finding the right primers: using ncbi for rt-pcr primer design

Integrated DNA Technologies Finding the Right Primers: Using NCBI for RT-PCR Primer Design Adam Clore, PhD

Upload: integrated-dna-technologies

Post on 28-Aug-2014

1.683 views

Category:

Health & Medicine

1 download

Report

Download

Tags:

Embed Size (px):

DESCRIPTION

Specializing in the design and troubleshooting of qPCR, mutagenesis, and cloning experiments at IDT, Scientific Applications Specialist, Adam Clore PhD, gave this presentation about the intelligent selection of PCR primers. Topics include identifying transcript variants for your target of interest and selecting primers that amplify only specific transcripts. Adam also discussed the growing SNP database and the potential impact of SNPs on qPCR data, how to locate any SNPs that fall in your target amplicon, and the use of free NCBI and IDT tools to help you avoid them.

TRANSCRIPT

Page 1: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Integrated DNA Technologies

Finding the Right Primers: Using NCBI for RT-PCR Primer DesignAdam Clore, PhD

Finding the Right Primers

Considerations When Designing RT-PCR Assays

Physical Properties of the Primers and Probe

Transcript Variants SNPs

Adam Clore, PhD

Finding the Right Primers

What is a Transcript Variant and Why Should You Care?

Genes with different combinations of exons Alternatively spliced transcripts

produce different isoforms of proteins

95% of human genes have alternate splicing

Many cancers and some genetic diseases are caused by transcript variants

Adam Clore, PhD

Gene

ExonsIntrons

DifferentialSplicing

TranscriptVariants

Finding the Right Primers

Role of Variants in Normal Gene Expression

Doublesex gene in D. melanogaster influences sex development by alternatively splicing the 3 exons of the gene:

Pre-mRNA

Female variant

Male variant

Adam Clore, PhD

Finding the Right Primers

Role of Transcript Variants in Disease

correlating with cancer: CD44 Wilms’ tumor gene WT1 BRCA1 MDM2 FGFR

Adam Clore, PhD

Finding the Right Primers

NCBI Gene GUI

Use to see all known transcript variants in the RefSeq database and how they differ.

Adam Clore, PhD

Page 7: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

1. Type in the gene of interest

Page 8: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

2. Select Genes: Gene-centered information

Page 9: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

3. Choose the species you are interested in.

Page 10: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

All known transcript variants are displayed.

Page 11: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

4. Select “reference sequence details” for information on each transcript variant.

Page 12: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Details about a specific transcript variant.

Finding the Right Primers

Options for Real Time PCR Design PrimeTime® Predesigned qPCR Assay Library

For Human, Mouse, and Rat All designs are screened for crosstalk between variants

http://www.idtdna.com/order/predesignedassay.aspx?source=scitools

RealTime Design Tool Real-time design for sequences entered by Ref Seq number or sequences

pasted in manually http://www.idtdna.com/scitools/Applications/RealTimePCR/

Adam Clore, PhD

http://www.idtdna.com/order/predesignedassay.aspx?source=scitools

http://www.idtdna.com/scitools/Applications/RealTimePCR/

Page 14: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Finding the Right Primers

Exon Naming… NCBI has had no official convention An example of how it’s often done

Variant #2

Variant #11 2 3 4 5

1 2 3 4 5 6

Adam Clore, PhD

Finding the Right Primers

Exon Naming… What NCBI (and IDT) are moving to:

Variant #2

Variant #1

1 2 3 4 7 8

1 5 6 7 8

Adam Clore, PhD

Page 18: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 19: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 20: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Finding the Right Primers

What is a SNP and Why Do I Care? Single nucleotide

polymorphism a single letter change in the genetic code

There are an approximately 56,000,000 SNPs in the human genome

16,000,000 are in gene introns and exons Most are silent mutations Some are clinically relevant

Adam Clore, PhD

Finding the Right Primers

NCBI SNP Database

Adam Clore, PhD

Page 24: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 25: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 26: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 27: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 28: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 29: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 30: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Page 31: Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Finding the Right Primers

Summary IDT RT-PCR Design Tools

PrimeTime® Predesign aPCR Assay Tool For Human, Mouse, or Rat Identifies transcript variants and avoids SNPs in all Pre-designed Assays

RealTime Design Tool Can design for any sequences submitted by user User needs to check for transcript variants and SNPs

Adam Clore, PhD

Polymerase Chain Reaction (PCR) · in PCR is Dependent on the Primers • The PCR reaction will amplify the DNA section between the two primers. • If the DNA sequence is known,

Specificity, Efficiency, and Fidelity of PCR...PCR generated a number of unspecific bands or if a different set of primers (i.e., internal primers) is to be utilized for the subsequent

two primers are used in pcr

Synthetic Biology for - 2015.igem.org2015.igem.org/.../c/cb/IGEM5_OurProject_InversePCR.pdf · 2015-09-19 · Our Primers in Inverse PCR In PCR, the primers are part of the newly

Supplementary Table 3. PCR oligonucleotide primers … · Web viewYellow bands in ladders = 500 bp. Primers and expected band sizes are included in Supplementary Table S2. Duplicate

Polymerase Chain Reaction (PCR). Tópicos 1. DNA 2. PCR –Alvos –Denaturação –Primers –Anelamento –Ciclos –Requerimentos

Fingerprinting Genomes Using PCR With Arbitrary Primers

PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the

Supplemental table 1 : List of primers used for Me-DIP coupled Q-PCR

The first PCR cycle: The sequence between the two primers will be amplified

Zip Nucleic Acids: new high affinity oligonucleotides as potent primers for PCR and reverse transcription

SBTexcellerator SBTengine...SBTexcellerator® Single amplification PCR Magnífica cobertura Una única PCR amplifica todos los exones relevantes de un locus HLA. Los primers hibridan

PCR with arbitrary primers - Gene bankcropgenebank.sgrp.cgiar.org/images/file/learning_space/...(AP-PCR) PCR with arbitrary primers Three main techniques fall within the category of

sem4-cdna sythesis,pcr,designing primers for pcr, synthesis of genes, shotgun experiment and gene library

An introduction to PCR primer design, the features …PCR primer design is a critical step in all types of PCR methods The design of polymerase chain reaction (PCR) primers, like the

Genetic Polymorphism in Barley Detected by PCR …PCR product with arbitrary primers; this method was developed in [1, 2]. Primers used for RAPD are of relatively small size (8-12

Supplemental Figures. Figure S1: Primers used for genotyping icp55 insertion lines, full length cDNA amplification and qRT-PCR. Primers for Genotyping:

PCR with arbitrary primers - Gene bank · uses a short primer ... Copyright: IPGRI and Cornell Univ ersity, 2003 PCR with arbitrary primers 15! Dominant!

Supporting Table 1 -Primers for qRT-PCR - Lunds universitetcbbp.thep.lu.se/pub/Preprints/03/lu_tp_03_36_suppl.pdf · 2006-09-19 · Supporting Text 2 – PCR conditions to determine

Appendix 1 List of primers and PCR conditions - CORE · Appendix 1 List of primers and PCR conditions CRB1gene Primer Sequence Product (kb) PCR Mix PCR Conditions exon11_1F ACCAATGTATTCAACAGGGACC

Lab safety Documentation, GLP Practical tips; primers and PCR

DynamicsofMyosinHeavyChainGeneRegulationinSlow … · The MHC mRNA isoform distribution was evaluated by RT with random primers followed by PCR with primers targeting the embryonic,

IMP PCR primers detect single nucleotide polymorphisms for

Phylogenetic placement of Cryptophiale Cryptophialoidea ...mycosphere.org/pdf/MYCOSPHERE_9_6_5.pdf · 1134 of PCR products were carried out using the above-mentioned PCR primers at

Reação Polimerásica em Cadeia (PCR) - dbbm.fiocruz.br · (PCR) PCR - consiste em fazer cópias de DNA “in vitro”, ... 2. Anneal: 37 ° C - 65 ° C Primers bind to specific

PCR Techniques. Basics of PCR Primers –15-60bp (60bp is limit synthesized by IDT) –Annealing temp ideally >55C (portion that anneals to your template)

A Simple Efficient Method for Purification of Degraded PCR Primers

Design and standardization of PCR primers and protocols for …€¦ · · 2015-03-10LEADING ARTICLE Design and standardization of PCR primers and protocols for detection of clonal

Quantitative Real-time PCR (qPCR) › media › 11375 › 9qpcr... · QF-PCR (quantitative fluorescence PCR) and qPCR? Introduction qPCR -Non labelled primers -Real time measurements

Nonaplex PCR using Cliffhanger primers to identify

Primers - needhammicrobialecology.files.wordpress.com€¦ · Web viewAppendix 4: PCR clean-up notes17. Appendix 5: Sequencing Submission18. References:19. Primers. 1,2, 5’->3’,

Nested PCR,Fusion primers, Integrated PCR

Table S2. Sequences of primers used for RT-PCR

Supplemental Table 1. Primers used for RT-PCR analysis of ...dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42917/JCI42917sd.pdf · Supplemental Table 1. Primers used for RT-PCR analysis