g3: genes, genomes, genetics genome sequence of ... · pdf file1 g3: genes, genomes, genetics...
TRANSCRIPT
![Page 1: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/1.jpg)
G3: Genes, Genomes, Genetics 1
2
Genome sequence of Saccharomyces carlsbergensis, the world’s first 3
pure culture lager yeast 4
5
Andrea Walther, Ana Hesselbart and Jürgen Wendland* 6
7
Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, Valby, Denmark 8
9
10
(*) Corresponding author: Jürgen Wendland, Carlsberg Laboratory, Yeast Biology, 11
Gamle Carlsberg Vej 10, DK-1799 Copenhagen V, Denmark 12
13
Email: [email protected] 14
Phone: +45/3327 5230; 15
Fax: +45/3327 4708 16
17
18
running title: S. carlsbergensis genome 19
20
key words: genome sequencing, genome evolution, chromosome loss, ploidy, fermentation 21
22
23
24
G3: Genes|Genomes|Genetics Early Online, published on February 27, 2014 as doi:10.1534/g3.113.010090
© The Author(s) 2013. Published by the Genetics Society of America.
![Page 2: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/2.jpg)
Abstract 25
26
Lager yeast beer production was revolutionized by the introduction of pure culture 27
strains. The first established lager yeast strain is known as the bottom fermenting 28
Saccharomyces carlsbergensis, which was originally termed Unterhefe No.1 by Emil 29
Chr. Hansen and used in production in since 1883. S. carlsbergensis belongs to group 30
I/Saaz-type lager yeast strains and is better adapted to cold growth conditions than 31
group II/Frohberg-type lager yeasts, e.g. the Weihenstephan strain WS34/70. Here, we 32
sequenced S. carlsbergensis using next generation sequencing technologies. Lager 33
yeasts are descendants from hybrids formed between a S. cerevisiae parent and a 34
parent similar to S. eubayanus. Accordingly, the S. carlsbergensis 19.5 Mb genome is 35
substantially larger than the 12 Mb S. cerevisiae genome. Based on the sequence 36
scaffolds, synteny to the S. cerevisae genome, and by using directed PCRs for gap 37
closure we generated a chromosomal map of S. carlsbergensis consisting of 29 unique 38
chromosomes. We present evidence for genome and chromosome evolution within S. 39
carlsbergensis via chromosome loss and loss of heterozygosity specifically of parts 40
derived from the S. cerevisiae parent. Based on our sequence data and via FACS 41
analysis we determined the ploidy of S. carlsbergensis. This inferred that this strain is 42
basically triploid with a diploid S. eubayanus and haploid S. cerevisiae genome content. 43
In contrast the Weihenstephan strain, which we re-sequenced, is essentially tetraploid 44
composed of two diploid S. cerevisiae and S. eubayanus genomes. Based on 45
conserved translocations between the parental genomes in S. carlsbergensis and the 46
Weihenstephan strain we propose a joint evolutionary ancestry for lager yeast strains. 47
![Page 3: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/3.jpg)
Introduction 48
Starting from the early ages of agriculture and the domestication of barley fermented 49
beverages played an important role in the emerging societies. Beer has been known for 50
millennia dating back at least to the Sumerians 6000 BC. Fermented beverages 51
provided not only nutrition but were basically the only sources of uncontaminated clean 52
liquids and thus of medicinal value. Although there is a plethora of microorganisms 53
within the Saccharomyces complex that can be found in natural fermentations, 54
Saccharomyces cerevisiae has been the predominant species in certain types of 55
fermentations, e.g. in ale beers and in wine. 56
Today, however, most beer volume is generated with lager beers. Lager brewing was 57
initiated in Bavaria in the 15th century (Libkind et al., 2011). The German Reinheitsgebot 58
from 1516 regulated that beer should only be made of water, malt and hops without any 59
other ingredients – of course at that time S. cerevisiae was not known. Yet, lager beer 60
production differed markedly from ale brewing by its substantially lower fermentation 61
temperatures -starting as low as 5°C. In the 18th century lager beer gained so much 62
popularity that keeping up production required a break with tradition. Supported by the 63
invention of refrigeration lager beer was then also produced in the summer months 64
which had traditionally been off-season. 65
However, beer spoilage of lager beers became increasingly frequent over summer due 66
to contamination with wild yeasts. This led to the scientific investigation of this problem 67
by Louis Pasteur and Emil Chr. Hansen. Hansen verified that wort became infected by 68
wild yeasts and therefore devised a method to isolate pure cultures of yeast strains 69
(Hansen, 1883). One of these strains, Unterhefe No.1, showed a very convincing 70
brewing performance and was thus chosen as production strain at the Carlsberg 71
![Page 4: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/4.jpg)
brewery in 1883 and given freely to other breweries by its owner J. C. Jacobsen and 72
later entered the CBS strain collection in 1947. 73
Lager yeasts are interspecies hybrids between S. cerevisiae and S. uvarum parents 74
(Nilsson-Tillgren et al., 1986; Kielland-Brandt et al., 1995; Casaregola et al., 2001; 75
Bond, 2009). The first lager yeast draft genome sequence was that of the 76
Weihenstephan (WS34/70) strain demonstrating the allotetraploid hybrid nature of this 77
lager yeast (Nakao et al., 2009). Prior analyses of lager yeast strains indicated that 78
different isolates contain different gene or chromosome sets (Hansen and Kielland-79
Brandt, 1994; Fuji et al., 1996; Borsting et al., 1997; Tamai et al., 1998; Yamagishi and 80
Ogata, 1999). Using PCR-RFLP two types of lager yeasts could be distinguished. On 81
the one hand there were lager strains currently used in production that showed almost a 82
complete set of both of the parental genomes, and on the other a set of lager yeast 83
strains including, S. carlsbergensis and S. monacensis that were found to lack certain 84
portions of the S. cerevisiae genome (Rainieri et al., 2006). By means of array-CGH this 85
partition into two groups was further refined. This indicated that regional distribution 86
matches the gene content and suggested that group I corresponds to the Saaz type, 87
while group 2 is represented by the Frohberg type. It was also suggested that two 88
independent hybridization events generated the two types of lager yeast (Dunn and 89
Sherlock, 2008). 90
The origin of the non-cerevisiae parent in lager yeast has long been debated. Recently, 91
the isolation of S. eubayanus from southern beech (Nothofagus) of Pathagonian forests 92
provided one potential resource of a strain that upon hybridization with e.g. an S. 93
cerevisiae ale yeast could have generated lager yeast hybrids (Dunn and Sherlock, 94
2008; Libkind et al., 2011). Throughout this paper we refer to the non-cerevisiae part of 95
lager yeast genomes as S. eubayanus, instead of S. uvarum or S. eubayanus-like etc. 96
![Page 5: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/5.jpg)
Here we report the genome sequence and analysis of the first pure culture lager yeast 97
production strain S. carlsbergensis and a genome scale comparison of this strain with 98
the Weihenstephan yeast WS34/70. 99
100
Materials and Methods 101
Strains, media and fermentation setup 102
The following strains were used in this study: Saccharomyces carlsbergensis, CBS 1513; 103
Saccharomyces monacensis, CBS 1503; Saccharomyces eubayanus, CBS 12357; 104
Saccharomyces cerevisiae CEN.PK; Saccharomyces pastorianus, Weihenstephan 105
WS34/70; Saccharomyces cerevisiae ale yeast (Carlsberg collection). Growth assays 106
were done in YPD medium (1 % yeast extract, 2 % peptone, 2 % glucose) at various 107
temperatures. Strains were inoculated with an initial OD600 of 0,1 and then grown for 2-4 108
days shaking. Industrial brewing conditions are produced by small scale fermentations 109
in tall tube cylinders with 200 ml volume. 14 °Plato granmalt (150 g/l malt granules, 5 g/l 110
yeast extract) was fermented with selected strains at 14 °C. Yeast strains were 111
propagated in granmalt prior to pitching with an OD600 of 0.2. Stirring of the fermentation 112
cyclinders was set to 190 rpm. The fermentation performance was followed by online 113
measuring of CO2 loss and wort density using an Anton Paar DMA 35 densitometer 114
measuring gravity (i.e. amount of sugars) in °P. End of fermentation was reached when 115
the sugar concentration did not drop further for two days. All fermentations were 116
conducted in biological triplicates. At the end of fermentation alcohol concentration was 117
measured using an Alcolyzer M (Alcolyzer Beer Analyzing System, Anton Paar). A 118
volume of 100 ml was used for flavor analysis. 119
120
121
![Page 6: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/6.jpg)
Flavor analysis: 122
Samples of 100 ml were removed at the end of fermentation for analysis of aroma 123
compounds. Alcohols and esters were measured by solvent extraction with carbon 124
disulphide (CS2). After stirring the samples for 30 min they were centrifuged and a 125
volume of 2 µl of the lipid organic phase was directly injected into the gas 126
chromatograph (GC, Agilent 6890). 1-octanol served as an internal standard. Volatiles 127
were separated on a DBWAX capillary column (30 m x 0.32 mm x 0.25 µm) and 128
detected by a flame ionization detector (FID). 129
130
Sequencing Strategy and chromosomal assembly: 131
Genome sequencing of S. carlsbergensis was performed using 454 GS FLX + 132
sequencing of single reads and of a mate-pair library of 8kb inserts. A fragment library 133
and the additional 8 kb paired-end library were constructed with Rapid Library Prep Kit. 134
An initial number of 635 399 reads and 480 966 paired end reads of an 8 kb library were 135
assembled into 386 contigs and further combined into 78 scaffolds. Assembly into 136
whole chromosomes was based on synteny to S. cerevisiae and S. eubayanus or 137
directed PCR fragments were obtained to merge scaffolds. Primers are listed in table 138
S1. The WS34/70 strain was re-sequenced using Illumina Miseq also including an 8 kb 139
mate-pair library. 140
141
Analysis of the S. carlsbergensis genome 142
The S. carlsbergensis Whole Genome Shotgun project has been deposited at 143
DDBJ/EMBL/GenBank under the accession AZCJ00000000. The version described in 144
this paper is version AZCJ01000000. The Weihenstephan WS34/70 Whole Genome 145
Shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession 146
![Page 7: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/7.jpg)
AZAA00000000. The version described in this paper is version AZAA01000000. For the 147
visualization of chromosomal rearrangements in a Circos plot a pairwise comparison of 148
S. carlsbergensis and S. cerevisiae chromosomes was done. The information about all 149
chromosomal rearrangements was then synthesized in a tabular matrix which can be 150
represented in a circular plot using the Circos software package (Kryzwinski et al., 151
2009). 152
Ploidy analysis was visualized using a violin plot. As a first step the shotgun reads were 153
aligned using the LASTZ program (http://www.bx.psu.edu/~rsharris/lastz/). Then its 154
output was parsed with SAMtools (Li et al., 2009) in order to index and extract the 155
number of aligned reads at each locus. A running average of mapped reads per window 156
was calculated. The violin plot shows the distribution of the log2 ratios of copy number 157
variation across each chromosome. The plot is generated using ggplot2 in R (Ito et al., 158
2013; R Development Core Group, 2013). Scaffold alignments and sequencing analysis 159
of PCR products were done using Lasergene DNAstar 11 (www.dnastar.com). 160
161
FACS analysis 162
Ploidy analysis was confirmed using FACS. Cells were grown o/n at room temperature 163
to an end-exponential growth state. For the staining of cells with propidium iodine 164
cultures were first washed and resuspended in 1xSSC buffer before fixation in 70 % 165
ethanol at -20 °C o/n. Samples were then treated with RNAse o/n at 37 °C followed by 166
proteinase K treatment at 50 °C for 1 hour. A final concentration of 3 µg/ml propidium 167
iodine was added to each sample and incubated for 18 hours in darkness before FACS 168
analysis (www.aragonlab.com/Protocols-Yeast.html). 169
170
171
![Page 8: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/8.jpg)
172
Results 173
Growth and fermentation characteristics of lager yeast strains 174
Lager yeasts are currently grouped into two categories, group I/Saaz and group 175
II/Frohberg. We compared growth and fermentation characteristics of two group I 176
strains, S. carlsbergensis and S. monacensis and the group II Weihenstephan WS34/70 177
strain with S. eubayanus, an ale yeast and the CEN.PK laboratory yeast strain. At low 178
temperatures of 10 °C S. eubayanus had a short lag phase and relatively rapid growth. 179
This profile was best matched by S. carlsbergensis. At 20 °C all assayed strains 180
grouped closely together. At higher temperature, however, S. cerevisiae and the ale 181
yeast strain showed better growth compared to S. eubayanus and both group I lager 182
yeasts. The Weihenstephan lager yeast showed intermediate growth rates at the upper 183
and lower end of the temperature range (Fig. 1). This indicates that S. carlsbergensis is 184
better adapted to cold fermentation temperatures than the group II lager 185
yeast/Weihenstephan strain. Historically, lager beer fermentation was carried out at very 186
low temperatures (as low as 5 °C). Currently, however, higher fermentation 187
temperatures are applied in industry. Here, we assayed fermentation performance at 14 188
°C using 14 °P wort. Under these conditions the group II lager yeast was fastest in 189
fermentation and wort attenuation. Amongst the group I lager yeasts S. carlsbergensis 190
was faster than S. monacensis and reached the same attenuation level as the 191
Weihenstephan strain (Fig. 2A). These results indicate that group II lager yeasts are 192
better adapted to higher temperature fermentation conditions than group I yeasts. Two 193
main post-fermentation parameters of industrial importance are the percentage of 194
surviving cells and the ratio of petite cells amongst them. This is because for the setup 195
of a second fermentation yeast cells from a previous fermentation are used as inoculum 196
![Page 9: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/9.jpg)
(termed “repitching”) and due to the inferior fermentation performance of petite cells. 197
Survival rates of group I and II lager yeasts at the end of fermentation were similar. Yet, 198
the Weihenstephan strain generated a lower amount of respiratory deficient “petite” 199
cells (not shown). 200
Lager yeast strains provide a clean taste to beers associated with rather low levels of 201
aroma alcohols and esters compared to more fruity ale and wine yeasts. We used 202
GC/FID to determine flavour differences in our group I and II lager yeast strains (Fig. 203
2B, Tab. S2). S. monacensis produced only low amounts of flavours. Group I lager 204
yeasts showed higher amounts of acetaldehyde (perceived as fruity at these 205
concentrations) while the group II strain produced far more ethylacetate (pear drops 206
flavour) and also more isoamyl alcohol/acetate (banana flavour). 207
208
Sequencing of S. carlsbergensis 209
We sequenced the S. carlsbergensis genome using 454 GS FLX+ technology. More 210
than 106 reads were generated and assembled into a 19.5 Mb genome. We obtained 211
>20x coverage with 680 bases average single-read length and an additional 8x 212
coverage via an 8 kb paired end library with 325 bases average read length. A draft 213
genome of the Weihenstephan has recently been generated (Nakao et al., 2009). Due 214
to the large number of sequence contigs we re-sequenced this strain using Illumina 215
MiSeq v2 to obtain similar high level coverage and quality as for the S. carlsbergensis 216
strain. To this end 107 reads derived from 250 bp paired-end reads and an 8 kb mate-217
pair library were used and assembled in the 23 Mb genome resulting in a total coverage 218
of 55x based on high quality reads (Tab.1). 219
The Weihenstephan lager yeast contains essentially two complete parental genomes. 220
As was shown previously, there is some loss of heterozygosity at chromosome ends, 221
![Page 10: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/10.jpg)
which in WS34/70 resulted in loss of ends of S. eubayanus chromosomes III, VII, XIII, 222
and XVI (Nakao et al., 2009). 223
Large scale loss of S. cerevisiae parental DNA in S. carlsbergensis 224
We found a substantial size difference between WS34/70 and S. carlsbergensis 225
indicating a loss of app. 3.5 Mb from the group I lager yeast strain. To generate an 226
overview of which parts of the parental genomes were lost we partitioned the scaffolds 227
into their S. cerevisiae and S. eubayanus origin based on sequence conservation. This 228
is straight-forward as scaffolds derived from the S. cerevisiae parent are >95% identical 229
to the S288C genome sequence whereas scaffolds derived from the S. eubayanus 230
parent are <95% identical to S288C. The two sets of scaffolds were then aligned to the 231
S288C genome sequence. To generate a genome overview and visualize both parental 232
genomes of S. carlsbergensis compared to the 16 S. cerevisiae chromosomes we used 233
CIRCOS (Fig. 3; see Materials and Methods for details). It became apparent that S. 234
carlsbergensis does not contain sequences from S. cerevisiae chromosomes VI, XI, and 235
XII. Our results are consistent with previous data obtained by PCR/RFLP mapping or by 236
array-based comparative genomic hybridization (array-CGH) (Rainieri et al., 2006, Dunn 237
and Sherlock, 2008). Next to loss of complete S. cerevisiae chromosomes we identified 238
several regions of loss of heterozygosity (LOH) in S. cerevisiae chromosomes IV, XIII, 239
XV, and XVI (Fig., 3; Tab. 2). In contrast, there was only two position of LOH for the S. 240
eubayanus part of chromosome III and XVI. In these cases sequences that were lost 241
were replenished by orthologous regions from the other parental genome, which 242
resulted in homozygous sequences derived from only one parental genome. In the S. 243
eubayanus part two reciprocal translocations can be noted encompassing the 244
chromosomes II and IV as well as VIII and XV (Fig. 3, see below). The total amount of 245
DNA lost by chromosome loss and LOH is sufficient to explain the genome size 246
![Page 11: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/11.jpg)
difference between the group I and group II lager yeast strains. The Weihenstephan 247
genome sequence initially was sized to 25 Mb. Our genome data comprises 23.6 Mb, 248
yet lacks telomeric regions due to redundancies. Thus, as indicated in Table 2 the 249
difference between the S. carlsbergensis and Weihenstephan genomes can readily be 250
explained by the loss of S. cerevisiae DNA observed in S. carlsbergensis. 251
252
Generation of a chromosomal map of S. carlsbergensis 253
Based on the high quality sequencing we could assemble the S. carlsbergensis genome 254
into just 78 scaffolds. Starting from these scaffolds we went on to merge the scaffolds 255
into chromosome-size super scaffolds. There were basically two sets of scaffold breaks: 256
either within parental scaffolds (Sc/Sc or Se/Se) or in case of LOH and lack of 257
contiguous sequences between Sc/Se scaffolds (Tab. 3). We used directed PCR 258
sequencing to obtain evidence of scaffold linkages. As an example the hybrid 259
chromosome XVI is shown (Fig. 4). Preliminary assembly of this chromosome 260
containing 5 scaffolds was done based on synteny to S. cerevisiae. One scaffold, 261
scaffold 18, covered the position of a reciprocal translocation within YPL240C of the S. 262
cerevisiae and S. eubayanus parental genomes (see below). Two scaffolds, 26 and 45, 263
could be manually assembled and were initially separated due to their short overlapping 264
regions. Scaffolds 18 and 26 were joined by directed PCR using primers specific for the 265
S. eubayanus sequence. The remaining two gaps were located between Sc/Sc and 266
Se/Se scaffolds and were joined based on synteny (Fig. 4). We analysed all scaffolds in 267
this way. Some scaffolds were merged based on synteny with their gaps presumably 268
marking positions of transposable elements (Tab. S3). Linkage mapping of all scaffolds 269
resulted in a total of 29 different chromosomes for S. carlsbergensis (Fig. 5). In contrast, 270
the Weihenstephan lager yeast was shown to harbour 36 different chromosomes which 271
![Page 12: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/12.jpg)
is confirmed by our analysis (Nakao et al., 2009). The complete list of S. carlsbergensis 272
chromosomes also enables an overview of the number and position of translocations in 273
this genome (Tab. 4). In the S. carlsbergensis genome we find conserved reciprocal 274
translocations between the S. eubayanus-derived chromosomes II/IV and VIII/XV that 275
are also present in the WS34/70 strain. Apparently, these translocations are ancestral 276
as they also occur in S. bayanus. Interestingly, the S. carlsbergensis and 277
Weihenstephan lager yeast strains share three translocations: One on chromosome XVI 278
shown in Fig. 4 within YPL240C, another one at the MAT-locus, and the last one within 279
YGL173C (see also below). In addition S. carlsbergensis harbours 7 unique 280
translocations between chromosomes of both parental genomes. The translocations 281
generated several chimeric chromosomes that are a distinguishing feature of this yeast. 282
WS34/70, on the other hand, carries 8 translocations that are specific for this strain. 283
284
Ploidy assessment for S. carlsbergensis 285
Previous reports suggested that based on array hybridization signal intensities group I 286
lager yeasts have a DNA content resembling that of 2n S. cerevisiae. Thus it was 287
hypothesized that group I lager yeasts originated from a hybridization of two haploid S. 288
cerevisiae and S. eubayanus cells (Dunn and Sherlock, 2008). Based on the high 289
coverage sequencing we could use the amount of sequence reads per scaffold unit size 290
as a measure of abundance of the corresponding chromosomes. To this end we used 291
LASTZ to map all S. carlsbergensis reads to the scaffolds and SAMtools to get sorted 292
alignments of the reads to the scaffolds. This was used to calculate the read depth per 293
1500 bp window. The data were visualized using ggplot2 in R (Fig. 6A). The data were 294
consistent with our mapping of individual scaffolds into chromosomes and the additional 295
translocation events observed, e.g. based on our chromosomal map the S. eubayanus-296
![Page 13: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/13.jpg)
derived scaffold 15 is present in three copies. Based on these data we were able to 297
generate an overview on the ploidy of each chromosome in S. carlsbergensis (Fig. 7 298
and Tab. 3). Surprisingly, these results indicate that S. carlsbergensis basically is a 299
triploid strain harbouring less than one haploid S. cerevisiae and more than a diploid S. 300
eubayanus genome. Two chromosomes are distinct: chromosome I is present only in 301
one S. cerevisiae and one S. eubayanus copy each, whereas chromosome III is present 302
in two S. cerevisiae copies and only one S. eubayanus copy. Based on our data we can 303
infer that S. carlsbergensis harbors 29 different chromosomes and a total of 47 304
chromosomes - i.e. 3n-1 (Tab. 3). Of these 47 chromosomes 10 are chimeric. The 305
ploidy analysis also revealed that the ratio for S. eubayanus vs S. cerevisiae derived 306
DNA is 2:1 in S. carlsbergensis (Fig. 6A). A similar analysis for WS34/70 using our 307
sequence data indicates that this group II lager yeast strain is tetraploid composed of 308
basically two diploid S. cerevisiae and S. eubayanus genomes (Fig. 6B). We also 309
performed FACS analyses with both lager yeast strains to obtain independent evidence 310
on their ploidies compared to 1n and 2n laboratory strains (Fig. 6C). These data are 311
consistent with the ploidy data generated from NGS data. 312
313
![Page 14: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/14.jpg)
314
Discussion 315
The tradition of beer making is ancient and goes back thousands of years. In central 316
Europe it was associated with monks, and one of the most famous places was Munich 317
in Bavaria (which actually literally means “the monks’ place”). Originally dark beers were 318
produced that became replaced at the end of the 19th century with pilsner type beers. 319
This movement may have originated in Munich as Gabriel Sedlmayer started pale ale 320
production in the Spaten Brewery of Munich (Hornsey, 2003; Kodama et al., 2005). 321
From there lager beer brewing spread to Pilsen, Czech Republic, and to Copenhagen, 322
Denmark. This geographic associations and affiliations with specific breweries is 323
reflected in today’s grouping of lager yeasts as group I (Czech and Carlsberg) or group 324
II (Weihenstephan and Heineken) (Dunn and Sherlock, 2008). 325
Lager beer production was revolutionized by the use of pure culture lager yeast strains 326
introduced by Emil Chr. Hansen at Carlsberg (Hansen, 1883). Up to this time point new 327
brews were initiated by repitching yeasts from a previous brew. This tradition has been 328
kept, however, from then on care was taken that the production strains were kept 329
isolated from other yeast strains. 330
Here we have determined the genome sequence of Saccharomyces carlsbergensis, the 331
Carlsberg brewery production strain since 1883. Our data fit well with previous reports 332
either covering the hybrid nature of lager yeasts based on the study of single genes or 333
using more global analyses like array-CGH (Rainieri et al., 2006, Dunn and Sherlock, 334
2008). 335
A clear distinction between group I and group II lager yeast strains is the selective loss 336
of parts of the S. cerevisiae parental genome in group I lager yeasts. For S. 337
carlsbergensis this resulted in the complete loss of three chromosomes (VI, XI, and XII) 338
and in loss of heterozygosity at four chromosomes (IV, XIII, XV, and XVI) amounting to 339
![Page 15: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/15.jpg)
a total of > 3.5 Mb of S. cerevisiae DNA. The driving force behind this evolution is yet 340
unclear. Loss of chromosome 12, for example, encompasses elimination of the S. 341
cerevisiae rDNA cluster in S. carlsbergensis. In contrast in the Weihenstephan strain a 342
massive loss of the S. eubayanus rDNA cluster was observed (Nakao et al., 2009). The 343
loss of other genome parts may be attributed to the cold fermentation conditions applied 344
during lager beer fermentation in the 19th century. At Carlsberg, fermentation 345
temperatures were as low as 5 °C. We found, correspondingly, that S. carlsbergensis 346
was better adapted to cold temperature growth conditions than group II lager yeasts 347
including the WS34/70 strain. The S. eubayanus ancestor is also a psychrophilic strain, 348
thus, maintenance of the S. eubayanus genome part may have been selected for under 349
these fermentation conditions. Current lager beer fermentations are carried out at 350
considerably higher temperatures and e.g. at 14 °C the group II lager yeasts are slightly 351
faster than group I strains (see Fig. 2; Saerens et al., 2008). 352
In S. carlsbergensis we noted loss of the left arm of S. eubayanus chromosome XVI 353
(~100 kb) and loss of the right arm of chromosome III starting at the MAT-locus (~100 354
kb). Both positions involved translocations between the respective S. cerevisiae and S. 355
eubayanus chromosomes and, interestingly, are conserved between group I and group 356
II lager yeasts. Genes involved in these translocations are the MAT-locus and the 357
HSP90 homolog HSP82. These re-arrangements may have played key roles in lager 358
yeast evolution. Alterations at the MAT-locus may have been instrumental to e.g. avoid 359
sporulation under adverse conditions such as at the end of fermentation. The 360
translocation at HSP82 occurred within the gene and thus has generated a chimeric 361
gene. HSP82, encodes a HSP90 chaperone required e.g. for refolding of denatured 362
proteins (Burnie et al., 2006; Pursell et al., 2012). HSP90 has been shown to act as a 363
capacitor for morphological evolution (Rutherford and Lindquist, 1998; Taipale et al., 364
![Page 16: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/16.jpg)
2010). Thus a translocation at YPL240C may have played a substantial role in lager 365
yeast evolution that is currently under further investigation. 366
Genome sequencing in lager yeasts is only at its early beginnings and the S. 367
carlsbergensis genome presented here is the first done using next-generation 368
sequencing technologies, which we also used to update the genome sequence of the 369
WS34/70 strain. Several hypotheses have been developed on the evolution of lager 370
yeast and the origin of the parental yeast strains. Currently, the non-cerevisiae parent is 371
viewed to be a close relative of S. eubayanus and the S. cerevisiae parent may have 372
been a strain already used for beer brewing, e.g. an ale yeast (Dunn and Sherlock, 373
2008; Bond, 2009; Libkind et al., 2011; Nguyen et al., 2011). Our work adds to this as 374
we can promote two hypotheses. First, based on our ploidy analyses, S. carlsbergensis 375
is functionally an allotriploid strain whereas group II lager yeasts are allotetraploid. This 376
could argue in favor of at least two independent hybridization events in that group I 377
lager yeasts were generated by a fusion of 1n S. cerevisiae with 2n S. eubayanus and 378
group II lager yeasts by fusion of two 2n yeasts. However, comparison of translocations 379
in S. carlsbergensis with those in the Weihenstephan strain identified 3 conserved 380
events and 7 to 8 strain specific events. Based on these conserved events, however, 381
and based on the history of lager beer production originating in Munich we favor the 382
notion that both strains share a joint history and a common ancestor. Previously, a close 383
relationship of CBS1513 with WS34/70 was also proposed based on the analysis of 384
single genes (Nguyen et al., 2011). A joint ancestry, on the other hand, suggests that S. 385
carlsbergensis evolved by massively reducing its S. cerevisiae genome content. Most of 386
this evolution was apparently due to whole chromosome loss but could also have come 387
about by meiotic reduction and remating. Whole genome duplication in the shared 388
ancestor between S. cerevisiae and e.g. S. castellii was also followed by massive gene 389
![Page 17: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/17.jpg)
losses. In S. cerevisiae this did not lead to wholesale chromosome loss, whereas S. 390
castellii has reduced the number of chromosomes from 16 down to 9 (Cliften et al., 391
2006; Scannell et al., 2007). We are currently investigating this in more detail by e.g. by 392
comparing the relationship between S. carlsbergensis and S. monacensis, another 393
strain isolated by Hansen in the 19th century, which apparently has lost additional parts 394
of the S. cerevisiae parental genome (our unpublished data). 395
The use and conservation of pure culture yeast strains in lager beer production has had 396
a profound impact on the quality and reproducibility in beer production and promoted 397
large scale productions. Yet, at the same time evolution of lager yeast strains was 398
impaired under these conditions. Batches of beer that were inferior compared to the 399
standard or became contaminated were readily discarded as the production strain could 400
be propagated from a pure culture. This generated consistent production results and on 401
the other hand diminished the chance of yeast strains to evolve further. To estimate the 402
level of diversity we obtained several historic bottles from the Carlsberg Museum bottle 403
collection filled with original beer from the late 19th century. In the slurry present in these 404
bottles yeast cells were found that could be stained with the cell wall dye calcofluor. 405
Using PCR we could detect S. carlsbergensis specific DNA fragments. Attempts to 406
isolate living material from these bottles generated two isolates, one determined as 407
Sporobolomyces roseus (a beer spoilage yeast not present in our lab) and the other as 408
S. carlsbergensis based on rDNA sequencing. Sequencing of this presumptive bottle 409
isolate revealed it to be identical to the CBS1513 genome sequence, which has been 410
kept in the CBS strain collection since 1947 with minimal propagation cycles. This 411
suggests very limited evolution of pure cultured yeast strains under industrial 412
fermentation conditions. Future work on lager yeast evolution will not only cover the 413
historic spectrum of lager yeast strains but move on to demonstrate the evolutionary 414
![Page 18: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/18.jpg)
potential of lager yeast hybrids to adapt to altered fermentation conditions and to study 415
the dynamics within lager yeast populations. 416
417
418
419
Acknowledgments 420
We thank Bjarne Maurer for providing access to the Carlsberg bottle collection and 421
insight into exact dating of bottles based on the respective labels used. We kindly thank 422
the analytical team of the Carlsberg Group Development in Strasbourg concerning 423
flavor analyses. This work was funded by grant 2010_01_0135 of the Carlsberg 424
Foundation to JWW. 425
426
427
![Page 19: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/19.jpg)
References 428
Bond, U., 2009 Chapter 6: The genomes of lager yeasts. Adv Appl Microbiol 69: 159-429 182. 430
Borsting, C., R. Hummel, E. R. Schultz, T. M. Rose, M. B. Pedersen et al., 1997 431 Saccharomyces carlsbergensis contains two functional genes encoding the acyl-432 CoA binding protein, one similar to the ACB1 gene from S. cerevisiae and one 433 identical to the ACB1 gene from S. monacensis. Yeast 13: 1409-1421. 434
Burnie, J. P., T. L. Carter, S. J. Hodgetts and R. C. Matthews, 2006 Fungal heat-shock 435 proteins in human disease. FEMS Microbiol Rev 30: 53-88. 436
Casaregola, S., H. V. Nguyen, G. Lapathitis, A. Kotyk and C. Gaillardin, 2001 Analysis 437 of the constitution of the beer yeast genome by PCR, sequencing and 438 subtelomeric sequence hybridization. Int J Syst Evol Microbiol 51: 1607-1618. 439
Cliften, P. F., R. S. Fulton, R. K. Wilson and M. Johnston, 2006 After the duplication: 440 gene loss and adaptation in Saccharomyces genomes. Genetics 172: 863-872. 441
Dunn, B., and G. Sherlock, 2008 Reconstruction of the genome origins and evolution of 442 the hybrid lager yeast Saccharomyces pastorianus. Genome Res 18: 1610-1623. 443
Fujii, T., H. Yoshimoto, N. Nagasawa, T. Bogaki, Y. Tamai et al., 1996 Nucleotide 444 sequences of alcohol acetyltransferase genes from lager brewing yeast, 445 Saccharomyces carlsbergensis. Yeast 12: 593-598. 446
Hansen, E.C., 1883. Recherches sur la physiologie et la morphologie des ferments 447 alcooliques V. Methodes pour obtenir des cultures pures de Saccharomyces et 448 de mikroorganismes analogues. C.R. Trav. Lab. Carlsberg 2: 92–105. 449
Hansen, J., and M. C. Kielland-Brandt, 1994 Saccharomyces carlsbergensis contains 450 two functional MET2 alleles similar to homologues from S. cerevisiae and S. 451 monacensis. Gene 140: 33-40. 452
Hornsey, I., 2003 A history of beer and brewing. RSC Paperbacks, Cambridge UK. 453 Ito, K., and D. Murphy, 2013 Application of ggplot2 to Pharmacometric Graphics. CPT 454
Pharmacometrics Syst Pharmacol 2: e79. 455 Kielland-Brandt, M. C., Nilsson-Tillgren, T., Gjermansen, C., Hollenberg, S., and M. B. 456
Pedersen, 1995. Genetics of brewing yeasts. In The yeasts (eds. A.H. Rose et 457 al.), pp. 223–254. Academic Press, London. 458
Kodama, Y., Kielland-Brandt, M. C., and J. Hansen, 2005. Lager brewing yeast. In 459 Comparative genomics (eds. P. Sunnerhagen and J. Piskur), pp. 145–164. 460 Springer-Verlag, Berlin. 461
Krzywinski, M., J. Schein, I. Birol, J. Connors, R. Gascoyne et al., 2009 Circos: an 462 information aesthetic for comparative genomics. Genome Res 19: 1639-1645. 463
Li, H., B. Handsaker, A. Wysoker, T. Fennell, J. Ruan et al., 2009 The Sequence 464 Alignment/Map format and SAMtools. Bioinformatics 25: 2078-2079. 465
Libkind, D., C. T. Hittinger, E. Valerio, C. Goncalves, J. Dover et al., 2011 Microbe 466 domestication and the identification of the wild genetic stock of lager-brewing 467 yeast. Proc Natl Acad Sci U S A 108: 14539-14544. 468
Nakao, Y., T. Kanamori, T. Itoh, Y. Kodama, S. Rainieri et al., 2009 Genome sequence 469 of the lager brewing yeast, an interspecies hybrid. DNA Res 16: 115-129. 470
Nguyen, H. V., J. L. Legras, C. Neuveglise and C. Gaillardin, 2011 Deciphering the 471 hybridisation history leading to the Lager lineage based on the mosaic genomes 472 of Saccharomyces bayanus strains NBRC1948 and CBS380. PLoS One 6: 473 e25821. 474
![Page 20: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/20.jpg)
Nilsson-Tillgren, T., Gjermansen, C., Holmberg, S., Petersen, J. G. L. and Kielland-475 Brandt. M. C., 1986 Analysis of chromosome V and the ILV1 gene from 476 Saccharomyces carlsbergensis. Carlsberg Res Commun 51: 309-326. 477
Pursell, N. W., P. Mishra and D. N. Bolon, 2012 Solubility-promoting function of Hsp90 478 contributes to client maturation and robust cell growth. Eukaryot Cell 11: 1033-479 1041. 480
Rainieri, S., Y. Kodama, Y. Kaneko, K. Mikata, Y. Nakao et al., 2006 Pure and mixed 481 genetic lines of Saccharomyces bayanus and Saccharomyces pastorianus and 482 their contribution to the lager brewing strain genome. Appl Environ Microbiol 72: 483 3968-3974. 484
R Development Core Team (2013). R: A language and environment for statistical 485 computing. R Foundation for Statistical Computing, Vienna, Austria. URL 486 http://www.R-project.org/. 487
Rutherford, S. L., and S. Lindquist, 1998 Hsp90 as a capacitor for morphological 488 evolution. Nature 396: 336-342. 489
Saerens, S. M., P. J. Verbelen, N. Vanbeneden, J. M. Thevelein and F. R. Delvaux, 490 2008 Monitoring the influence of high-gravity brewing and fermentation 491 temperature on flavour formation by analysis of gene expression levels in 492 brewing yeast. Appl Microbiol Biotechnol 80: 1039-1051. 493
Scannell, D. R., G. Butler and K. H. Wolfe, 2007 Yeast genome evolution--the origin of 494 the species. Yeast 24: 929-942. 495
Taipale, M., D. F. Jarosz and S. Lindquist, 2010 HSP90 at the hub of protein 496 homeostasis: emerging mechanistic insights. Nat Rev Mol Cell Biol 11: 515-528. 497
Tamai, Y., T. Momma, H. Yoshimoto and Y. Kaneko, 1998 Co-existence of two types of 498 chromosome in the bottom fermenting yeast, Saccharomyces pastorianus. Yeast 499 14: 923-933. 500
Yamagishi, H., and T. Ogata, 1999 Chromosomal structures of bottom fermenting 501 yeasts. Syst Appl Microbiol 22: 341-353. 502
503 504
505
![Page 21: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/21.jpg)
Figure Legends 506
507
Figure 1. Growth comparisons with lager yeasts. 508
Growth curves were obtained from YPD cultures grown at 10°C, 20°C, and 30°C over a 509
period of 2- 4 days. The following strains were used: Group I lager yeast S. 510
carlsbergensis (1513), S. monacensis (1503), group II lager yeast (WS34/70), an S. 511
cerevisiae ale yeast (ALE), S. eubayanus (EUB), and the laboratory S. cerevisiae strain 512
CEN.PK. 513
514
Figure 2. Malt based fermentations and volatile compound analysis with lager 515
yeast strains. 516
(A) Representative fermentation kinetics of S. carlsbergensis (CBS1513), S. 517
monacensis (CBS1503), and the Weihenstephan strain (WS34/70) with granulated malt 518
of 14 °P at 14 °C. Data were averaged based on n>4 parallel fermentations. The upper 519
plot shows the weight loss over time based on CO2 release (g/l) the lower chart 520
indicates the reduction of sugar content. (B) Spider chart representing the volatile 521
flavors analysed by GC/FID. The values obtained for the Weihenstephan strain were set 522
to 100% (see Tab. S2 for details) and compared to those from the group I lager yeasts. 523
524
Figure 3. Overview of the S. carlsbergensis subgenomes. 525
Genome sequencing data for S. carlsbergensis were assembled into the S. cerevisiae and S. 526
eubayanus sub-genomes and used in a pairwise comparison with the S. cerevisiae S288C 527
chromosomes. The resulting information on all chromosome rearrangements is converted from 528
tabular data into a circular plot by the Circos software package. Highlighted in green are the lack 529
of chromosomes VI, XI, and XII in the S. cerevisiae sub-genome and the translocations between 530
![Page 22: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/22.jpg)
chromosomes II/IV and VIII/XV in the S. eubayanus sub-genome of S. carlsbergensis (see also 531
Tab. 2). 532
533
Figure 4. Strategy of chromosome assembly for the S. carlsbergensis genome. 534
The scaffold composition of the chimeric chromosome XVI consisting of a telomeric left 535
end derived from its S. cerevisiae parent and a major part of S. eubayanus is shown. 536
Scaffolds were merged based on assembly of initial sequence reads (scaffold 537
assembly) by directed PCR using S. eubayanus specific primers to merge scaffolds 18 538
and 26 (PCR) or based on synteny to the parental genomes (synteny). Lasergene 539
DNAstar software was used for sequence alignments, alignment snapshots of the 540
scaffold ends and the linking PCR or template sequences are shown. 541
542
Figure 5. Chromosomal composition of the S. carlsbergensis genome. 543
The chromosomal structure of the S. carlsbergensis genome is summarized and 544
compared to the 16 chromosomes of the S. cerevisiae genome. The chromosome sizes 545
are proportional to the size bar (in bp) on top of the chart. Chromosomal DNA derived 546
from the S. cerevisiae sub-genome is indicated in blue, that of the S. eubayanus sub-547
genome in orange. Loss of heterozygosyity (LOH) e.g. on chromosomes III and XVI can 548
be located, reciprocal translocations in the S. eubayanus sub-genome (II/IV and VIII/XV) 549
are shown in checkers and stripes on the chromosomes, respectively. Additional LOH-550
events in the S. cerevisiae sub-genome on chromosomes IV and XV are marked with 551
connectors encompassing the chromosomal segments involved. 552
553
554
![Page 23: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/23.jpg)
555 Figure 6. Ploidy analysis for the S. carlsbergensis genome. 556
557
A violin plot generated by ggplot2 shows the ploidy calculated based on the read depth 558
for S. carlsbergensis CBS1513 (A) and S. pastorianus WS34/70 (B). The individual 559
reads were aligned to the respective scaffolds using LASTZ, the alignment output was 560
parsed with SAMtools in order to index and extract the number of aligned reads at each 561
locus. A running average of mapped reads per 1500 bp window was calculated. The 562
violin plot shows the distribution of the log2 ratios of copy number variation across each 563
chromosome. Blue represents the S. cerevisiae sub-genome, orange the S. eubayanus 564
sub-genome and green indicates hybrid scaffolds/chromosomes. (C) Flow cytometry 565
analysis of the DNA content of the S. carlsbergensis and Weihenstephan strains 566
compared to 1n and 2n laboratory strains. DNA content is plotted versus cell counts. 567
568
Figure 7. Chromosomal structure and chromosome copy number of S. 569
carlsbergensis. 570
The 16 Saccharomyces sensus stricto chromosomes were used to align the 571
chromosomes of S. carlsbergensis. Blue parts of chromosomes represent the S. 572
cerevisiae sub-genome, orange the S. eubayanus sub-genome. Ploidy was taken into 573
account to represent the parental contribution. 574
575
576
577
578
579
580
![Page 24: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/24.jpg)
581 Tables 582
Table 1. Genome Assembly data 583
584
CBS1513 WS34/70
Number of Contigs 386 1336
Number of Scaffolds 78 985
N50 scaffold size 552 537 92 939
Largest scaffold size 1 262 187 1 252 108
Annotated bases in scaffolds 19 436 056 22 954 394 585
586
![Page 25: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/25.jpg)
587 Table 2. Genome reduction in Saccharomyces carlsbergensis 588
589
S. cerevisiae genome size (Mb) 12.1
S. bayanus genome size (Mb) 11.5
Hypothetical hybrid tetraploid genome (Mb) 23.6
Unterhefe No1 genome (Mb) 19.5
Loss of chromosomes CHR6 0.27
CHR11 0.67
CHR12 1.1
Loss of heterozygosity
Chr3nonSc 0.11
CHR4sc 0.38
CHR13sc 0.12
CHR13sc 0.08
CHR15sc 0.48
CHR16nonSc 0.11
CHR16sc 0.36
CHR16sc 0.02
Total (Mb) 23.2
590
591
![Page 26: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/26.jpg)
592 Table 3. Chromosomal make-up of Saccharomyces carlsbergensis 593
Sc Chr SC copies chimeric Se Chr** Se copies unique Chr
I 1 0 I 1 2
II 1 0 II-IV 2 2 III 2 1 III 0 2
IV 0 1 IV-II 2 2
V 1 0 V 2 2
VI 0 0 X-VI 3 1
VII 0 3* VII 0 2
VIII 1 0 VIII-XV 2 2
IX 1 0 IX 2 2
X 1 0 VI-X 2 2
XI 0 0 XI 3 1
XII 0 0 XII 3 1
XIII 0 1 XIII 2 2
XIV 1 0 XIV 2 2
XV 0 1 XV-XIII 2 2
XVI 0 3* XVI 0 2
Sum 9 10 28 29
Total 47
* for Chr7 and 16 are 2 different chimera present
** Se = S. eubayanus 594
![Page 27: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/27.jpg)
595 Table 4. List of translocations in the Saccharomyces carlsbergensis genome 596
Type TranslocationGene:
Systematic NameGene:
Standard Name
S.eub-S.eub II-IV YBR030w - YDR012w* RKM3 - RPL4B
IV-II YDR011w - YBR031w* SNQ2- RPL4A
VIII-XV YHR014w - YOR019w* SPO13 - n/a
XV-VIII YOR018w - YHR015w* ROD1 - MIP6
S.eub-S.cer III-III YCR038c - YCR039c* BUD5 - MATALPHA2
VII-VII YGL173c - YGL173c* XRN1
XIII-XIII YML074c - YML073c FPR3 - RPL6A
XVI-XVI YPL036c - YPL036c PMA2
S.cer-S.eub IV-IV YDR324c - YDR324c UTP4
VII-VII YGL173c - YGL173c KEM1
XIII-XIII YMR287c - YMR287c MSU1
XV-XV YOR133w - YOR134w EFT1 - BAG7
XVI-XVI YPL240c - YPL240c* HSP82
XVI-XVI YPR184w - YPR185w GDB1 - ATG13
* Indentical translocations to WS34/70
597
598
599
![Page 28: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/28.jpg)
600 Table S1. Primers used in this study to bridge gaps between scaffolds 601
602
Chr Primer 1
sequence Primer 2
sequence 2 scaffold
2/4 6479 GGCGACAGCACGACCAGTACCCC 6485 GGAAGCAGGAGTGACTGAGGC 1
4 6591 GTTGCGTGTGCACAGTAGAGGG 6611 cagtgtactccggaggagcattcac 3+42
4 6964 GTGTAATAGACGACCCATG 6965 GAAGGCTTATGCTGGAGC 42+1p
4/2 6480 GGTATGTAAGTAAAACCAG 6486 CATAAGGAAAAGTAAGCAATG 4
7 6482 CTCTTAATAAAGAAAGGTGCAAAAGAA 6488 TAGTCCACCTGTACTTGGGCCG 6
7 6593 CTGATTCATAGCCTCGTAtAG 6613 GCTCAGAGTTTACCAAGAGAG 6+32
7 6481 CTTAATAAAGAAAGATGTAATAAGT 6487 GTTGTTCCAGGCATACTCGCA 2
7 6594 CCAGTAGGTCCTCTGTAAGAC 6614 CCAATGTCGACCCAGACGAG 32+77
7 6595 CAACCACCAGATTTGATGTTC 6615 GAGATTCGCCAAGCAGACGTC 77+59
8 6596 CATAAATTTGATCTTAGCATC 6616 GGACAACGTGGATAGCAAGGAC 50+22
8/15 6520 GTTATTTCGTTCGGTTCTCAAGG 6528 CTGTAAGGATTATTTGGTCAAACTC 27+15
8/15 6551 CTGTGATCCAAAGGCTGACTTG 6552 GTATACTACCTTATTATATGTATTAC 27+15
10 6598 GGAGAATATTGACAGTTACAC 6618 GTGAAAGTTCTTTGCAAGATG 24+23
10 6599 GGATTGCAGACCATTTCATC 6619 GAATTTCGTTATTCCTACCTTC 25+37
10 6600 CAGATTCTCCAAATTACTGG 6620 GAAGAAGCTGCCATTTCCG 37+28
11 6601 CTCGAAGACAGTTCATCGTATG 6621 CTGTGTGTTCCGTAGTTCACC 53+10
12 6602 GATGACCGTAAATGCTGCTTG 6622 CGAACGACTTGTCAGACGC 5+40
13 6517 GGTGATACGGATGGTAATGGGCATCG 6526 CATTGCTACCTCTACTAAGGTT 39+51
13 6604 CTGGTGGGGCTGTGTGGATGC 6624 CTACCCGTAATCAAGTTGCC 11+41
13 6515 GCAAGTAATTCCAATATTAATGG 6523 CTATTGGGTGTACCGAGTATCCTG 41+47
13 6517 GGTGATACGGATGGTAATGGGCATCG 6525 CATTGCCACCTCCACCAACGTC 39+30
13 6548 CCGTTCTACCCTGAACTACGAG 6549 TCACGACTTATAGCTGCAATTAATCAC 39+30
13 6605 CCATTGTTGACCTGATTCTG 6625 GATGAAGGCCTTCGACCGTC 30+16
13 6515 GCAAGTAATTCCAATATTAATGG 6524 CTTTATACGTCGCTCCCTCAG 16+47
14 6606 CAGCGAAGTGGAAGATGACC 6626 GAACATCAAGGCTTTGGACC 46+14
14 6607 GACATTGTCTTGTGGAGCC 6627 GCAATGATAAGGTGTTCTTC 14+36
15 6608 GACGAAGACAGTTAGCTTTAC 6628 GAGCGGACCATTGCAAGTGG 44+17
15 6519 gtcgctgtcgaagtcaagaacgc 6527 GTTGGGGACGAGTCGCCTTGAG 17+15
15 6550 CAGAATCCAAGGTCCAAACTACG 6528 CTGTAAGGATTATTTGGTCAAACTC 17+15
15/8 6609 GCCATCTCATTTAGCACCAGC 6629 GTCACCATCTCTCATTTCCAAG 9+43
16 6521 GCACCAGCAGAAGAGTTAGTC 6529 TGAGTCAGAATCATCAGCGGCAGAAG 18+20
16 6521 GCACCAGCAGAAGAGTTAGTC 6530 GGAGTCGGAGTCGTTAGCAGCAGGCA 18+26
16 6522 GAAAGTGTGTGGGCAGGATTG 6531 CTCTTTCTCGTTATTCAGATTG 20+52
603 604 605
606
![Page 29: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/29.jpg)
607 608 Table S2. Volatile compound analysis 609
610
compound WS34/70 CBS1513 CBS1503
Ethanol % v/v 5,86 ± 0,01 6,04 ± 0,01 5,13 ± 0,00
acetaldehyde ppm 3,5 ± 0,7 5,2 ± 0,2 4,5 ± 0,2
ethylacetate mg/l 35,1 ± 1,3 18,1 ± 1,3 17,5 ± 4,4
isobutanol mg/l 116,8 ± 11,0 194,9 ± 1,4 76,6 ± 27,2
isobutylacetate mg/l 0,3 ± 0,1 0,2 ± 0,1 0,1 ± 0,1
propanol mg/l 31,0 ± 1,1 25,4 ± 0,3 24,8 ± 1,2
isoamyl alcohol mg/l 244,1 ± 17,2 224,3 ± 1,2 174,0 ± 32,1
isoamylacetate mg/l 7,5 ± 0,8 4,9 ± 0,4 2,5 ± 1,1
2-phenylethanol mg/l 57,8 ± 6,4 76,9 ± 7,2 60,1 ± 17,9
2-phenylethyl acetate mg/l 1,3 ± 0,1 1,3 ± 0,1 0,7 ± 0,3
ethyl hexanoate mg/l 0,2 ± 0,1 0,2 ± 0,0 0,2 ± 0,1
ethyl octanoate mg/l 0,2 ± 0,0 0,2 ± 0,0 0,1 ± 0,0
hexanoic acid mg/l 0,8 ± 0,0 0,7 ± 0,1 0,7 ± 0,2
octanoic acid mg/l 5,4 ± 0,2 6,5 ± 0,3 5,6 ± 1,6
vinyl gaïacol mg/l 0,7 ± 0,1 0,7 ± 0,1 0,8 ± 0,0
Decanoic acid mg/l 0,2 ± 0,0 1,3 ± 0,1 1,3 ± 0,3
Total acids mg/l 6,4 ± 0,2 8,5 ± 0,3 7,6 ± 1,6
Sub-total alcohols mg/l 205,6 ± 17,8 297,3 ± 8,8 161,4 ± 44,7
Total esters mg/l 43,3 ± 2,2 23,7 ± 1,8 20,3 ± 5,5
611
612
![Page 30: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/30.jpg)
613 Table S3. Scaffold assembly for S. carlsbergensis. 614
615
Saccharomyces carlsbergensis
Sc Chr Scaffolds Se Chr Scaffolds I 33 I 34
II 7 II‐IV 1
III 38 (TY) 35 III 31+78+35part
IV 3+42+1part IV‐II 4
V 12 V 13
VI ‐ VI 29
VII 6+32+77+59 VII 2
VIII 50+22**48 VIII‐XV 27+15
IX 19 IX 21
X 24 (TY) 23 X 25*37+28
XI ‐ XI 53*10, 52
XII ‐ XII 5+40
XIII 39+51 (TY) 11+41+47 XIII 39+30 (TY) 16+47
XIV 46 (TY) 14 (TY) 36 XIV 8
XV 44+17+15 XV‐XIII 9+43
XVI 56+18*20+52 XVI 56+18+26+45+52
616
A „+“ indicates that scaffolds were combined by PCR and sequencing. Grey 617
boxes mark scaffolds that represent either chromosomes consisting of only one 618
scaffold or chromosomes which were generated by merging scaffolds. Red 619
boxes mark scaffolds with gaps containing TY-elements. A “*” indicates a gap < 620
0.5 kb verified by PCR and “**” indicates the region between YHR165C and 621
YHR174W that is apparently missing in S. carlsbergensis. 622
623
624
625
626
627
![Page 31: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/31.jpg)
![Page 32: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/32.jpg)
![Page 33: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/33.jpg)
![Page 34: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/34.jpg)
![Page 35: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/35.jpg)
![Page 36: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/36.jpg)
![Page 37: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/37.jpg)
![Page 38: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/38.jpg)
![Page 39: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/39.jpg)
![Page 40: G3: Genes, Genomes, Genetics Genome sequence of ... · PDF file1 G3: Genes, Genomes, Genetics 2 3 Genome sequence of Saccharomyces carlsbergensis, the world’s first 4 pure culture](https://reader034.vdocument.in/reader034/viewer/2022050714/5a8ef1ea7f8b9a085a8d8045/html5/thumbnails/40.jpg)