN Response

SustainedResponse Nonresponse Significance

G1764MutHBeAg-positive 53% (8/15) 16% (8/49) P , .007HBeAg-negative 29% (4/14) 83% (15/18) P , .003

T1762MutHBeAg-positive 47% (7/15) 12% (6/49) P , .008HBeAg-negative 29% (4/14) 72% (13/18) P , .03

Mutations in the BCPHBeAg-positive 3.6 6 0.8 2.0 6 0.3 P , .04HBeAg-negative 2.0 6 0.3 4.5 6 1.0 P , .04

Mutations in 1753-1766HBeAg-positive 1.4 6 0.4 0.6 6 0.1 P , .015HBeAg-negative 1.0 6 0.4 3.0 6 0.4 P , .02

G1896A 24% (7/29) 16% (11/67) NSHBV DNA (Log pg/mL)

All 2.35 6 0.2 3.2 6 0.1 P , .0005HBeAg-positive 2.8 6 0.13 3.5 6 0.1 P , .0005HBeAg-negative 1.9 6 0.34 2.4 6 0.2 NS

HBsAg quantitative(Log µg/mL)

All 0.96 6 0.12 1.4 6 0.09 P , .006HBeAg-positive 1.2 6 0.11 1.7 6 0.07 P , .003HBeAg-negative 0.58 6 1.5 0.65 6 1.9 NS

HBeAg quantitative(Log PEI U/mL)

HBeAg-positive 2.6 6 0.27 3.0 6 0.11 NS; P , .08ALT (U/L) 139 6 18 105 6 13 NSGenotype A (n 5 46) 66% (19/29) 43% (29/67) NSGenotype D (n 5 32) 25% (9/29) 40% (27/67) NS

Abbreviation: NS, not significant.

FIG. 5. Different effects of muta-tions in the basic core promoter andtheir function in HBeAg-negativeand HBeAg-positive hepatitis.


RNA is translated into core and polymerase proteins andreverse transcribed into minus-strand DNA. It has beenshown in vivo and in vitro that the 1762 and 1764 mutationscause a reduction of circulating HBeAg by suppressingprecore RNA transcription.27,35-39 A marked reduction ofHBeAg was seen in our HBeAg-positive patients carryingmutations at nt 1762 and 1764 (Table 4). On the other handthe 1762 and 1764 mutations have been shown in transfec-tion studies to increase viral replication by enhancing prege-nome transcription39,40 or virus encapsidation.35,41 Further-more, in vitro studies have shown that an intact precore geneimpairs progeny virus production.42,43

In HBeAg-positive hepatitis the dominant effect of muta-tions in the BCP might be a reduction of circulating HBeAg asseen in our patients (Table 4) resulting in a reduced immuno-logic tolerance, an improved clearance of the virus, and thus abetter response to IFN. This model is supported by our andformer data23,44 showing that the 1762 and 1764 mutationsare more common in HBeAg-negative hepatitis than inHBeAg-positive hepatitis indicating its emergence duringseroconversion, which is commonly associated with virusclearance. Furthermore HBeAg-positive patients with muta-tions at nt 1762 and 1764 displayed lower HBV-DNA levelsthan patients with wild-type at nt 1762 and 1764. MoreoverHBeAg-positive patients with mutations at nt 1762 and 1764exhibit high ALT levels28 and high histological liver inflamma-tory scores,23 both markers of a reduced immunotoleranceand known predictors of a sustained IFN response. Consis-tent with this observation are our data showing a significantlyhigher prevalence of the mutated nt 1764 in HBeAg-positivepatients with cirrhosis (Table 4) which was not observed inHBeAg-negative patients. However, although there was aclear correlation of mutations at nt 1762 and 1764 withHBeAg levels and sustained response in HBeAg-positivepatients, no clear correlation was seen for HBeAg levels andsustained response. This is not surprising because in HBeAg-positive patients with mutations at nt 1762 or 1764 or othermutations in the BCP an intermediate pattern of variableHBeAg levels and HBV DNA may result.

In HBeAg-negative hepatitis the mechanism of immunotol-

erance may play only a minor or no role in virus clearancebecause of the absence of HBeAg. The dominant effect ofmutations in the promoter region might be that of increasingHBV replication or encapsidation, thus impairing IFN-induced virus clearance. In fact higher HBV-DNA titers andHBsAg levels were found in HBeAg-negative patients withmutations at nt 1762 and 1764 (Table 4). Our observation isin agreement with reports that patients with deletions in theBCP tend to have a better response to IFN therapy thanpatients with wild-type sequence.25 In contrast to HBeAg-positive hepatitis, mutations at nt 1762 and 1764 may thusnegatively influence IFN response in HBeAg-negative hepati-tis B.

The nucleotide region 1753 to 1766 harbors a series oftranscription factor binding sites. Among these are an HNF4binding site 2, COUP, and SP1 binding site. As a member ofliver-enriched transcription factors, HNF4 has been shown toup-regulate transcription from the BCP.45 The COUP transcrip-tion factor is a member of the steroid/thyroid receptor familyand is involved in cell metabolism, proliferation, and differen-tiation.46-48 It is unknown how the action of these transcrip-tion factors is modulated during IFN therapy.

Most of the mutations within the BCP lie in the X gene,which exerts multiple functions in the pathogenesis of HBVinfection.49 The A1762T and G1764A/T mutations convert alysine to methionine and valine to isoleucine or leucine,respectively, within a Kunitz domain–like sequence spanningthe AA sequence 130KVFVKGGCRHKLV14250 of the HBV Xgene. This region is considered important for its transactivat-ing function51 as well as for its interaction with proteasomesas part of a serine protease inhibitor. AA exchanges within theKunitz domain-like region may thus alter transactivationcapacity and protease activity. One consequence may be anincreased ubiquitin dependent degradation of transcriptionfactors and viral proteins.

Taken together mutations of the BCP, especially of thenucleotide region 1753 to 1766 as well as nucleotides 1762and 1764 offer a variety of explanations for a modulation ofIFN action. Our data suggest that genetic alterations of the HBVgenome within the BCP, mainly at nt position 1753 to 1766, areimportant factors that determine response to IFN therapy.

Acknowledgment: The authors thank U. Wend for techni-cal assistance with the HBsAg and HBeAg quantification.

REFERENCES

1. Kane M. Global programme for control of hepatitis B infection. Vaccine1995;13(Suppl 1):S47-S49.

2. Niederau C, Heintges T, Lange S, Goldmann G, Niederau CM, Mohr L,Haussinger D. Long-term follow-up of HBeAg-positive patients treatedwith interferon alfa for chronic hepatitis B. N Engl J Med 1996;334:1422-1427.

3. Perrillo RP, Schiff ER, Davis GL, Bodenheimer-HC J, Lindsay K, Payne J,Dienstag JL, et al. A randomized, controlled trial of interferon alfa-2balone and after prednisone withdrawal for the treatment of chronichepatitis B. The Hepatitis Interventional Therapy Group. N Engl J Med1990;323:295-301.

4. Thomas HC, Karayiannis P, Brook G. Treatment of hepatitis B virusinfection with interferon. Factors predicting response to interferon. JHepatol 1991;13(Suppl 1):4-7.

5. Brunetto MR, Oliveri F, Rocca G, Criscuolo D, Chiaberge E, Capalbo M,David E, et al. Natural course and response to interferon of chronichepatitis B accompanied by antibody to hepatitis B e antigen. HEPATOL-OGY 1989;10:198-202.

6. Brunetto MR, Oliveri F, Colombatto P, Capalbo M, Barbera C, Bonino F.Treatment of chronic anti-HBe-positive hepatitis B with interferon-alpha.J Hepatol 1995;22:42-44.

TABLE 4. Clinical and Molecular Parameters Dependingon Nucleotide 1764

1764 Mut 1764 WT Significance

HBV DNA (Log pg/mL)All 2.8 6 0.12 3.07 6 0.15 NSHBeAg-positive 3.03 6 0.17 3.5 6 0.1 P , .04HBeAg-negative 2.5 6 0.16 1.7 6 0.35 P , .017

HBsAg quantitative (Log µg/mL)All 0.9 6 0.12 1.5 6 0.08 P , .0005HBeAg-positive 1.3 6 0.11 1.7 6 0.07 P , .02HBeAg-negative 0.56 6 0.16 0.68 6 0.18 NS

HBeAg quantitative (Log PEI U/mL)HBeAg-positive 2.4 6 0.27 3.1 6 0.11 P , .004

ALT [U/L]:All 118 6 14 113 6 15 NSHBeAg-positive 95 6 14 108 6 17 NSHBeAg-negative 136 6 23 137 6 31 NS

Cirrhosis [%]:All 34 10 P , .009HBeAg-positive 31 4 P , .009HBeAg-negative 38 31 NS

Abbreviations: Mut, mutant; WT, wild-type; NS, not significant.


7. Hadziyannis S, Bramou T, Makris A, Moussoulis G, Zignego L, Papaioan-nou C. Interferon alfa-2b treatment of HBeAg negative/serum HBV DNApositive chronic active hepatitis type B. J Hepatol 1990;11(Suppl 1):7-36.

8. Pastore G, Santantonio T, Milella M, Monno L, Mariano N, Moschetta R,Pollice L. Anti-HBe-positive chronic hepatitis B with HBV-DNA in theserum response to a 6-month course of lymphoblastoid interferon. JHepatol 1992;14:221-225.

9. Brunetto MR, Giarin M, Saracco G, Oliveri F, Calvo P, Capra G, RandoneA, et al. Hepatitis B virus unable to secrete e antigen and response tointerferon in chronic hepatitis B. Gastroenterology 1993;105:845-850.

10. Aikawa T, Kanai K, Kako M, Kawasaki T, Hino K, Iwabuchi S, TsubouchiH, et al. Interferon-alpha 2a for chronic hepatitis B with e antigen orantibody: comparable antiviral effects on wild-type virus and precoremutant. J Viral Hepat 1995;2:243-250.

11. Fattovich G, Farci P, Rugge M, Brollo L, Mandas A, Pontisso P, GiustinaG, et al. A randomized controlled trial of lymphoblastoid interferon-alpha in patients with chronic hepatitis B lacking HBeAg. HEPATOLOGY

1992;15:584-589.12. Zhang X, Zoulim F, Habersetzer F, Xiong S, Trepo C. Analysis of hepatitis

B virus genotypes and pre-core region variability during interferontreatment of HBe antigen negative chronic hepatitis B. J Med Virol1996;48:8-16.

13. Lampertico P, Del Ninno E, Manzin A, Donato MF, Rumi MG, Lunghi G,Morabito A, et al. A randomized, controlled trial of a 24-month course ofinterferon alfa 2b in patients with chronic hepatitis B who had hepatitis Bvirus DNA without hepatitis B e antigen in serum. HEPATOLOGY 1997;26:1621-1625.

14. Lopez-Alcorocho JM, Bartolome J, Cotonat T, Carreno V. Efficacy ofprolonged interferon-alpha treatment in chronic hepatitis B patientswith HBeAb: comparison between 6 and 12 months of therapy. J ViralHepat 1997;4(Suppl 1):27-32.

15. Angus PW, Locarnini SA, McCaughan GW, Jones RM, McMillan JS, BowdenDS. Hepatitis B virus precore mutant infection is associated with severerecurrent disease after liver transplantation. HEPATOLOGY 1995;21:14-18.

16. Lai ME, Solinas A, Mazzoleni AP, Deplano A, Farci P, Lisci V, Porru A, etal. The role of pre-core hepatitis B virus mutants on the long-termoutcome of chronic hepatitis B virus hepatitis. A longitudinal study. JHepatol 1994;20:773-781.

17. Omata M, Ehata T, Yokosuka O, Hosoda K, Ohto M. Mutations in theprecore region of hepatitis B virus DNA in patients with fulminant andsevere hepatitis [see comments]. N Engl J Med 1991;324:1699-1704.

18. Feray C, Gigou M, Samuel D, Bernuau J, Bismuth H, Brechot C. Lowprevalence of precore mutations in hepatitis B virus DNA in fulminanthepatitis type B in France. J Hepatol 1993;18:119-122.

19. Liang TJ, Hasegawa K, Munoz SJ, Shapiro CN, Yoffe B, McMahon BJ,Feng C, et al. Hepatitis B virus precore mutation and fulminant hepatitisin the United States. A polymerase chain reaction-based assay for thedetection of specific mutation. J Clin Invest 1994;93:550-555.

20. Fattovich G, McIntyre G, Thursz M, Colman K, Giuliano G, Alberti A,Thomas HC, et al. Hepatitis B virus precore/core variation and interferontherapy. HEPATOLOGY 1995;22:1355-1362.

21. Schepis F, Verucchi G, Pollicino T, Attard L, Brancatelli S, Longo G,Raimondo G. Outcome of liver disease and response to interferontreatment are not influenced by hepatitis B virus core gene variability inchildren with chronic type B hepatitis. J Hepatol 1997;26:765-770.

22. Alexopoulou A, Owsianka AM, Kafiri G, Dourakis SP, Carman WF,Hadziyannis SJ. Core variability does not affect response to interferonalpha in HBeAg negative chronic hepatitis B. J Hepatol 1998;29:345-351.

23. Lindh M, Horal P, Dhillon AP, Furuta Y, Norkrans G. Hepatitis B viruscarriers without precore mutations in hepatitis B e antigen-negativestage show more severe liver damage. HEPATOLOGY 1996;24:494-501.

24. Tong SP, Li JS, Vitvitski L, Trepo C. Replication capacities of natural andartificial precore stop codon mutants of hepatitis B virus: relevance ofpregenome encapsidation signal. Virology 1992;191:237-245.

25. Laskus T, Rakela J, Tong MJ, Nowicki MJ, Mosley JW, Persing DH.Naturally occurring hepatitis B virus mutants with deletions in the corepromoter region. J Hepatol 1994;20:837-841.

26. Laskus T, Rakela J, Nowicki MJ, Persing DH. Hepatitis B virus corepromoter sequence analysis in fulminant and chronic hepatitis B.Gastroenterology 1995;109:1618-1623.

27. Okamoto H, Tsuda F, Akahane Y, Sugai Y, Yoshiba M, Moriyama K,Tanaka T, et al. Hepatitis B virus with mutations in the core promoter foran e antigen-negative phenotype in carriers with antibody to e antigen. JVirol 1994;68:8102-8110.

28. Takahashi K, Aoyama K, Ohno N, Iwata K, Akahane Y, Baba K,Yoshizawa H, et al. The precore/core promoter mutant (T1762A1764) of

hepatitis B virus: clinical significance and an easy method for detection. JGen Virol 1995;76:3159-3164.

29. Pawlotsky JM, Bastie A, Lonjon I, Remire J, Darthuy F, Soussy CJ,Dhumeaux D. What technique should be used for routine detection andquantification of HBV DNA in clinical samples? J Virol Methods1997;65:245-253.

30. Gerlich W, Thomssen R. Standardized detection of hepatitis B surfaceantigen: determination of its serum concentration in weight units pervolume. Dev Biol Stand 1975;30:78-87.

31. Erhardt A, Schaefer S, Athanassiou N, Kann M, Gerlich WH. Quantita-tive assay of PCR-amplified hepatitis B virus DNA using a peroxidase-labelled DNA probe and enhanced chemiluminescence. J Clin Microbiol1996;34:1885-1891.

32. Kidd LK, Oberg M, Kidd AH. The hepatitis B virus X gene: analysis offunctional domain variation and gene phylogeny using multiple se-quences. J Gen Virol 1995;76:2119-2130.

33. Yuh CH, Chang YL, Ting LP. Transcriptional regulation of precore andpregenomic RNAs of hepatitis B virus. J Virol 1992;66:4073-4084.

34. Milich DR, Schodel F, Hughes JL, Jones JE, Peterson DL. The hepatitis Bvirus core and e antigens elicit different Th cell subsets: antigen structurecan affect Th cell phenotype. J Virol 1997;71:2192-2201.

35. Buckwold VE, Xu Z, Yen TS, Ou JH. Effects of a frequent double-nucleotide basal core promoter mutation and its putative single-nucleotide precursor mutations on hepatitis B virus gene expression andreplication. J Gen Virol 1997;78:2055-2065.

36. Gunther S, Piwon N, Will H. Wild-type levels of pregenomic RNA andreplication but reduced pre-C RNA and e-antigen synthesis of hepatitis Bvirus with C(1653) = T, A(1762) = T and G(1764) = A mutations inthe core promoter. J Gen Virol 1998;79:375-380.

37. Kurosaki M, Enomoto N, Asahina Y, Sakuma I, Ikeda T, Tozuka S, IzumiN, et al. Mutations in the core promoter region of hepatitis B virus inpatients with chronic hepatitis B. J Med Virol 1996;49:115-123.

38. Baptista M, Kramvis A, Kew MC. High prevalence of 1762(T) 1764(A)mutations in the basic core promoter of hepatitis B virus isolated fromblack Africans with hepatocellular carcinoma compared with asymptom-atic carriers. HEPATOLOGY 1999;29:946-953.

39. Moriyama K. Reduced antigen production by hepatitis B virus harbour-ing nucleotide deletions in the overlapping X gene and precore-corepromoter. J Gen Virol 1997;78:1479-1486.

40. Moriyama K, Okamoto H, Tsuda F, Mayumi M. Reduced precoretranscription and enhanced core-pregenome transcription of hepatitis Bvirus DNA after replacement of the precore-core promoter with se-quences associated with e antigen-seronegative persistent infections.Virology 1996;226:269-280.

41. Buckwold VE, Xu Z, Chen M, Yen TS, Ou JH. Effects of a naturallyoccurring mutation in the hepatitis B virus basal core promoter on precoregene expression and viral replication. J Virol 1996;70:5845-5851.

42. Guidotti LG, Matzke B, Pasquinelli C, Schoenberger JM, Rogler CE,Chisari FV. The hepatitis B virus (HBV) precore protein inhibits HBVreplication in transgenic mice. J Virol 1996;70:7056-7061.

43. Lamberts C, Nassal M, Velhagen I, Zentgraf H, Schroder CH. Precore-mediated inhibition of hepatitis B virus progeny DNA synthesis. J Virol1993;67:3756-3762.

44. Kidd LK, Oberg M, Kidd AH. Hepatitis B virus X gene 1751 to 1764mutations: implications for HBeAg status and disease. J Gen Virol1997;78:1469-1478.

45. Raney AK, Johnson JL, Palmer CN, McLachlan A. Members of thenuclear receptor superfamily regulate transcription from the hepatitis Bvirus nucleocapsid promoter. J Virol 1997;71:1058-1071.

46. Hall RK, Sladek FM, Granner DK. The orphan receptors COUP-TF andHNF-4 serve as accessory factors required for induction of phosphoenol-pyruvate carboxykinase gene transcription by glucocorticoids. Proc NatlAcad Sci U S A 1995;92:412-416.

47. Kerber B, Fellert S, Hoch M. Seven-up, the Drosophila homolog of theCOUP-TF orphan receptors, controls cell proliferation in the insectkidney. Genes Dev 1998;12:1781-1786.

48. Ritchie HH, Wang LH, Tsai S, O’Malley BW, Tsai MJ. COUP-TF gene: astructure unique for the steroid/thyroid receptor superfamily. NucleicAcids Res 1990;18:6857-6862.

49. Uchida T, Saitoh T, Shinzawa H. Mutations of the X region of hepatitis Bvirus and their clinical implications. Pathol Int 1997;47:183-193.

50. Takada S, Kido H, Fukutomi A, Mori T, Koike K. Interaction of hepatitisB virus X protein with a serine protease, tryptase TL2 as an inhibitor.Oncogene 1994;9:341-348.

51. Arii M, Takada S, Koike K. Identification of three essential regions ofhepatitis B virus X protein for trans-activation function. Oncogene1992;7:397-403.


erhardt a, 1999

Documents