7J Clin Pathol 1996;49:72-76

Expression of Epstein-Barr virus encoded latentgenes in nasal T cell lymphomas

J van Gorp, A Brink, J J Oudejans, A J C van den Brule, J G van den Tweel,N M Jiwa, P C de Bruin, C J L M Meijer

AbstractAims-To determine the expression ofEpstein-Barr (EB) virus encoded latentgenes in nasal T-cell lymphomas in TheNetherlands.Methods-Seven europid (Dutch) cases ofnasal T cell lymphoma were investigatedfor the presence of EB virus by RNA insitu hybridisation (EBER). The expressionof the EB virus encoded genes BARFO,EBNAI, EBNA2, LMP1, LMP2A, LMP2B,and ZEBRA was studied at themRNA levelusing reverse transcriptase polymerasechain reaction. At the protein level theexpression was investigated ofEBNA2 andLMP1 by immunohistochemistry.Results-In all seven nasal T cell lymph-omas EBER was detected in the nuclei ofvirtually all tumour cells. BARFO mRNAwas detected in all samples. EBNAI mRNAwas found in six cases, LMP1 mRNA infive, LMP2A mRNA in three, LMP2BmRNA in one, and ZEBRA mRNA in one.EBNA2 mRNA was not found in any case.At the protein level occasional LMP1 pos-itive tumour cells were seen in only onecase. The EBNA2 protein was not detected.Conclusions-Nasal T cell lymphomas inThe Netherlands are strongly associatedwith EB virus. The virus shows a type IIlatency pattern (EBNAI +, LMP1 +,EBNA2 -) that seems to be similar to theEB virus associated nasal T cell lymph-omas in oriental countries.(J7 Clin Pathol 1996;49:72-76)

Keywords: T cell lymphoma, EB virus encoded genes.

Department ofPathology, UniversityHospital Utrecht,Utrecht,The NetherlandsJ van GorpJ G van den Tweel

Department ofPathology, FreeUniversity Hospital,Amsterdam,The NetherlandsA BrinkJ J OudejansA J C van den BruleN M JiwaP C de BruinC J L M Meijer

Correspondence to:Dr J van Gorp, Departmentof Pathology (H04.312),University Hospital Utrecht,PO Box 85500, 3508 GAUtrecht, The Netherlands.

Accepted for publication5 September 1995

Recent reports have shown a strong associationbetween nasal T cell lymphomas and Epstein-Barr (EB) virus in both oriental and occidentalcountries, suggesting that the virus plays a rolein the aetiology of this neoplasm.'`8 EB virusis known to be associated with several differentmalignancies. The pathogenic role of this virusin these neoplasms, if any, is not fully un-

derstood, but it is probably different in thevarious tumours, since the expression of EBvirus encoded latent gene products is not ident-ical.Three different patterns of EB virus latent

gene expression are known to be associated withthe various EB virus associated malignancies.Type I latency, that is, expression ofEBER 1/2,EBNA1, and BARFO, is found in AfricanBurkitt's lymphoma.910 In Hodgkin's diseaseand nasopharyngeal carcinoma, latency pattern

type II is found, with expression of EBER 1/2,EBNA1, LMP1, BARFO, and often LMP2Aor 2B." 16 Latency type III (EBER1/2,EBNA1, -2, -3A, -3B, -3C, -LP, LMP1, -2A,-2B, and BARFO) is present in largeB cell lymphomas in immunocompromisedindividuals. 718There are two different promoter sites for

the transcription ofEBNA1, the C/W promoterand the F promoter. The F promoter is activein Burkitt's lymphomas and in nasopharyngealcarcinomas (latency type I and II) and resultsin the QIU/K splice variant ofEBNA1 mRNA,while the C/W promoter is active in type IIIlatency, resulting in the Y3/U/K splicevariant.'9 20

Studies on the expression of EB virus en-coded gene products in nasal T cell lymphomashave provided conflicting results, both at theprotein level and at the mRNA level. Not allstudies agree on the expression of the EB virusencoded protein latent membrane protein 1(LMP1) and EB virus nuclear antigen 2(EBNA2) in these lymphomas. Expression ofthese proteins may be important, since theyare known for their transforming capacities in

21 22vitro.

This prompted us to investigate the ex-pression of EB virus latent genes in cases ofnasal T cell lymphoma from The Netherlands.We also investigated the transcription ofBZLF1 transactivation protein (ZEBRA).ZEBRA mediates a switch between the latentand lytic state ofEB virus infection by binding,as a dimer, to the promoters of genes involvedin lytic DNA replication and activating their

23 24transcription.

MethodsFormalin fixed, paraffin wax embedded ma-terial and snap frozen tissue stored at -80°Cof seven cases of nasal T cell lymphoma wereretrieved from the files of the pathology de-partments ofthe University Hospital ofUtrechtand the Free University Hospital of Am-sterdam. Clinicopathological and immuno-phenotypic findings of these cases have beenpublished recently.8

IN SITU HYBRIDISATIONThe presence ofEB virus was studied in paraffinembedded tissue sections using a very sensitiveRNA in situ hybridisation against EBER 1and 2, two EB virus encoded RNAs that areexpressed in high quantity in latently infectedcells. In three cases a fluorescein conjugated

72

Latent EB virus genes in nasal T cell lymphoma

Table 1 Sequences ofPCR primers and oligoprobes

Transcript Oligo' Sequence (5'-3') Amplimer length

BARFO A3 (s) AGAGACCAGGCTGCTAAACA 240 bpA4 (as) AACCAGCTTTGCCTTTCCGAGProbe AAGACGTTGGAGGCACGCTG

EBNA1 Y3 (s) TGGCGTGTGACGTGGTGTAA Y3/U/K spliced: 265 bpQ (s) GTGCGCTACCGGATGGCG Q/U/K spliced: 236 bpK (as) CATTT-'CCAGGTCCTGTACCTU (probe) AGAGAGTAGTCTCAGGGCAT

EBNA2 Y2 (s) TACGCATTAGAGACCACTTTGAGCC 195 bpHI (as) AAGCGCGGGTGCTTAGAAGGY3 (probe)2 TGGCGTGTGACGTGGTGAA

LMP1 1 (s) TGTACATCGTTATGAGTGAC 240 bp2 (as) ATACCTAAGA/CAAGTAAGCA3 (probe) ACAATGCCTGTCCGTGCAAA

LMP2A Al (s) ATGACTCATCTCAACACATA 280 bpAB2 (as) CATGTTAGGCAAATTGCAAAProbe ATCCAGTATGCCTGCCTGTA

LMP2B BI (s) CAGTGTAATCTGCACAAAGA 324 bpAB2 (as)3 CATGTTAGGCAAATTGCAAAProbe ATCCAGTATGCCTGCCTGTA

ZEBRA Zi (s) CGCACACGGAAACCACAACAGC 227 bpZ2 (as) CGGCGGATAATGGAGTCAACATCCProbe GCTTGGGCACATCTGCTTCAACAGG

'The sense (s) or antisense (as) orientation is indicated in brackets.2EBNA2 specific transcripts were detected with the Y3 probe, which was also used as primer for detection of EBNA1 transcripts.'The antisense primer and probe of LMP2B are similar to those of LMP2A.

mixture of oligoprobes was used against EBER1 and 2 (Dako, Glostrup, Denmark), and infour cases a mixture of EBER specific bio-tinylated EBER 1 and 2 RNA antisense orsense (control) (kindly provided by Dr L SYoung, Birmingham, United Kingdom). Thein situ hybridisation protocols have been de-scribed recently.2526 An EB virus positive Hodg-kin's disease specimen served as a positivecontrol.

REVERSE TRANSCRIPTASE POLYMERASE CHAINREACTIONThe reverse transcriptase polymerase chain re-action (RT-PCR) protocol has been publishedrecently.27 In short, ten 10 jm sections werecut from snap frozen tissue samples and ho-mogenised in an RNAzol B buffer. RT-PCRwas performed using intron flanking primers.The primers sequences and oligoprobes usedfor analysis have been published previously andare listed in table 1.11132728 For the RT-PCRan amount of RNA was used equivalent toRNA extracted from one 5 jtm section. RTreaction was performed in a final volume of20pl containing 25pmol of one to four ofeach EB virus antisense primer specific for thedifferent genes. To exclude false positive signalsresulting from DNA amplification, sim-ultaneous reactions were performed with omis-sion of the reverse transcriptase. Afterdenaturation of the DNA, 40 cycles of am-plification were performed. The amplificationproducts were analysed by electrophoresis onagarose gel and hybridised overnight with aspecific 32P end labelled internal oligoprobe.The EB virus transformed lymphoblastoidKCA cell line and the EB virus negative B cellline BJAB were used as positive and negativecontrols.

IMMUNOHISTOCHEMISTRYImmunohistochemistry was performed on6 pm sections of the snap frozen material. The

primary antibodies used were raised againstEBNA2 (PE2, Dako) and LMP1 (CS1-4,Dako). Either an avidin-biotin HRP complexmethod or an indirect alkaline phosphatasetechnique was used. A lymph node from apatient with infectious mononucleosis servedas a control.

ResultsThe nuclei of virtually all the tumour cells inall seven cases stained positive after the EBERin situ hybridisation. Epithelial cells, endo-thelium, and reactive non-malignant infiltratewere negative (fig 1).The sensitivity of the RT-PCR protocol for

EBNA1, EBNA2, and LMP1 was estimatedby using a dilution series of the EB virus trans-formed lymphoblastoid KCA cell line in EBvirus negative BJAB B lymphocytes (A Brinket al, manuscript submitted). Detection of upto 5 KCA cells was possible in a background

Figure 1 Positive signal in the nuclei of the atypical cellsafter EBER in situ hybridisation. Note that the nuclei ofthe epithelial cells and the reactive infiltrate of smallmononuclear cells are negative.

73

van Gorp, Brink, Oudejans, van den Brule, van den Tweel, Jiwa, et al

Figure 2 Blot of LMPI RT-PCR products of a dilutionseries of KCA cells (EB virus positive) in BJ7AB cells (EBvirus negative).

of 5 x 105 BJAB cells after hybridisation and12 hours ofautoradiography (fig 2). The resultsof RT-PCR are shown in table 2. Although thefunction of the BARFO transcript is not known,it seems to be transcribed in high quantities inall cells latently infected with EB virus."'BARFO was detected in all specimens, therebyconfirming the in situ hybridisation resultswhich also showed that EB virus was presentin all specimens and that mRNA was availablefor RT-PCR (fig 3). In all samples but one

EBNA1 mRNA was found. The signal was

weak in two samples (fig 3). In these six cases

the Q/U/K splice variant was present. The Y3/U/K splice variant was not found in any case.In none of the seven cases was EBNA2 de-tected, but in five cases LMP1 mRNA was

present (fig 3). LMP2A was found in threecases and LMP2B in one. A faint positive signalof ZEBRA mRNA could be detected in one

lymphoma.As with the RT-PCR results, EBNA2 could

not be detected at the protein level in any case.

In only one of the five LMP1 mRNA positivecases (case 1) was this protein detected on

occasional tumour cells. In the LMP1 mRNAnegative cases the LMP1 protein was not de-tected.

DiscussionAlthough several recent publications describea strong association between nasal T celllymphomas and EB virus, little is known aboutthe pathogenic role of the virus in this lymph-oma, and there are conflicting reports on theexpression of the EB virus encoded latentgenes. Expression of these genes may beimportant. EBNA2 and LMP1 in particularare known for their transforming capacities invitro and are thought to play an oncogenic

Figure 3 Blots ofRT-PCR products LMPI, EBNA1,and BARFO from the seven nasal T cell lymphomasamples. In cases 1 and 2 only a very faint EBNA 1

signal was found.

role in the development of the variousmalignancies.2 22 The LMP2 proteins probablyplay a role in transmembrane signal induction.29

In one article about a small series of nasal Tcell lymphomas expression of both LMP1 andEBNA2 is reported at the protein level in allinvestigated cases,' whereas in another studyonly the presence ofLMP1 could be detected,without expression of EBNA2.4 Others did notdetect any LMP1 expression,3 or found pos-itivity only in a minority of cases.5

Similarly, at the mRNA level (using RT-PCR) conflicting reports have been published.Minarovits et al found RNA coding for EBNA1and LMP1 but not EBNA2 in all six nasal Tcell lymphomas tested.30 In contrast Suzushimaet al only detected EBNA1 and not EBNA2 or

LMP1I. Interestingly, both studies comprisedonly Japanese cases. To the best of our know-ledge there are no reports on EB virus geneexpression in nasal T cell lymphomas at themRNA level in europid cases.

Table 2 EBVgene transcription as determined by RT-PCR in diffuse EBERI12 positive nasal Tcell lymphomas

Case No. EBNAI EBNA2 LMPI LMP2A LMP2B ZEBRA BARFO

1 Q/U/K + + +2 Q/U/K + + +3 +4 QIU/K - + - +5 Q/U/K - + +6 Q/U/K - + + +7 Q/U/K - + +

' In this case the expression of LMP1 was confirmed by immunohistochemical detection of LMP1.

74

AM6ANk4m

Latent EB virus genes in nasal T cell lymphoma

The present study supports a type II latencypattern in nasal T cell lymphomas in TheNetherlands. Only the F promoter was usedfor the transcription of EBNA1 (Q/U/K splicevariant); in most cases LMP1 mRNA was de-tected, while EBNA2 was constantly negative.EBNA1 mRNA was detected in almost alllymphomas. However, in one of our casesEBNA1 mRNA could not be detected. Themost plausible explanation for this is that therelatively low expression level of EBNA1mRNA was below the detection level ofour RT-PCR technique in this case, possibly becauseof some degradation of mRNA in the tissuesample.The pattern of EB virus gene expression in

nasal T cell lymphomas in The Netherlands isprobably similar to Japanese cases. In two ofour seven cases, LMP1 mRNA could not bedetected, and this might explain the results ofSuzushima's small series,3' in which all threecases were negative for LMP 1 mRNA. In mostof our cases the pattern was similar to the casesdescribed by Minarovits.30An EB virus latency type II expression is

also found in Hodgkin disease and in un-differentiated nasopharyngeal carcinoma.However, there are some differences betweenHodgkin's disease and nasal T cell lymphomas.In EB virus associated Hodgkin's disease,LMP1 mRNA can be detected in all EB viruspositive samples, and more importantly, allmalignant cells (Reed-Sternberg cells and vari-ants) show strong expression of LMP1 at theprotein level." 12 In our study of nasal T celllymphomas, on the other hand, LMP1 mRNAcould not be detected in all cases. We cannotexclude the possibility that the LMP1 mRNAwas degradated in some cases and thereforecould not be detected. Still, in only one of thefive LMP1 mRNA positive cases were oc-casional LMP1 positive tumour cells detectedat the protein level. Recently, we have reportedsimilar results on LMP1 expression at the pro-tein level in a series of Chinese cases of nasalT cell lymphoma.5 The expression of EB virusencoded gene products in nasal T cell lymph-omas shows more similarities to EB virus as-sociated nasopharyngeal carcinoma, in whichLMP1 mRNA expression is not found in allcases.'3 Moreover, only in part of the LMP1mRNA positive cases can the protein can bedetected in occasional tumour cells byimmunohistochemistry.'3-16 Whether in theother LMP1 mRNA positive cases there is notranslation to the protein level or whether theexpression is below the level of detection hasnot been elucidated so far.

In Hodgkin's disease occasional Reed-Stern-berg cells have been shown to express ZEBRAat the protein level, and similar findingshave been described for nasopharyngealcarcinomas.3233 The ZEBRA mRNA detectedin case 6 suggests that occasionally the ZEBRAprotein may be expressed in nasal T cell lymph-omas as well. One can speculate that in oc-casional tumour cells a switch is made fromlatent to lytic cycle, and that occasionally viralparticles will be produced. However, expressionof the ZEBRA protein does not automatically

mean that a complete lytic cycle is takingplace.34 In the ZEBRA positive cases of Hodg-kin's disease no expression of other lytic pro-teins was found (that is, EB virus early antigen,EA; viral capsid antigen, VCA; and membraneantigen, MA), suggesting an abortive viral lyticcycle.32 Although the expression of other lyticEB virus proteins in nasopharyngeal car-cinomas is still under investigation, preliminaryresults also suggest an abortive lytic cycle.33Therefore it may well be that the presence ofZEBRA mRNA in one of the cases of nasal Tcell lymphomas in our series is an expressionof an abortive lytic cycle, and it does not ne-cessarily mean that viral particles are be pro-duced.

In conclusion, nasal T cell lymphomas arestrongly associated with EB virus. The virusshows a type II latency pattern, which seemsto be similar to the EB virus gene expressionin undifferentiated nasopharyngeal car-cinomas. The EB virus gene expression patternin nasal T cell lymphomas from The Neth-erlands does not differ from oriental cases.

1 Harabuchi Y, Yamanaka N, Kataura A, Imai S, KinoshitaT, Mizuno F, et al. Epstein-Barr virus in nasal T-celllymphomas in patients with lethal midline granuloma.Lancet 1990;335:128-30.

2 Ho FSC, Srivastava G, Loke SL, Fu KH, Leung BPY,Liang R, et al. Presence of Epstein-Barr virus DNA innasal lymphomas of B and 'T' cell type. Haematol Oncol1990;8:271-81.

3 Arber DA, Weiss LM, Albujar PF, Chen YY, Jaffe ES. Nasallymphomas in Peru. High incidence of T-cell im-munophenotype and Epstein-Barr virus infection. AnmSurg Pathol 1993;17:392-9.

4 Kanavaros P, Lescs MC, Briere J, Divine M, Galateau F,Joab I, et al. Nasal T-cell lymphoma: a clinicopathologicentity associated with peculiar phenotype and withEpstein-Barr virus. Blood 1993;81:2688-95.

5 Van Gorp J, Liu W, Jacobse K, Liu YH, Li FY, De WegerRA, et al. Epstein-Barr virus in nasal T-cell lymphomas(polymorphic reticulosis/midline malignant reticulosis) inWestern China. J Pathol 1994;173:81 -7.

6 De Bruin PC, Jiwa M, Oudejans JJ, Van der Valk P, VanHeerde P, Sabourin JC, et al. Presence of Epstein-Barrvirus in extranodal T-cell lymphomas: differences in re-lation to site. Blood 1994;83:1612-8.

7 Chan JKC, Yip TTC, Tsang WYW, Ng CS, Lau WH, PoonYF, et al. Detection ofEpstein-Barr viral RNA in malignantlymphomas of the upper aerodigestive tract. Anm 7 SurgPathol 1994;18:938-46.

8 Van Gorp J, De Bruin PC, Sie-Go DMDS, Van Heerde P,Ossenkoppele GJ, Rademakers LHPM, et al. Nasal T-celllymphoma: a clinicopathological and immunophenotypicanalysis of 13 cases. Histopathology 1995;27;139-48.

9 Rowe M, Rowe DT, Gregory CD, Young LS, Farrell PJ,Rupani H, et al. Differences in B cell growth phenotypereflect novel patterns of Epstein-Barr virus latent geneexpression in Burkitt's lymphoma cells. EMBO_J 1987;6:2743-51.

10 Brooks LA, Lear AL, Young LS, Rickinson AB. Transcriptsfrom the Epstein-Barr virus BamHI A fragment are de-tectable in all three forms of virus latency. J Virol 1993;67:3182-90.

11 Deacon EM, Pallesen G, Niedobitek G, Crocker J, BrooksL, Rickinson AB, et al. Epstein-Barr virus and Hodgkin'sdisease: transcriptional analysis of virus latency in themalignant cells. J Exp Med 1993;177:339-49.

12 Pallesen G, Hamilton-Dutoit SJ, Rowe M, Young LS. Ex-pression of Epstein-Barr virus encoded latent gene prod-ucts in tumour cells of Hodgkin's disease. Lancet 1991;337:320-2.

13 Brooks L, Yao QY, Rickinson AB, Young LS. Epstein-Barr virus latent gene transcription in nasopharyngealcarcinoma cells: coexpression of EBNA1, LMP1, andLMP2 transcripts. J Virol 1992;66:2689-97.

14 Young LS, Dawson CW, Clark D, Rupani H, Busson P,Tursz T, et al. Epstein-Barr virus gene expression innasopharyngeal carcinoma. J7 Gen Virol 1988;69: 1051-65.

15 Fahraeus R, Fu HL, Ernberg I, Finke J, Rowe M, Klein G,et al. Expression of Epstein-Barr virus-encoded proteins innasopharyngeal carcinoma. Int3 Cancer 1988;42:329-38.

16 Niedobitek G, Young LS, Sam CK, Brooks L, Prasad U,Rickinson AB. Expression of Epstein-Barr virus genes andof lymphocyte activation molecules in undifferentiatednasopharyngeal carcinomas. Am J Pathol 1992;140:879-87.

17 Gratama JW, Zutter MM, Minarovits J, Oosterveer AP,Thomas ED, Klein G, et al. Expression of Epstein-Barrvirus-encoded growth-transformation-associated proteins

75

van Gorp, Brink, Oudejans, van den Brule, van den Tweel, Jiwa, et al

in lymphoproliferations of bone-marrow transplant re-cipients. Int T Cancer 199 1;47:188-92.

18 Young LS, Alfieri C, Hennessy K, Evans H, O'Hara C,Anderson KC, et al. Expression of Epstein-Barr virustransformation-associated genes in tissues of patients withEB virus lymphoproliferative disease. N Engl3 Med 1989;321:1080-5.

19 Sample J, Brooks L, Sample C, Young L, Rowe M, GregoryC, et al. Restricted Epstein-Barr virus protein expressionin Burkitt lymphoma is due to a different Epstein-Barrnuclear antigen 1 transcriptional initiation site. Proc NatlAcad Sci USA 1991;88:6343-7.

20 Smith PR, Griffin BE. Differential expression of Epstein-Barr virus gene EBNA1 from different promoters in naso-pharyngeal carcinoma and B lymphoblastoid cells. J Virol1992;66:706-14.

21 Cohen JI, Wang F, Mannick J, Kieff E. Epstein-Barr virusnuclear protein 2 is a key determinant of lymphocytetransformation. Proc NatlAcad Sci USA 1989;86:9558-62.

22 Kaye KM, Izumi KM, Kieff E. Epstein-Barr virus latentmembrane protein 1 is essential for B-lymphocyte growthtransformation. Proc Natl Acad Sci USA 1993;90:9150-4.

23 Grogan E, Jenson H, CountrymanJ, Heston L, Gradoville L,Miller G. Tranfection of a rearranged viral DNA fragment,WZhet, stably converts latent Epstein-Barr viral infectionto productive infection in lymphoid cells. Proc Natl AcadSci USA 1987;84:1332-6.

24 Carey M, Kolman J, Katz DA, Gradoville L, Barberis L,Miller G. Transcriptional synergy by the Epstein-Barrvirus transactivator ZEBRA. J Virol 1992;66:4803-13.

25 Van Gorp J, Jacobse KC, Broekhuizen R, Alers J, Van denTweel JG, De Weger RA. Encoded latent membraneprotein 1 of Epstein-Barr virus on follicular dendritic cellsin residual germinal centres in Hodgkin's disease. J ClinPathol 1994;47:29-32.

26 Jiwa NM, Kanavaros P, Van der Valk P, Walboomers JMM,Horstman A, Vos W, et al. Expression of c-myc and bcl-

2 oncogene products in Reed-Stemnberg cells is in-dependent of the presence of Epstein-Barr virus. 7 ClinPathol 1993;46:211-7.

27 Oudejans JJ, Van den Brule AJC, Jiwa NM, De Bruin PC,Ossenkoppele GJ, Van der Valk P, et al. BHRF1, theEpstein-Barr virus (EBV) homologue of the bcl-2 (proto-)oncogene, is transcribed in EBV associated B-cell lymph-omas and in reactive lymphocytes. Blood 1995;86:1893-902.

28 Lear AL, Rowe M, Kurilla G, Lee S, Henderson S, KieffE, et al. The Epstein-Barr virus (EBV) nuclear antigen 1BamHI F promoter is activated on entry of EBV-trans-formed B-cells into the lytic cycle.J Virol 1992;66:7461-8.

29 BurkhardtAL, BolenJB, KieffE, LongneckerR. AnEpstein-Barr virus transformation-associated membrane proteininteracts with src family tyrosine kinases. J 1irol 1992;66:5161-7.

30 Minarovits J, Hu LF, Imai S, Harabuchi Y, Kataura A,Minarovits-Kormuta S, et al. Clonality, expression andmethylation patterns of the Epstein-Barr virus genomesin lethal midline granulomas classified as peripheral an-giocentric T-cell lymphomas. J Gen Virol 1994;75:77-84.

31 Suzushima H, Asou N, Fujimoto T, Nishimura S, OkuboT, Yamasaki H, et al. Lack of EBNA2 and LMP1 in T-cell neoplasms possessing Epstein-Barr virus. Blood 1995;85:480-6.

32 Pallesen G, Sandvej K, Hamilton-Dutoit SJ, Rowe M,Young LS. Activation of Epstein-Barr virus replication inHodgkin and Reed-Stemnberg cells. Blood 199 1;78: 1162-5.

33 Cochet C, Martel-Renoir D, Grunewald V, Bosq J, CochetG, Schwaab G, et al. Expression of the Epstein-Barrvirus immediate early gene, BZLF1 in nasopharyngealcarcinoma tumor cells. Virology 1993;197:358-65.

34 Gradoville L, Grogan E, Taylor N, Miller G. Differencesin the extent of activation of Epstein-Barr virus replicationgene expression among four non-producer cell lines stablytransformed by OriP/BZLF1 plasmids. Virology 1990;178:345-54.

76