evolution mrs. knopke fullerton union high school

EVOLUTIONEVOLUTION

Mrs. Knopke

Fullerton Union High School

California State StandardCalifornia State Standard

3.3. Biological evolution accounts for the Biological evolution accounts for the diversity of species developed through diversity of species developed through gradual processes over many gradual processes over many generations. generations.

c.c. Independent lines of evidence from Independent lines of evidence from geology, fossils, and comparative geology, fossils, and comparative anatomy provide the bases for the anatomy provide the bases for the theory of evolution. theory of evolution.

EvolutionEvolution

What is it?What is it?

EvolutionEvolution

Simply stated, evolution is a Simply stated, evolution is a change in a lineage of change in a lineage of

organisms through time.organisms through time.

Root Word - EvolutRoot Word - Evolut

An unrollingAn unrolling

Types of EvidenceTypes of Evidencefor Evolutionfor Evolution

FossilsFossilsComparative AnatomyComparative AnatomyEmbryologyEmbryologyBiochemistryBiochemistry

What is a Fossil?What is a Fossil?

Any trace of an Any trace of an organism that organism that lived long ago.lived long ago.

Paleontologists also study fossils to gain Paleontologists also study fossils to gain knowledge about ancient climate and knowledge about ancient climate and geography.geography.

Paleontologists-Detectives to the pastPaleontologists-Detectives to the past

By studying the condition, position, and By studying the condition, position, and location of rocks and fossils, geologists and location of rocks and fossils, geologists and paleontologists can make deductions about paleontologists can make deductions about the geography of past environments.the geography of past environments.

For fossils to form, For fossils to form, organisms usually have to organisms usually have to be buried in mud, sand, be buried in mud, sand, or clay soon after they or clay soon after they die.die.

Fossil formationFossil formation

Most fossils are found in sedimentary rocks. Most fossils are found in sedimentary rocks. These rocks form at relatively low temperatures These rocks form at relatively low temperatures and pressures that may prevent damage to the and pressures that may prevent damage to the organism.organism.

Fossils are not usually found in other types of Fossils are not usually found in other types of rock because of the ways those rocks form. rock because of the ways those rocks form. For example, the conditions under which For example, the conditions under which metamorphic rocks form often destroy any metamorphic rocks form often destroy any fossils that were in the original sedimentary fossils that were in the original sedimentary rock.rock.

Fossil formationFossil formation

Few organisms become fossilized because, Few organisms become fossilized because, without burial, bacteria and fungi immediately without burial, bacteria and fungi immediately decompose their dead bodies. Occasionally, decompose their dead bodies. Occasionally, however, organisms do become fossils in a however, organisms do become fossils in a process that usually takes many years.process that usually takes many years.

The Fossilization ProcessThe Fossilization Process

The Fossilization ProcessThe Fossilization Process• A Protoceratops drinking at a river falls into the water and drowns• Sediments from upstream

rapidly cover the body, slowing its decomposition. Minerals from the sediments seep into the body.

• Over time, additional layers of sediment compress the sediments around the body, forming rock. Minerals eventually replace all the body’s bone material.

• Earth movements or erosion may expose the fossil millions of years after it formed.

Scientists use a variety of methods to determine Scientists use a variety of methods to determine the age of fossils. One method is a technique the age of fossils. One method is a technique called relative dating.called relative dating.

Relative datingRelative dating

If the rock layers If the rock layers have not been have not been disturbed, the disturbed, the layers at the layers at the surface must be surface must be younger than the younger than the deeper layers.deeper layers.

The Fossil RecordThe Fossil Record

Darwin’s views were influenced by Darwin’s views were influenced by fossilsfossils, , the relics or impressions of organisms from the relics or impressions of organisms from the past, mineralized in the past, mineralized in sedimentary sedimentary rocksrocks.. Sedimentary rocks form when mud and sand settle to Sedimentary rocks form when mud and sand settle to

the bottom of seas, lakes, and marshes.the bottom of seas, lakes, and marshes. New layers of sediment cover older ones, creating New layers of sediment cover older ones, creating

layers of rock called strata.layers of rock called strata. Fossils within layers show that a succession of Fossils within layers show that a succession of

organisms have populated Earth throughout time.organisms have populated Earth throughout time.

Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Fig. 22.2 Fig. 22.4

Fossils are the preserved remnants or Fossils are the preserved remnants or impressions left by organisms that lived in impressions left by organisms that lived in the past.the past. In essence, they are the historical documents In essence, they are the historical documents

of biology.of biology. The The fossil recordfossil record is the ordered array in which is the ordered array in which

fossils appear within sedimentary rocks.fossils appear within sedimentary rocks. These rocks record the passing of geological time.These rocks record the passing of geological time.


The organic material in a dead organism The organic material in a dead organism usually decays rapidly, but hard parts that usually decays rapidly, but hard parts that are rich in minerals (such as bones, teeth, are rich in minerals (such as bones, teeth, shells) may remain as fossils.shells) may remain as fossils.

Under the right conditions minerals Under the right conditions minerals dissolved in groundwater seep into the dissolved in groundwater seep into the tissues of dead organisms, replace its tissues of dead organisms, replace its organic material, and organic material, and create a cast in the create a cast in the shape of the organism.shape of the organism.


Fig. 25.1c

Trace fossils consist of footprints, Trace fossils consist of footprints, burrows, or other impressions left in burrows, or other impressions left in sediments by the activities of animals.sediments by the activities of animals.

These rocks are in These rocks are in essence fossilized essence fossilized behavior.behavior. These dinosaur tracksThese dinosaur tracks

provide informationprovide informationabout its gait.about its gait.


Fig. 25.1f

Rarer than mineralized fossils are those Rarer than mineralized fossils are those that retain organic material.that retain organic material.

These are sometimes discovered as thin These are sometimes discovered as thin films between layers of sandstone or films between layers of sandstone or shale.shale. As an example, plant leaves millions of As an example, plant leaves millions of

years old have been discovered that are still years old have been discovered that are still green with chlorophyll.green with chlorophyll.

The most commonThe most commonfossilized material isfossilized material ispollen, which has apollen, which has ahard organic casehard organic casethat resiststhat resistsdegradation.degradation.


Comparative AnatomyComparative AnatomyHomoHomologous Structureslogous Structures

homo-homo-

SAMESAME

Comparative AnatomyComparative AnatomyHomoHomologous Structureslogous Structures

Comparative AnatomyComparative Anatomy Not all similarity is homology…Not all similarity is homology…

Remember: homologous = Remember: homologous = common ancestorcommon ancestor

Comparative AnatomyComparative Anatomy

AnaAnalogous Structureslogous Structures

ana- NOTana- NOT



Mammals

Distant rat-like common ancestor


Vestigial StructuresVestigial Structures

TOP 10 Useless Limbs TOP 10 Useless Limbs (and other Vestigial Organs)(and other Vestigial Organs)

10. The wings on flightless birds.10. The wings on flightless birds.

http://www.livescience.com/animalworld/top10_vestigial_organs.html

1. The human appendix.1. The human appendix.

2. Male breast tissue and nipples.2. Male breast tissue and nipples.

3. Mating behavior of virgin whiptail lizards.3. Mating behavior of virgin whiptail lizards.

4. Sexual organs of dandelions.4. Sexual organs of dandelions.

5. Wisdom teeth in humans.5. Wisdom teeth in humans.

6. The blind fish 6. The blind fish Astyanax mexicanusAstyanax mexicanus..

7. The human tailbone (coccyx).7. The human tailbone (coccyx).

8. Erector pili and body hair.8. Erector pili and body hair.

9. Hind leg bones in whales and snakes.9. Hind leg bones in whales and snakes.

Evidence from EmbryologyEvidence from Embryology

58 days old 166 days old

4 mm long 6 cm long

An Elephant Embryo

Comparative Embryology

EmbryosEmbryos

A fish

B bird

C pig

D human

Comparative EmbryologyComparative Embryology

Can you guess which embryo belongs to…

The human?

The fish?

The pig?

The bird?

Biochemical Evidence Biochemical Evidence

Looking at an organism Looking at an organism and the relationship and the relationship with other organisms at with other organisms at the DNA level.the DNA level.

Evidence from BiochemistryEvidence from BiochemistryAmino acids and enzymes Amino acids and enzymes

(proteins)(proteins)Ex: Cytochrome cEx: Cytochrome c

Biochemical Similarities of Organisms

Comparison of Organisms

Percent Substitutions of Amino Acids in

Cytochrome c Residues

Two orders of mammals

Birds vs. mammals

Amphibians vs. birds

Fish vs. land vertebrates

Insects vs. vertebrates

Algae vs. animals

5 and 10

8-12

14-18

18-22

27-34

57

Molecular EvidenceMolecular Evidence

Evidence from BiochemistryEvidence from Biochemistry

Factoid: Roundworms share 25% of their genes with humans!

On a molecular level, the On a molecular level, the DNA code links living DNA code links living organisms to common organisms to common ancestors.ancestors.

Evidence for EvolutionEvidence for Evolution

Today, scientists combine data fromToday, scientists combine data from fossils, comparative anatomy, fossils, comparative anatomy, embryology, embryology, and and biochemistry biochemistry in in order to interpret the order to interpret the evolutionary evolutionary relationshipsrelationships among species. among species.

Relative Age of FossilsRelative Age of Fossils

Radioactive DatingRadioactive Dating How to date a fossil (without spending a

fortune for dinner and flowers) Have you wondered how the age of fossils are determined? There are several different methods scientists use to determine age of fossils. Sometimes, it is possible to determine age directly from the fossil. Many times however, fossils are to old to have their age directly measured. Instead, age can be determined from radioactive elements occuring within rock found in association with the fossils.

Over time, radioactive “parent” isotopes Over time, radioactive “parent” isotopes are converted at a steady decay rate to are converted at a steady decay rate to “daughter” isotopes.“daughter” isotopes.

The rate ofThe rate ofconversion isconversion isindicated as theindicated as thehalf-life, thehalf-life, thetime it takestime it takesfor 50% offor 50% ofthe isotopethe isotopeto decayto decay..

Copyright © 2002 Pearson Education, Inc., publishing as Benjamin CummingsFig. 25.2

MimicryMimicry How Does Mimicry Help Animals?How Does Mimicry Help Animals?

Usually, an animal will MIMIC another Usually, an animal will MIMIC another to avoid predators. If it can to avoid predators. If it can trick its enemy into thinking it is trick its enemy into thinking it is something less tasty or more something less tasty or more dangerous, it will survive dangerous, it will survive

This tropical saturniid moth displays eyespots on This tropical saturniid moth displays eyespots on its hindwings when threatened. This is a its hindwings when threatened. This is a "dishonest" signal, in contrast to the "honest" "dishonest" signal, in contrast to the "honest" signal of the Io moth in the preceding image.signal of the Io moth in the preceding image.

MimicryMimicry A Lonomia moth A Lonomia moth

resembles a dead resembles a dead leaf on the forest leaf on the forest floor of the floor of the Monteverde Cloud Monteverde Cloud Forest in Costa Forest in Costa Rica, her head at Rica, her head at the left and a the left and a simulated leaf vein simulated leaf vein running from wingtip running from wingtip to wingtip.to wingtip.

In the lowland rain forest of the Peruvian In the lowland rain forest of the Peruvian Amazon, a "bird dropping" on a leaf Amazon, a "bird dropping" on a leaf turns out to be a caterpillar.turns out to be a caterpillar.

Munching on a plant Munching on a plant stem in Costa Rica's stem in Costa Rica's Monteverde Cloud Monteverde Cloud Forest Reserve, this Forest Reserve, this Xylophanes Xylophanes caterpillar has such caterpillar has such tiny eyes that you tiny eyes that you would need a hand would need a hand lens to see them. lens to see them. The red "eyes" and The red "eyes" and pointed "stinger" are pointed "stinger" are both fakeboth fake..

CamouflageCamouflage A masked A masked

treefrog seems to treefrog seems to be strumming a be strumming a stem as we watch stem as we watch him on the slopes him on the slopes of Costa Rica's of Costa Rica's Penas Blancas Penas Blancas cloud forestcloud forest

CamouflageCamouflage An animal uses An animal uses camouflagecamouflage to blend in to blend in

with its environment. Camouflage is the with its environment. Camouflage is the use of color, pattern, and shape to look use of color, pattern, and shape to look like the things around you like the things around you

A gravid female A gravid female katydid blends with katydid blends with the tropical the tropical vegetation in the vegetation in the lowland Amazon lowland Amazon rain forest of Peru. rain forest of Peru. Her wings mimic Her wings mimic the mottling of the the mottling of the surrounding leaves, surrounding leaves, and she holds even and she holds even her long antennae her long antennae still as we take this still as we take this available-light photo available-light photo

Physiological EvidencePhysiological Evidence

A change in the organisms metabolic A change in the organisms metabolic processes:processes:

Weeds ability to become resistant to Weeds ability to become resistant to herbicides.herbicides.

Bacteria’s ability to become resistant to Bacteria’s ability to become resistant to antibiotics.antibiotics.

Venom of a snakeVenom of a snake

Structural AdaptationsStructural Adaptations

Take many different forms –Take many different forms – ThornsThorns teethteeth hairhair beaksbeaks colorcolor TailsTails

Possible AncestralLasan finch

Amakihi Extinct mamo

Crestedhoneycreeper

Akialoa

Akepa

Akiapolaau LiwiMaui parrotbill

Apapane

Ou

Grosbeak finch

PalilaAkikiki

Niihau

Kauai

Oahu

Lanai

Molokai

Maui

KahoolaweHawaii

Diversity in new environmentsDiversity in new environments

Charles Darwin – Father of Charles Darwin – Father of Modern Scientific ThoughtModern Scientific Thought

Raised on a farm Raised on a farm Was an avid Was an avid

outdoorsman (fished outdoorsman (fished and hunted), collected and hunted), collected bugs, taxidermistbugs, taxidermist

Influenced greatly buy Influenced greatly buy his grandfather his grandfather Erasmus DarwinErasmus Darwin Was a Physician, Was a Physician,

Poet and early Poet and early EvolutionistEvolutionist

Charles Darwin – Father of Charles Darwin – Father of Modern Scientific Modern Scientific Thought, cont’dThought, cont’d Family plans were to Family plans were to

have him become a have him become a doctor like his doctor like his grandfather and father grandfather and father

After 2 years of After 2 years of Medical School he Medical School he dropped outdropped out Operations were Operations were

bloody and had bloody and had problems with faintingproblems with fainting

Charles Darwin – Father of Charles Darwin – Father of Modern Scientific Modern Scientific Thought, cont’dThought, cont’d Parents sent him to Parents sent him to

Divinity School for 3 Divinity School for 3 years to become a years to become a clergy in the Church of clergy in the Church of England England Left because he Left because he

preferred to be preferred to be outdoorsoutdoors

As any parent would As any parent would do, they worried about do, they worried about what they were going what they were going to do with their sonto do with their son

Charles Darwin – Father of Charles Darwin – Father of Modern Scientific Modern Scientific Thought, cont’dThought, cont’d

Darwin’s Botany Darwin’s Botany professor at Cambridge professor at Cambridge (John Stevens Henslow) (John Stevens Henslow) was contacted about a job was contacted about a job as a naturalist for a shipas a naturalist for a ship

He thought of Darwin for He thought of Darwin for the positionthe position

Because of Henslow’s Because of Henslow’s recommendation, Darwin recommendation, Darwin was hired as the was hired as the Naturalist aboard the Naturalist aboard the H.M.S. Beagle and as a H.M.S. Beagle and as a companion for Captain companion for Captain FitzroyFitzroy

Charles Darwin – Father of Charles Darwin – Father of Modern Scientific Modern Scientific Thought, cont’dThought, cont’d Darwin had one major Darwin had one major problem on the voyageproblem on the voyage He was seasick for almost He was seasick for almost

the entire voyage the entire voyage

Because of this, every time Because of this, every time he had a chance to go he had a chance to go ashore, he didashore, he did

While away from the ship, While away from the ship, he collected plants and he collected plants and animals to send back to animals to send back to England and made England and made meticulous drawings of meticulous drawings of those he didn’t collectthose he didn’t collect

Cape Verde Islands

Galapagos Islands

Lamarckism:Lamarckism: Inheritance Inheritance of Acquired Traitsof Acquired Traits

““Organisms by striving to adapt to their Organisms by striving to adapt to their environment acquire adaptations during environment acquire adaptations during their lives that are passed on to its their lives that are passed on to its offspring”offspring” New parts from no parts and use disuseNew parts from no parts and use disuse

Pangenetic view of developmentPangenetic view of development ““Gemules” modify the preformed embryo in Gemules” modify the preformed embryo in

the males spermthe males sperm

Inheritance of Acquired Inheritance of Acquired TraitsTraits

Observation #1: All Observation #1: All species have such great species have such great potential fertility that their potential fertility that their population size would population size would increase exponentially if all increase exponentially if all individuals that are born individuals that are born reproduced successfully.reproduced successfully.

Observation #2: Observation #2: Populations tend to remain Populations tend to remain stable in size,stable in size,except for seasonal except for seasonal fluctuations.fluctuations.

Observation #3: Environmental resources are Observation #3: Environmental resources are limited.limited.

Fig. 22.8


Observation #4: Individuals of a population Observation #4: Individuals of a population vary extensively in their characteristics; no vary extensively in their characteristics; no two individuals are exactly alike.two individuals are exactly alike.

Observation #5: Much of this variation is Observation #5: Much of this variation is heritable.heritable.

Fig. 22.9

•Inference #1: Production of more individuals than the environment can support leads to a struggle for existence among the individuals of a population, with only a fraction of the offspring surviving each generation.

Inference #2Inference #2: Survival in the struggle for : Survival in the struggle for existence is not random, but depends in existence is not random, but depends in part on the hereditary constitution of the part on the hereditary constitution of the individuals. individuals. Those individuals whose inherited Those individuals whose inherited

characteristics best fit them to their characteristics best fit them to their environment are likely to leave more offspring environment are likely to leave more offspring than less fit individuals.than less fit individuals.

Inference #3Inference #3: This unequal ability of : This unequal ability of individuals to survive and reproduce will individuals to survive and reproduce will lead to a gradual change in a population, lead to a gradual change in a population, with favorable characteristics accumulating with favorable characteristics accumulating over the generations.over the generations.

Causes of Genetic Causes of Genetic Variation in a PopulationVariation in a Population

RecombinationRecombination

Gene Flow - MigrationGene Flow - Migration

Genetic DriftGenetic Drift

MutationsMutations



Gene Flow – MigrationGene Flow – Migration


MutationsMutations

Gene FlowGene Flow

The loss or gain of alleles in a population The loss or gain of alleles in a population due to the migration of fertile individuals due to the migration of fertile individuals or gametes between populations. or gametes between populations. If too much gene flow, populations become If too much gene flow, populations become

homogeneoushomogeneous

Gene FlowGene Flow

10 Red : 0 White6 Red : 4 White6 Red : 4 White

Gene FlowGene Flow

10 Red : 2 White10 Red : 0 White10 Red : 0 White





MutationsMutations


Changes in the gene pool of a small Changes in the gene pool of a small population due to chance. population due to chance.

Important to small populations.Important to small populations. The Founder EffectThe Founder Effect

New colony being populated by a few New colony being populated by a few individualsindividuals Important on islandsImportant on islands

The BottleneckThe Bottleneck Diseases or other catastrophes cause the Diseases or other catastrophes cause the

population to dramatically decrease in numberspopulation to dramatically decrease in numbers


A change in a population’s allele A change in a population’s allele frequency due to chance. Important to frequency due to chance. Important to small populations.small populations. The Founder EffectThe Founder Effect

New colony being populated by a few New colony being populated by a few individualsindividuals Important on islandsImportant on islands

The BottleneckThe Bottleneck Natural catastrophes cause the population to Natural catastrophes cause the population to

dramatically decrease in numbersdramatically decrease in numbers

The BottleneckThe Bottleneck


Flood kills Flood kills most of most of the the individualsindividuals





MutationsMutations

Mutations:Mutations: Any change in the genetic Any change in the genetic sequence of DNAsequence of DNA

Most Mutations are NeutralMost Mutations are Neutral Replicational repair Replicational repair Redundancy in genetic codeRedundancy in genetic code Intron/Exon formation in mRNAIntron/Exon formation in mRNA Masked by dominant geneMasked by dominant gene

On average, mutations occur 1 out of a On average, mutations occur 1 out of a billion base pairs; thus we carry 3 mutations billion base pairs; thus we carry 3 mutations in our genetic codein our genetic code

Genetic RedundancyGenetic Redundancy

Genetic RedundancyGenetic Redundancy

MetSerValStopMetSerValStop

AUGUCAGUUUAGAUGUCAGUUUAG

MutationsMutations

AUGUCAGUAUGUCAGUAAUAUAAA

MetSerValStopMetSerValStop

Introns/ExonsIntrons/Exons

Sickle-cell AnemiaSickle-cell Anemia First described by a Chicago First described by a Chicago

MD in the early 1900’s.MD in the early 1900’s. Caused by a SINGLE mutation Caused by a SINGLE mutation

(change second base of the (change second base of the codon from uracil to adenine – codon from uracil to adenine – from valine to glutamate) at from valine to glutamate) at the sixth position of the beta the sixth position of the beta chain.chain.

Causes the hemoglobin Causes the hemoglobin molecule to lose their molecule to lose their flexibility and become rigid.flexibility and become rigid.

Under low oxygen condition, Under low oxygen condition, the RBC will become sickle in the RBC will become sickle in shape.shape.

These sickled RBC are then These sickled RBC are then destroyed.destroyed.

Sickle-cell AnemiaSickle-cell Anemia A recessive gene that A recessive gene that

follows “Mendelian follows “Mendelian Inheritance”.Inheritance”.

Homozygous recessive Homozygous recessive condition is “Sickle-cell condition is “Sickle-cell Anemia” with only a Anemia” with only a 20% chance of 20% chance of surviving to puberty.surviving to puberty.

Heterozygous condition Heterozygous condition is “Sicklemia” and is “Sicklemia” and individuals will only individuals will only become ill under become ill under extreme conditions, e.g. extreme conditions, e.g. high altitudes, exertion.high altitudes, exertion.

Three Forms of Natural Three Forms of Natural SelectionSelection

StabilizingStabilizing

DirectionalDirectional

DisruptiveDisruptive

Stabilizing SelectionStabilizing Selection

Directional SelectionDirectional Selection

Disruptive SelectionDisruptive Selection

Allopatric SpeciationAllopatric Speciation

From Ricklefs, R.E. 2001. The Economy of Nature. W.H. Freeman. New York.

Mammals

Distant rat-like common ancestor

What happens when 2 What happens when 2 “new” species come in “new” species come in contact again?contact again?

Post-zygotic BarriersPost-zygotic Barriers

Pre-zygotic BarriersPre-zygotic Barriers

Which ones happen are a function of timeWhich ones happen are a function of time

Once these types of barriers are in place, two Once these types of barriers are in place, two species can overlap in space, and remain true species can overlap in space, and remain true biological speciesbiological species

Post-zygotic barriersPost-zygotic barriers

Hybrid sterility - hybrids can't Hybrid sterility - hybrids can't produce functional gametes produce functional gametes

Hybrid Hybrid breakdownbreakdown - hybrids - hybrids never reach sexual maturity. never reach sexual maturity.

Hybrid Hybrid inviabilityinviability - offspring - offspring of hybrids are inviable.of hybrids are inviable.

Time Time IncreasingIncreasing

Pre-zygotic BarriersPre-zygotic Barriers

Gametic isolation - gametes fail Gametic isolation - gametes fail to uniteto unite

Structural isolation - mating is Structural isolation - mating is physically impossiblephysically impossible

Behavioral isolation - mates Behavioral isolation - mates recognize species specific sexual recognize species specific sexual signalssignals

Temporal isolation - mating Temporal isolation - mating occurs at different times. occurs at different times.

Habitat isolation - mating occurs Habitat isolation - mating occurs in different places in different places

Time IncreasingTime Increasing

Adaptive Radiation – Adaptive Radiation – Produces Homologous Produces Homologous structuresstructuresA Common AncestorA Common Ancestor

Convergent Radiation- Convergent Radiation- Species that are Species that are notnot closely related have closely related have similar traits in similar similar traits in similar environmentsenvironments

Homology or analogy?

You have probably noticed that dolphins and sharks both have a streamlined body shape with a triangular fin on the back and two side fins. However, the two animals also have many differences.

Sharks Dolphins

skeleton made of cartilageskeleton made of cartilage skeleton made of bone<> skeleton made of bone<>

use gills to get oxygen from the water in use gills to get oxygen from the water in which they swimwhich they swim

go to the surface and breathe go to the surface and breathe atmospheric air in through their blowholesatmospheric air in through their blowholes

don't nurse their youngdon't nurse their young do nurse their youngdo nurse their young

don't have hairdon't have hair do have hair — they are born with hair do have hair — they are born with hair around their "noses"around their "noses"

They may share the same basic They may share the same basic shape, but underneath their skins, shape, but underneath their skins, sharks and dolphins are very sharks and dolphins are very different! different!

evolution mrs. knopke fullerton union high school

Documents

unrolling slide

fossil record slide

fossilization process

age of fossils

summary pages

rock layers

layers of rock

sedimentary rocks form