ICANCER RESEARCH57. 3772-3778. September I. 1997)

ABSTRACT

Loss ofheterozygosity (LOH) on chromosome 18q21 is found frequently invarious human cancers. Three candidate tumor suppressor genes, DCC (de

leted in colorectal carcinomas), DM24 (deleted in pancreatic carcinomas, locus4), and MADR2/JV18-1(MAD-relatedgene2), have been doned and Identifiedfrom this chromosome region. We have reported recently that LOH onchromosome 18q is observed frequently in neuroblastoma. Alterations ofDCC are involved in many human tumors. DPC4 and MADR2/JVJ8-1 arerecently demonstrated to be altered in pancreatic and colorectal cancers,respectively.To confirm if inactivation of the DCC, DPC4, and MADR2/JV18-1 genes is involved in the pathogenesis of neuroblastoma and to clarifythe mechanism of inactivation,we analyzed the expression of DCC, DPC4,and MADR2/JVI8-1 in neuroblastoma cell lines and primary tumors byreverse transcription-PCR and investigated the mutations in the codingregions of these genes by PCR/reverse transcription-PCR single-strand con

formation polymorphism. We found that 12 of 25 (48%) cell lines and 14 of32 (44%) primary tumors, including 3 with lSq LOH, had absent or reduced

expression of DCC mRNA. Expression was more likely to be reduced inadvanced (67%) than in early stage neuroblastomas (24%) (P 0.036),suggesting that inactivation of the DCC gene plays an important role in theprogressionof neuroblastoma.Altered expressionoIDPC4 was found in six(24%) cell lines and six (19%) tumors. MADR2/JV18-1expression was reduced or absent only In four (16%) cell lines and three (9%) tumors. Mutadons ofthe DCC genes were examined in 25 of29 exons in neuroblastoma celllines,andthoseexonsinwhichmutationswerefoundwerefurtherexaminedin prlmal7 tumors. We found mi&sensemutations oIAAC (Asn)to AGC (Ser)at DCCcodesi 176 in one cell line and ACC (Thr) to ATC (lIe) at codon 1105in one cell line and tumor, respectively; polymorphlsmsof CGA (ArgJ toGGA (Gly) at codon 201 and lTf (Phe) to UG (Leu) at codon 951 in mostofthe cell linesand tamors and a silentmutationofGAG (Glu)to GAA (Glu)at codon 118 in four cell lines and five primarytumors. We did not identifyany mutations in theDPC4 and MADR2/JVI8-1 genes in neuroblastoma. Ourresults suggested that mutations of the DCC gene may be involved in thepathogenesis of neuroblastomas but failed to account for the relatively high

frequency of the altered expression, implying that other mechanisms areresponsible for the inactivation of the DCC gene in neuroblastoma. Lowfrequency of reduced or absent mRNA expression and lack of mutations inDPC4 and MADR2/JV18-1 genessuggested a limited role for these two genesin neuroblastoma.

INTRODUCTION

Frequent LOH3 is a hallmark for the presence of tumor suppressorgenes on the affected chromosome regions. LOH on chromosome

Received 3/17/97; accepted 7/1/97.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

I This work was supported in part by a Grant-in-Aid for Intemational ScientificResearch, Scientific Research on Priority Areas, and Scientific Research (B) and (C) fromthe Ministry of Education, Science, Sports and Culture, Japan.

2 To whom requests for reprints should be addressed. Phone: 81-3-3815-541 1. exten

sion3452;Fax:81.3.3816-4108.3 The abbreviations used are: LOH. loss of heterozygosity; DCC, deleted in colorectal

carcinomas; DPC4, deleted in pancreatic carcinomas. locus 4; MAD, Mothers against dpp;MADR2, MAD-related gene 2; RT-PCR, reverse transcription-PCR; SSCP, single-strandconformational polymorphism; PB. peripheral blood.

l8q2l is frequently detected in various human cancers (1—8).Threecandidate tumor suppressor genes have been cloned and identified inthis region. They are the DCC, DPC4, and MADR2/JVJ8-1 genes,respectively (9—12). The relative positions of these three genes at

chromosome 18q2l are: l8cen-MADR2/JVJ8-1-DPC4-DCC-l8qter

(11).The DCC gene was originally identified as a tumor suppressor gene

in colorectal carcinomas, with allelic deletions of this gene present inabout 7 1% of tumors (9). DCC expression is reduced or absent inapproximately 50% of primary cancers and 100% of metastatic tumors of colorectal cancers in the liver (13—16).Recent evidence hasdemonstrated that the DCC gene is also involved in the carcinomas of

the esophagus, pancreas, stomach, breast, prostate, bladder, malegerm cells, female reproductive tract, leukemias, neuroblastomas, andgliomas, and loss of DCC expression is associated with distant me

tastasis or progression of the tumors (17—21).Thus, DCC is a strongcandidate for the 18q target in a variety of human cancers. DCC geneis mapped to l8q21.3 and is extremely large, spanning greater than

1.35 megabases and having at least 29 exons (22). The cDNA of theDCC gene predicts a 1447-amino acid transmembrane protein, whichhas four immunoglobulin-like and six fibronectin type Ill-like domains and shows high homology to the neural cell adhesion moleculefamily of cell surface proteins (23, 24). It also reveals a similarity tofrazzled and UNC-40, two recently identified transmembrane proteinsof the immunoglobulin superfamily mainly expressed on motorneurons of the nervous system and required for netrin-dependent motilecells/axons guidance (25, 26). The cytoplasmic domain only sharessimilarity to neogenin (27). The DCC transcript and protein are mostabundant in the central and peripheral nervous system of adult mammals (23, 24).

The functional studies have proposed that the DCC gene may havean important role in mediating cell differentiation in the nervoussystem (28, 29). A recent study also suggested that DCC is likely areceptor for a family of celllaxon guidance molecules (30). Otherstudies have provided evidence that the DCC gene functions in tumorsuppression (31, 32). Specifically, a full length but not truncated DCC

inhibited tumorigenicity in a human squamous carcinoma cell line that

had allelic loss and reduced expression of DCC (33).Although the DCC gene has been thought to be an important gene

inactivated by l8q LOH in human cancers, the limited number mutations detected in the affected cancer cells has prompted a search forother candidate genes in the same chromosome region. A recent studyof pancreatic cancers has identified another candidate tumor suppressor gene, DPC4, located on the 18q21 region (10). This gene was

mapped to l8q2l.l. Homozygous deletions of DPC4 were found in 25(30%) of 84 pancreatic carcinomas and somatic mutations in thecoding regions of DPC4 were identified in 6 of 27 tumors (10).MADR2/JVJ8-1, the most recently identified candidate tumor suppressor gene, was detected in 18q2 1 from colorectal cancers (1 1, 12).

The DPC4 and MADR2/JVI8-I genes share similarity to the Drosophila melanogaster gene, MAD, which is known to be involved inthe transforming growth factor @3signaling pathway (34). Inactivation

3772

Expression and Mutational Analysis of the DCC, DPC4, and MADR2/JVJ8-1 Genes

in Neuroblastoma'

Xiao-Tang Kong, Seung Hoon Choi, Akira Inoue, Feng Xu, Tao Chen, Junko Takita, Jun Yokota, Fumio Bessho,Masayoshi Yanagisawa, Ryoji Hanada, Keiko Yamamoto, and Yasuhide Hayashi2

Departments of Pediatrics IX. T. K.. F. X., T. C.. F. B.. M. I'.. I'. H.J and Pediatric Surgers [S. H. C.]. Faculty of Medicine, University of Tokyo. Hongo 7.31, Bunkvo-ku, Tokyo113: Department of Molecular Biology, Toho Unit'ersitv School of Medicine, Ohmori-Nishi 5-21-16. Ohta-ku, Tokyo 143 (A. 1.1: Biology Division. National Cancer CenterResearch Institute. Tsukiji 5-1-I. Chuo-ku, Tokyo 104 Ii. T.. J. Y.]: and Division of Hematology/Oncology, Saitama Children ‘sMedical Center, Magome 211Xt, Iwatsuki, Saitama339 (R. H., K. I'.], Japan

on June 22, 2020. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Table 1 Oligonucleotide primers used in RT.PCRanalysisGenesSenseAntisenseDCC

DPC4MADR2f3-actin5'

-TTCCGCCATGGTTTTTAAATCA- 3 ‘

5'-ACCTGGAGATGCTGTTCA- 3‘5,-CAGGGTTTTGAAGCCGTCTAT- 3‘5‘-CTTCTACAATGAGCTGCGTG- 3‘5'

-AGCCTCATTTTCAGCCACACA- 3'5 ,-TGTCTTGGGTAATCCGGTC -3'

5‘-CATGGGACTTGATTGGTGAA -3'5' -TCATGAGGTAGTCAGTCAGG- 3'

DCC. DPC4. AND MADR2JJVI8-lGENESIN NEUROBLASTOMA

of either of the genes may function to disrupt transforming growthfactor f3 signaling (11). Investigation of the alterations of the DPC4 invarious tumor types and MADR2/JV18-1 in lung cancers showed thatthey are uncommon in many tumor types (35—39).

Neuroblastoma is a malignant tumor of neural crest origin and is themost common childhood extracranial solid neoplasm with an mcidence of about 1 in 100,000 to 130,000 children under 15 years of age(40). Genetic changes in neuroblastoma include an aberration ofchromosome ip (41, 42), LOH of 1lq and 14q (43, 44), and amplifiedoncogenes such as N-myc (45, 46). We recently found that LOH onchromosome l8q21 was frequent (31%) in neuroblastoma (8). A morerecent study showed that DCC protein expression was correlated withdissemination of the neuroblastoma (20). Thus, to address whether theinactivation of the DCC gene plays a role in the development andprogression of neuroblastoma and whether the mutations contributedto the inactivation, and furthermore, whether the other two 18qcandidate genes, DPC4 and MADR2/JVI8-1, are involved in thisdisease, we examined neuroblastoma cell lines and primary tumors forexpression of DCC, DPC4, and MADR2/JVJ8-l by RT-PCR and formutations of these three genes by PCR-SSCP, followed bysequencing.

MATERIALS AND METHODS

Tumor Cell Lines. We studied 25 neuroblastoma cell lines. Five of them(SCMC-N2, SCMC-N3, SCMC-N4, SCMC-N5, and 90-T5') were establishedin our laboratory (47, 48). Seven (SJNB-l , SJNB-2, SJNB-3, SJNB-4, SJNB-5,SJNB-7, and SJNB-8) were a generous gift from Dr. A. 1. Look (St. JudeChildren's Research Hospital, Memphis, TN). The other cell lines were obtamed from the Japanese Cancer Research Resources Cell Bank (NH12, TOW,NB-l, GOTO, IMR-32, NB-l9, LAN-5, SK-N-SH, CHPI34, NB-16, NB-69,LAN-l, LAN-2). All cell lines were cultured in RPMI 1640 containing 9%fetal bovine serum.

Primary Tumor Specimens. Thirty-two tumor specimens were mainlytaken from the neuroblastoma patients either at Saitama Children's MedicalCenter or at the University of Tokyo Hospital before chemotherapy. Tissuespecimens were immediately frozen in liquid nitrogen and stored at —80°C.Eleven noncancerous tissues, including peripheral lymphocytes, and bonemarrow were obtained from the tumor patients. Normal control samplesincluded skeletal muscle and thymus gland specimens obtained from noncancer patients after obtaining the informed consent of the parents, as well aseight PB samples for RT-PCR. All PB samples were obtained from healthyvolunteers.

Patient Data. The stage of patients was defined according to Evan'sclassification (49). Thirty-two tumors from patients of ages 38 days to 11

years, with a median age of 8.5 months, were analyzed for DCC expression byRT-PCR.Of the 32 patients,21 were youngerand 11 were older than 1 year(20 males and 12females). Eleven were found by mass screening (50), 21 werefound clinically. Twelve were classified as stage I, 5 as stage II, 2 as III, and13as IV. All patients were alive for 4 to 108months, except for three who diedof the disease 1, 8, and 49 months after diagnosis. N-myc gene amplificationwas found in four patients. Of the 32 primary tumors from these patients, 13have been analyzed by Southern blotting and found to be informative at theDCC locus, and 6 of them had LOH at the DCC locus (8). Patients in stage Ior II were treated by either surgery or surgery plus chemotherapy, whichmainly consisted of vincristine and cyclophosphamide without radiotherapy.Patients in stage III or IV were administered multidnig chemotherapy consisting ofcyclophosphamide, Adriamycin, cisplatin, and etoposide with or without

surgery, radiotherapy, and hematopoietic stem cell transplantation (51).

Total RNA Isolation. Total RNAs were extracted from the cell lines andtissues using the acid guanidinium thiocyanate-phenol chloroform method(52).

RT-PCR Detection of mRNA Expression of DCC, DPC4, and MADR2/JVJ8-1. Randomly primed cDNAs were reverse-transcribed from 4 @goftotal RNAs using a cDNA synthesis kit (Boehringer Mannheim Corp., Mannheim, Germany) in a 20-pi mixture as described (53). Two @lof the cDNA

conversion mixture was amplified by PCR. The 2-p.l mixture was increased to

100 @lby adding 10 mMTris-HCI (pH 8.3), 50 mt@iKC1, 1.5 nmi MgCl2, 200@.LMof each deoxynucleotide triphosphate, 6 units of Taq polymerase, and 50

pmol of each of the specific oligonucleotide primers for DCC, DPC4, andMADR2/JVI8-1.ThesequencesoftheoligonucleotideprimersforRT-PCRareshown in Table 1. The primers for DCC amplification were the same as

reported previously (9). Previous studies have suggested that mutations in theDPC4 cluster within exons 8 and 11 of the gene (10) and in MADR2/JVI8-I

within nucleotides I I 82—1430 ( 1 1). These regions contain a high level of

homology to the Drosophila melanogaster Mad and Caenorhabditis elegansSma genes. The primers for DPC4 and MADR2/JVI8-l detection were newlydesigned from these highly conserved regions. f3-Actin-specific oligonucleo

tides provided a quantitative control of the reaction. PCR amplification wasperformed in a DNA thermal cycler (Perkin-Elmer Corp.) and consisted of 30or 40 cycles of denaturation for 1 mm at 94°C,annealing for 1 mm at atemperature appropriate for the various primers, and extension for 2 mm at72°C.A finalextensionproceededfor 7 mm at 72°C.The @-actingene wasamplified at 94°Cfor 1 mm, 55°Cfor I mm, and 72°Cfor 2 mm for 30 cycles.

Southern Blotting of PCR Products. The PCR products were transferredto a Biodyne B nylon membrane (PALL; BioSupport Corp. NY) under alkalineconditions. The blots were hybridized with a [y-32PIATP-labeled oligonucleotide probe in prehybridization mixture consisting of 50% formamide, 5 XDenhardt's solution, 5X standard saline citrate (SSC), 1% SDS, and 100 @.ag/mldenatured salmon sperm DNA (Sigma Chemical Co., St. Louis, MO) at 37°Covernight and washed in the following solutions at room temperature for 15mm sequentially: (a) 2X SSC, 0.1% SDS; (b) 0.5X SSC, 0.1% SDS; and (c)

0.1 X SSC, 0.1% SDS. Finally the blots were incubated in 0.1 X SSC containing 1% SDS at 42°C for 30 mm. The membrane was exposed to an X-ray film

for 1 h at room temperature. The probe for DCC hybridization was 57 bp ofpartial DCC cDNA from nucleotide 1 141 to 1 197 (13). The oligonucleotide

primers for DPC4 and MADR2/JVI8-l were used as probes. The coding regionof @-actinfrom nucleotide 42 to I 169 was used as the probe for @3-actinhybridization (54). The intensity of individual bands was measured by image

analysis (Model BAS 2000; Fuji Corp., Tokyo, Japan). The expression level of

mRNA was calculated by normalization of the amount of the amplifiedfragment of the genes to the 305-bp f3-actin fragment. The ratio of theexpression to f3-actin was given as arbitrary units (d.u.) and then converted tothe following scale: —,(0 to <0.10 d.u.; DCC gene: median, 0.02; range,0.00—0.07);+1—,(0.10 to <1.00 d.u.; DCC gene: median, 0.56; range,0.18—0.81);+, (1.00 to <2.00 d.u.; DCC gene: median, 1.46; range, 1.26—1.97); ++, (2.00 to <3.00 d.u.; DCC gene: median, 2.61; range, 2.12—2.88);and + + +, (3.00 d.u.; DCC gene: median, 3.82; range, 3.22—4.00). Thisallowed for good discrimination of absent (—)to reduced (+1—),and abundant(+ to ++), toveryabundant(+++) expressionofmRNA.

PCR/RT-PCR-SSCP and Direct Sequencing. High molecular weightDNA was prepared from cell lines or tumor tissues using the proteinaseK/phenol-chloroform method for examination of the mutations in the DCCgene (48). RNA was prepared, and cDNA was reversely transcribed (53) forscreening mutations in the DPC4 and MADR2/JVI8-1 genes. PCRIRT-PCRSSCP was performed as reported with some modification (48). Twenty-fivepairs of DCC oligonucleotide primers, either based on the intron-exon boundary sequences of the gene or synthesized as described ( 19, 22), were used toamplify 25 of the 29 DCC exons (Fig. 1). Primer pairs for the remaining four

exons could not be designed based on the boundary sequences available. The

3773

on June 22, 2020. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Table 2 Oligonucleotide primers for mutation analysis of 25 exons of the DCCgeneExonSense

primerAntisenseprimerCodonI

235'

-GTGAGTGCTGCCGCTG-3 ,5'-ATTTCCCTGTGCTCTCTTGTTC- 3'5 , -ATTTGGAAGACTTATTCTTCC - 3 ‘5'-GGGTACGGAAGGGGGT-3

‘5'-GAAGAATCCACCTACCTGCTAC-3'5,- TCTGAAGGCAACAAAGAGCA-3‘1-31

31-138138-23345

,-TTTTCCCCTCATAGATCCAG- 3‘5' -GTGAAATACCTGAGTTGGA- 3‘233-28355'-AATTTACTCTGCACCTTCCCTA-3 ‘5'-CTCATCTCCAGCCACTAACTT-3‘283-32965

‘- TTTCTGTCTTTGCAGTTCCG - 3 ‘5 ‘-GAAACAAAATAATTACGACT- 3‘329-38075'-ATACTTTACCTGCTTTTTCT-3'5'-ACCAAAGCAAGGTTCCCATT-3‘381-42185‘-TCTGATAGCCTCCTCTTCTT- 3 ‘5 ‘-TTATTGGTAGCATCACCTAC- 3‘421-47395,-TCAGGGAACGAGCATTGA- 3‘5' -TTCATACTCACACTCAGGC- 3‘473-525105‘-TTATACAGTGCAAGTTCCAG- 3‘5' -ATTCCTTCTCCTACCTGTT- 3‘525-574I

I5' -TTGGTGTTTTATGTCTCCAG- 3,5 ,-ACCGTCAGAAAGTGTAACCA- 3‘575-621125‘-GTTTGATTCCTTTTAGTGCC- 3‘5 ‘-TAGGTAATGGAGTAGTGAAC- 3‘621-637135'-CAGAGTATCAAAGTTAGCTG- 3 ‘5' -TGCAAGACTACACCACGT-3‘638-685155

‘-TGCTGATGATGCCTCTTT- 3 ,5 ‘-TCACAGATACTCACCTAACC- 3‘722-787165'-CAGAGTCAAGTTCCCATT-3'5'-AACAATTTCACTTACCGG-3‘787-819175'

-TGTTTGTTTCATTTGGTGGG- 3‘5 ,-CACCTTGTATTTTGCACTTG- 3‘819-896185‘-CTTTGCTATTTCCTACTTGT- 3‘5 ‘-ATTATCAAGGGTCCAAAGTAG- 3‘897-943195‘-TTATCTCTGTCTCACCTCAC- 3 ‘5 ‘-GCTATGCTGGGAGAGAAA- 3,943-979235‘- CTTCTGCCAAATCTTCCTAAACC - 3 ‘S ‘- TCAAAAATATAACCCCAAAAG - 3 ‘I 077-I I31245'-CTCACATTTGCCTTCTAAC-3'5'

-TTTTCCCTAATGCCAGTG-3 ,I131-1207255‘-AGGGCATGTTTCTCAGGA- 3‘5 ‘-TTCATTTCTTCATTGTGGCA- 3‘1207-1246265'-GTTGAGTGAATACATAAGGTTC- 3 ‘5' -CCTTTGCTATTATTCATTTGTG- 3‘1246-1300275

‘- CAGGAATAATGAATGACTTTTC - 3 ‘5 ‘- TTTTAAAGGTGAACAACCGAG - 3 ‘I301-1371285'-ATATACTTGAGAAAGTGTTCT-3'5'-TCCCTTGATGAAGCATGAA-3,1371-1418295'-GTTACTAACTCTTGTCTCTC-3

,5'-GGTATGCTGCAAAGTTCC- 3‘1419-1447

DCC. DPC4. AND MADR2/1V18-IGENESIN NEUROBLASTOMA

849-985 986-1140 1141-12611262-14181419-15731@@j,722

191 186 177 206 193 171

2936-31303131-3163

Fig. I. DCC gene regions analyzed by PCRSSCP. The coding regions of the DCC gene areindicated by solid boxes with nucleotide positions(Nt), whereas the 5' and 3' untranslated regions ofexons I and 29 are indicated by unfilled boxes.Horizontal solid arrows above each exon indicatethe primer pair used in PCR-SSCP analysis. The 25DNA fragments amplified by 25 pairs of primersare indicated by horizontal lines with their nudeotide lengths.

.@--ø-* .4—1II-@%Exon I 2 3 4

Nt 1.91 92-412 413-697 698-848bp >138 361 353 174

*@ I

Exon II 14 15Nt 1723-18611862-1911 1912-20532054-21642165-2359 23@:@4552456-2688 2689-2827 28@!:@!35

bp 161 101 173 220 114 269 200 144@ .4IExon 22 23 24 25 26 27 28 29

Nt 3164-3229 3230-3392 3393-3619 36@@.2:!2.@3737-3898 3899-41I I 4112-4254 4255>4608

bp >255 290 185 265 279 179 >387

(DCC gene: 5+, 5+ + ; range, I .61—2.75d.u.; median, 2.1 1 d.u.; Fig.2A). Southern blots of RT-PCR products demonstrated that the amplified fragments were specific transcripts to the three genes. Amongthe 25 neuroblastoma cell lines, DCC mRNA expression was absentor reduced in 12 (48%) cell lines (Fig. 2B). Expression of DPC4 andMADR2/JVJ8-1 was altered in six (24%) and four (16%) cell lines,respectively (Table 3). Of the 32 primary tumors, altered expressionof DCC was found in 14 (44%), DPC4 in 6 (19%), and MADR2/fy18-! in 3 (9%; Figs. 2B and 3). Of the six tumors with LOH at theDCC locus (8), three had reduced DCC, one had reduced DPC4expression, and the remaining two were not altered compared withnormal controls. Of the seven patients without LOH at the DCC locus,only one had reduced DCC expression (Table 4). Eight of the 12 celllines and tumors with altered DPC4 and 5 of 7 with altered MADR2/fy18-! expression showed reduced or undetectable levels of DCCmRNA. All of the samples with reduced or absent MADR2/JVI8-1

revealed altered DPC4 expression except one tumor (Fig. 3). Todetermine the sensitivity of the RT-PCR used in this study, the cDNAof one cell line SJNB-5 was diluted with H2O before amplification. Asignal equivalent to + +, + , and +/— of DCC expression wasobtained when the cDNA was diluted 1:2, 1:10 to 1:102, and i:i0@,respectively (data not shown). The band intensities of the DCCtranscripts varied in the different neuroblastoma samples. In the cell

lines of SCMC-N4, IMR-32, TGW, and SJNB-5, the transcripts were

sequences of the 25 pairs of primers and the sizes of amplified PCR products

are shown in Table 2. The primers for DPC4 and MADR2/JVI8-1 were

synthesized as reported ( I 1, 35). The PCR consisted of 35 cycles of 1 mm at

94°Cfor denaturation, 1—2mm at an appropriate temperature for annealing, 1mm at 72°Cfor extension as an amplification step, and 7 mm at 72 for the finalextension step. Following amplification, the product was resolved by electrophoresis on a 5% nondenaturing polyacrylamide gel at 26°C or 4°C.

Direct sequencing was performed as described previously (48). Briefly, asmall piece of the gel containing the shift band detected by SSCP was excised,immersed in 20 ,xl of water, and placed at room temperature overnight. Thecentrifuged water extract was applied to PCR under the conditions describedabove for SSCP screening. The PCR products were purified using a Microcon100(Amicon, Beverly, MA). The purified DNA fragments were sequenced bythe dideoxy chain termination method using 5'-['y-32P]ATP-labeledprimersand Taq DNA polymerase from dsDNA Cycle Sequencing System (LifeTechnologies, Inc., Gaithersburg, MD) as described previously (48). The

sequencing products were resolved by electrophoresis on a polyacrylamide gelcontaining 7 M urea.

RESULTS

Expression of DCC, DPC4, and MADR2/JVJ8-1 Genes in Neuroblastoma. We examined mRNA levels of DCC, DPC4, andMADR2/JV18-1 in 25 neuroblastoma cell lines and 32 primary tumorsby RT-PCR. RT-PCR amplified the expected transcripts of the threegenes in all of the control samples with little variability in intensity

3774

on June 22, 2020. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Table 3 Ezpression of the DCC, DPC4, and MADR2JJVI8-I mRNA inneuroblastomacelllines°Cell

lines DCC DPC4MADR2NB1+1— ++SCMC-N4

+++ ++SCMC-N5+ + ++SCMC-N2- ++SCMC-N3+ ++GOTO

+1— ++IMR-32+++ ++TGW+++ ++NB-19

+ ++LAN-5++ +1—+SK-N-SH+ ++CHP-l34

+1— +1—+1—NB-l6+1— ++NB-69+ ++LAN-I+ +1—+LAN-2—+1—SJNB-l

+1— +1—+1—SJNB-2+ ++SJNB-3

+1— ++SJNB-4+1— ++SJNB-5

+++ ++SJNB-7+1— ++SJNB-8

— +1—+1—NH-12+1— ++90-T5'

+ ++a

@@ @,highlyabundant;+or++,abundant;+1—,reduced;—,absent.

Table 4 Correlation of mRNAexpression of the DCC, DPC4. andMADR2/JVI8.1geneswith clinical and biologicalfindings in primaryneuroblastomasNo.

of patients withalteredexpression(%)

No. of patientsFindings examined DCC DPC4MADR2Age<I

yr 21 8(38) 4(19) 1(5)>1yr II 6(55) 2(18)2(18)StageI,

II 17 4 (24)― 1(6) 1(6)III,IV 15 lO(67)° 5(33)2(13)Survival+

29 12(41) 4(14)3(10)—3 2(67) 2(67)0N-myc+

4 2(50) 1(25)0—28 12(43) 5(18)3(11)Mass

screening+II 2(18) 1 (9) 1(9)—21 12(57) 5(24)2(10)LOH+

6 3(50) 1(17)0—

7 1(14) 0 0

DCC. DPC4, AND MADR2/JVI8.I GENES IN NEUROBLASTOMA

Fig. 2. DCC mRNA expression in normal controts and neuroblastoma cell lines and primarytumors. Southern blotting of RT-PCR productsusing an oligonucleotide probe between DCC 2and DCC 3 demonstratedthat the 233-bpfragments were DCC-specific transcripts. A, the hybridized DCC 233-bp transcripts in normal muscle(Nor 1), thymus gland (Nor 2), PB controls (Nor3—10),and one neuroblastoma (NB) cell line(SJNB-5). The band intensities of normal controlswereaboutone-halfof theintensityof theSJNB-5cellline.Littlevariabilitywasfoundamongbandsof normal controls. The faint shadow under theDCC bands were considered to be nonspecificcontamination because they are not observed intheethidiumbromidegel. In B, the upperlineofbands are the hybridized DCC transcripts in neuroblastoma cell lines (Lanes I, 2, 5, 6, 7, 8, 10, and12 are SCMC-N3, 90-T5', TGW, NB-l, SCMCN4,SCMC-N5,SCMC-N2,and SJNB-8,respeclively) and primary tumors (Lanes 3, 4, 9, and Ii,cases R3, R4, R9, and R5l). Expression is reducedor lost in Lanes 4, 6, 10, and 12. Beta-actin bands,amplified in abundance from each sample, areindicated below the corresponding DCC bands.

4 233bp

‘4 233bp

i4 305bp

@w@@ w

screening. Reduced expression of the DPC4 and MADR2/JVJ8-Igenes was not associated with either of the described findings(Table 4).

Mutations of the DCC, DPC4, and MADR2/JV18-l Genes inNeuroblastoma. We investigated by PCR-SSCP, 25 exons of theDCC gene in 25 neuroblastoma cell lines. Those exons which showedmutations were further investigated in primary tumors and corresponding noncancerous tissues if available. Mobility shifts were detected in DCC exons 2, 3, 19, and 23 in both cell lines and tumors.Shifts were detected in exon 2 in 4 of 25 cell lines and 5 of 32 primarytumors, in exon 3 in 19 cell lines and 30 tumors, in exon 19 in 2 celllines and 21 tumors, and in exon 23 in one cell line and one tumor,respectively. Sequencing analysis showed a transition of GAG (Glu)to GAA (Glu) at codon 118 in exon 2, an AAC (Asn) to AGC (5cr)

highly abundant; the levels were approximately double that of normalcontrols (Fig. 2A). However, the band intensities of the DPC4 andMADR2/JVI8-1 products showed liule difference between the normalPB controls and the neuroblastoma samples with detectable transcripts.

Clinical Findings of the Neuroblastoma Patients with ReducedExpression of the Three Genes. Four of 17 (24%) tumors in stagesI and II and 10 of 15 (67%) in stages ifi and IV showed reducedexpression of DCC mRNA. The frequency of reduced expression ofDCC mRNA was significantly higher in stages III and IV than that instages I and II tumors (P = 0.036, by Fisher's exact test). However,it was not associated with age, N-myc amplification, survival, or mass

aThefrequencyofreducedDCCmRNAexpressionwassignificantlyhigherinstagesIII and IV than that in stages I and II neuroblastomas (P = 0.036, by Fisher's exact test).

3775

Nor! 2 3 4 5 6 7 8 9 10 NB

A

DCC

B

NB! 2 3 4 5 6 7 8 9 !O 11 12

DCC •@ - @.

Beta-actin

on June 22, 2020. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DCC, DPC4. AND MADR2/JVI8-1 GENES IN NEUROBLASTOMA

Fig. 3. DPC4 and MADR2JJVI8-1 mRNA cxpression in neuroblastoma primary tumors. Lanes/-JOofthe topline are DPC4 bands that are from thecases Rl55, Rl67, RI7O, Rlll, R173, R174, Rl75,Rl76, Rl77, and Rl78. Lanes i—JOof the bottomline are MADR2JJVI8-I bands from the cases ofR98, R99, RlOO,RIOl, Rl02, Rl03, R155, R167,R170, and Rl7l. The cases in Lanes 1—4in the topline (DPC4 expression) are the same as those inLanes 7—10in the bottom line (MADR2./JV18-I cxpression). DPC4 expression was reduced in casesR155. R170, and Rl74 (Lanes 1,3, and 5). MADR2JJVI8.I expression was absent in case Rl67 (Lane 8)and reduced in cases R 103 and R 155 (Lanes 6 and7).

@w @ww

transition at codon 176, and a CGA (Arg) to GGA (Gly) change atcodon 201 in exon 3, a substitution of TT'G (Lou) for lTf (Phe) atcodon 951 in exon 19, and a mutation from ACC (Thr) to ATC (lie)at codon 1105 in exon 23. The mutation at codon 176 was found onlyin one cell line (NB-16; Fig. 4). The transversions at codon 201 werefound in both alleles in 10 (40%) of 25 cell lines and 19 (59%) of 32primary tumors and in one allele in 9 (36%) cell lines and 1 1 (34%)

tumors. The substitutions at codon 951 were observed in both allelesin one (4%) cell line and 1 1 (34%) tumors, and in one allele in one

(4%) cell line and 9 (28%) tumors. The variation of codon 201 andcodon 95 1 in tumor tissues was the same as in the available corresponding noncancerous tissues. Thus, the nucleotide changes atcodons 201 and 951 likely represented two polymorphisms. Thenoncancerous tissues of the tumor with the mutation at the codon 1105was not available.

We also examined the possible mutations in the coding regions ofthe DPC4 and MADR2/JV18-1 genes in both the 25 cell lines and the32 primary tumors by RT-PCR-SSCP, using the same primers asdescribed previously (1 1, 35); however, we did not find any mutationsin these two genes (data not shown).

DISCUSSION

In the present study, we showed that reduced or absent mRNAexpression of DCC was frequent but that of DPC4 and MADR2/JVJ8-1 was not in neuroblastoma cell lines and primary tumors,suggesting that inactivation of the DCC gene plays an important role

in the pathogenesis of neuroblastoma, whereas DPC4 and MADR2/JVI8-1 genes play only a limited role.

Alterations of the DCC gene are related to metastatic events and the

degree of differentiation of tumor cells in some carcinomas (13—21).We previously failed to show a correlation between LOH of the DCCgene and stage of neuroblastoma, perhaps due to the increased numberof cases found by mass screening in that study (8). In the presentstudy, we found that the reduced expression of DCC mRNA wassignificantly more frequent in tumors in advanced stages than in earlystages, suggesting that the DCC gene is associated with the progression of the neuroblastoma. This finding supports the notion that theloss of DCC protein expression is more likely to be found in patients

with disseminated or stage IV neuroblastoma (20). The lack of arelationship between the reduced expression of DCC mRNA andN-myc amplification established in the present study also supports the

notion that the DCC gene contributes to the dissemination of tumorcells, perhaps through alterations in growth and differentiation pathways distinct from those regulated by the N-myc gene (20).

Most of the neuroblastoma cell lines and all of the primary tumorsshowed a reduction but not a total loss of DCC mRNA expression inthe present study. We could not exclude the possibility of contamination by noncancerous cells in the primary tumors, but this could notfully explain the reduced expression observed in most cell lines. Wespeculated that the DCC gene acts in a similar way to the p53 gene incolorectal carcinomas in that the alteration of one allele may be

sufficient to provide an altered cellular phenotype through a dominant-negative effect, although the wild-type DCC allele is present(55). The remainingallele may express detectablelevels of DCCtranscripts, although the expression is likely reduced. In the present

study, we also found that some neuroblastoma samples showed abundant expression of transcripts, even more abundant than that of the PBcontrols. We considered that this is due to the high expression level of

NB-i 6

3,

/A/A/C

A Asn

AACAACC

Ser GAGA

MT WT

CAGTCA G TFig. 4. SSCP analysis of mutations in exon 3 of theDCC gene in neuroblastoma cell lines. An abnor

mal bandshift was found in NB-l6 cell line (left).Sequence analysis of this bandshift DNA showed amutation of AAC (WI; wild type) to AGC (MT,mutant type) at codon 176 of the DCC gene(right).

5,

DCC Codon 1763776

sscP

44_@_ 285bp

.4— 230bp

1 2 3 4 5 6 7 8 910

I 2 3 4 5 6 7 8 910

DPC4

MADR2/JV1 8-1

on June 22, 2020. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DCC. DPC4. AND MADR2/JVJ8-lGENESIN NEUROBLASTOMA

the DCC gene in neural tissues (23, 24). Further studies are needed totions at initiator or promotor sites of the DCC gene may alsobecharacterizethe expression levels of the DCC gene in normal adrenalresponsible for the DCCinactivation.medullary

cells. The low frequency of the altered expression of DPC4Mutational screening of DPC4 in a variety of cancers hassuggestedandMADR2/JVJ8-l and the finding that most of the samples withthat inactivation of DPC4 may be limited to those of thepancreaticaltered

expression of the two genes also had reduced or absentcancers and possibly other tissues of the gastrointestinal tract(35—38).expressionof the DCC gene suggest that the reduced expression ofMutations of the MADR2/JVI8-I was also found to be rare inlungDPC4

and MADR2/JV18-1 is likely caused by alteration of the DCCcancers (39). In the present study, we investigated the mutations inthegeneor other neighboring genes.coding regions of the DPC4 and MADR2/JVJ8-I genes in neuroblas

Inactivation of a tumor suppressor gene may occasionally be ac toma. Unfortunately, we failed to identify any mutations in thecodingcomplished

through protein-protein interactions, but tumor suppressorregions of these two genes, suggesting their limited roles inthegenes

in most human cancers usually appear to be inactivated by adevelopment of neuroblastoma. Thus, DPC4 and MADR2/JVJ8-Ipoint

mutation of one allele and loss of the remaining allele. Sixgenes seemed not to be mutated in various humancancers.primary

neuroblastomas with and seven without 18q2 1 LOH wereIn conclusion, we showed that the reduced or absent expressionofanalyzed

for DCC mRNA expression in the present study. We foundDCC mRNA was relatively frequent in neuroblastoma, particularlyinthat

three of the six tumors with LOH had reduced DCC. One hadadvanced stage tumors, suggesting that inactivation of the DCCgenereduced

DPC4 expression, and none showed reduced MADR2 expression, suggesting that LOH at 18q2l affected the levels of DCC mRNAand gave less or no effect on the DPC4 and MADR2/JV-18 levels. Theremaining three samples with LOH did not show reduced DCCexpression, possibly due to mixing with noncancerous cells. DCCexpression was also reduced in one of the seven tumors without LOH,suggesting that LOH is not necessary for inactivating the DCC genein this tumor and that other mechanisms such as mutations in theplays

an important role in the development and progression of neuroblastoma. Mutations in the coding regions of the DCC gene wereindeed identified in the neuroblastoma but failed to account for alteredexpression in most tumors; thus, other mechanisms likely contribute

to the inactivation of the DCC gene. The low frequency of the alteredexpression and absence of mutations in DPC4 and MADR2/JVI8-Igenes suggested that these two genes do not play an important role inthe pathogenesis ofneuroblastoma.coding

regions or alterations in an initiator or promoter area oftheDCCgene contribute to the reduced expression. To determinewhethermutation

of the DCC gene is involved in DCC inactivation in neuro

blastoma, we examined 25 of the 29 exons of the DCC gene forpossible mutations. Two missense mutations were observed at codons176 and 1105, respectively. These mutations at codons 176 and I 105have not been found previously (19, 22). The mutation at codon 176We

thank Dr. A. Thomas Look, St. Jude Children's Research Hospital, forgenerously providing some cell lines. We express appreciation to S. Sohma forexcellent technical assistance. Special thanks are also addressed to clinicians atvarious institutes in Japan for generously providing samples and clinicaldata.was

only found in one cell line, and the normal tissue of thetumorwiththe mutation at codon I 105 was not available; furthermore,thesetwomutations were not found in the six neuroblastoma patients with

I8q LOH. Thus, we do not know if these two mutations are function

I Vogelstein. B.. Fearon, E.. Kern, S., Hamilton, S., Preismgcr. A., Nakamura. Y.. andWhite, R. Allelotype of colorectal carcinomas. Science (Washington DC). 244:207-2 I I ,1989.ally

significant. The transversion at codon 201 has been reported to bea polymorphism (19). The mutation at codon 95 1 was also demonstrated to be a polymorphism, because it was found in noncancerous2.

Huang. Y.. Boynton. R. F.. Blount, P. L., Silverstein, R. J., Yin, Y.. Tong. Y.,McDaniel, T. K., Newkirk, C., Resau, J. H., Sndhara, R., Reid, B. J., and Meltzer,

@@ Loss of heterozygosity involves multiple tumor suppressor genes in humanesophageal cancers. Cancer Res., 52: 6525—6530,1992.tissues

from the tumor patients. Finally, a silent mutation that did notchange the amino acid of the gene was found at codon I I 8 in exon 2.Cliby,

W., Ritland, S., Hartmann, L., Dodson, M.. HaIling. K. C.. Keeney. G..Podrats, K. C.. and Jenkins, R. B. Human epithelial ovarian cancer allelotype. CancerRes., 53: 2393-2398,1993.Altered

mRNA expression of DCC was demonstrated in 48% ofneuroblastoma cell lines and 44% of primary tumors. DCC protein4.

Brewster, S. F.. Gingell, J. C.. Browne, S., and Brown, K. W. Loss of heterozygosityon chromosome 18q is associated with muscle-invasive transitional cell carcinoma ofthe bladder. Br. J. Cancer, 70: 697-700,1994.expression

was found to be undetectable in 56% of cell lines and 46%5. Shibagaki, I., Shimada, Y., Wagata, T.. Ikenaga. M., Imamura, M., and lshigaki.K.of

tumors in a recent study (20). The mutations detected in the presentstudy seem not to be sufficient to account for most of the reduction orAllelotype

analysis of esophageal squamous cell carcinoma. Cancer Rca.. 54: 2995—3000, 1994.

6. Shiseki, M., Kohno, T., Nishikawa, R.. Sameshima, Y., Mizoguchi, H.. andYokota.lossof expression in the neuroblastoma. Therefore, although muta

tions in the remaining four exons and the 5',3' untranslated sequencesremain to be investigated, the limited mutations in the coding regionsJ.

Frequent allelic losses on chromosomes 2q. I8q, and 22q in advanced non-smallcell lung careinoma. Cancer Res., 54: 5643—5648, 1994.

@ Hahn. S. A.. Seumour, A. B., Hoque, A. 1. M. S., Schutte, M., da Costa, L. T..Redston, M. S., Caldas, C., Weinstein, C. L., Fischer, A., Yeo, C. J., Hruban, R.H.,of

the DCC gene in the present study imply that other mechanismsmay contribute to the inactivation of the DCC gene.and

Kern, S. E. Allelotype of pancreatic adenocarcinoma using xenograft enrichment.Cancer Res.. 55: 4670—4675,1995.

8. Takita, J., Hayashi. Y.. Kohno. T., Shiseki. M., Yamaguchi. N.. Hanada,R.,Aberrant

DNA methylation is considered to be an important mechanism by which tumor suppressor genes are inactivated in humancancers (56). Hypermethylation of the 5' CpG island in the p16/MTSIYamamoto,

K., and Yokota, J. Allelotype of neuroblustomu. Oncogene. 11: 1829--1834, 1995.Fearon, E. R., Cho, K. R., Nigro, J. M., Kern, S. E.. Simons. J. W.. Ruppert. J. M.Hamilton, S. R., Preisinger, A. C.. Thomus, G., Kinzler, K. W., and Vogelatein,B.tumor

suppressor gene was found to be associated with the loss oftranscripts in neuroblastomas in our most recent study (57). AlthoughIdentification

of a chromosome l8t@gene that is altered in colorectal cancers. Science(Washington DC), 247: 49—56.1990.

10. Hahn, S. A., Schutte, M., Hoque, A. T. M. S., Moskaluk, C. A., da Costa, L.T.,no

apparent differences in the methylation sequences of flanking DCCexon I were found between brain tumors with and without expression(58), the 5' regionof the enormousDCC gene is largelyuncharac

Rozenhium. E.. Weinstein, C. L., Fischer, A., Yeo, C. J., Hruban, R. H., and Kern,S. E. DPC4. a candidate tumor suppressor gene at human chromosome I8q2I. I.Science (Washington DC), 271: 350-353, 1996.

I I. Eppert. K.. Schcrer, S. W., Ozcelik. H.. Pirone, R.. Hoodless, P., Kim, H., Tsui,L-C.,terized,

and more detailed studies should be performed to determine

whether this mode is a pathway of DCC inactivation. Aberrant splic

Bapat, B., Gallinger, S., Andrulis, I. L., Thomsen, G. H., Wrana, J. L., and Attisano.L. MADR2 maps to 18q2l and encodes a TGF@-regulatedMAD-related protein that

@ functionally mutated in colorectal carcinoma. Cell. 86: 543—552,1996.ingof DCC transcripts and allele-specific loss of transcripts are 12. Riggins.0. J.. Thiagalingam,S. R., Rozenblum,E., Weinstein,C. L., Kern,S. E.,

Hamilton, S. R.. Wilson, J. K. V., Markowitz, S. D., Kinzler, K. W.. and Vogelatein.considered to be important alternative mechanisms for loss of DCC B. Mad-relatedgenesin the human.Nat.Genet..13:347—349.1996.expression (58). Other mechanisms like intronic deletions and muta- 13. Kikuchi-Yanoshita,R.,Konishi,M.,Fukunari,H.,Tanaka,K.,andMiyaki.M.Loss

3777

ACKNOWLEDGMENTS

REFERENCES

9.

on June 22, 2020. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DCC. DPC4. AND MADR2/JVI8-1GENESIN NEUROBLASTOMA

of expression of the DCC gene during progression of colorectal carcinomas in familialadenomatous polyposis and non-familial adenomatous polyposis patients. CancerRes.,52:3801—3803,1992.

14. Itoh, F., Hinoda. Y., Ohe, M., Ban, T., Endo, T., Imai, K., and YachL A. Decreasedexpression of DCC mRNA in human colorectal cancers. tnt. J. Cancer, 53: 260—263,1993.

IS. Ookawa, K., Sakamoto, M., Hirohashi, S., Yoshida, Y., Sugimura, T., Terada, M., andYokota, J. Concordant p53 and DCC alterations and allelic losses on chromosomes13q and l4q associated with liver metastases of colorectal carcinoma. mt. i. Cancer,53: 382—387,1993.

16. Shibata, D., Reale, M. A., Lavin, P., Silverman, M., Fearon, E. R., Steele, 0., JessupJ. M.. Load, M., and Summerhayes, I. C. The DCC protein and prognosis in colorectalcancer. N. EngI. J. Med., 335: 1727—1732,1996.

17. Cho, K. R., and Fearon, E. R. DCC. Linking tumor suppressor genes and altered cellsurface interactions in cancer? Eur. J. Cancer, 3/A: 1055—1060,1995.

18. Enomoto, T. Fujita, M., Cheng, C., Nakashima. R., Ozaki, M., Inoue, M., andNomura, T. Loss of expression and loss of heterozygosity in the DCC gene inneoplasms ofthe human female reproductive tradt. Br. J. Cancer, 71: 462—467, 1995.

19. Miyake, S., Nagai. K., Yoshino, K., Oto, M., Endo, M., and Yuasa, Y. Pointmutations and allelic deletion of tumor suppressor gene DCC in human esophagealsquamous cell carcinomas and their relation to metastasis. Cancer Res., 54: 3007—3010, 1994.

20. Reale. M. A., Reyes-Mugica, M., Pierceall, W. E., Rubinstein, M. C., Hedrick, L.,Cohn, S. L., Nakagawara, A., Brodeur, G. M., and Fearon, E. R. Loss of DCCexpression in neuroblastomas is associated with disease dissemination. Clin. CancerRes., 2: 1097—1102, 1996.

21. Reyes-Mugica, M., Rieger-Christ, K., Ohgaki. H., Ekstrand, B. C., Helie, M., Kleinman, G., Yahanda, A., Fearon, E. R., Kleihues, P., and Reale, M. A. Loss of DCCexpression and glioma progression. Cancer Res., 57: 382—386,1997.

22. Cho, K. R., Oliner, J. D., Simons J. W., Hedrick, L., Fearon, E. R., Preisinger, A. C.,Hedge, P., Silverman, G. A., and Vogelstein, B. The DCC gene: structure analysis andmutations in colorectal carcinomas. Genomics, 19: 525—531,1994.

23. Hedrick, L., Cho, K. R., Fearon, E. R., Wu, T-C., Kinzler, K. W., and Vogelstein, B.The DCC gene product in cellular differentiation and colorectal tumorigenesis. GenesDcv..8: 1174—1183,1994.

24. Reale, M. A., Hu, G., Zafar, A. I., Getzenberg, R. H., Levine S. M., and Fearon, E. R.Expression and alternative splicing of the deleted in colorectal cancer (DCC) gene innormal and malignant tissues. Cancer Res., 54: 4493—4501, 1994.

25. Kolodziej, P. A., Timpe. L. C.. Mitchell, K. J., Fried, S. R., Goodman, C. S., Jan.L. Y., and Jan. Y. N. frazzled encodes a Drosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance. Cell. 87:197—204,1996.

26. Chan, S. S-Y., Zheng, H., Su, M-W., Wilk, R., Killeen, M. T., Hedgecock, E. M., andCulotti, J. G. UNC-40, a C. elegans homolog of DCC (deleted in colorectal cancer),is required in motile cells responding to UNC-6 netrin cues. Cell, 87: 187—195,1996.

27. Vielmetter, J., Kayyem, J. F., Roman, J. M., and Dreyer, W. J. Neogenin, an avian cellsurface protein expressed during terminal neuronal differentiation, is closely relatedto the human tumor suppressor molecule deleted in colorectal cancer. J. Cell Biol.,127: 2009—2020, 1994.

28. Lawlor, K. G., and Narayanan, R. Persistent expression of the tumor suppressor geneDCC is essential for neuronal differentiation. Cell Growth & Differ.. 3: 609—616,1992.

29. Pierceall, W. E., Cho, K. R., Getzenberg. R. H., Reale, M. A., Hedrick, L., Vogelstein,B., and Fearon, E. R. NIH3T3 cells expressing the deleted in colorectal cancer tumorsuppressor gene product stimulate neurite outgrowth in rat PCI 2 pheochromocytomacells. J. Cell Biol., 124: 1017—1027,1994.

30. Masu-Keino, K., Masu, M., Hinck, L., Leonardo, E. D., Chan, S. S-Y., Culotti, J. G.,and Tessier-Lavigne, M. Deleted in colorectal cancer (DCC) encodes a netrmnreceptor. Cell, 87: 175—185,1996.

31. Tanaka, K., Oshimura, M., Kikuchi, R., Seki, M., Hayashi, T., and Miyaki, M.Suppression of tumorigenicity in human colon carcinoma cells by introduction ofnormal chromosome 5 or 18. Nature (Land.), 349: 340—342, 1991.

32. Narayanan, R., Lawlor, K. G., Schaapvel, R. Q., Cho, K. R., Vogelstein, B.. Tran, P.B-V., Osbome, M. P., and Telang, N. T. Antisense RNA to the putative tumorsuppressor gene DCC transforms Rat-I fibroblasts. Oncogene, 7: 533—561,1992.

33. Klingelhutz, A. J., Hedrick, L., Cho, K. R., and McDougall, J. K. The DCC genesuppresses the malignant phenotype of transformed human epithelial cells. Oncogene,/0:1581—1586,1995.

34. Massagué.J. TGFI3 signaling: receptors, transducers and Mad proteins. Cell, 85:947—950,1996.

35. Nagatake. M., Takagi. Y., Osada, H., Uchida, K., Mitsudomi, T., Saji, S., Shimokata,K.. Takahashi, T., and Takahashi, T. Somatic in vivo alterations of the DPC4 gene at18q21 in human lung cancers. Cancer Res., 56: 2718—2720, 1996.

36. Barrett, M. T., Schuue, M., Kern, S. E., and Reid, B. J. Allelic loss and mutationalanalysis of the DPC4 gene in esophageal adenocarcinoma. Cancer Res., 56: 435 1—4353, 1996.

37. Schutte, M., Hruban, R. H., Hedrick, L., Cho, K. R., Nadasdy, G. M., Weinstein,C. L., Bova, G. S., Isaacs, W. B., Cairns, P., Nawroz, H., Sidransky, D., Casero, R. A.,Meltzer, P. S., Hahn, S. A., and Kern, S. E. DPC4 gene in various tumor types. CancerRes., 56: 2527—2530,1996.

38. Kim, S. K., Fan, Y., Papadimitrakopoulou, V., Clayman, G., Hittelman, W. N., Hong,W. K., Lotan, R., and Mao, L. DPC4, a candidate tumor suppressor gene, is alteredinfrequently in head and neck squamous cell carcinoma. Cancer Rca., 56: 25 19—2521,1996.

39. Uchida, K., Nagatake, M., Osada, H., Yatabe, Y., Kondo, M., Mitsudomi, T., Masuda,A., Takahashi, T., and Takahashi, T. Somatic in vivo alterations of the JV18-1 geneat l8q2l in human lung cancers. Cancer Res., 56: 2718—2720, 1996.

40. Bessho, F. Effects of mass screening on age-specific incidence of neuroblastoma. Int.J. Cancer, 67: 520—522,1996.

41. Hayashi, Y., Kanda, N., Inaba, T., Hanada, R., Nagahara, N., Muchi, H., andYamamoto, K. Cytogenetic findings and prognosis in neuroblastoma with emphasison marker chromosome 1. Cancer (Phila.), 63: 126—132,1989.

42. Fong, C. T., Dracopoli, N. C., White, P. 5., Merrill, P. T., Griffith, R. C., Housman,D. E., and Brodeur, G. M. Loss of heterozygosity for the short arm of chromosome1 in human neuroblastomas: correlation with N-myc amplification. Proc. NatI. Acad.Sci. USA, 86: 3753—3757, 1989.

43. Srivatsan, E. S., Ying, K. L., and Seeger, R. C. Deletion of chromosome 11 and 14qsequences in neuroblastoma. Genes Chromosomes Cancer, 7: 32—37,1993.

44. Suzuki, T., Yokota, J., Mugishima, H., Okabe, I., Ookuni, M., Sugimura, T., andTerada, M. Frequent loss of heterozygosity on chromosome 14q in neuroblastoma.Cancer Res., 49: 1095—1098,1989.

45. Brodeur, G. M., Seeger, R. C., Schwab, M., Varmus, H. E., and Bishop, J. M.Amplification of N-myc in untreated human neuroblastomas correlates with advanceddisease stage. Science (Washington DC), 224: 1121—1124, 1984.

46. Seeger, R. C., Brodeur, G. M., Sather, H., Dalton, A., Siegel, S. E., Wong, K. Y., andHammond, D. Association of multiple copies of the N-myc oncogene with rapidprogression of neuroblastomas. N. Engl. J. Med., 313: 1111—1116, 1985.

47. Hayashi, Y., Hanada, R., Moriwaki, K., Yamamoto, K., Imaizumi, S., Hirata, A., andNishida, T. Establishment and characterization of cell lines derived from malignanttumors in children. J. Saitama Child. Med. Ctr., 8: 17—23,1991 (in Japanese).

48. Komuro, H., Hayashi, Y., Kawamura, M., Hayashi, K., Kaneko, Y., Kamoshita, S.,Hanada, R., Yamamoto, K., Hongo, T., Yamada, M., and Tsuchida, Y. Mutations ofthe p53 gene are involved in Ewing's sarcomas but not in neuroblastomas. CancerRes., 53: 5284—5288, 1993.

49. Evans, A. E., D'Angio, 0. J., and Randolph, J. A proposed staging for children withneuroblastoma. Children's cancer study group A. Cancer (Phila.), 27: 374—378,1971.

50. Hayashi, Y., Hanada, R., and Yamamoto, K. Biology of neuroblastoma in Japanfound by screening. Am. J. Pediatr. Hematol. Oncol., 14: 342—347,1992.

51. Sawaguchi, S., Kaneko, M., Uchino, J., Takeda, T., Iwafuchi, M., Matsuyama, S.,Takahashi, H., Nakajo, T., Hoshi, Y., Okabe, 1.,Yokoyama, J., Nishihira, H., Sakaki,S., Sakurai, M., Sawada, T., Nagahara, N., and Tsuchida, Y. Treatment of advancedneuroblastoma with emphasis on intensive induction chemotherapy: a report from theStudy Group of Japan. Cancer (Phila.), 66: 1879—1887, 1990.

52. Chomczynski, P., and Sacchi, N. Single step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156—159, 1987.

53. Ida, K., Kobayashi, S., Taki, T., Hanada, R., Bessho, F., Yamamori, S., Sugimoto, T.,Ohki,M.,andHayashi,Y.EWS-FU-1andEWS-ERGchimericin RNAsin Ewing'ssarcoma and primitive neuroectodermal tumor. Int. J. Cancer, 63: 500—504, 1995.

54. Ponte, P., Ng, S. Y., Engel, J., Gunning. P., and Kedes, L. Evolutionary conservationin the untranslated regions of actin mRNAs: DNA sequence of a human fJ-actineDNA. Nucleic Acids Res., 12: 1687—1696,1984.

55. Fearon, E. R., and Vogelstein, B. A genetic model for colorectal tumorigenesis. Cell,61: 759—767,1990.

56. Merlo, A., Herman, J. G., Mao, L., Lee, D. J., Gabrielson, E., Burger, P. C., Baylin,S. B., and Sidransky. D. 5' CpG island methylation is associated with transcriptionalsilencing of the tumor suppressorp/6/CDKN2/MTSI in human cancers. Nat. Med., 1:686—692, 1995.

57. Takita, J., Hayashi, Y., Kohno, T., Yamaguchi, N., Hanada, R., Yamamoto, K., andYokota, J. Deletion map of chromosome 9 and p16 (CDKN2A) gene alterations inneuroblastoma. Cancer Res., 57: 907—912,1997.

58. Ekstrand, B. C., Mansfield, T. A., Bigner, S. H., and Fearon, E. R. DCCexpression is altered by multiple mechanisms in brain tumors. Oncogene, II:2393—2402, 1995.

3778

on June 22, 2020. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1997;57:3772-3778. Cancer Res   Xiao-Tang Kong, Seung Hoon Choi, Akira Inoue, et al.  

Genes in NeuroblastomaMADR2/JV18-1, and DCC, DPC4Expression and Mutational Analysis of the

  Updated version

  http://cancerres.aacrjournals.org/content/57/17/3772

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/57/17/3772To request permission to re-use all or part of this article, use this link

on June 22, 2020. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from