ethanol-inducedho-1andnqo1aredifferentially regulatedbyhif-1 ... · 2011-01-18 · supplemental...

Ethanol-induced HO-1 and NQO1 Are DifferentiallyRegulated by HIF-1� and Nrf2 to Attenuate InflammatoryCytokine Expression*□S

Received for publication, April 27, 2010, and in revised form, August 16, 2010 Published, JBC Papers in Press, September 10, 2010, DOI 10.1074/jbc.M110.138636

Samantha M. Yeligar‡1, Keigo Machida§, and Vijay K. Kalra‡2

From the Departments of ‡Biochemistry and Molecular Biology and §Molecular Microbiology and Immunology, Keck School ofMedicine, University of Southern California, Los Angeles, California 90033

Oxidative stress plays an important role in alcohol-inducedinflammation and liver injury. Relatively less is known abouthow Kupffer cells respond to oxidative stress-inducedexpression of heme oxygenase-1 (HO-1) and NAD(P)H:qui-none oxidoreductase (NQO1) to blunt inflammation and liverinjury. We showed that Kupffer cells from ethanol-fed ratsand ethanol-treated rat Kupffer cells and THP-1 cells dis-played increased mRNA expression of HO-1, NQO1, andhypoxia-inducible factor-1� (HIF-1�). Our studies showedthat silencing withHIF-1� and JNK-1 siRNAs attenuated eth-anol-mediated mRNA expression of HO-1, but not NQO1,whereas Nrf2 siRNA attenuated the mRNA expression ofboth HO-1 and NQO1. Additionally, JunD but not JunBformed an activator protein-1 (AP-1) oligomeric complex toaugment HO-1 promoter activity. Ethanol-induced HO-1transcription involved antioxidant response elements,hypoxia-response elements, and an AP-1 binding motif in itspromoter, as demonstrated by mutation analysis of the pro-moter, EMSA, and ChIP. Furthermore, livers of ethanol-fedc-Junfl/fl mice showed reduced levels of mRNA for HO-1 butnot of NQO1 compared with ethanol-fed control rats, sup-porting the role of c-Jun or the AP-1 transcriptional complexin ethanol-induced HO-1 expression. Additionally, attenua-tion of HO-1 levels in ethanol-fed c-Junfl/fl mice led toincreased proinflammatory cytokine expression in the liver.These results for the first time show that ethanol regulatesHO-1 and NQO1 transcription by different signaling path-ways. Additionally, up-regulation of HO-1 protects the liverfrom excessive formation of inflammatory cytokines. Thesestudies provide novel therapeutic targets to ameliorate alco-hol induced inflammation and liver injury.

Alcoholism is the third leading cause of preventable mortal-ity in the United States behind cigarette smoking and obesityand contributes to about 100,000 deaths annually (1, 2). His-topathological features of alcoholic liver disease include fattyliver (steatosis) followed by liver inflammation (steatohepati-tis), cirrhosis, and hepatocellular carcinoma (3–5). It has beenhypothesized that reactive oxygen species (ROS)3 generated byethanol metabolism via CYP2E1 in hepatocytes contributes toliver injury. However, no differences in liver injury and ROSformation are observed in CYP2E1�/� mice compared withwild-type mice upon ethanol feeding (6). However, studiesshow ethanol increases gut permeability toGram-negative bac-teria endotoxins, which activate Kupffer cells to generate ROSand the potent inflammatory mediator TNF-�, causing liverinjury (5). It has been shown that oxidants derived fromNADPHoxidase inKupffer cells contribute to cytotoxic TNF-�production. This is demonstrated in studies wherein ethanol-fed p47phox knock-out mice, lacking a critical NADPH oxidasesubunit, show reduced ROS and TNF-� production in Kupffercells and result in reduced liver injury (7).To counteract these oxidative stress insults, higher animals

have evolved defense mechanisms, including antioxidant pro-teins and phase II detoxifying enzymes (8, 9). Induction ofphase II enzymes, e.g. heme oxygenase-1 (HO-1) and NADPH-quinone oxidoreductase-1 (NQO1), renders cells more resis-tant to the potential subsequent challenges of greater stress.The importance of HO-1 expression in mediating antioxidantand anti-inflammatory effects has been well characterized bothin vitro and in vivo (10–14) and corroborated in HO-1 knock-out mice (15, 16) and patients with HO-1 deficiency (17).The antioxidant response element (ARE), a cis-acting ele-

ment, has been shown to be involved in the transcriptional reg-ulation of redox-regulated gene products, including HO-1 (18).Further studies demonstrate that nuclear factor erythroid 2-re-lated factor (Nrf2) binds to ARE sites in the promoter of cyto-protective phase II genes to regulate their expression (19–21).Nrf2 is bound to its inhibitor Keap1 in the cytosol of the cell.Under oxidative stress conditions, Nrf2 dissociates fromKeap1

* This work was supported by Hide Tsukamoto Pilot Grant P50-AA011999 (toV. K. K.), Non-Parenchymal Liver Cell Core Grant R24-AA012885 (to HideTsukamoto), Predoctoral Fellowship T32-AA07578 (to S. M. Y.). This workwas also supported, in whole or in part, by National Institutes of HealthGrants CA108302 and AA018857 (to K. M.) and Analytical-Metabolic-In-strumentation Core, University of Southern California Research Center forLiver Diseases Grant P30-DK048522.

□S The on-line version of this article (available at http://www.jbc.org) containssupplemental Table S1 and Figs. S1–S4.

1 To whom correspondence may be addressed: Dept. of Pulmonology, EmoryUniversity, Atlanta, GA 30322. Tel.: 404-727-9202; Fax: 404-727-3236;E-mail: [email protected].

2 To whom correspondence may be addressed. Tel.: 323-442-1526; Fax: 323-442-1528; E-mail: [email protected].

3 The abbreviations used are: ROS, reactive oxygen species; HO-1, heme oxy-genase-1; NQO1, NAD(P)H-quinone oxidoreductase-1; KC, Kupffer cell;rKC, rat KC; E-rKC, ethanol-fed rKC; C-rKC, isocaloric-fed control rKC; HIF-1�,hypoxia-inducible factor-1 �; Nrf2, nuclear factor erythroid 2-related fac-tor; AP-1, activator protein-1; ARE, antioxidant response element; HRE,hypoxia response element; DPI, diphenyliodonium; TBP, TATA bindingprotein; Dn, dominant negative; qRT, quantitative real-time; PI, phospha-tidylinositol; MAP, mitoen-activated protein.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 46, pp. 35359 –35373, November 12, 2010© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

NOVEMBER 12, 2010 • VOLUME 285 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 35359

by guest on Novem

ber 21, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/cgi/content/full/M110.138636/DC1

http://www.jbc.org/

and translocates to the nucleuswherein it oligomerizeswith theproteinsMaf, Jun, Fos, ATF4, and/orCBP (cAMP-response ele-ment-binding protein (CREB)-binding protein) and inducestranscription by binding to the ARE sites of target genes (21,22). The role of Nrf2 in up-regulating the expression of phase IIenzymes has been corroborated in vivo using Nrf2 knock-outmice (23).HO-1 expression has been shown to be induced by a variety

of stimuli, such as LPS, cytokines, cigarette smoke, oxidativestress (17, 19, 24), and antioxidant photochemicals (25). TheARE core sequence is present in mouse and human HO-1 pro-moters (26) as well as other phase II enzymes, which have anAP-1 or AP-1 like motif (8). Recent studies have shown thatJunB binding to the AP-1 site activates, whereas JunD represseshumanHO-1 gene expression (27). LPS and cytokine-mediatedinduction of HO-1 has been shown to involve AP-1 transcrip-tion factors (28).However, relatively less is knownof themolec-ular mechanism by which ethanol-mediated oxidative stressinsult is counteracted in liver cells.In this report Kupffer cells (KCs) derived from ethanol-fed

rats and ethanol treatment of rat Kupffer cells and humanTHP-1 monocytic cells showed increased mRNA expression ofHIF-1�, HO-1, and NQO1. Our studies showed that ethanol-mediated up-regulation of HO-1 involved activation of JNK-1,HIF-1�, and Nrf2, whereas NQO1 expression utilized onlyNrf2. Furthermore, the AREs, hypoxia-response elements(HREs), and an AP-1 binding motif in the promoter of humanHO-1 were essential for ethanol induced HO-1 transcription.Additionally, JunD augmented, whereas JunB repressed etha-nol-induced HO-1 promoter activity. Furthermore, livers ofethanol-fed c-Junfl/fl mice showed attenuated mRNA levels ofHO-1, but not NQO1, supporting the role of c-Jun in ethanol-induced HO-1 expression. Our in vitro and in vivo results pro-vide evidence that ethanol-induced oxidative stress differen-tially regulated the expression of HO-1 andNQO1 in liver cells.Moreover, our studies for the first time demonstrated thatattenuated levels of HO-1 in vitro and in vivo led to increasedexpression of proinflammatory cytokines, indicating that liverHO-1 levels affect the inflammatory state of the liver. Thesestudies also showed that oxidative stress-induced signaling thatleads to the expression of phase II enzymes, namely HO-1 andNQO1, occurred through divergent pathways.

EXPERIMENTAL PROCEDURES

Animal Experiments—The experimental protocol and use ofanimals was approved by the Institutional Animal Care andUseCommittee (IACUC) of the University of Southern Californiafor this study. Studies of chronic alcohol administration inmaleWistar rats involved implantation of gastrostomy catheters asdescribed previously (29). These rats were fed a high-fat diet(35% calories as corn oil) via intragastric infusion supplementedwith an increasing dose of ethanol (9–16 g/kg per day) or iso-caloric dextrose solutions (30) and weekly enteral lipopolysac-charide (5mg/kg) over 9weeks (ALPDAnimal Core, Universityof Southern California).Because the c-Jun-null mutation results in embryonic lethal-

ity, we utilized c-Jun floxed mice (c-Junfl/fl) (31), which werekindly provided by Dr. Bruce D. Carter (Vanderbilt University

Medical School, Nashville, TN). Briefly, knock-out of c-Jun inimmune cells and sinusoidal endothelial cells was accom-plished by crossing heterozygous c-Junfl/wt mice with Mx-1-Cre mice (The Jackson Laboratory, Bar Harbor, ME) to gener-ate c-Junfl/wt-Mx-1-Cre(�)mice, whichwere then crossedwithc-Junfl/fl mice to generate c-Junfl/fl-Mx-1-Cre(�) mice. Meth-ods used for genotyping were described previously (37). Micewere bred to homozygosity, as measured by PCR analysis of tailDNA. Poly(I:C) was injected to induce the knock-out of c-Junby recombination. In c-Junfl/fl-Mx-1-Cre mice, liver Creexpression was augmented by poly(I:C) (GE Healthcare).Briefly, 300 �l of poly(I:C) solution (1 mg/ml in PBS) wasinjected intraperitoneal 3 times at 48-h intervals. These micewere then used for ethanol challenge studies, where they werefed in pairs with the Lieber-DeCarli control liquid diet or etha-nol (36% of total calories) containing liquid diet (32). Both con-trol and ethanol diet also contained 18% of calories from pro-tein and 8% from fat; for the ethanol diet, a portion of thecarbohydrates was isocalorically replaced with ethanol (33).Liver samples were obtained from c-Junfl/fl mice and wild-typemice that were either fed control or ethanol diet.Isolation and Culture of Kupffer Cells and THP-1 Monocytic

Cells—Kupffer cells were isolated from normal male Wistarrats, alcohol-fed (E-rKCs) and pair-fed control rats (C-rKCs) bythe Non-Parenchymal Liver Cell Core of Southern CaliforniaResearch Center for Alcoholic Liver and Pancreatic Diseasesand Cirrhosis at the University of Southern California. Briefly,livers were digested in situ with Pronase and collagenase. Thedigests were subjected to arabinogalactan density gradient sed-imentation followed by isolation and purification of KCs as pre-viously described (30). Normal KCs were cultured in low glu-cose, DMEM supplemented with 5% FBS for 2 days beforeinitiation of experimental protocols. KCs isolated fromalcohol-fed and pair-fed rats were cultured for 3 h in serum-freemedium before treatment. THP-1 cells weremaintained in cul-ture (34) and kept overnight in serum-free medium beforetreatment.Reagents—DPI andGF109203Xwere purchased from Sigma.

LY294002, SB203580, SP600125, and R59949 were obtainedfrom Tocris (Ellisville, MO). Protein phosphatase 1 was pur-chased from Biomol International Inc. (Plymouth Meeting,PA). These pharmacological inhibitors were utilized at the fol-lowing concentrations, as deemed optimal from the literature:DPI (10 �M), GF109203X (25 �M), LY294002 (15 �M),SB203580 (1 �M), SP600125 (100 nM), R59949 (30 �M), andprotein phosphatase 1 (10�M). Primary antibodies againstHIF-1�, �-actin, phospho-JNK-1 and JNK, HO-1 and secondaryantibodies conjugated to HRP were obtained from Santa CruzBiotechnology (Santa Cruz, CA). HIF-1� siRNA was synthe-sized at the University of Southern California ComprehensiveCancer Center Microchemical core facility as described previ-ously (35). siRNAs for p47phox, p38 MAPK, JNK-1, JNK-2,Src-1, Nrf2, p65 (a subunit of NF-�B), c-Jun, JunD, JunB, andcontrol siRNA were obtained from Santa Cruz Biotechnology,Inc. (Santa Cruz, CA). The dominant negative (Dn) PI3Kexpression plasmid was kindly provided by Dr. Debbie Johnson(University of Southern California, Los Angeles, CA). The tar-gets of the inhibitors and siRNA mentioned are described in

Ethanol-induced HO-1 and NQO1 Are Differentially Regulated

35360 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 46 • NOVEMBER 12, 2010

by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

supplemental Table I. The human �9.2-kb HO-1-pGL3,�4.5-kb HO-1-pGL3, and mutant construct of the �4.5-kbHO-1-pGL3 promoter with a deletion of the ARE enhancerregion E1 and the JunB expression plasmid were generouslyprovided by Dr. Anupam Agarwal (University of Alabama, Bir-mingham, AL) (27, 36). Mutant constructs of the HO-1-lucpromoter were generated using wild-type �4.5-kb HO-1 con-struct as a template with the QuikChange site-directedmutagenesis kit (Stratagene, Cedar Creek, TX) using the prim-ers shown inTable 1.Mutationswere confirmedby sequencing.c-Jun, c-Fos, and JunD expression plasmids were kindly pro-vided byDr.Michael Karin (University of California, SanDiego,CA). All siRNAs and overexpression plasmids used in this studywere shown to knock down or augment both the mRNA (sup-plemental Fig. S2) and protein (supplemental Fig. S3) expres-sion of their corresponding genes. The oligonucleotides usedfor electrophoretic mobility shift assay (EMSA) and chromatinimmunoprecipitation (ChIP) analysis were obtained from Inte-grated DNA Technologies (Coralville, IA). All other reagentswere obtained from Sigma unless otherwise indicated.Isolation of RNA and qRT-PCR—Total RNA was extracted

from KCs, THP-1, and liver samples using TRIzol reagent(Invitrogen). Cells in culture were treatedwith 100mM ethanol,unless otherwise indicated, for the indicated time periods. Cellswere preincubated for 30 min with pharmacological inhibitorsbefore ethanol treatment. Using specificmRNAprimers shownin Table 1, mRNA expression levels of genes were determinedandquantified. Real-timequantitative PCRofmRNA templateswas performed using the iScript SYBR Green One-Step RT-PCR Kit (Bio-Rad) and the ABI PRISM 7900 HT sequencedetection system (Applied Biosystems, Foster City, CA).Briefly, PCR amplification of RNA (100 ng) was performedunder the following conditions; cDNA synthesis at 50 °C for 10min, iScript reverse transcriptase inactivation at 95 °C for 5min, and PCR cycling and detection for 40 cycles at 95 °C for10 s followed by 60 °C for 30 s. Values are expressed as relativemRNA expression that has been normalized to housekeepingGAPDH mRNA.Preparation of Cytosolic and Nuclear Extracts and Western

Blot Analysis—Cultured THP-1 and KCs in serum-free me-diumwere treatedwith ethanol (100mM) for the indicated timeperiods. Cytosolic and nuclear extract proteins were obtainedas previously described (37) andwere subjected to SDS-gel elec-trophoresis followed by transfer to nitrocellulose membranes.Membraneswere probedwith aHIF-1� antibody (1:250),HO-1antibody (1:250), or a phosphorylated JNK-1 antibody(p-JNK-1) (1:250) as described. Blots were also probed withprimary antibodies for p47phox (1:500), p38 MAPK (1:500),Src-1 (1:250), Nrf2 (1:100), c-Jun (1:200), c-Fos (1:200), JunD(1:200), and JunB (1:200) followed by incubation with anti-rab-bit or anti-goat IgG secondary antibodies. These membraneswere stripped and re-probed with �-actin (1:2500), TATA-binding protein (TBP; 1:2000), GAPDH (1:2000), or unphos-phorylated JNK antibodies (1:250) to monitor protein loading.For Western blots of THP-1 or KC nuclear extracts, either�-actin or TBPwas used as a loading control, as neither proteinexpression changed in response to treatment and both werefound to be expressed in nuclear extracts (supplemental Fig.

S4). Antibodies to HO-1 and TBP were obtained from AbcamInc. (Cambridge, MA), whereas the remaining antibodies werefrom Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Theprotein bands were detected using Immobilon Westernreagents (Millipore Corp., Billerica, MA) or LumiGlo reagents(Thermo Scientific, Rockford, IL) and exposed in a Bio-RadChemidoc XRS/HQ.THP-1 Transient Transfections with Promoter Constructs

and siRNA—Cultured THP-1 (1� 106 cells) were suspended in100 �l of Nucleofactor Solution (Nucleofactor kit V, AmaxaBiosystems, Cologne, Germany) with either 50 nM siRNA con-structs or 0.5 �g of luciferase reporter plasmids and 0.5 �g of apCMV-�-galactoside vector followed by nucleofection inaccordance with the manufacturer’s instructions using theV-001 program (Amaxa Nucleofactor II). The cells were keptovernight in complete RPMI 1640 medium containing 10%FBS. After 24 h post-transfection, the cells were harvested andincubated in serum-free medium for 3 h and then treated withethanol for the indicated time periods. The cells were collected,lysed, and analyzed for luciferase activity using a luminometer(Lumat LB 950, Berthold, Badwildbad, Germany) and �-galac-tosidase activity using kits (Promega, Madison, WI) asdescribed previously (37). For transfection efficiency, luciferasevalues were normalized to �-galactosidase values. Data areexpressed relative to promoter-less pGL3 vector activity.Transient Transfections of Kupffer Cells with siRNAs—Cul-

tured rat Kupffer cells (1 � 106 cells) were suspended in 100 �lof Lipofectamine 2000 plus reagent (Invitrogen) and 50 nMsiRNAconstructs followedbynucleofection in accordancewiththe manufacturer’s instructions using the V-001 program(AmaxaNucleofactor II). The cells were kept overnight in com-plete low glucose-DMEM supplemented with 5% FBS. After24 h post-transfection, the cells were harvested and incubatedin serum-free medium for 3 h and then treated with ethanol for12 h. The cells were collected, lysed, and analyzed for mRNAexpression using qRT-PCR.EMSA for Nrf2, AP-1 Complex, and HIF-1�—The double-

stranded consensus oligonucleotides (shown in Table 1) werebiotin-labeled using a light shift chemiluminescent EMSA kit(Pierce) as previously described (37). The probes correspondedto ARE, AP-1, and HRE flanking the respective ARE (�3936 to�3927), AP-1 (�913 to �907), and HRE (�42 to �39) sites ofthe wild-type HO-1 promoter and HO-1 promoter with muta-tions in these sites. Briefly, the DNA binding reaction consistedof 10 �g of nuclear extract, 5% glycerol, 5 mM MgCl2, 50 ng/�lpoly(dI�dC), 0.05% Nonidet P-40, and 0.5 ng of biotinylatedduplex DNA, which was incubated for 20 min at room temper-ature. The samples were then subjected to gel electrophoresisand transferred to a Hybond-N� nylonmembrane (AmershamBiosciences). Band detection was performed using streptavi-din-HRP/chemiluminescence kit (Pierce). DNA-protein inter-action specificity was established using a 50-fold excess of unla-beled probe or use of a mutant probe.ChIP Assay—THP-1 (10 � 106 cells) was cultured in serum-

free medium and treated with ethanol (100 mM) for the indi-cated time period with or without pharmacological inhibitors.Chromatin immunoprecipitation analysis (37) was performedusing a HIF-1� antibody. Immunoprecipitated DNA was PCR-



by guest on Novem


ww

.jbc.org/D

ownloaded from







http://www.jbc.org/

amplified using primers for the HO-1 promoter region (�862to�666 bp) (Table 1), yielding a 350-bp product. PCR productswere subjected to 2% agarose gel electrophoresis, visualized bystaining with ethidium bromide, and quantitated by densito-metric analysis (37). All values were normalized to input DNA.Enzyme-linked Immunosorbent Assay (ELISA) for TNF-� and

IL-1� Release—THP-1 (1.5 � 106 cells/ml) was transfectedwith siRNAs for either Nrf2 or c-Jun and then cultured inserum-free medium before ethanol (100 mM) treatment for24 h. Supernatants from these cells were collected and assayedfor TNF-� and IL-1� release using specific DuoSet Enzyme-Linked Immunosorbent Assays (R&D Systems, Minneapolis,MI) for TNF-� and IL-1�, respectively. All assays were per-formed in accordance with manufacturer’s instructions.Statistical Analysis—Data are presented as the means � S.D.

Student’s t test was utilized to determine the significance ofdifference between untreated and alcohol-treated samples. Thesignificance of difference in mean values between multiplegroups was conducted with parametric one-way analysis ofvariance followed by a Tukey-Kramer using the Instat 2 soft-ware program (GraphPad, San Diego, CA). Values of p � 0.05were considered statistically significant.

RESULTS

Ethanol Augments HO-1 and HIF-1� mRNA Expression inRat Kupffer Cells (rKCs) in Vivo and in Vitro—KCs isolatedfrom ethanol-fed rats (E-rKCs) comparedwith KCs from isoca-loric fed control rats (C-rKCs) showed an �2.5-fold increase inHO-1 mRNA expression as determined by qRT-PCR. Addi-tionally, therewas�1.7-fold increase inHIF-1�mRNAexpres-sion in E-rKCs compared with C-rKCs (Fig. 1A). We have pre-viously shown that ethanol-mediated expression of RANTES(regulated upon activation normal T cell expressed andsecreted) and endothelin-1 was dose-dependent (25–100mM) with optimal expression at 100 mM ethanol (38, 39);thus, we utilized this dose of ethanol for studies describedherein. Although this concentration of alcohol (0.46%) mayseem physiologically high, studies (40) show that the metab-

olism of ethanol increases toaccommodate increased alcoholintake in chronic alcoholics.Treatment of C-rKCs with ethanol(100 mM) showed 3- and 7-foldincrease in HO-1 mRNA expres-sion at 12 and 24 h, respectively.Moreover, HIF-1� mRNA levelsincreased 2- and 6-fold at 12 and24 h, respectively.Ethanol Increases mRNA Expres-

sion of HO-1 in THP-1 Cells viaActivation of Src-1 Kinase, PI 3-Ki-nase (PI3K), p38 MAP Kinase, andJNK-1—Because ethanol in vivo andin vitro induced HO-1 mRNAexpression in rKCs, we examinedwhether a human monocytic cellline (THP-1) exhibited a similarresponse to ethanol as was seen in

rKCs. We utilized THP-1 as a model system for elucidatingethanol-induced cell signaling pathways for ease of culture andtransfection efficiency. There was an increase in HO-1 mRNAexpression at 4, 8, and 24 h, with maximal and sustainedincrease of 5-fold after 8 h (Fig. 2A). Moreover, there was adose-dependent increase in HO-1 mRNA level in response to25–100 mM ethanol treatment for 8 h, which was maximal at100mM (data not shown). Additionally, ethanol-induced HO-1mRNA levels were attenuated by 4-methylpyrazole (alcoholdehydrogenase inhibitor) and cyanamide (aldehyde dehydro-genase inhibitor) to the extent of 99 � 4.1 and 95 � 2.5%,respectively (supplemental Fig. S1). Acetaldehyde (1.0 mM)-in-duced HO-1 expression was attenuated by cyanamide but notwith 4-methylpyrazole (supplemental Fig. S1). The viability ofTHP-1 cells was unaffected by ethanol (100 mM) treatment for8 h. As shown in Fig. 2B, transfection of THP-1 cells withsiRNAs for p47phox (NADPH oxidase subunit), p38 MAPkinase, Src-1 kinase, and N-terminal Jun kinase (JNK-1)resulted in 80–100% (p � 0.001) attenuation of ethanolinduced HO-1 mRNA expression. Transfection with Dn PI3-kinase also reduced �90% ethanol-induced HO-1 mRNAexpression. However, transfection of THP-1 cells with JNK-2siRNA or mock siRNA did not affect HO-1 mRNA expression(Fig. 2B). Taken together, these results suggested that ethanolmetabolism was required for HO-1 expression. Moreover,these studies showed the involvement of Src-1 kinase, NADPHoxidase, PI 3-kinase, p38 MAP kinase, and JNK-1 in ethanolinduced HO-1 mRNA expression.Ethanol-induced HIF-1� mRNA and Protein Expression—

Previous studies (41) show that hypoxia causes an increase inHIF-1� protein levels without affecting HIF-1� mRNA levels.We observed that ethanol (100 mM) treatment of THP-1 cellsled to a time-dependent increase in HIF-1� mRNA expressionat 4, 8, and 24 h, with a maximal increase of 3-fold at 8 h (Fig.2C). As shown in Fig. 2D, Dn PI3K attenuated HIF-1� mRNAexpression, whereas p47phox siRNA did not affect HIF-1�mRNA levels. Because siRNA for p47phox inhibited HO-1mRNA expression (Fig. 2B), we examined whether ROS

FIGURE 1. Ethanol augments HO-1 mRNA expression in rKCs. A, shown is ethanol-induced mRNA expressionof HO-1 and HIF-1� in KCs isolated from ethanol-fed rats (E-rKCs) as determined by qRT-PCR. The data representthe -fold increase after ethanol feeding compared with isocaloric fed control in KCs. B, shown is ethanol-induced mRNA expression of HO-1 and HIF-1� in ethanol-treated rKCs. The data of ethanol-treated rKCs rep-resent a -fold increase in mRNA expression after treatment with ethanol (100 mM) for the indicated time periodcompared with no ethanol treatment. All mRNA expression levels were normalized to GAPDH mRNA levels,and the data shown represent three independent experiments (mean � S.D.). p values are denoted as: ***, p �0.001; and **,. p � 0.01.



by guest on Novem


ww

.jbc.org/D

ownloaded from



http://www.jbc.org/

affected HIF-1� protein levels. As shown in Fig. 2E, ethanolinduced a time-dependent (2–4 h) increase in HIF-1� proteinlevels in nuclear extracts of THP-1 cells, which was maximal

(2.3-fold) at 2 h. Furthermore, etha-nol-induced HIF-1� protein levelswere reduced below basal level by PI3-kinase inhibitor (LY294002) butwere unaffected byNADPHoxidaseinhibitor (DPI) (Fig. 2F). As shown,the levels of �-actin protein re-mained constant in response to eth-anol treatment of THP-1 cells.These results indicated that etha-nol-mediated PI 3-kinase activationled to increase in both mRNA andprotein levels of HIF-1�, whereasthe NADPH oxidase pathway wasnot involved in HIF-1� expression.Ethanol-mediated Nrf2 mRNA

Expression Involves Src-1 Kinase,NADPH Oxidase, PI 3-Kinase, andp38 MAP Kinase—Previous studies(10) show the importance of tran-scription factor Nrf2 in regulatingARE-dependent transcription ofHO-1 and NQO1 genes. LPS-in-duced NQO1 expression requiresthe transcriptional activation ofNrf2 (10). Thus, we determinedwhether ethanol augmented mRNAexpression of Nrf2 in THP-1 mono-cytic cells. Ethanol treatment ofTHP-1 cells resulted in an �5-foldincrease in Nrf2 mRNA expression(Fig. 3A). Transfection of THP-1cells with siRNAs for p47phox, p38MAPkinase,Nrf-2, and Src-1 kinaseresulted in complete abrogation ofethanol-induced Nrf2 mRNAexpression (Fig. 3A). Additionally,transfection of THP-1 cells with DnPI 3-kinase expression plasmidattenuated ethanol-induced Nrf2mRNA expression. However, trans-fection of THP-1 cells with eitherJNK-1 or JNK-2 siRNAs did notaffect ethanol-mediated Nrf2mRNA expression (Fig. 3A). Takentogether, these results showed thatethanol induced signaling leading toNrf2 mRNA expression involvedSrc-1 kinase, NADPH oxidase, PI3-kinase, and p38 MAP kinase butnot JNK-1 and JNK-2.Ethanol-induced NQO1 Gene

Expression Involves Src-1 Kinase,NADPH Oxidase, PI 3-Kinase, andp38 MAP Kinase but Not JNK-1/2—

Ethanol treatment of THP-1 cells for 8 h resulted in an�4-fold increase in NQO1 mRNA expression (Fig. 3B).Transfection of THP-1 cells with siRNAs for p47phox and p38

FIGURE 2. Ethanol augments HO-1 expression in THP-1 via Src kinase, PI 3-kinase, p38 MAP kinase,NADPH oxidase, and JNK-1 but not JNK-2. A, shown is then time course of ethanol (100 mM)-induced HO-1mRNA expression in THP-1 cells. B, shown is ethanol-induced HO-1 mRNA expression in THP-1 that weretransiently transfected with p47 siRNA, p38 MAPK siRNA, Src-1 siRNA, dominant negative PI 3-kinase, JNK-1siRNA, JNK-2 siRNA, and mock siRNA as a control followed by ethanol treatment (100 mM) for 8 h. C, shown is thetime course of ethanol (100 mM)-induced HIF-1� mRNA expression in THP-1 cells. D, shown is ethanol-inducedHIF-1� mRNA expression in THP-1 cells that were transiently transfected with p47 siRNA and dominant nega-tive PI 3-kinase plasmid and mock siRNA as a control followed by ethanol treatment. qRT-PCR data of ethanol-treated THP-1 represent the -fold increase in mRNA expression after treatment with ethanol (100 mM) for 8 hcompared with no ethanol treatment; the latter mRNA levels were normalized to a value of 1.0. All mRNAexpression levels for genes were normalized to GAPDH mRNA levels, and the data shown represent threeindependent experiments (mean � S.D.). *** p � 0.001; ns, not significant. E, shown is the time course ofethanol (100 mM)-induced HIF-1� protein expression in nuclear extracts of THP-1. The data were expressed as-fold change, normalized to �-actin and relative to untreated control. F, shown is ethanol-mediated HIF-1�protein expression in nuclear extracts of THP-1, in response to ethanol treatment (100 mM) for 2 h. Whereindicated, cells were preincubated with the inhibitors DPI and LY294002 for 30 min before ethanol treatment.The data are representative of three independent experiments. Densitometric analysis of protein bands wasdetermined, and the values are expressed relative to untreated control, normalized to �-actin. Vertical linesindicate repositioned gel lanes in E and F.



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

MAP kinase and Dn PI 3-kinase expression plasmid com-pletely abrogated ethanol-induced NQO1 expression toeither basal or below basal levels (Fig. 3B). Transfection of

THP-1 with siRNAs for Nrf2 orSrc-1 reduced�75%of ethanol-me-diated NQO1 expression, whereasJNK-1 siRNA and JNK-2 siRNA hadno effect (Fig. 3B). Taken together,these results showed that ethanol-mediated cell signaling leading toNQO1 expression involved Src-1kinase, NADPH oxidase, PI 3-ki-nase, and p38 MAP kinase. How-ever, JNK-1 and JNK-2 were notinvolved in NQO1 expression, asobserved for Nrf2 expression.Ethanol-mediated HO-1 Expres-

sion Involves Both HIF-1� and Nrf2Transcription Factors in HumanMonocytic Cells—To determinewhether HIF-1� and Nrf2 played arole in ethanol-mediated HO-1expression, THP-1 cells were trans-fected with siRNAs for HIF-1� andNrf2. As shown in Fig. 4A, transfec-tion with HIF-1� siRNA completelyreduced HO-1 expression, whereascontrol mock siRNA had no effect.Moreover, transfection of THP-1cells with siRNA for Nrf2 attenu-ated HO-1 expression by �60%.These data indicate the involvementof Nrf2 and HIF-1� in ethanol-me-diated HO-1expression in humanTHP-1 monocytic cells.Differential Roles of HIF-1� and

Nrf2 in Ethanol-induced Expressionof HO-1 and NQO1 in rKCs—Be-cause ethanol-mediated HO-1expression in THP-1 cells showedthe involvement of Nrf2 and HIF-1�, we determined whether thesame transcription factors wereinvolved in ethanol-mediated acti-vation of phase II enzymes, namelyHO-1 and NQO1, in rat Kupffercells. Treatment of C-rKCs withethanol led to an increase in themRNAexpression ofHIF-1� (�3.5-fold), Nrf2 (�5.5-fold), HO-1 (�6-fold), and NQO1 (�5-fold) (Fig.4B). Transfection with HIF-1�siRNA attenuated HIF-1� andHO-1 mRNA expression, whereasexpression of Nrf2 and NQO1 wasnot affected (Fig. 4B). Additionally,transfection of rKCs with Nrf2siRNA followed by ethanol treat-

ment resulted in �80% reduction of Nrf2, HO-1, and NQO1mRNA expression (Fig. 4B), whereas expression of HIF-1�remained unchanged. Taken together, these results indi-

FIGURE 3. Cellular signaling pathway of ethanol-induced Nrf2 and NQO1 expression in THP-1 cells. A andB, THP-1 were transiently transfected with indicated siRNA or mock siRNA constructs or PI 3-kinase expressionplasmid followed by ethanol treatment (100 mM) for 8 h. qRT-PCR data of Nrf2 and NQO1 mRNA expressionwere normalized to GAPDH mRNA levels. The data of ethanol-treated THP-1 represent the -fold increase inmRNA expression compared with no ethanol treatment. The data shown represent three independent exper-iments (mean � S.D.). p values are denoted as: *** p � 0.001; * p � 0.05; ns, not significant, p � 0.05.

FIGURE 4. Ethanol-induced expression of HO-1 and NQO1 mRNA utilize divergent set of transcriptionfactors. A, shown is ethanol-induced HO-1 mRNA expression in THP-1 cells that were transiently transfectedwith indicated siRNA or mock siRNA as a control followed by ethanol treatment (100 mM) for 8 h. B, shown isethanol-induced mRNA expression of HIF-1a, Nrf2, HO-1, and NQO1 in C-rKCs that were transiently transfectedwith indicated siRNA or mock siRNA constructs followed by ethanol treatment for 8 h. qRT-PCR data representthe -fold increase in mRNA expression after ethanol treatment compared with untreated cells. All mRNAexpression levels were normalized to GAPDH mRNA levels, and the data shown represent three independentexperiments (mean � S.D.). p values are denoted as: ***, p � 0.001 and ns (not significant), p � 0.05. C, shownis ethanol-mediated HO-1 protein expression in nuclear extracts from ethanol-treated rat Kupffer cells. Whereindicated cells were preincubated with the inhibitors DPI, LY294002, and SB203580 for 30 min before ethanoltreatment (100 mM) for 12 h. The data are expressed as the -fold change, normalized to �-actin and relative tountreated cells. The data are representative of three independent experiments.



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

cated the involvement of both Nrf2 and HIF-1� in ethanol-mediated HO-1 gene expression. However, Nrf2, but notHIF-1�, was involved in NQO1 gene expression.Differential Role of JNK-1 in Ethanol-mediated HO-1 and

NQO1 mRNA Expression in rKCs—As shown in Fig. 4B, trans-fection of rKCs with JNK-1 siRNA followed by ethanol treat-ment resulted in complete attenuation of HO-1mRNA expres-sion compared with ethanol-treated rKCs. However, mRNAexpression of HIF-1�, Nrf2, and NQO1 were not affected.These results indicated that JNK-1 was involved in ethanol-mediated HO-1 expression. However, JNK-1 did not play a rolein ethanol-induced gene expression of HIF-1�, Nrf2, andNQO1 in rKCs.Ethanol-mediated HO-1 Protein Expression—As shown in

Fig. 4C, ethanol treatment of rKCs resulted in an increasedHO-1 protein expression in the nuclear extracts of these cells.Inhibitors of NADPH oxidase (DPI), PI 3-kinase (LY294002),and p38 MAP kinase (SB203580) reduced ethanol-inducedHO-1 protein expression below the basal level (Fig. 4C). Theseresults indicated that ethanol-mediated HO-1 protein expres-sion involved activation of NADPH oxidase, PI 3-kinase, andp38 MAP kinase.Role of ARE in Ethanol-mediated Activation of HO-1 Pro-

moter Activity—The 5�-flanking region of the HO-1 gene con-tains potential NF-�B, C/EBP, NF-1L6, AP-1, AP-2, ARE, andGATA motifs (12). An in silico analysis of the human HO-1promoter element (�4500 bp to�1 bp) (GenBankTM accessionnumber AF145047) revealed the presence of two invertedhypoxia response element motifs (RGCAC) at �862 to �859bp and�669 to�666 and oneHRE (RCGTG) at�42 to�39 bprelative to the transcriptional start site, as shown in schematicsof Fig. 5A. Furthermore, AP-1 binding sites were found at�1884 to �1878 bp, �1003 to �986 bp, and �913 to �907 bp(Fig. 5A).Because ethanol-mediated HO-1 expression was attenuated

byHIF-1� siRNA andNrf2 siRNA, we determinedwhether thisoccurred via HREs and AREs present in the promoter region ofHO-1. The full-length human HO-1 promoter (�15 kb) con-tains twoARE sites in the enhancer regions at�-4 and��9kb,designated as E1 and E2, respectively (36). As shown in Fig. 5B,both �9.2 kb and its serially deleted �4.5-kb HO-1 promoterconstruct showed an �8-fold induction of promoter activity inresponse to ethanol, indicating that the �4.5-kb region wassufficient for promoter activity. Deletion of ARE site (E1) in the�4.5-kb region resulted in �68 � 4% reduction in promoteractivity. Furthermore, pharmacological inhibitors of p38 MAPkinase (SB203580), protein kinase C (GF109203X), HIF-1�(R59949), PI 3-kinase (LY294002), NADPH oxidase (DPI), Srckinase (PPI), and JNK (SP600125), which attenuated ethanol-induced HO-1 mRNA expression, also reduced HO-1 pro-moter activity (Fig. 5C). Because pharmacological inhibitorscan be nonspecific, we utilized a targeted gene knockdownapproach. Transfection ofTHP-1 cells with siRNAs for p47phox,p38 MAP kinase, Src-1 kinase, and the p65 subunit of NF-�Band dominant negative PI 3-kinase resulted in �61–88 �4–6% inhibition of ethanol-induced HO-1 promoter activity(Fig. 5D). However, JNK-1 siRNA, but not JNK-2 siRNA, com-pletely reduced HO-1 promoter activity. Furthermore, trans-

fection with siRNAs for c-Jun, Nrf2, and HIF-1� also com-pletely abrogated ethanol-mediated HO-1 promoter activity(Fig. 5D). Transfection with mock siRNA did not reduce etha-nol-mediated HO-1 promoter luciferase activity 9 (Fig. 5D).Taken together, these data indicated the involvement ofNADPH oxidase, PI 3-kinase, p38 MAP kinase, and Src-1kinase in HO-1 promoter activation by ethanol. Furthermore,these studies showed the participation of c-Jun, NF-�B, Nrf2,and HIF-1� in HO-1 transcriptional activation. Moreover,JNK-1, but not JNK-2, was involved in ethanol-induced HO-1transcription.To substantiate the role of the HREs and AP-1 in HO-1 pro-

moter activity, we generatedmutants of theHRE andAP-1 sites(Table 1) of the HO-1 promoter. Ethanol-induced HO-1 pro-moter activity was reduced 80–90% upon mutation of eitherthe proximalHRE orAP-1 sites in the promoter region ofHO-1(Fig. 5E). However, mutation of the AP-1 sites designatedAP-1_2 and AP-1_3, as illustrated in the schematics of Fig. 5A,did not show reduced HO-1 promoter activity (Fig. 5E). Theseresults showed that the proximal HRE-1 site (�42 to �39 bp)and proximal AP-1 site (�913 to �907 bp) in the HO-1 pro-moter were effective in mediating ethanol-mediated HO-1transcription.Ethanol-induced Activation of JNK Involves Upstream Acti-

vation of Protein Kinase C, Src-1 Kinase, and p38 MAP Kinase—Because ethanol-induced HO-1 transcription involved JNK-1,we examined upstream signaling events involved in its activa-tion. Ethanol caused a time-dependent (5–60 min) change inJNK-1 phosphorylation, with maximal phosphorylation (�2.2-fold) at 10 min (Fig. 6A, upper panel). The levels of JNK-1 orJNK-2 protein did not change in response to ethanol treatmentof THP-1 (Fig. 6A, lower panel). Preincubation of THP-1 cellswith inhibitors of protein kinase C (GF109203X), Src-1 kinase(protein phosphatase 1), and p38 MAP kinase (SB203580)resulted in an �45% reduced JNK-1 phosphorylation at 10 minafter ethanol treatment (Fig. 6B). However, inhibitor of JNK(SP600125) reduced the phosphorylation of JNK-1 by �70%(Fig. 6B). These results showed that ethanol-mediated JNKacti-vation involved upstream activation of protein kinase C, Src-1kinase, and p38 MAP kinase.Ethanol-induced HO-1 Promoter Activity Involves AP-1

Complex Binding Proteins—Because HO-1 promoter activitywas attenuated by c-Jun siRNA and the HO-1 promoter con-tains an AP-1 motif, we determined the role of candidate Junproteins in the AP-1 complex that regulated ethanol-mediatedhuman HO-1 transcription. Co-transfection studies were per-formed using c-Fos, c-Jun, JunB, and JunD expression plasmidsand the �4.5-kb HO-1 luciferase promoter construct. Asshown in Fig. 6C, ethanol treatment of THP-1 increased HO-1promoter activity by �5-fold compared with untreated cells.Overexpression of c-Fos did not change promoter activity;however, c-Jun caused an �8-fold increase in HO-1 promoteractivity (Fig. 6C). Also c-Jun together with c-Fos augmentedHO-1 promoter activity by �8.5-fold. JunB alone repressed,whereas JunD enhanced HO-1 promoter activity over andabove that seen with ethanol treatment (Fig. 6C). Additionally,JunB co-transfected with c-Fos and c-Jun did not affect HO-1promoter activity compared with cells transfected with c-Jun



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

and c-Fos (Fig. 6C). In contrast, JunD augmented c-Fos andc-Jun mediated HO-1 promoter activity to �12-fold (Fig. 6C).To further validate the opposing roles of JunD and JunB in

regulating HO-1 transcription, THP-1 cells were co-trans-fected with HO-1 promoter constructs along with siRNAs forc-Jun, JunD, or JunB. As shown in Fig. 6D, ethanol-mediatedHO-1 promoter activity was attenuated with siRNAs for c-Junand JunD but enhanced with JunB siRNA. Taken together,these results suggested that c-Jun/c-Fos and JunD formed anactive AP-1 transcriptional complex that interacted with theAP-1 site of the HO-1 promoter, augmenting its activity. How-ever, JunB was observed to have no effect on c-Fos/c-Jun-me-diated HO-1 promoter activity (Fig. 6C), indicating that JunDand JunB had opposite roles in regulating ethanol-mediatedHO-1 transcription in THP-1 cells.Ethanol Increases Nuclear Protein Binding to HRE, ARE, and

AP-1 Consensus DNA Sequence in HO-1 Promoter as Deter-mined by EMSA—Nuclear extracts from ethanol-treatedTHP-1 cells showed a severalfold increased binding to an oli-gonucleotide encompassing the HRE consensus sequence(Table 1) of the HO-1 promoter region (Fig. 6E, lane 2). Theprotein-DNA complex formation was attenuated completelyby HIF-1� siRNA (Fig. 6E, lane 3). The protein-DNA complexformationwas also completely eliminated by a 50-fold excess ofnonbiotinylated oligonucleotide probe (Fig. 6E, lane 4). Addi-tionally, oligonucleotides withmutations in theHRE consensussequence of the HO-1 promoter (Table 1) did not show forma-tion of theDNA-protein complex (Fig. 6E, lane 5). These resultsshowed that ethanol increased binding of HIF-1� protein fromthe nuclear extracts to HRE binding sites in the HO-1promoter.The role of Nrf2 and AP-1 protein complex in the binding to

ARE and AP-1 sites, respectively, in HO-1 promoter was deter-mined by EMSA. Ethanol augmented the binding of nuclearextract protein from ethanol-treated THP-1 cells to biotinyl-ated oligonucleotide probe (Fig. 6F, lane 2) corresponding tothe ARE region in the HO-1 promoter (Table 1). Furthermore,Nrf2 siRNA attenuated protein-DNA complex formation (Fig.6F, lane 3). The protein-DNA complex formationwas inhibitedcompletely by a 50-fold excess of nonbiotinylated oligonucleo-tide probe (Fig. 6F, lane 4). Additionally, the oligonucleotideprobe with a mutation in ARE-1 site of HO-1 promoter (Table1) did not show DNA-protein complex formation (Fig. 6F, lane5). These results showed that ethanol augmented binding ofNrf2 protein in nuclear extracts to ARE binding sites in theHO-1 promoter.Ethanol also increased binding to an oligonucleotide probe

encompassing AP-1 consensus sequence (Table 1) in thehuman HO-1 promoter (Fig. 6F, lane 7). The protein-DNA

complex formation was completely attenuated by c-Jun siRNA(Fig. 6F, lane 8) and by a 50-fold excess of nonbiotinylated oli-gonucleotide probe (Fig. 6F, lane 9). Additionally, oligonucleo-tide with a mutation in the AP-1 consensus sequence (Table 1)of the HO-1 promoter did not exhibit DNA-protein complexformation (Fig. 6F, lane 10). These results showed that nuclearextracts derived from ethanol-treated THP-1 cells exhibitedincreased binding of c-Jun/AP-1 protein complex toAP-1 bind-ing site of the human HO-1 promoter.Ethanol Augments HIF-1� Binding to the HRE Site in the

HO-1 Promoter Region in the Chromatin—The binding ofHIF-1� to the HO-1 promoter in the chromatin of THP-1 cellswas supported by ChIP analysis (Fig. 6G). Chromatin samplesfrom ethanol-treated THP-1 were immunoprecipitated withHIF-1� antibody, which showed an �2.2-fold increase in theexpected PCR product size of 350 bp, corresponding tothe HO-1 promoter region (�862 to �666 bp) containing theHRE-2 and HRE-1 sites utilizing the primers listed in Table 1.As shown in Fig. 6G, pretreatment of THP-1 with SP600125(JNK kinase inhibitor) had no effect, and R59949 (HIF-1�inhibitor) attenuated an ethanol-induced increase in theexpected PCR product by �125%, as determined by densitom-etry. The amplification of input DNA before immunoprecipi-tation was equal in all samples (Fig. 6G, middle panel). Immu-noprecipitation of chromatin samples with rabbit IgG as acontrol did not show any amplification of the expected prod-ucts (lower panel). Taken together, these data indicated thatethanol increased HIF-1� binding to the HO-1 promoter toup-regulate the expression of HO-1 in vivo.Ethanol-induced HO-1 Protein Expression Involves HIF-1�,

Nrf2, and c-Jun—Because ethanol enhanced HO-1 proteinexpression in ethanol-treated rKCs, and HIF-1� and Nrf2 andc-Jun were found to be involved in regulating HO-1 mRNAexpression, we determined whether these transcription factorsaffected HO-1 protein expression. As shown in Fig. 6H, etha-nol-inducedHO-1protein levels (�1.7-fold) in nuclear extractsof THP-1 cells were reduced below the basal levels (�100%)when cells were transfected with siRNAs for HIF-1�, Nrf2, andc-Jun, indicating the role of these factors in regulating bothHO-1 mRNA and protein expression.Differential Expression of HO-1 and NQO1mRNA in the Liv-

ers of Ethanol-fed c-Junfl/fl Mice—Because in vitro studiesshowed involvement of JNK and c-Jun in ethanol-mediatedexpression ofHO-1, we determinedwhether c-Jun played a rolein its expression in vivo. Because the c-Jun-null mutation isembryonic lethal, we used c-Jun floxed mice (c-Junfl/fl) (31) forthese studies. mRNA was isolated from the livers of isocaloricfed control and c-Junfl/fl mice, ethanol-fed wild-type, and etha-nol-fed c-Junfl/fl mice followed by measurement of HO-1 and

FIGURE 5. Identification of functional cis-acting elements in ethanol-induced HO-1 promoter activation. A, schematics of human HO-1 promoter(�3936/�1 bp, relative to the transcription start site), indicating the location of HRE-1 to �3, proximal and distal AP-1 binding sites, and AREs. B, shown isethanol-induced �9.2kb-HO-1-luc and �4.5kb-HO-1-luc human promoter activity in THP-1 cells. Where indicated, the ARE enhancer region (E1) of the �4.5-kbHO-1 promoter was deleted (rE1). C, shown is the effect of pharmacological inhibitors on HO-1 promoter activity in response to ethanol treatment. Whereindicated, cells were preincubated with the indicated inhibitors for 30 min before ethanol treatment for 8 h. RLU, relative luciferase unit. D, THP-1 cells weretransiently transfected with indicated siRNAs or Dn PI 3-kinase expression plasmid followed by ethanol treatment for 8h. E, shown is the effect of mutations ofAP-1 (AP-1_1, AP-1_2, and AP-1_3) and HRE (HRE-1) binding sites on �4.5-kb HO-1 promoter activity in response to ethanol treatment. Luciferase assay dataare expressed as -fold change and have been normalized relative to the change in luciferase activity of the untreated controls and to transfection efficiency with�-galactosidase. The data shown represent three independent experiments in duplicate (means � S.D.). p values are denoted as ***, p � 0.001; **, p � 0.01, andns (not significant).



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

TA

BLE

1O

ligo

nu

cleo

tid

ep

rim

ers

use

din

this

stu

dy

R,rat;H,hum

an;SDM,site

-dire

cted

mutagenesis,

where

mutated

nucleotid

esareindicatedin

bold;m

ut,m

utant.

Organ

ism/G

ene

Metho

dFo

rwardsequ

ence

Reverse

sequ

ence

R,GAPD

HPC

Rttcaatggcacagtcaaggc

tcaccccatttgatgttagcg

R,HIF-1

�PC

Rcgagctgcctcttcgacaag

cccagccgctggagcta

R,Nrf2

PCR

gccagctgaactccttagac

gattcgtgcacagcagca

R,HO-1

PCR

ttgtctctctggaatggaagg

ctctaccgaccattctg

R,NQO1

PCR

cattctgaaaggctggtttga

ctagctttgatctggttgtcag

H,G

APD

HPC

Raacctgccaagtacgatgacatc

gtagcccaggatgcccttga

H,H

IF-1

�PC

Rctcaaagtcggacagcctca

ccctgcagtaggtttctgct

H,N

rf2

PCR

aaccaccctgaaagcacagc

tgaaatgccggagtcagaatc

H,H

O-1

PCR

gagcctgcagcttctcagat

cggccggtcacatttatgct

H,N

QO1

PCR

cgcagaccttgtgatattccag

cgtttcttccatccttccagg

H,p

47ph

oxPC

Rgtacccagccagcactatg

gtctggttgtctgtggggag

H,p

38MAPK

PCR

tgaaatgacaggctacgtgg

catctataaggaggtccctga

H,p

65PC

Rgcggccaagcttaagatctgccgagtaaac

cgctgcttagagaacacaatggccacttgcc

H,Src-1

PCR

aacgtcagcgggaactgtaca

cctcataagcatggctctttgc

H,JNK-1

PCR

ccaccaaagatccctgacaag

tggatgctgagagccattg

H,JNK-2

PCR

tggattgggaagaaagaagc

cgtcgaggcatcaagactg

H,c-Jun

PCR

cgcggatcccaggccctgaaggaggag

gagggaagcttactgctgcgttagcatgagtt

H,c-Fos

PCR

gaataagatggctgcagccaaatgccgcaa

cagtcagatcaagggaagccacagacatct

H,Jun

BPC

Rgcactaaaatggaacagccctt

ggctcggtttcaggagtttg

H,Jun

DPC

Rggaattccggaggatggaaacacccttctac

cccaagcttgggtacgccgggacctggtgct

H,H

O-1-H

RE-1

SDM

gttccgcctggcccacataacccgccgagc

gctcggcgggttatgtgggccaggcggaac

H,H

O-1-A

P-1_1

SDM

ggagtccacctcatgcagaatttgcacaataggcgatcagcaagggcc

ggcccttgctgatcgcctattgtgcaaattctgcatgaggtggactcc

H,H

O-1-A

P-1_2

SDM

ttagaatgagaatcacagtattgggaaaggactgtatgaatcatctggtccattcgttttg

caaaacgaatggaccagatgtcgtatacagtcctttcccaatactgtgattctcattctaa

H,H

O-1-A

P-1_3

SDM

cactggagagagaaagagactggtctccatcaccagacccagacagattt

aaatctgtctgggtctggtgatggagaccagtctctttctctctccagtg

H,H

O-1wtA

REconsen

suso

ligo

EMSA

gattttgctgagtcaccagt

actggtgactcagcaaaatc

H,H

O-1mutARE

consen

suso

ligo

EMSA

gattttgcagtcacaccagt

actggtgtgactgcaaaatc

H,H

O-1wtH

REconsen

suso

ligo

EMSA

cctgagcaggcactgagtata

tatactcagtgcctgctcagg

H,H

O-1mutHRE

consen

suso

ligo

EMSA

cctgagcaggatctgagtata

tatactcagatcctgctcagg

H,H

O-1wtA

P-1consen

suso

ligo

EMSA

gagactgggagtcatcaccag

ctggtgatgactcccagtctc

H,H

O-1mutAP-1consen

suso

ligo

EMSA

gagactggacagcatcaccag

ctggtgatgctgtccagtctc

H,H

O-1

(HRE

)ChIP

tcccccgagttctaaggagtc

cctacaactgacctgtgaggg



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

NQO1mRNAexpression by qRT-PCR. Ethanol feeding to con-trolmice resulted in�3- and�2-fold increasedmRNA levels ofHO-1 and NQO1, respectively (Fig. 7A, lane 3) compared withisocaloric-fed control mice (Fig. 7A, lane 1). However, therewas complete attenuation of the ethanol-induced increase ofHO-1 mRNA levels in the livers of ethanol-fed c-Junfl/fl mice(Fig. 7A, lane 4) compared with ethanol-fed wild-type mice(Fig. 7A, lane 3). ThemRNA levels ofNQO1 remained the samein the livers of ethanol-fed c-Junfl/fl mice (Fig. 7A, lane 4) as inethanol-fed wild-type mice (Fig. 7A, lane 3). Taken together,these results showed that c-Jun orAP-1 complex contributed toethanol-mediated HO-1 expression, but not to NQO1 expres-sion, in vivo.Silencing with siRNA for Either Nrf2 or c-Jun Augments

Release of Inflammatory Mediators from Ethanol-treatedTHP-1 Cells—Because we observed that silencing with Nrf2siRNA attenuated ethanol-induced HO-1 and NQO1 expres-sion, whereas JNK-1 siRNA only abrogated HO-1 expression,we determined whether the expression of these proteins con-ferred protection against formation of proinflammatory cyto-kines. Silencing with Nrf2 siRNA, which attenuated ethanol-induced HO-1 and NQO1 mRNA expression, augmented therelease of TNF-� by 1.4-fold and IL-1� by 1.5-fold from etha-nol-treated THP-1 cells (Fig. 7B, lane 3) compared with controluntreated THP-1 cells (Fig. 7B, lane 1). Similarly, silencing withc-Jun siRNA, which reduced expression of HO-1 only, aug-mented the release of TNF-� by �1.5- and IL-1� by �1.5-foldfrom ethanol-treated THP-1 cells (Fig. 7B, lane 4) comparedwith control cells (Fig. 7B, lane 1). However, the levels of TNF-�and IL-1� (Fig. 7B) in THP-1 cells transfected with control(mock) siRNA (Fig. 7B, lane 5) were similar to that of ethanol-treated THP-1 cells (Fig. 7B, lane 2). These results showed thatreduced expression of both HO-1 and NQO1 or HO-1 aloneaugmented ethanol-mediated expression of proinflammatorycytokines in THP-1 monocytic cells.HO-1 mRNA Levels and Proinflammatory Cytokines Are

Expressed in a ReciprocalManner in Liver Tissue of Ethanol-fedMice—Because we observed an inverse correlation betweenHO-1 levels and expression of inflammatory cytokines upontreatment of monocytic cells in culture with ethanol, we deter-mined whether a similar correlation existed in the livers of eth-

anol-fed mice. As shown in Fig. 7C, liver tissue of ethanol-fedmice showed a 4-fold increase inHO-1mRNAexpression and aseveralfold decrease in TNF-� and IL-1� mRNA expression(lane 3) compared with control mice fed an isocaloric diet (lane1). However, the livers of isocaloric fed c-Junfl/fl mice showed a5-fold reduced mRNA expression of HO-1, a 15-fold increase inTNF-�, and a 6-fold increase in IL-1�mRNA expression (Fig. 7C,lane 2) compared with livers from isocaloric-fed control animals(Fig. 7C, lane 1). Similarly, livers derived fromethanol-fed c-Junfl/flmice showed reduced mRNA expression of HO-1, an �17-foldincrease in TNF-�, and an �11-fold increase in IL-1� mRNAexpression (Fig. 7C, lane 4) comparedwith livers fromethanol-fedwild-type animals (Fig. 7C, lane 3). Taken together, these resultsshowed that a decrease in HO-1mRNA expression resulted in anincreased expression of inflammatory cytokines in the liver andvice versa, indicating a reciprocal relationship in the expressionlevels of HO-1 to inflammatory status of the liver.

DISCUSSION

Acute and chronic alcohol exposure leads to enhanced ROSgeneration and a concomitant reduction of antioxidant levels,culminating in oxidative stress. To compensate for these oxida-tive stress insults, higher animals have evolved physiologicaldefense mechanisms, including antioxidant proteins and phaseII detoxifying enzymes (8, 9). Induction of phase II enzymessuch as HO-1 renders cells more resistant to potential subse-quent challenges of greater stress. Moreover, studies haveshown that silencing of HO-1 and NQO1 results in increasedexpression of inflammatory cytokines in vitro (10), whereasinduction of these enzymes protects against excess proinflam-matory responses (10, 12).In the present study we delineated themolecularmechanism

by which ethanol modulated the expression of phase IIenzymes, namely HO-1 and NQO1. Our studies showed thatKupffer cells from ethanol-fed rats and acute treatment of rKCswith ethanol resulted in a severalfold increase in the mRNAexpression of HO-1, NQO1, and HIF-1�. Although humanmonocytic THP-1 cells have some unique characteristics as acancer cell line, treatment of these cells also showed similarincrease in mRNA expression of the same genes; thus, we uti-lized THP-1 cells for ease of culture and transfection as amodel

FIGURE 6. Role of JNK-1, individual components of AP-1 and HIF-1a in ethanol-induced HO-1 promoter activity. A, shown is a time-dependent increasein JNK-1 phosphorylation in nuclear extracts from ethanol-treated THP-1 cells. The data were normalized to unphosphorylated JNK as a loading control and areexpressed as -fold change. B, shown is the effect of indicated inhibitors on JNK-1 phosphorylation in response to ethanol treatment. THP-1 cells werepreincubated with pharmacological inhibitors for 30 min followed by ethanol treatment for 10 min and analysis of nuclear extracts by Western blotting.The data in A and B are representative of three independent experiments. C, shown is the effect of transient transfection of c-Fos, c-Jun, JunD, and JunBexpression plasmid on HO-1-luciferase promoter activity. THP-1 was transiently transfected with total 1 �g of indicated expression plasmid or combination ofindicated plasmids. RLU, relative luciferase unit. D, shown is the effect of silencing with siRNAs for c-Jun, JunD, and JunB on ethanol-induced HO-1-luciferasepromoter activity. Luciferase assay data are expressed as -fold change and have been normalized relative to the change in luciferase activity of the untreatedcontrols and to transfection efficiency with �-galactosidase. The data shown represent three independent experiments in duplicate (means � S.D.). p valuesare denoted as: ***, p � 0.001 and ns, not significant. E and F, EMSA of nuclear extracts from THP-1 utilizing oligonucleotide probes corresponding to HRE, ARE,and AP-1 binding sites in HO-1 promoter (the primer sequence listed in Table 1). Where indicated, THP-1 was transfected with siRNAs for HIF-1�, Nrf2, or c-JunsiRNA followed by ethanol treatment for 8 h and isolation of nuclear extracts. As denoted, oligonucleotide probes with mutated HRE, ARE, or AP-1 sites wereused (Table 1). Additionally, a 50-fold excess of cold probe was added to the nuclear extracts as indicated. The data are representative of three independentexperiments. G, ethanol augments HIF-1� binding to HRE sites (the primer sequence listed in Table 1, corresponding to HRE-2 and HRE-3 sites in the HO-1promoter) as assessed by ChIP analysis. THP-1 was preincubated for 30 min with indicated inhibitors before ethanol treatment for 8 h. Soluble chromatin wasimmunoprecipitated with either HIF-1� antibody (upper panel) or control rabbit IgG (lower panel). Primers used to amplify the products flanking the HRE site inthe HO-1 promoter are indicated in Table 1. The middle panel represents the amplification of input DNA before immunoprecipitation. Densitometric analysiswas performed and is shown as the -fold change. Data are representative of three independent experiments. H, shown is ethanol-induced HO-1 proteinexpression in nuclear extracts of THP-1 involves HIF-1�, Nrf2, and c-Jun. Where indicated, cells were transfected with siRNAs for HIF-1�, Nrf2, or c-Jun beforeethanol treatment. The data are expressed as -fold change, normalized to TBP and �-actin relative to untreated cells, and are representative of three inde-pendent experiments.



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

system for delineating cell signaling pathways as previouslydescribed (55).We showed that ethanol-inducedHO-1 expres-sion in rKCs and THP-1 involved activation of Src-1, p38MAPkinase, and JNK-1, but not JNK-2, as demonstrated by the use ofpharmacological inhibitors and knockdown of these kinasegenes with siRNAs. Moreover, transfection with Dn PI3K andp47phox siRNA (a subunit of NADPH oxidase) attenuated eth-anol-mediated HO-1 expression, indicating the involvement ofPI 3-kinase and NADPH oxidase in HO-1 gene expression asillustrated in the schematics of Fig. 7D. Previous studies showthe involvement of PI 3-kinase/Akt, p38 MAP kinase and JNKin HO-1 expression in response to diverse stimuli (42). Ourstudies showed that selective activation of JNK-1 by ethanol,among ubiquitously expressed JNK-1 and JNK-2, up-regulated

the expression of HO-1 but not NQO1. Previous studies (43)have identified 13 MAP kinase kinases (MKKs) that regulateJNKs, but how these MKKs differentially regulate JNKs is notcompletely understood. Studies utilizing JNK-1 and JNK-2knock-out mice reveal differential roles of JNK isoforms in ste-atohepatitis; that is, knockdown of JNK-1 augments steatosisand hepatitis (44). In contrast, knockdown of JNK-2 attenuateshepatocyte cell death (44, 45). Differential roles of JNKs havebeen observed in inflammation and insulin resistance whereindisruption of the JNK-1 gene prevents development of insulinresistance in obese and diabetic mice (46). JNK-1 also has beenshown to determine the oncogenic or tumor suppressor activityof the integrin-related kinase in human rhabdomyosarcoma(47). Differential roles of JNKs in regulating the central tran-

FIGURE 7. Role of HO-1 and NQO1 in attenuating expression of proinflammatory cytokines in vitro and in vivo. A, mRNA from liver tissue of control isocaloric fedwild-type, ethanol-fed wild-type, isocaloric fed c-Junfl/fl, and ethanol-fed c-Junfl/fl mice were analyzed for the expression of HO-1 and NQO1. The data represent liversfrom six rats in each category, and the assay was performed in duplicate (mean � S.D.). B, TNF-� and IL-1� protein release from THP-1 treated with ethanol is shown.Where indicated, cells were transfected with indicated siRNA or control mock siRNA constructs. The data represent four independent experiments, and the ELISA assaywas performed in duplicate (mean � S.D.). C, mRNA levels of HO-1 show inverse correlation with TNF-� and IL-1� mRNA levels in liver tissue. mRNA isolated fromcontrol isocaloric-fed wild-type, ethanol-fed wild-type, isocaloric-fed c-Junfl/fl, and ethanol-fed c-Junfl/fl mice were analyzed by qRT-PCR. The data represent livers fromsix mice in each category, and the assay was performed in duplicate (mean � S.D.). p values are denoted as: ***, p � 0.001 and ns, not significant. D, shown is anillustration of proposed ethanol-induced cell signaling pathways involved in regulating Nrf2 and HO-1 transcription.



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

scription initiation factor TBP have been identified, whereinJNK-1 augments, whereas JNK-2 decreases TBP expression(48). JNK-1 has been shown to increase c-Jun activity and sta-bility, whereas JNK-2 binds to c-Jun and targets it for degrada-tion (49). Thus, we suggest that ethanol-mediated JNK-1 acti-vation via phosphorylation likely leads to activation of c-Junand formation of an AP-1 transcriptional complex to affect theexpression of HO-1.By utilizing a siRNAknockdown approach, we demonstrated

the involvement of the Nrf2 transcription factor in ethanol-mediated expression of both HO-1 and NQO1 in Kupffer cellsand THP-1. Furthermore, our studies showed that ethanol-in-duced Nrf2mRNA expression and cell signaling involved Src-1kinase, NADPH oxidase, p38 MAP kinase, and PI 3-kinase, asillustrated in Fig. 7D. Previous studies show that oxidant stressand antioxidant phytochemicals increase Nrf2 protein translo-cation into the nucleus for the purpose of gene inductionthrough stress-responsive elements or AREs in the promotersof cytoprotective genes, including HO-1 (12, 21, 50, 51). Multi-pleARE sites in the enhancer regions of the full-length (�15 kb)HO-1 promoter have been identified (51). Because ARE siteshave an AP-1 or AP-1 like binding motif in the promoter ofthese cytoprotective battery of genes (8, 18), it has been pro-posed that members of the AP-1 protein family may act onAREs (20), and such a concept was subsequently challenged(52). Our studies showed thatmutation of theAP-1 binding siteother than that present in an ARE site in the HO-1 promoterresulted in substantial reduction of ethanol-inducedHO-1 pro-moter activity. Furthermore, we showed that c-Jun and JunDformed an active AP-1 transcriptional complex with othermembers of theAP-1 family to interact with theAP-1 site in theHO-1 promoter to augment its activity in response to ethanolchallenge. However, JunB was observed to repress c-Fos/c-Jun-mediated HO-1 promoter activity. Because JunB and JunD arepresent endogenously, we selectively silenced JunD and JunBwith siRNAs and observed that attenuation of JunD repressedHO-1 promoter activity, whereas a decrease of JunB increasedHO-1 promoter activity. These results show that JunD andJunB have opposing roles in regulating ethanol-mediatedHO-1transcription. Previous studies in HK-2 cells, an immortalizedhuman renal epithelial cell line, show that hemin-inducedHO-1 promoter activity is augmented by c-Jun and JunB butrepressed by JunD (27). These results and data from our studiesimplicate differential roles of JunD and JunB in regulatingHO-1 gene expression and are context-sensitive to the natureof stimuli and cell type. Additionally, our studies showed thatthe c-Jun, a component of the AP-1 complex, was involved inregulating ethanol-mediated HO-1 expression in vivo, as liversderived from ethanol-fed c-Junflox/flox mice showed attenuatedlevels of HO-1 mRNA compared with wild-type mice fed etha-nol for the same duration. It is possible that c-Jun and Nrf2interact with common ARE sites to regulate HO-1 induction.Because the ARE site of interest is located �3.9 kb upstream ofthe proximal HRE site, chromatin folding may allow boundHIF-1� at the HRE to interact with components of the ARE.

Because ethanol-induced HO-1 expression was attenuatedby HIF-1� siRNA in vitro, we performed an in silico analysis ofthe promoter region of HO-1 and identified several possible

HREs that were located at �42 to �39 bp and two invertedHREs (RGCAC) at �862 to �859 bp and �669 to �666 bp inhuman HO-1 promoter. Utilizing a gene knockdown approachand mutation of consensus HIF-1� DNA binding sites, ourstudies demonstrated that proximal HREs in the HO-1 pro-moter were involved in ethanol-mediated HO-1 transcription,as was further substantiated by EMSA andChIP. Previous stud-ies show that hypoxia-induced HO-1 expression in rat tissuesoccur via HIF-1� activation (53). Our studies showed that theAP-1 complex played an important role in ethanol-mediatedHO-1 expression, as demonstrated by EMSA, ChIP, and silenc-ing with c-Jun siRNA. Overall, our results suggest that ethanol-mediatedHO-1 expression inTHP-1 andKupffer cells involvedAREs, HREs, and AP-1 binding motifs in the HO-1 promoter.The ethanol-induced cell signaling pathways involved in regu-lating HO-1 transcription are illustrated in Fig. 7D.Furthermore, our studies showed that ethanol-mediated up-

regulation of HO-1 and NQO1 in THP-1 cells led to signifi-cantly reduced levels of inflammatory cytokines, such asTNF-�and IL-1�. In contrast, attenuation of HO-1 expression inmonocytic cells with either Nrf2 siRNA or c-Jun siRNAresulted in an increased expression of TNF-� and IL-1�. Theseresults in vitro showed that ethanol-induced expression ofphase II enzymes, i.e. HO-1 and NQO1, led to attenuatedexpression of proinflammatory cytokines. Our studies corrob-orate previous findings wherein LPS and prostaglandin J2-in-duced expression of HO-1 in monocytic cells showed an anti-inflammatory effect (10, 54). Moreover, our in vivo studiesshowed that increased mRNA levels of HO-1 in the livers ofethanol fed mice correlated with a concomitant decrease inTNF-� and IL-1� mRNA expression. Conversely, livers of eth-anol-fed c-Junflox/flox mice or control c-Junflox/flox mice, com-pared with control or ethanol-fed wild-typemice showed lowerlevels of HO-1 and exaggerated levels of cytokines. These stud-ies showed for the first time that ethanol-induced up-regula-tion of HO-1 in the liver leads to reduced expression of inflam-matory cytokines in the liver.In conclusion, our studies show that ethanol-induced oxi-

dant stress leads to up-regulation of HO-1 and NQO1.Although both of these enzymes are phase II-detoxifyingenzymes, they are regulated by common and divergent path-ways. The ethanol-mediated expression of HO-1 and NQO1involves common Nrf2 binding to AREs in their promoter toup-regulate their expression. The signal transduction pathwaysfor induction of the HO-1 gene deviates; ethanol-inducedexpression of HO-1 involves activation of JNK-1, HIF-1�, andanAP-1 transcriptional complex composed of c-Jun, c-Fos, andJunD but not JunB. However, a subset of these transcriptionfactors, namelyHIF-1� andAP-1, do not participate in ethanol-induced NQO1 expression. We show that ethanol-inducedexpression of HO-1 or HO-1 and NQO1 in monocytic cellscontributes to reduced expression of proinflammatory cyto-kines in vitro. Furthermore, we show that reduced expression ofHO-1 in the liver correlates with increased inflammatory stateas seen in ethanol-fed c-Junfl/fl mice. The ethanol-induced oxi-dative stress leading to up-regulation of HO-1 and a concomi-tant decrease in expression of inflammatory cytokines in theliver in vivo suggests a reciprocal relationship between expres-



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

sion levels of HO-1 to the inflammatory state in the liver. Stud-ies are warranted to elucidate whether ethanol-mediatedexpression of other phase II enzymes, such as glutathione syn-thetase, also utilizes similar or divergent cell signaling path-ways.We suggest that therapeuticmodalities to induce phase IIdetoxification enzymes such as HO-1 and NQO1, utilizingselective activators of Nrf2 such as phytochemicals (25, 50),may be beneficial in preventing alcohol mediated liver inflam-mation and injury.

Acknowledgments—We thank Jiaohong Wang for kindly isolatingand providing rat Kupffer cells. We also thank Dr. Anupam Agarwal(University of Alabama at Birmingham, AL) for generously providingthe human HO-1 promoter luciferase constructs. Furthermore, weacknowledge Dr. Debbie Johnson at the University of Southern Cali-fornia (Los Angeles, CA) for providing the Dn PI3K and JNK-2 expres-sion plasmids and Drs. Michael Stallcup and Stanley Tahara forreview of the manuscript.

REFERENCES1. Thun, M. J., Peto, R., Lopez, A. D., Monaco, J. H., Henley, S. J., Heath,

C. W., Jr., and Doll, R. (1997) N. Engl. J. Med. 337, 1705–17142. Liangpunsakul, S., and Crabb, D. W. (2009) in Textbook of Gastroenterol-

ogy (Yamada, T., Alpers, D. H., Kalloo, A. N., Kaplowitz, N., Yang, C., andPowell, D. W., eds) pp. 2247–2273, Wiley–Blackwell, West Sussex, UK

3. Ramaiah, S. K., and Jaeschke, H. (2007) Toxicol. Pathol. 35, 757–7664. Tsukamoto, H., and Kaplowitz, N. (1996) in Liver and Biliary Diseases

(Kaplowitz, N., ed) pp. 125–137, Williams and Wilkins, Baltimore, MD5. Pritchard, M. T., and Nagy, L. E. (2005) Alcohol Clin. Exp. Res. 29,

146S–150S6. Kono, H., Bradford, B. U., Yin, M., Sulik, K. K., Koop, D. R., Peters, J. M.,

Gonzalez, F. J., McDonald, T., Dikalova, A., Kadiiska, M. B., Mason, R. P.,and Thurman, R. G. (1999)Am. J. Physiol. Gastrointest. Liver Physiol. 277,G1259–G1267

7. Kono, H., Rusyn, I., Yin, M., Gabele, E., Yamashina, S., Dikalova, A., Kadi-iska, M. B., Connor, H. D., Mason, R. P., Segal, B. H., Bradford, B. U.,Holland, S. M., and Thurman, R. G. (2000) J. Clin. Invest. 106, 867–872

8. Jaiswal, A. K. (1994) Biochem. Pharmacol. 48, 439–4449. Dalton, T. P., Shertzer, H. G., and Puga, A. (1999) Annu. Rev. Pharmacol.

Toxicol. 39, 67–10110. Rushworth, S. A.,MacEwan,D. J., andO’Connell,M.A. (2008) J. Immunol.

181, 6730–673711. Drechsler, Y., Dolganiuc, A., Norkina, O., Romics, L., Li, W., Kodys, K.,

Bach, F. H., Mandrekar, P., and Szabo, G. (2006) J. Immunol. 177,2592–2600

12. Ryter, S. W., Alam, J., and Choi, A. M. K. (2006) Physiol. Rev. 86, 583–65013. Belcher, J. D., Mahaseth, H., Welch, T. E., Otterbein, L. E., Hebbel, R. P.,

and Vercellotti, G. M. (2006) J. Clin. Invest. 116, 808–81614. Abraham, N. G., Cao, J., Sacerdoti, D., Li, X., and Drummond, G. (2009)

Am. J. Physiol. Renal Physiol. 297, F1137–F115215. Poss, K. D., and Tonegawa, S. (1997) Proc. Natl. Acad. Sci. U.S.A. 94,

10925–1093016. Kapturczak, M. H., Wasserfall, C., Brusko, T., Campbell-Thompson, M.,

Ellis, T. M., Atkinson, M. A., and Agarwal, A. (2004) Am. J. Pathol. 165,1045–1053

17. Yachie, A., Niida, Y., Wada, T., Igarashi, N., Kaneda, H., Toma, T., Ohta,K., Kasahara, Y., and Koizumi, S. (1999) J. Clin. Invest. 103, 129–135

18. Wasserman,W.W., and Fahl,W. E. (1997) Proc. Natl. Acad. Sci. U.S.A. 94,5361–5366

19. Lee, I. T., Wang, S. W., Lee, C. W., Chang, C. C., Lin, C. C., Luo, S. F., andYang, C. M. (2008) J. Immunol. 181, 5098–5110

20. Nguyen, T., Sherratt, P. J., and Pickett, C. B. (2003)Annu. Rev. Pharmacol.Toxicol. 43, 233–260

21. Hayes, J. D., and McMahon, M. (2009) Trends Biochem. Sci. 34, 176–188

22. Nair, S., Doh, S. T., Chan, J. Y., Kong, A. N., and Cai, L. (2008) Br. J. Cancer99, 2070–2082

23. Khor, T. O., Huang, M. T., Prawan, A., Liu, Y., Hao, X., Yu, S., Cheung,W. K. L., Chan, J. Y., Reddy, B. S., Yang, C. S., and Kong, A. N. (2008)Cancer Prev. Res. (Phila.) 1, 187–191

24. Baglole, C. J., Sime, P. J., and Phipps, R. P. (2008) Am. J. Physiol. Lung CellMol. Physiol. 295, L624–L636

25. Innamorato, N. G., Rojo, A. I., García-Yague, A. J., Yamamoto, M., deCeballos, M. L., and Cuadrado, A. (2008) J. Immunol. 181, 680–689

26. Sikorski, E. M., Hock, T., Hill-Kapturczak, N., and Agarwal, A. (2004)Am. J. Physiol. Renal Physiol. 286, F425–F441

27. Hock, T. D., Liby, K., Wright, M.M., McConnell, S., Schorpp-Kistner, M.,Ryan, T. M., and Agarwal, A. (2007) J. Biol. Chem. 282, 6875–6886

28. Alam, J., and Cook, J. L. (2007) Am. J. Respir. Cell Mol. Biol. 36, 166–17429. Tsukamoto, H., Mkrtchyan, H., and Dynnyk, A. (2008)MethodsMol. Biol.

447, 33–4830. Xiong, S., She, H., Zhang, A. S., Wang, J., Mkrtchyan, H., Dynnyk, A.,

Gordeuk, V. R., French, S. W., Enns, C. A., and Tsukamoto, H. (2008)Am. J. Physiol. Gastrointest. Liver Physiol. 295, G512–G521

31. Palmada, M., Kanwal, S., Rutkoski, N. J., Gustafson-Brown, C., Johnson,R. S., Wisdom, R., Carter, B. D., and Gufstafson-Brown, C. (2002) J. CellBiol. 158, 453–461

32. Lieber, C. S., andDeCarli, L.M. (1986)Alcohol Clin. Exp. Res. 10, 550–55333. Gukovsky, I., Lugea, A., Shahsahebi, M., Cheng, J. H., Hong, P. P., Jung,

Y. J., Deng, Q. G., French, B. A., Lungo,W., French, S.W., Tsukamoto, H.,and Pandol, S. J. (2008) Am. J. Physiol. Gastrointest. Liver Physiol. 294,G68–G79

34. Giri, R. K., Selvaraj, S. K., and Kalra, V. K. (2003) J. Immunol. 170,5281–5294

35. Kim, K. S., Rajagopal, V., Gonsalves, C., Johnson, C., and Kalra, V. K.(2006) J. Immunol. 177, 7211–7224

36. Hill-Kapturczak, N., Sikorski, E., Voakes, C., Garcia, J., Nick, H. S., andAgarwal, A. (2003) Am. J. Physiol. Renal Physiol. 285, F515–F523

37. Patel, N., Gonsalves, C. S., Malik, P., and Kalra, V. K. (2008) Blood 112,856–865

38. Yeligar, S., Tsukamoto, H., and Kalra, V. K. (2009) J. Immunol. 183,5232–5243

39. Yeligar, S. M., Machida, K., Tsukamoto, H., and Kalra, V. K. (2009) J. Im-munol. 183, 5964–5976

40. Haseba, T., Duester, G., Shimizu, A., Yamamoto, I., Kameyama, K., andOhno, Y. (2006) Biochim. Biophys. Acta 1762, 276–283

41. Huang, L. E., Gu, J., Schau,M., and Bunn,H. F. (1998) Proc. Natl. Acad. Sci.U.S.A. 95, 7987–7992

42. Ohlmann, A., Giffhorn-Katz, S., Becker, I., Katz, N., and Immenschuh, S.(2003) Exp. Biol. Med. 228, 584–589

43. Johnson, G. L., and Lapadat, R. (2002) Science 298, 1911–191244. Singh, R., Wang, Y., Xiang, Y., Tanaka, K. E., Gaarde, W. A., and Czaja,

M. J. (2009) Hepatology 49, 87–9645. Kodama, Y., and Brenner, D. A. (2009) Hepatology 49, 6–846. Yang, R., and Trevillyan, J. M. (2008) Int. J. Biochem Cell Biol. 40,

2702–270647. Durbin, A. D., Somers, G. R., Forrester, M., Pienkowska, M., Hannigan,

G. E., and Malkin, D. (2009) J. Clin. Invest. 119, 1558–157048. Zhong, S., Fromm, J., and Johnson, D. L. (2007)Mol. Cell Biol. 27, 54–6449. Sabapathy, K., Hochedlinger, K., Nam, S. Y., Bauer, A., Karin, M., and

Wagner, E. F. (2004)Mol. Cell 15, 713–72550. Lin, W., Wu, R. T., Wu, T., Khor, T. O., Wang, H., and Kong, A. N. (2008)

Biochem. Pharmacol. 76, 967–97351. Pugazhenthi, S., Akhov, L., Selvaraj, G., Wang, M., and Alam, J. (2007)

Am. J. Physiol. Endocrinol. Metab. 293, E645–E65552. Nguyen, T., Rushmore, T. H., and Pickett, C. B. (1994) J. Biol. Chem. 269,

13656–1366253. Lee, P. J., Jiang, B. H., Chin, B. Y., Iyer, N. V., Alam, J., Semenza, G. L., and

Choi, A. M. (1997) J. Biol. Chem. 272, 5375–538154. Lee, T. S., Tsai, H. L., and Chau, L. Y. (2003) J. Biol. Chem. 278,

19325–1933055. Patel, N., Gonsalves, C. S., Yang, M., Malik, P., and Kalra, V. K. (2009)

Blood 113, 1129–1138



by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Samantha M. Yeligar, Keigo Machida and Vijay K. KalraNrf2 to Attenuate Inflammatory Cytokine Expression

andαEthanol-induced HO-1 and NQO1 Are Differentially Regulated by HIF-1

doi: 10.1074/jbc.M110.138636 originally published online September 10, 20102010, 285:35359-35373.J. Biol. Chem.

10.1074/jbc.M110.138636Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

http://www.jbc.org/content/suppl/2010/09/10/M110.138636.DC1

http://www.jbc.org/content/285/46/35359.full.html#ref-list-1

This article cites 53 references, 21 of which can be accessed free at

by guest on Novem


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M110.138636

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;285/46/35359&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/285/46/35359

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=285/46/35359&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/285/46/35359

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/suppl/2010/09/10/M110.138636.DC1

http://www.jbc.org/content/285/46/35359.full.html#ref-list-1

http://www.jbc.org/

ethanol-inducedho-1andnqo1aredifferentially regulatedbyhif-1 ... · 2011-01-18 · supplemental...

Documents