first semester exam review topics – life characteristics
DESCRIPTION
First Semester Exam Review Topics – Life Characteristics. NOT ALIVE!. ALIVE!. Biology is all about being Alive! Know what that means!. O – H – M – R – G&D – E&A. First Semester Exam Review Topics – Pyramids. All about Energy! Who has the energy? Where from? How? - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/1.jpg)
First Semester Exam Review Topics – Life Characteristics
Biology is all about being Alive!
Know what that means!
O – H – M – R – G&D – E&A
ALIVE!
NOT ALIVE!
![Page 2: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/2.jpg)
First Semester Exam Review Topics – Pyramids
All about Energy!
Who has the energy?
Where from? How?
How much flows “upwards” between the levels?
Can you Name the Levels?
What is wrong with this Diagram?
![Page 3: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/3.jpg)
First Semester Exam Review Topics – Food Webs
Know the energy levels, -vores, -trophs, niche, etc…
What would happen if the area was sprayed the area and the Herbivorous
Insects were wiped out?
What are these Illustrations Called?
What is the Spider? Fox?! Rabbit?
Why is the Toad the most fragile animal here?
![Page 4: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/4.jpg)
Both Benefit!
One Benefits at the expense of
the other!
One Benefits without
affecting the other!
One Consumes the other!
First Semester Exam Review Topics - Symbiosis
![Page 5: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/5.jpg)
First Semester Exam Review Topics – Limiting Factors
Limiting Factors and Seasons that support/control the Producers.What do the Producers require to Thrive?!
![Page 6: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/6.jpg)
First Semester Exam Review Topics – Population Growth
Balance
Small populations are in danger because: (?)
![Page 7: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/7.jpg)
First Semester Exam Review Topics – Human Population
Age Structure Graph
Shows the pattern of
growth of a population.
How many offspring =
How fast the Population will
grow!
Developing Country = Fast Growing Pop.
Slow Growing Developed Country.
Developed Country = Stable Zero
Growth.
Remember! Growth Rate (GR) = Birth Rate (BR) – Death Rate (DR)
![Page 8: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/8.jpg)
First Semester Exam Review Topics – Carbon Cycle
Photosynthesis collects CO2 vs. Cellular Respiration releases CO2 in rough Balance to maintain atmospheric levels.
?!
![Page 9: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/9.jpg)
First Semester Exam Review Topics – Global Warming
Linked to the release of CO2 into the atmosphere which absorbs radiation and traps heat.
Excess CO2 results from Combustion of fossil fuels.
Rapid and Recent Increase in the average temperature of the Earth following the beginning of the Industrial Revolution.
All related to the Greenhouse Effect.
![Page 10: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/10.jpg)
First Semester Exam Review Topics – Nitrogen Cycle
Why is Nitrogen essential to all living things?
What form does that Nitrogen need to be in to become available to the Food Web?
What important plants are especially important in the Nitrogen Cycle and what do they have?
![Page 11: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/11.jpg)
First Semester Exam Review Topics – Bioaccumulation
Pollution affects organisms when it become concentrated enough to damage them.
Producers collect a little of the toxic chemicals, but the higher organisms in the Food Web end up with toxic levels.
Who is affected?
Where is the Toxic Chemical Stored?
How did the environment become exposed?
Why did the Producers not die?
![Page 12: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/12.jpg)
First Semester Exam Review Topics – Dead Zones
Ecosystems SHOULD be in rough Balance! If there is an over-abundance of Nutrient Run-off from farmlands, the algae “Bloom” and this leads to loss of Oxygen – Dead Zones!
Nutrients cause too much Algal Growth, leaving too much dead algae!
Decomposers then Overgrow and use the Oxygen!! Red Tide does Something
Else! Toxic!
![Page 13: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/13.jpg)
First Semester Exam Review Topics – Organic Compounds
Living Things are mostly composed of Organic Compounds.
Organic mean Based on CARBON!!
Carbon is the BFF that holds all of the various atoms together.
Bonds in three dimensions and can form highly complex, large molecules.
Typically, other elements involved in Organic Molecules include H,N, and O = 96+% of all living matter!
![Page 14: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/14.jpg)
First Semester Exam Review Topics – Organic Compounds
There are four (4) basic types of Organic Compounds.
CARBOHYDRATES are Sugars and are universal
energy sources! Photosynthesis!!
LIPIDS are Fats and are good for energy
storage!
Monosaccharides such as Glucose = Blood Sugar!
Benedict’s Test turns Orange
Polysaccharides that store glucose and thus energy.
Starch stores energy in Plants – Iodine test = Black.
Cellulose in Cell Walls of Plants.
Glycogen stores energy in Animals.
Triglyceride with three Fatty Acids.
P
Phospholipid found in
Membranes.
Lipids are Non-Polar and do not dissolve in Water = Insoluble.
Brown Paper Bag Test!!
![Page 15: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/15.jpg)
First Semester Exam Review Topics – Enzyme
![Page 16: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/16.jpg)
First Semester Exam Review Topics – Plasma Membrane
?
?
?
Phospholipid Bilayer Barrier.
Selective Permeability and Homeostasis!
Receptor for Information and Control of the Cell
![Page 17: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/17.jpg)
First Semester Exam Review Topics - Prokaryotes
How do you
KNOW that it is a
“Pro” karyote?
![Page 18: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/18.jpg)
First Semester Exam Review Topics - Eukaryotes
Must Know! Nucleus, Plasma Membrane, Mitochondrion, Food Vacuole, Ribosome and what they do!
Also Must Know! Cell Wall, Vacuole, Chloroplast and what THEY do!
![Page 19: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/19.jpg)
First Semester Exam Review Topics – Cell Organization
CellCell
Cell Cell Cell Cell
CellCellCell
Organize into
TISSUES
Organize into
Blood
NervousConnective
MuscularEpithelial
ORGANS
Organize into
ORGAN ORGAN ORGANORGAN SYSTEM
ORGAN SYSTEMORGAN SYSTEM
ORGAN SYSTEM
Organize into
ORGANISM
![Page 20: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/20.jpg)
First Semester Exam Review Topics - Osmosis
Low concentration
of solutes = lots of water!
0%
Higher concentration
of solutes = less water!
i.e., 10%
Movement of Water to maintain Equilibrium. Uncontrolled.
![Page 21: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/21.jpg)
First Semester Exam Review Topics – Membrane Transport
Passive Transport
always flows High
↓Low
“with” the conc.
gradient.
Active Transport
always forces from Low
↓High
Need ATP to move
“against” the conc. gradient.
ATP!
![Page 22: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/22.jpg)
First Semester Exam Review Topics - Photosynthesis
Plants Require CO2 and H2O!!! They then use those Reactants to produce Glucose!!
Stomata Control Everything since they determine TRANSPIRATION and delivery of the Reactants!!
![Page 23: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/23.jpg)
First Semester Exam Review Topics – Cellular Respiration
If O2 present = Aerobic!
If O2 NOT present = Anaerobic!
36-38 ATP!
2 ATP
Fermentation in cytoplasm
Efficient /
Eukaryotes / Oxygen!
Inefficient / Yeast and
Bacteria / Sealed Up.
![Page 24: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/24.jpg)
PPP
N
N
N
N
NH2
Adenine
First Semester Exam Review Topics – ATP
Adenosine Triphosphate. THE Basic Energy Carrying Molecule of Cells. Can pass energy on to other molecules to drive Metabolism via the third Phosphate Group. Cycles back and forth with ADP.
Universal Energy Source means that Enzymes and various Chemical Reactions can become specialized to use THIS molecule. Little Variation = Same Shapes!
ATP!
ADPRespiration Metabolism
![Page 25: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/25.jpg)
First Semester Exam Review Topics – Fermentation
Fermentation is Anaerobic!! Useful Process for many different Foods. All are sealed during their Production!
Alcoholic Fermentation
produces CO2 =
Bubbly!!
Lactic Acid Fermentation leaves a sour taste as the
pH changes – Goes Down!!
Psst!! CO2!
Fluffy with CO2 holes!!
Remember! What happens to Muscle as a result of Lactic Acid Fermentation?
![Page 26: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/26.jpg)
First Semester Exam Review Topics – DNA Structure
DeoxyriboNucleic Acid
THE Genetic Material carries
Information of the Organism.
Stable as a Double Helix protecting the information on the Inside.
Building Blocks are Nucleotides.
Bases represent the information and always form Complementary
Base Pairs.
A T
G C
Complementary Base Pairs!
This Illustration shows the copying of DNA. What is this process called and what is the final product? Why is it “Semi-Conservative”?
If DNA Strand G C T A T T C G C A C G T A A C G T AOther Strand isC G A T A A G C G T G C A T T G C A T
![Page 27: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/27.jpg)
First Semester Exam Review Topics – RNA
How is RNA different from DNA:
Structurally?
Bases?
Function?
Location?
What is this Process called?
If DNA Strand G C T A T T C G C A C G T A A C G T A
RNA Strand is C G A U A A G C G U G C A U U G C A U
What is the Original Sequence Called?
![Page 28: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/28.jpg)
First Semester Exam Review Topics – Protein Synthesis
DNA Transcription RNA Translation Protein
![Page 29: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/29.jpg)
First Semester Exam Review Topics - Translation
CCTTACGGTCGCTTTTTACGGGTAATTGGAATGCCAGCGAAAAATGCCCATTAA
GGAAUGCCAGCGAAAAAUGCCCAUUAA
Met Pro Ala Lys Asn Ala His STOP
mRNA Genetic Code
NOW – Have an Amino Acid Chain. What has to happen to get a functional
Protein?
![Page 30: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/30.jpg)
Usually caused during Meiosis! Random!
Usually caused during Replication (=Error) OR as a result of exposure to
damaging Mutagens (=radiation, chemicals, etc…). Random and
Constant.
CAG↓
Q = Glu
CAA↓
Q = GluSame = Silent
AAG↓
K = LysProblem!
TAG↓
STOPDisaster!
Delete AG↓
Only 2?!Disaster!
First Semester Exam Review Topics - Mutation
![Page 31: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/31.jpg)
First Semester Exam Review Topics – Cell Cycle
The Production of new cells should be tightly controlled!
Daughter Cells are only made when there is space during
Growth and Healing.
Cells have to “shut-down” DNA as Chromosomes!
Most Cells Do Not Divide as they are specialized to function. G0 cells are “working” and typically cannot do
Mitosis.
DNA is Chromatin and in Use!
In Mitosis, all of the Daughter Cells are Genetically Identical (barring Mutation), but since they “Express” different genes in different ways, they can “Differentiate” into very different cellis: e.g., Muscle and
Nerve Cells that are very active (lots of Mitochondria!), or Connective Tissue Cells, etc…
![Page 32: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/32.jpg)
First Semester Exam Review Topics – Cancer
The Cell Cycle is controlled by Genes just like everything else! If those genes are mutated, then the Cell Cycle will be affected.
Those Daughter Cells SHOULD stop growing when they contact each other (Contact Inhibition!) and then shift to
G0 and get to Work!.
IF the Cell Cycle is disrupted (e.g., by mutated Oncogenes), this process
cannot stop when it SHOULD!
Cancer is caused by Mutation. Major causes include UV Radiation (Ozone is Important!!), Smoking (Don’t do it!), Viruses (new vaccines
can prevent!), and Replication Errors (No Fix There).
![Page 33: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/33.jpg)
Controlled growth.
UNControlled growth.
First Semester Exam Review Topics – Cell Division/Mitosis
![Page 34: First Semester Exam Review Topics – Life Characteristics](https://reader036.vdocument.in/reader036/viewer/2022081516/56813ac2550346895da2d317/html5/thumbnails/34.jpg)
First Semester Exam Review Topics – Cell Division/Mitosis
Asexual
Identical
Clone
Daughter Cells
Growth/Dev.
Do not need to know the four Phases, but need to be able to
recognize the parts and put the phases in order.