gateway cloning manual

GATEWAY™ Cloning Technology

Version 1

Note: This product is covered by a Limited Label License (see Section 1.3).The consideration paid for this product grants a Limited License with a paid up royalty to use the product pursuant to the terms set forth in the accompanying Limited Label License. By use of this product, you accept the terms and conditions of the Limited Label License.

www.lifetech.com/gateway

Table of Contents

1. Notices to Customer…………………………………………………………………….…….….….. 11.1 Important Information…………………………………………………………………...……. 11.2 Precautions…………………………………………………………………………….…..….. 11.3 Limited Label License………………………………………………………………….…..…. 1

2. Overview…………………………………………………………………………………….……..… 32.1 Two Reactions Constitute the GATEWAY™ Cloning System………………………...…..….. 42.2 Basis of GATEWAY Recombination Reactions……………………………………………….. 52.3 Details of the GATEWAY Cloning Reactions……………………………………………………62.4 Entry Vectors and Entry Clones……………………………………………………..……….. 82.5 Destination Vectors………………………………………………………………….………..102.6 Protein Expression in the GATEWAY Cloning System……………………………….……… 112.7 Considerations in Designing Entry Clones………………………………………………….. 12

2.7.1 Location of Translation Start Sequences…………………………………………… 122.7.2 Reading Frame………………………………………………………………………. 132.7.3 Examples of Sequences for Different Protein Constructs…………………………... 132.7.4 Transcription from Entry Clones…………………………………………………… 15

2.8 Choosing the Right Entry Vector…………………………………………………….……… 152.8.1 Features of the Entry Vectors………………………………………………………. 152.8.2 Entry Vector pENTR™11………………………………………………………….. 16

2.9 GATEWAY Nomenclature………………………………………………………………..….... 173. Methods………………………………………………………………………………………...…… 18

3.1 General Comments………………………………………………………………...………… 183.2 Creating an Entry Clone…………………………………………………………....………... 19

3.2.1 Cloning Genes into Entry Vectors using Restriction Endonucleases and Ligase……193.2.2 Cloning cDNA Libraries into Entry Vectors using Restriction

Endonucleases and Ligase……………………………………………………………213.2.3 Transferring Genes from Expression Clones into Entry Vectors via the BP Reaction...223.2.4 Cloning of attB-PCR Products via the BP Reaction……………………………….. 23

3.3 Creating Expression Clones (Transferring Genes from Entry Clones into DestinationVectors via the LR Reaction).……………………………………………………...……….... 27

4. Troubleshooting………………………………..…………………………………………………… 295. Additional Information…………….………………………………..……………………………… 34

5.1 Converting a Vector into a GATEWAY Destination Vector………………………...………... 345.2 Protocol for Making a Destination Vector……………………………………………....…... 355.3 Using the Destination Vector in the GATEWAY Cloning System…………………….….…... 385.4 "One-tube" Protocol: A Protocol for Cloning attB-PCR products directly into

Destination Vectors …………………………………………………..………….….….…… 395.5 Transferring Clones from cDNA Libraries Made in GATEWAY Vectors…………..….…….. 405.6 Detailed Descriptions of the Vectors of the GATEWAY Cloning System………….….….….. 41

6. Related Products …………………………………………………………..………….….………….57

Figures and Tables

Figure 1. Transferring a DNA Segment (Gene) between an Entry Clone and Multiple DestinationVectors. ... .....................................................................................................................................3

Figure 2. GATEWAY Cloning Reactions: The LR Reaction. . ......................................................................4Figure 3. GATEWAY Cloning Reactions: The BP Reaction. . .....................................................................5


Figure 4. Bacteriophage Lambda Recombination in E. coli. . .....................................................................6Figure 5. GATEWAY Cloning Technology as an Operating System for Cloning and Subcloning Genes. .. 6Figure 6. Sequences of attB1 and attB2 Sites Flanking a Gene after Subcloning into a Destination

Vector to Create an Expression Clone..........................................................................................7Figure 7. DNA Molecules Participating in the LR Reaction. . ....................................................................8Figure 8. Four Ways to Make Entry Clones.. ..............................................................................................9Figure 9. Schematic of Available Entry Vectors. ......................................................................................10Figure 10. Cloning A PCR Product by the BP Reaction............................................................................11Figure 11. Examples of Different Protein Expression Constructs. ...........................................................13Figure 12. Two Types of GATEWAY Protein Expression...........................................................................16Figure 13. attB Sequences to Add to Primers for PCR Cloning into an Entry Vector. ............................24Figure 14. Schematic of the GATEWAY Cloning System Reading Frame Cassettes. ................................34Figure 15. Sequences at Ends of GATEWAY Reading Frame Cassettes. ...................................................36Figure 16. Examples of How to Choose the Correct GATEWAY Reading Frame Cassette for N-Terminal

Fusions. . ...................................................................................................................................36Figure 17. One-Tube Protocol for Cloning PCR Products Directly into Destination Vectors. ................39Figure 18. Vector Map of Typical Entry Vector.……………………………………………………….. 41Figure 19. Cloning Sites of the Entry Vector pENTR™1A……………………………………………...42Figure 20. Cloning Sites of the Entry Vector pENTR2B……………………………………………..….42Figure 21. Cloning Sites of the Entry Vector pENTR3C……………………………………………..….43Figure 22. Cloning Sites of the Entry Vector pENTR4……………………………………………….….43Figure 23. Cloning Sites of the Entry Vector pENTR11……………………………………………...….43Figure 24. pDEST™8…………………………………………………………………………………….44Figure 25. pDEST10……………………………………………………………………………………...45Figure 26. pDEST12.2……………………………………………………………………………………46Figure 27. pDEST14…………………………………………………………………………………….. 47Figure 28. pDEST15…………………………………………………………………………………….. 48Figure 29. pDEST17…………………………………………………………………………………….. 49Figure 30. pDEST20…………………………………………………………………………………….. 50Figure 31. pDEST26…………………………………………………………………………………….. 51Figure 32. pDEST27…………………………………………………………………………………….. 52Figure 33. pDONR™201…………………………………………………………………………………56

Table 1. Available Entry Vectors.................................................................................................................9Table 2. Available Destination Vectors .....................................................................................................12Table 3. Location of Cleavage Sites for a Selection of Restriction Endonucleases. .................................35Table 4. Restriction Endonucleases Restriction Endonucleases That Do Not Cleave the Destination Vectors, or Cleave Twice…………………………………………………………………………….. 53

BAC-TO-BAC®, BENCHMARK™, CELLFECTIN®, CLONASE™, CLONECHECKER™, CONCERT™, DH5α™, DB3.1™,

DH10BAC™, GATEWAY™, GENETICIN®, FOCUS

®‚ 1 Kb PLUS DNA LADDER™, LIPOFECTAMINE™, LIBRARY

EFFICIENCY®, MASS™, MAX EFFICIENCY

®, pDEST™, pDONR™, pENTR™, pFASTBAC™, PLATINUM®,

PROQUEST™, REACT®, SUPERSCRIPT™, TAQUENCH™, TECH-LINE

SM, THERMOSCRIPT™, and the LifeTechnologies logo are marks of Life Technologies, Inc.

Kodak Digital Science™ is a trademark of Eastman Kodak Co.

Falcon® is a registered trademark of Becton Dickinson & Company.


1

1. Notices to Customer

1.1 Important Information

This product is authorized for laboratory research use only. The product has not been qualified or foundsafe and effective for any human or animal diagnostic or therapeutic application. Uses for other than thelabeled intended use may be a violation of applicable law.

1.2 Precautions

Warning: This product contains hazardous reagents. It is the end-user’s responsibility to consult theapplicable MSDS(s) before using this product. Disposal of waste organics, acids, bases, and radioactivematerials must comply with all appropriate federal, state, and local regulations. If you have any questionsconcerning the hazards associated with this product, please call the Life Technologies, Inc.Environmental Health and Safety Chemical Emergency hotline at (301) 431-8585.

1.3 Limited Label License

This product and its use is the subject of U.S. Patent 5,888,732 and other pending U.S. and foreign patentapplications owned by Life Technologies, Inc. (LTI). Use of this product requires a license from LTI.Academic, Not-for-Profit and For-Profit institutions acquire certain limited nontransferable rights with thepurchase of this product (see below).

Academic and Not-For-Profit Institutions: The purchase price of this product includes limited,nontransferable rights for non-profit and academic institutions to use only the purchased amount of the productto practice recombinational cloning solely for internal research purposes, but does not provide rights toperform amplification using primers containing recombination sites or portions thereof. Rights for performingamplification using primers containing att recombination sites or portions thereof solely for internal researchpurposes may be obtained by purchasing such primers from LTI or from a licensed supplier of such primers.LTI reserves all other rights and in particular, the purchaser of this product can not transfer or otherwise sellthis product or its components to a third party and no rights are conveyed to the purchaser to use the product orits components for commercial purposes as defined below. Academic and non-profit institutions must obtain alicense from LTI to acquire rights to use this product for any purpose other than those permitted above.

For-Profit Institutions: The purchase price of this product includes limited, nontransferable rights for for-profit institutions to use only the purchased amount of the product up to but no more than 5000 µl ofCLONASE™ products per year per site to practice recombinational cloning solely for internal researchpurposes, but does not provide rights to perform amplification using primers containing recombination sites orportions thereof. Rights for performing amplification using primers containing att recombination sites orportions thereof solely for internal research purposes may be obtained by purchasing such primers from LTI orfrom a licensed supplier of such primers. LTI reserves all other rights and in particular, the purchaser of thisproduct can not transfer or otherwise sell this product or its components to a third party and no rights areconveyed to the purchaser to use the product or its components for commercial purposes as defined below.For-Profit institutions must obtain a license from LTI to use this product for any purpose other than thosepermitted above.

Commercial purposes means any activity for which a party receives consideration and may include, but is notlimited to, (1) use of the product or its components in manufacturing, (2) use of the product or its componentsto provide a service, information or data, (3) use of the product or its components for diagnostic purposes, (4)transfer or sell vectors, clones, or libraries made with the product or components of the product, or (5) resellthe product or its components, whether or not such product or its components are resold for use in research.


2

If the purchaser is not willing to accept these use limitations, LTI is willing to accept return of the product for afull refund. For information on obtaining a license, contact the Director of Licensing, 9800 Medical CenterDrive, Rockville, MD 20850, phone (301) 610-8000, fax (301) 610-8383.

Products 11827-011, 11804-010, 11806-015, 11807-013 are sold under patent license from Monsanto forresearch purposes only and no license for commercial use is included. Requests for licenses for commercialmanufacture or use should be directed to Director, Monsanto Corporate Research, 800 N. Lindbergh, St.Louis, MO 63167.

Products 11822-012, 11823-010, 11826-013, 11827-011, 11803-012, 11806-015, 11809-019 are provided witha license for research use only. Information in respect of licenses to use the product for purposes other thanresearch may be obtained from F. Hoffmann-LaRoche Ltd, Corporate Licensing, 4002 Basel Switzerland.

Vectors containing the His6 affinity purification tag are manufactured for Life Technologies™ by QIAGEN,Inc.

Ni-NTA resin may be purchased from QIAGEN, Inc., 9600 De Soto Ave., Chatsworth, CA 91311. (800-426-8157).

The composition and/or use of the BL21-SI COMPETENT CELL is claimed in patents and patent applicationslicensed to Life Technologies, Inc. ("LTI") (i) by Brookhaven Science Associates, LLC (U.S. Patent Nos.4,952,496 and 5,693,489 and U.S. Submission 08/784,201) and (ii) by The Council of Scientific and IndustrialResearch ("CSIR") (U.S. Patent No. 5,830,690.)

The "T7 expression system" and its improvements are based on technology developed at Brookhaven NationalLaboratory under contract with the U.S. Department of Energy and separately by CSIR, and are the subject ofpatents and patent applications assigned to Brookhaven Science Associates, LLC ("BSA", see above) andCSIR respectively. By provisions of the Distribution License Agreements granted to Life Technologies, Inc.covering said patents and patent applications, LTI grants you a non-exclusive sub-license for the use of thistechnology, including the enclosed materials, based upon the following conditions:(i) University/Academic and Not-for-Profit Institutions: The purchase of this product conveys to University,

Academic and Not-for-Profit Institutions the right to use the BL21-SI COMPETENT CELLS only for internalnon-commercial research purposes.

(ii) For-Profit Organizations: For-profit organizations inside the United States must obtain a license fromBrookhaven Science Associates, LLC prior to purchasing and using the BL21-SI COMPETENT CELLS, forresearch or commercial purposes. For information about obtaining the required license to purchase, useand practice the "T7 expression system", please contact The Office of Technology Transfer, BrookhavenNational Laboratory, Bldg. 475D, P.O. Box 5000, Upton, New York, 11973-5000, Telephone (516) 344-7134.

(iii) Commercial Use: Commercial use of this product may require an additional license to the improvements.For information about obtaining a commercial license to purchase, use and practice the improvements tothe "T7 expression system", please contact The Centre for Cellular and Molecular Biology, Uppal Road,Hybderabad, 500 007, India, Attention: Director, Telecopier 91-40-717-1195.

(iv) Usage Restrictions: No materials that contain the cloned copy of the T7 gene 1, the gene for T7 RNApolymerase, may be distributed further to third parties outside of your laboratory, unless the recipientreceives a copy of this sub-license and agrees to be bound by its terms. This limitation applies to strainsBL21(DE3), BL21(DE3)pLysS and BL21(DE3)pLysE, CE6, BL21-SI Competent Cells and anyderivatives that are made of them.


3

2. Overview

GATEWAY Cloning Technology is a powerful new methodology that greatly facilitates proteinexpression, cloning of PCR products, and analysis of gene function by replacing restrictionendonucleases and ligase with site-specific recombination. The GATEWAY Cloning Technologyprovides:

• Transfer, in parallel, of one or more DNAsequences into multiple types of vectors(Figure 1).

• Rapid, efficient cloning – and expression – ofPCR products, of a wide range of sizes.

• Faithful maintenance of orientation andreading frame of the transferred DNAsequence.

• Generation of a high percentage of correctcolonies (usually >99%), minimizing the needfor screening.

• Robust reactions that are simple to perform(works well using miniprep DNA).

• A completely versatile system. Virtually anystandard cloning or expression vector can beconverted to a GATEWAY-compatible vector(creating a Destination Vector).

• An "operating system" for the exchange andimmediate use of validated clones andexpression vectors between differentlaboratories. Once gene sequences areconverted to Entry Clones, they can besubcloned into virtually any type ofDestination Vector, maintaining reading frame and orientation.

• Maximum flexibility to easily transfer DNA sequences from one expression vector into another. Thisgreatly speeds validation of clones, for example, in a two-hybrid screen.

• Reactions can be automated. GATEWAY Cloning Technology provides a versatile system for transferring DNA segments betweenvectors. Once in the system, DNA segments can be transferred from an Entry Clone into numerous vectors(e.g., for protein expression) or from the Expression vector back into Entry Clones. Several options areavailable for creating Entry Clones. These include:

• GATEWAY cloning (via the BP Reaction) of PCR products flanked by attB recombination sites togenerate Entry Clones.

• Cloning by standard recombinant DNA methods of restriction enzyme-generated fragmentsdirectly into Entry Vectors.

• GATEWAY cloning (via the BP Reaction) into Entry Vectors of genes from genomic or cDNAlibraries prepared in attB-containing GATEWAY vectors. (See the following sections.)

Entry

Clone

Gene

Gene

Gene

Gene

Gene

Gene

Gene

Gene Gene

His 6

GST

Trx

ptrc Your

2-HybridCMV-neo

FastBac

L1 L2

Vector

Figure 1. Transferring a DNA Segment (Gene)between an Entry Clone and MultipleDestination Vectors. DNA segments can betransferred from an Entry Clone into any number ofrecipient vectors (Destination Vectors) to generateExpression Clones, or from Expression Clones backinto Entry Clones.


4

2.1 Two Reactions Constitute the GATEWAY Cloning System

The first reaction, the LR Reaction, (Figure2) is the main pathway of this system. TheLR Reaction is a recombination reactionbetween an Entry Clone and a DestinationVector (pDESTTM), mediated by the LRCLONASE mix of recombination proteins.This reaction transfers DNA segments (e.g.,cDNA, genomic DNA, or gene sequences) inthe Entry Clone to the Destination Vector, tocreate an Expression Clone.

The sites labeled L, R, B, and P arerespectively the attL, attR, attB, and attPrecombination sites for bacteriophage lambda(λ) in E. coli (See Section 2.2). These sites arespecifically recognized by the recombinationproteins that constitute the CLONASE EnzymeMix cocktails. The GATEWAY cloningreactions are equivalent to concerted, highlyspecific, cutting and ligation reactions.Viewed in this way, the recombinationproteins cut to the left and right of the gene inthe Entry Clone and ligate it into theDestination Vector, creating a new ExpressionClone. During this process, reading frame ismaintained.

The gene in an Expression Clone is flanked byattB1 and attB2 sites. The orientation of thegene is maintained throughout the subcloning,because attL1 reacts only with attR1, andattL2 reacts only with attR2.

When an aliquot from the recombinationreaction is introduced into E. coli, the desiredtransformants can be selected on plates containing ampicillin. The unreacted Destination Vector does notgive ampicillin-resistant colonies, even though it carries the ampicillin-resistance gene, because itcontains a gene lethal to E. coli, ccdB. Thus selection for ampicillin resistance selects for E. coli cellsthat carry the desired product, which usually comprise >99% of the colonies on the ampicillin plate.

Expression Clones can express either native or fusion proteins. For native (non-fusion) proteins, thecoding sequence together with its translational start and stop signals is flanked by attB recombinationsites. As a consequence, the attB1 sequence resides in the 5′ untranslated region of the mRNA. In N-terminal fusion proteins, in contrast, the 25 bp attB1 site becomes part of the coding sequence and insertsan additional eight amino acids between the fusion domain and the protein encoded by a gene. For C-terminal fusions, the attB2 sequence adds an additional eight codons between the gene and the C-terminal fusion sequence.

Knr

P2

200 bp

P1

200 bp

Gene

Ap r

R1 R2

125 bp 125 bp

Apr

r

LR CLONASE

L1 L2

B2

100 bp 100 bp

25 bp 25 bp

(Int, IHF, Xis)

+

GeneB1

Entry Clone

Destination Vector

Expression Clone

By-product

+

ccdB

ccdB

Kn

Incubate ~60 min at 25˚C

Enzyme Mix

Transform E. coli

Apr Colonies Next Day (>90% Correct Clones)

pENTR-gene

pDEST

pEXP-gene

Figure 2. GATEWAY Cloning Reactions: The LRReaction. An Entry Clone, containing a gene flanked byrecombination sites, recombines with a DestinationVector to yield an Expression Clone and a by-productplasmid. The result is that a gene sequence in the EntryClone is transferred into an Expression Vector, donatedby the Destination Vector. The by-product plasmidcontains the ccdB gene, and hence gives rise to nocolonies when using standard strains of E. coli.


5

The second major pathway of theGATEWAY Cloning System is the BPReaction, shown in Figure 3. Essentiallythe reverse of the LR Reaction, the BPReaction transfers the gene in theExpression Clone (between attB sites) intoa Donor vector (containing attP sites), toproduce a new Entry Clone (attL sites).This reaction is catalyzed by the BPCLONASE mix of recombination proteins.Once a gene is flanked by attL sites as anEntry Clone, it can be transferred into newexpression vectors by recombination withDestination Vectors (via the LR Reaction).

A major use of the BP Reaction is forcloning PCR products as Entry Clones.PCR products made with primerscontaining terminal attB sites (25nucleotides + 4 Gs) are efficient substratesfor the BP reaction. The result is an EntryClone containing the PCR fragment. SuchEntry Clones can be readily recombinedwith Destination Vectors (through the LRReaction) to yield Expression Clones ofthe PCR product.

2.2 Basis of GATEWAY RecombinationReactions

The recombination reactions of theGATEWAY Cloning Technology are basedon the site-specific recombinationreactions of bacteriophage λ in E. coli.

Bacteriophage λ can grow as a lytic phage, in which case the host cell is lysed, with the release ofprogeny virus. Alternatively, lambda can integrate site-specifically into the genome of E. coli by aprocess called lysogenization. In this lysogenic state, the phage genome can be transmitted to daughtercells for many generations, until conditions arise that trigger its excision from the genome. At this point,the virus enters the lytic part of its life cycle. The control of the switch between the lytic and lysogenicpathways is one of the best understood processes in molecular biology (Ptashne, M (1992) A GeneticSwitch, Cell Press, Cambridge). See Figure 4.

The integrative and excisive recombination reactions of phage λ are mediated by proteins encoded byphage λ and E. coli. These recombination reactions, performed in vitro, are the basis of the GATEWAY

Cloning Technology. They can be represented as follows:

attB x attP ⇔⇔⇔⇔ attL x attR (where “x” signifies recombination).

The four att sites contain binding sites for the proteins that mediate the reactions. The wild type attP,attB, attL, and attR sites contain 243, 25, 100, and 168 base pairs, respectively. The attB x attP reaction

Apr

R1 R2

125 bp 125 bp

By-product

Knr

P2

200 bp

P1

200 bp

Donor Vector

Ap r

B2

25 bp 25 bp

GeneB1

Expression Clone

Gene

r

L1 L2

100 bp 100 bp

+

Entry Clone

(Int + IHF)

+

BP CLONASE

ccdB

ccdB

Kn

Enzyme Mix Incubate ~60 min at 25˚C

pEXP-gene

pDONR

pENTR-gene

Transform E. coli

Knr Colonies Next Day (>90% Correct Clones)

Figure 3. GATEWAY Cloning Reactions: The BPReaction. A gene in an Expression Clone can betransferred into an Entry Vector by the BP Reaction.Only plasmids without the ccdB gene that are alsokanamycin resistant (Knr) will yield colonies.


6

(integration) is mediated by the proteins Int and IHF.The attL x attR reaction (excision) is mediated by theproteins Int, IHF, and Xis. Int (integrase) and Xis(excisionase) are encoded by the λ genome, whileIHF (integration host factor) is an E. coli protein.[For a general review of lambda recombination, seeLandy, A. (1989) Annu. Rev. Biochem. 58, 913.]

By using a combination of the LR and BP reactions, agene or DNA segment can be easily moved betweenEntry Clones and Expression Clones. This versatilityprovides an operating system in which genes can betransferred easily into different vector backbones.(See Figure 5)

2.3 Details of the GATEWAY Cloning Reactions

The LR CLONASE Enzyme Mix that mediates theGATEWAY LR Reaction contains λ recombinationproteins Int, Xis, and the E. coli-encoded protein IHF.In contrast, the BP CLONASE Enzyme Mix, whichmediates the BP Reaction (Figure 3) contains Int andIHF, alone.

E. coli Genome

attB (25 bp)

ExcisionIntegration(Int, IHF) (Int,Xis,IHF)

E. coli Genome

Lambda Genome

attL attR

Phage Lambda

attP(243 bp)

(168 bp)(100 bp)

Figure 4. Bacteriophage LambdaRecombination in E. coli.

BP Reaction LR Reaction

Expression Clone

By-Product

By-Product

Destination Vector

Donor Vector

PCR Product

Restriction Enzymeand Ligase Cloning

Entry CloneccdB

attR1

GENE

attL1 attL2

attP1 attP2

GENE

attB1 attB2

attR1 attR2

attP1 attP2

attB1 attB2

GENE

ccdB

ccdB

ccdB

attR2

Figure 5. GATEWAY Cloning Technology as an Operating System forCloning and Subcloning Genes. Once a DNA segment is cloned into theGATEWAY system, it can be easily transferred from an Entry Clone into aDestination Vector (via the LR reaction) to generate an Expression clone. A DNAsegment in an Expression Clone can be easily transferred into an attP pDONRvector (via the BP reaction) to generate an Entry Clone and then into differentDestination Vectors, all without the need for restriction enzymes and ligase.


7

Note that the recombination reaction is conservative, i.e., there is no net synthesis or loss of base pairs.The DNA segments that flank the recombination sites are merely switched. The wild type λrecombination sites have been modified for purposes of the GATEWAY Cloning System, as follows:

• A part (43 bp) of attR has been removed, to make the excisive reaction irreversible and moreefficient [Bushman, W., Thompson, J.F., Vargas, L., and Landy, A. (1985), Science 230, 906). TheattR sites in GATEWAY Cloning System Destination Vectors are 125 bp in length.

• Mutations have been made to the core regions of the att sites to eliminate stop codons and to ensurespecificity of the recombination reactions (i.e., attR1 reacts only with attL1, attR2 reacts only withattL2).

• Other mutations have been introduced into the short (5 bp) regions flanking the 15-bp core regionsof the attB sites to minimize secondary structure formation in single-stranded forms of attB plasmids,e.g., in phagemid ssDNA or in mRNA.

The recombination (att) sites of each vector comprise a hybrid sequence, donated by the parental vectors.The staggered lines dividing the two portions of each att site, in Figure 2, Figure 3, and Figure 6represent the seven-base staggered cut produced by Int during the recombination reactions.

This structure is shown in greater detail in Figure 6, which displays the recombination sequences of anattB Expression Clone, generated by recombination between the attL1 and attL2 sites of an Entry Cloneand the attR1 and attR2 sites of a Destination Vector.

The gene in the ExpressionClone is flanked by attB sites:attB1 to the left (aminoterminus) and attB2 to the right(carboxy terminus). As shown,the bases within the 25-bp attBsite that are adjacent to the geneare donated by the attL sites ofthe Entry Vector; whereas theattB sequences distal to thegene derive from theDestination Vector (attR).Within the attB sites, these tworegions are demarcated by theseven-base staggered cutproduced by Int during therecombination reaction. Thesequence of both attB sites isdisplayed (Figure 6) in tripletscorresponding to one of threepossible open reading frames.

If the reading frame of the gene cloned in the Entry Vector is in phase with the reading frame shown forattB1 (note the –AAA-AAA-), amino-terminal protein fusions can be made between the gene and anyDestination Vector encoding an amino-terminal fusion domain. An analogous convention is followed for

Figure 6. Sequences of attB1 and attB2 Sites Flanking a Geneafter Subcloning into a Destination Vector to Create anExpression Clone.


8

making C-terminal fusions withDestination Vectors encoding C-terminalfusion domains (See Sections 2.7.2 and5.2).

Figure 7 illustrates how an Entry Cloneand a Destination Vector recombine inthe LR Reaction to form a co-integrate,which resolves through a second reactioninto two daughter molecules. A similarprocess occurs during the BP Reaction.

The two daughter molecules have thesame structure regardless of which pair ofsites, attL1 and attR1 or attL2 and attR2,react first to form the co-integrate. Thesegments change partners by thesereactions, regardless of whether theparental molecules are both circular, oneis circular and one is linear, or both arelinear. Selection for ampicillin resistancecarried on the Destination Vector, whichalso carries the ccdB gene, ensuressurvival of only the desired attB productplasmid.

2.4 Entry Vectors and Entry Clones

The LR Reaction allows transfer of agene sequence into new expressionvectors by recombining an Entry Clone

with various Destination Vectors. To participate in the LR Reaction, the DNA segment of interest mustbe flanked by attL1 and attL2 sites to create an Entry Clone. Entry Clones can be made in one of fourways, as shown in Figure 8.

The first approach is to clone the gene into one or more of the Entry Vectors, using standard recombinantDNA methods, with restriction endonucleases and ligase. The starting DNA fragment can be generatedby restriction endonuclease digestion or as a PCR product. The fragment is cloned between the attL1and attL2 recombination sites in the Entry Vector. Note that the ccdB gene, provided to minimizebackground colonies from incompletely digested Entry Vector, must be excised and replaced by yourDNA.

A schematic of the Entry Vectors and summary of their features is shown in Figure 9. Five EntryVectors currently are available, providing an array of cloning options. All carry the kanamycinresistance gene. Table 1 provides information on the available Entry Vectors and details of their cloningsites. Choosing the right Entry Vector is discussed in depth in Section 2.7.2.

Co-integrate

ExpressionClone

By-product

Entry Clone Destination Vector

attL1 attL2attR1 attR2

attL1 attB2

attP2

attR1

attB1 attB2

attP1 attP2

Knr Apr

Knr

Knr

Apr

Apr

ccdBGene

Gene

Gene

ccdB

ccdB

attL2 X attR2

attL1 X attR1

Figure 7. DNA Molecules Participating in the LRReaction. Two different co-integrates form during the LRReaction (only one of which is shown here), depending onwhether attL1 and attR1 or attL2 and attR2 are first torecombine.


9

Table 1. Available Entry Vectors

Name Cloning Features Expression Features

pENTR1ApENTR2BpENTR3C

Alternative reading frame vectors forN-terminal fusions. Multiple cloning site(MCS) immediately follows attL1. Firstrestriction endonuclease cut site yieldsblunt ends.

N-terminal or C-terminal fusions in E. coli oreukaryotic cells.

Native expression and carboxy fusions requireaddition of ribosome recognition sequenceand ATG translation initiation codon.

pENTR4 MCS immediately follows attL1. Firstrestriction endonuclease site is Nco I.

C-terminal fusions require that no stopcodons precede attL2.

pENTR11 Two good E. coli and eukaryoticribosome binding sites (SD and Kozak)downstream of attL1. Blunt and Nco Isites each preceded by SD and Kozak.

Native, N-terminal or C-terminal fusions inE. coli or eukaryotic cells.

C-terminal fusions require that no stopcodons precede attL2.

A second way to obtain Entry Clonesis to prepare a cDNA library in anEntry (attL) Vector. Individual EntryClones, as well as populations ofEntry Clones, can be transferreddirectly into the desired DestinationVectors.

The third approach to making anEntry Clone (Figure 8) is by PCR.This method is diagrammed in Figure10. The DNA sequence is firstamplified with PCR, using primerscontaining the 25-bp attB sequences(plus four terminal Gs). The PCRproduct is then converted to an EntryClone by performing a BP Reaction,in which the attB-PCR productrecombines with a Donor Vectorcontaining attP sites. Details of thisapproach and protocols for PCRfragment subcloning are provided inSection 3.2.

The fourth approach to making EntryClones (Figure 8) is to useExpression Clones. These can beobtained from cDNA librariesprepared in GATEWAY ExpressionVectors or from the product of an LRReaction. DNAs flanked by attB sitescan be introduced into an Entry

cDNALibrary

Clone/Library

L1 L2

Knr

P1 P2

DonorVector

Knr

+

B2Gene

B1

attB PCR Product

Gene

Entry Vector

L1 L2

Knr

+

+ Restriction Enzymesand Ligase

Gene

ExpressionClone/Library

Apr

B1 B2

Gene

Entry Clone

L1 L2

BP Reaction 4

3

2

1

Kn

Entry

r

ccdB

Figure 8. Four Ways to Make Entry Clones: 1. Usingrestriction endonucleases and ligase. 2. Starting with a cDNAlibrary prepared in an attL Entry Vector. 3. Using anExpression Clone from a library prepared in an attB expressionvector via the BP Reaction. 4. Recombinational cloning of PCRfragments with terminal attB sites, via the BP Reaction.Approaches 3 and 4 rely on recombination with a Donor Vectorthat provides the Entry Vector carrying Knr.


10

Vector by recombination with aDonor Vector, via the BP Reaction.The BP Reaction protocols are givenin Section 3.2. Expression ClonecDNA libraries (attB) are availablefrom Life Technologies inGATEWAY vectors pCMV•SPORT 6or pSPORT-P.

All Entry Vectors and DestinationVectors are constructed so that theN-terminal region of a cDNA insertwill be positioned next to the attL1site. All Entry Vectors contain therrnB transcriptional terminator,upstream of the attL1 site. Thissequence ensures that expression ofcloned genes is reliably "off" inE. coli, to increase the likelihoodthat even toxic genes can besuccessfully cloned. Thus incontrast to Expression Clones, EntryClones are designed to betranscriptionally silent.

2.5 Destination Vectors

Once a gene has been cloned into anEntry Vector, it is ready to bemoved into any of the availableDestination Vectors or into aDestination Vector that youconstruct (see Section 5.1). The upper-right portion of Figure 2 shows a schematic of the DestinationVectors. The thick arrow represents some function (often transcription or translation) that will act oncloned DNA. During the recombination reaction, the region between the attR1 and attR2 sites, includingthe ccdB gene, is replaced by the DNA segment from the Entry Clone. Selection for recombinants thathave acquired ampicillin resistance (carried on the Destination Vector) and also lost the ccdB geneensures that a high percentage (usually >99%) of the resulting colonies will contain the correct insert.

The genes ccdA and ccdB are the antidote and toxin genes respectively of the E. coli F plasmid [Bernard,P., Kezdy, K.E., Van Melderen, L., Steyaert, J., Wyns, L., Pato, M.L., Higgins, P.N., Couturier, M.(1993) J. Mol. Biol. 234, 534]. Together they ensure that daughter cells that do not receive a copy of Fwill not survive. The CcdB protein interferes with the rejoining step of DNA gyrase, causing thechromosome to be cut to pieces. Plasmids that contain the ccdB gene without the antidote gene (EntryVectors and Destination Vectors) can be propagated in the gyrase mutant, gyrA462 [Miki, T., Park, J.A.,Nagao, K., Murayama, N., and Horiuchi, T. (1992) J. Mol. Biol. 225, 39]. We have constructed agyrA462 strain, DB3.1™, for propagating Destination Vectors and Entry Vectors:

DB3.1: E. coli RR1 gyrA462 endA (recA-).

ccdB

VariableRegion N

Sal IBamH I

Kpn I EcoR I EcoR I

Not IXho I

EcoR VXba I

Entry Vector

rrnB

Variable Region N Options:Blunt site close to attL1 site, in three possible reading

frames (pENTR1A, 2B, 3C)Nco I site close to attL1 site (pENTR4)

Blunt (Xmn I) and Nco I sites each preceded by E. coliand eukaryotic ribosome recognition site (pENTR11)

attL1 attL2

ori Knr

Figure 9. Schematic of Available Entry Vectors. Shown atthe top are restriction sites flanking the ccdB gene that arecommon to all Entry Vectors. In addition, each Entry Vector hasits own selection of cloning sites and other options residing nextto the attL1 site (Variable Region N).

Variable Region N options are summarized in the lower half ofthe figure.


11

Destination Vectors carry an inactive copy of theccdA gene (caused by a frame shift) as well as anactive ccdB gene. Entry Vectors carry only theccdB gene, with its own promoter (Figure 9).

To move a gene into a Destination Vector,Destination Vector DNA is mixed with EntryClone DNA and incubated with LR CLONASE

Enzyme Mix, followed by transformation into anystandard E. coli strain. LIBRARY EFFICIENCY®DH5α™ Competent Cells are recommended.Section 3 provides further details and protocols.

Destination Vectors presently available from LifeTechnologies are summarized in Table 2. Mapsand cloning site information for DestinationVectors are provided in Section 5, as well asmethods for converting most standard vectors intoDestination Vectors.

2.6 Protein Expression in the GATEWAY

Cloning System

Proteins are expressed in vivo as a result of twoprocesses, transcription (DNA into RNA), andtranslation (RNA into protein).

Ribosomes convert the information present in mRNA into protein. Ribosomes scan RNA moleculeslooking for methionine (AUG) codons, which begin nearly all nascent proteins. Ribosomes must,however, be able to distinguish between AUG codons that code for methionine in the middle of proteinsfrom those at the start. Most often ribosomes choose AUGs that are 1) first in the RNA (toward the 5′end) and 2) have the proper sequence context. In E. coli the favored context [first recognized by Shineand Dalgarno, (1975) Eur. J. Biochem, 57, 221] is a run of purines (As and Gs) from five to 12 basesupstream of the initiating AUG, especially AGGAGG or some variant.

In eukaryotes, a survey of translated mRNAs by Kozak [(1991) J. Biol. Chem. 266, 19867] has revealed apreferred sequence context: --- GCC ACC ATG G-- around the initiating methionine, with the A at -3being most important, and a purine at +4 (where the A of the ATG is +1), preferably a guanine (G), beingnext most influential. Having an A at -3 is enough to make most ribosomes choose the first AUG of anmRNA in plants, insects, yeast, and mammals. [For a review of initiation of protein synthesis ineukaryotic cells, see Pain, V.M. (1996) Eur. J. Biochem. 236, 747.]

L2

Entry Clone100 bp 100 bp

L1

GenerrnB

Knr

Deathccd BP1 P2

200 bp 200 bprrnB

ccd B

By-product

R1 R2

125 bp125 bp

GeneB1 B2

attB-PCR Product25 bp 25 bp

BP CLONASE

(Int + IHF)

+

+

Donor Vector

Knr

Figure 10. Cloning A PCR Product by the BPReaction. A PCR product with 25-bp terminalattB sites (+ 4Gs) is shown as a substrate for theBP Reaction. Recombination between the attB-PCR product of a gene and a Donor Vector(which donates an Entry Vector that carries Knr)results in an Entry Clone of the PCR product.


12

Table 2. Available Destination Vectors

Name Expressionin

Features ori AntibioticResistance

pDEST14 E. coli Native protein expression with T7 promoter pBR Amp

pDEST15 E. coli N-terminal Glutathione-S-transferase fusion expressionwith T7 promoter

pBR Amp

pDEST17 E. coli N-terminal 6X histidine affinity tag fusion expressionwith T7 promoter

pBR Amp

pDEST8 insect cells Native protein expression with polyhedron promoter forbaculovirus expression

pUC Amp

pDEST10 insect cells N-terminal 6X histidine affinity tag fusion expressionwith polyhedron promoter for baculovirus expression

pUC Amp

pDEST20 insect cells N-terminal Glutathione-S-transferase fusion expressionwith polyhedron promoter for baculovirus expression

pUC Amp

pDEST12.2 mammaliancells

Native expression with SV40 promoter/ori and neoresistance

pUC Amp

pDEST26 mammaliancells

N-terminal 6X histidine affinity tag fusion expressionwith SV40 promoter/ori and neo resistance

pUC Amp

pDEST27 mammaliancells

N-terminal Glutathione-S-transferase fusion expressionwith SV40 promoter/ori and neo resistance

pUC Amp

2.7 Considerations in Designing Entry Clones

2.7.1 Location of Translation Start Sequences

Ribosome binding-site sequences (Shine-Dalgarno in E. coli and Kozak in eukaryotes) must lie close tothe initiating ATG. The attB site is 25 base pairs long. Therefore, if translation is to initiate at the nativeATG within a gene of interest, the ribosome binding site (RBS) sequence close to the ATG needs to bepositioned between the attL1 and attL2 sites in the Entry Clone of that gene. If the Destination Vector provides a promoter but no N-terminal fusion sequence, protein synthesis willinitiate exclusively at the translation start signals of the native open reading frame (ORF). If theDestination Vector encodes an N-terminal fusion peptide, however, protein synthesis may begin not onlyat the N-terminal fusion sequence, but to some degree at the internal, native ATG as well. Even thoughribosomes most often initiate protein synthesis at the 5'-most ATG, internal ATGs can also serve toinitiate protein synthesis. The better the translation context around the internal ATG, the more internalinitiation of translation will be seen. Whether to construct different Entry Clones to express native protein and N-terminal fusion protein is animportant consideration in designing Entry Clones. The presence of internal start sequences inN-terminal fusion constructs will sometimes result in a significant amount of native protein being made,contaminating and lowering the yield of the N-terminal fusion protein. This problem can be morepronounced with short N-terminal fusion tags, such as the 6X histidine affinity tag.


13

2.7.2 Reading frame

When making fusions it is essential to maintain the correct reading frame in the Entry Vectors. For nativeexpression any reading frame is acceptable since translation starts and stops between the two att sites.For fusions the reading frame of the DNA cloned into all GATEWAY vectors must be in phase with thereading frame of the attB1 site shown in Figure 6, such that the six As of the site are split into two lysinecodons (AAA - AAA). All of the Destination Vectors that make amino-terminal fusions have beenconstructed so that the attR1 site is in this reading frame. Figure 15 presents the attR1 and attR2sequences present within the three GATEWAY Reading Frame Cassettes used to create new DestinationVectors.

Therefore, if a gene is cloned into an Entry Vector so that the --- AAA - AAA --- reading frame withinthe attL1 site is in phase with the reading frame of the gene, amino terminal fusions will automatically becorrectly phased, for all N-terminal fusion tags.

Likewise, for C-terminal fusion Destination Vectors, the C-terminal coding sequences should be alignedin phase with the -TAC-AAA- sequence of the attR2 site, which translates into –Tyr-Lys- (See Figure 6and Figure 15).

2.7.3 Examples of Sequences for Different Protein Constructs

The following examples of Expression Clone sequences and attB-PCR primer sequences (for preparingEntry Clones) have been used successfully to express both native and fusion proteins in various cellularcontexts using the GATEWAY Cloning System. Other sequence options and motif combinations arepossible, and may be preferable in some situations. The examples below are offered only as a startingpoint for recombinant protein expression in the GATEWAY Cloning System.

Figure 11. Examples of Different Protein Expression Constructs

1. Native expression in prokaryotic, insect, and mammalian cells:

A. Expression clone structure:

attB1 attB2 (promoter)

B. Expression clone sequence: Shine-Dalgarno Kozak Open reading frame (amino end)5' - ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG NNN NNN NNN ---3' - TGT TCA AAC ATG TTT TTT CGT CCG AAG GTT CCT CTA TCT TGG TAC NNN NNN NNN ---

attB1 Translation start*

Open reading frame (carboxy end)--- NNN NNN NNN TAG GAC CCA GCT TTC TTG TAC AAA GTG GT - 3'--- NNN NNN NNN ATC CTG GGT CGA AAG AAC ATG TTT CAC CA - 5' Translation stop attB2

*Note: By placing the ATG in frame with the attB1sequence this construction can be used in both nativeand N-terminal fusion expression vectors.

RBS ATG StopOpen Reading Frame


14

C. Suggested oligonucleotides for attB-PCR cloning of gene for native expression

attB1 forward oligo: (attB1 sequence bold; translation start codon underlined; sequence includes SD and Kozak)

5' - GGGGACAAGTTTGTAC AAAAAAGCAGGCT TAGAAGGAGATAGAACCATG(18-25 gene-specific nucleotides in framewith start codon) - 3'

attB2 reverse oligo: (attB2 sequence bold; translation stop codon [complement strand] underlined)

5' - GGGGACCACTTTGTACAAG AAAGCTGGGT CCTA(18-25 gene-specific nucleotides [complement strand] in frame withstop codon) - 3'

2. N-terminal and C-terminal fusion expression in prokaryotic, insect, and mammalian cells:

A. Expression clone structure:

attB1 attB2

(promoter)

B. Expression clone sequence:

Open reading frame (amino end)5' – ATG NNN --- --- NNN ACA AGT TTG TAC AAA AAA GCA GGC TTC NNN NNN NNN ---3' – TAC NNN --- --- NNN TGT TCA AAC ATG TTT TTT CGT CCG AAG NNN NNN NNN ---

N-fusion attB1

Open reading frame (carboxy end)

--- NNN NNN NNN GAC CCA GCT TTC TTG TAC AAA GTG GTN NNN --- --- NNN (Stop) - 3'--- NNN NNN NNN CTG GGT CGA AAG AAC ATG TTT CAC CAN NNN --- --- NNN NNN - 5'

attB2 C-fusion

C. Suggested oligonucleotides for attB-PCR cloning of gene for N-terminal and C-terminal fusion expression

attB1 forward oligo: (attB1 sequence bold)

5' - GGGGACAAGTTTGTAC AAAAAAGCAGGCT TA (18-25 gene specific nucleotides in frame with attB1) - 3'

attB2 reverse oligo: (attB2 sequence bold)

5' - GGGGACCACTTTGTACAAG AAAGCTGGGT C (18-25 gene specific nucleotides [complement strand] in frame withattB2) - 3'

Note: Other nucleotides may be substituted for the underlined sequences as long as the reading frame is maintained andthe substituted sequences do not create a stop codon.

StopATGRBS

GSTHis6Txn

Open Reading Frame

MycHA


15

2.7.4 Transcription from Entry Clones

Many standard expression vectors use the lac promoter to control expression of cloned genes.Transcription from the lac promoter is turned on by adding the inducer IPTG. Even in the absence ofinducer, however, a low level of mRNA is made, i.e., the lac promoter is never completely off. Theresult of this "leakiness" is that genes whose expression is harmful to E. coli may prove difficult orimpossible to clone in vectors that contain the lac promoter, or they may be cloned only as inactivemutants.

In contrast to other gene expression systems, genes cloned into an Entry Vector are designed not to beexpressed. The presence of the strong transcriptional terminator rrnB [Orosz, A., Boros, I., andVenetianer, P. (1991) Eur. J. Biochem. 201, 653] just upstream of the attL1 site in Entry Vectors andEntry Clones is designed to prevent transcription from vector promoters from reaching the cloned gene.

2.8 Choosing the Right Entry Vector

The choice of Entry Vector is dictated bythe particular DNA and what is to bedone with it (see sidebar). These factorsare critical when transferring a gene froman Entry Clone to a Destination Vector,because all the base pairs between thegene and the Int cut sites in attL1 andattL2 (such as in Figure 6) move also.

For example, translation start signalspresent in an Entry Clone will betranslated into amino acids if an amino-terminal fusion to the gene is constructed.Deciding whether to express a gene as afusion protein, native protein, or both(See Figure 12), dictates whethertranslational start sequences must beincluded between the attL sites of theclone (native protein) or supplied by aDestination Vector (fusion protein).

Entry Clones that include translational start sequences may prove less suitable for making fusionproteins, as internal initiation of translation at these sites can decrease the yield of N-terminal fusionprotein, as discussed above.

2.8.1 Features of the Entry Vectors

All Entry vectors have restriction sites to the left and right of the ccdB gene to allow directional cloningof the DNA. Each vector enables amino or carboxy fusions when transferred into the appropriateDestination Vector if the cloned DNA maintains the reading frame registers shown in Figures 19-23.

The cloning sites of the Entry Vectors are organized in two groups that flank a copy of the ccdB gene.The CcdB protein interferes with DNA gyrase and thereby inhibits growth of E. coli. The Entry Vectorsare positive selection vectors; therefore, undigested or partially digested molecules will not generate

Considerations in Choosing an Entry Vector:

The DNA:—Does it contain a gene?—Is the sequence known?—Is the reading frame known?—Are there 5′ and 3′ untranslated regions?—Do these regions contain stop codons?—Does the gene fragment carry its own promoter and/or

translation signals?—Is the DNA a restriction fragment, or a PCR product?—Are there unique restriction endonuclease sites at theamino and carboxy ends?

How is the gene to be expressed?—In eukaryotes or in E. coli?—As native protein, or as a fusion protein?—With or without a protease cleavage site?


16

transformants in standard E. coli strains(e.g., DH5α). For carboxy-terminalfusions, stop codons must be absentfrom the cloned gene.

Table 1 lists the available Entry Vectors,and more detailed sequence information.The location of cloning sites is presentedin Figures 19-23. pENTR1A,pENTR2B, and pENTR3C are almostidentical, except that the restriction sitesat the 5'-end of the MCS (prior to theccdB gene) are in different readingframes.

pENTR4 is essentially identical to 1A,except that the blunt Dra I site has beenreplaced with an Nco I site containingthe ATG methionine codon. Genes thatcontain this site at the initiating ATGcan be conveniently cloned in this EntryVector. The Nco I site in pENTR4 isespecially useful for expression of genesin eukaryotic cells, since it containsmany of the bases that give efficienttranslation.

pENTR11 is useful for expression ofboth native and fusion proteins in E. coliand eukaryotic cells.

2.8.2 Entry Vector pENTR11

As an example, consider pENTR11(Figure 23). Here is what can be donewith it:

• Clone cDNAs from most commercially available libraries. The sites to the left and right of the ccdBgene have been chosen so that directional cloning is possible.

• Clone genes directionally: Sal I, BamH I, Xmn I (blunt), or Kpn I on the left of ccdB; Not I, Xho I,Xba I, or EcoR V (blunt), on the right.

• Clone genes or gene fragments with a blunt amino end at the Xmn I site. The Xmn I site has four ofthe six most favored bases for eukaryotic expression (see Section 2.6), so that if the first three basesof the DNA are ATG, the open reading frame will be expressed in mammalian, insect, yeast, etc.,cells when it is transcribed in the appropriate Destination Vector. In addition, a Shine-Dalgarnosequence is situated 8 bp upstream, for initiating protein synthesis in E. coli at an ATG.

• Clone cDNAs that have an Nco I site at the initiating ATG into the Nco I site. Similar to the Xmn Isite, this site has four of the six most favored bases for eukaryotic expression. Also, a Shine-Dalgarno sequence is situated 8 bp upstream, for initiating protein synthesis in E. coli using an ORFwith a 5′ ATG .

attB1 attB2

Term

attB1 attB2

Apr

Pro

Pro

ATG

His 6GSTTxn

MycHA

Native Protein Expression:

Fusion Protein Expression:

TermATG

rbs

rbs

cDNA

cDNA

Apr

Figure 12. Two Types of GATEWAY Protein Expression.Native Protein Expression (upper figure): All thetranslational start signals are included between the attB1and attB2 sites. Therefore these signals must be present inthe starting Entry Clone.

Fusion Protein Expression (lower figure): This exampleillustrates expression with both N-terminal and C-terminalfusion tags, so that ribosomes read through attB1 as well asattB2 to create the fusion protein. Unlike native proteinexpression vectors, N-terminal fusion vectors have theirtranslational start signals upstream of the attB1 site.Likewise, C-terminal fusion vectors have the terminationsignals downstream of the attB2 site.


17

• Select against uncut or singly cut Entry Vector molecules during cloning with restrictionendonucleases and ligase. If the ccdB gene is not removed with a double digest, it will kill anyrecipient E. coli cell.

• Enable amino fusions with ORFs in all cloning sites. There are no stop codons (in the attL1 readingframe) upstream of the ccdB gene.

• Enable carboxy fusions with ORFs positioned in phase with the reading frame convention for C-terminal fusions, indicated in Figure 23.

2.9 GATEWAY Nomenclature

For subclones, the following naming convention has been adopted: the name of the vector is placed first,followed by the name of the transferred gene.

Plasmid Type Descriptive Name Individual Vector or Clone Names

attL Vector Entry Vectors pENTR1,2,... (nos. 1-99)

attL subclone Entry Clones pENTR3-gus, .. ; pENTR201-gus

(where the number 3 refers to the Entry Vector and201 refers to the Donor Vector used to make the Entrysubclone; gus is the subcloned gene)

attR Vector Destination Vectors pDEST1,2,3,...

attB Vector Expression Vectors pEXP501, 502,… (nos. 501-599). These vectors areused to prepare Expression cDNA libraries.

attB subclone Expression Clones pEXP3-cat, ... [where 3 refers to the DestinationVector (pDEST3) used to make the expressionsubclone and cat is the subcloned gene]

attP Vector Donor Vectors pDONR™201

Other Names:

Name Reacting Sites Catalyzed by Desired Product Structure ofDesired Product

LR Reaction attL x attR LR CLONASE

Enzyme MixExpression Clone attB1-gene-attB2

BP Reaction attB x attP BP CLONASE

Enzyme MixEntry Clone attL1-gene-attL2

Examples:

• An LR Reaction:pENTR201-tet x pDEST10 Æ pEXP10-tet

• Two BP Reactions:attB-p53 PCR product x pDONR205 Æ pENTR205-p53

pEXP14-lacZ x pDONR201 Æ pENTR201-lacZ


18

3. Methods

3.1 General Comments

See www.lifetech.com/gateway for current information on additions/modifications to the protocols andan increasing selection of GATEWAY-compatible vectors and libraries.

Purification of DNA: When preparing plasmid DNAs for use in the GATEWAY System reactions, DNApurified by CONCERT™ Rapid Plasmid Systems is recommended. Miniprep DNA prepared by standardalkaline lysis protocols, with or without RNase treatment, can be used as well. During alkaline lysistreatment, we recommend a final concentration of NaOH no higher than 0.125 M, to minimizeirreversible denaturation of the supercoiled plasmid DNA.

DNA Topology: For LR reactions, the most efficient substrates are supercoiled, relaxed, or linear EntryVectors (attL) and relaxed or linear Destination Vectors (attR). Reactions in which the DestinationVector is supercoiled give five to ten-fold fewer colonies.

For BP Reactions, the attB vectors should be linear (PCR products or Expression Clones linearized byrestriction endonucleases), while the attP-containing pDONR Vector must be supercoiled. ExpressionClones (attB) can be used as supercoiled or relaxed (i.e., with Topoisomerase I) molecules, but will reactless efficiently than linearized Expression Clones.

Linearized Destination Vector can be obtained by cleaving at a restriction site within the region of theGATEWAY Cassette, taking care to avoid the ccdB gene. All Destination Vectors from Life Technologiesare provided already linearized in this manner.

When suitable single-cut restriction sites are unavailable or unknown, as with complex mixtures ofplasmids or cDNA libraries, the DNA may be relaxed by brief treatment with Topoisomerase I.

Primers: Primers for attB PCR should have 18-25 bases of gene-specific sequence and 29 bases attBsequence (includes four Gs). Generally, 50 nmol of standard purity oligos are adequate for mostapplications. Oligos should be dissolved to a concentration of 20-50 µM and the concentration verifiedby spectrophotometry. For cloning of large PCR products (>5 kb), colony output can be increased ifoligos (>65 bases) are further purified (i.e., HPLC or PAGE).

Incubation time: In the following protocols we recommend incubating the GATEWAY reactions for60 min at 25°C. This will generally give sufficient colonies when transforming E. coli competent at 108

CFU/µg or higher, virtually all of which should contain the correct subclone. In some circumstances,however, you may wish to convert a higher percentage of starting plasmid carrying your gene to product.This can be achieved by incubating for longer periods, such as for 4-6 h, or overnight. An overnightincubation often gives five-fold or more product than a one-hour incubation.

Longer incubation times are recommended for LR and BP Reactions involving large plasmids (≥10 kb),for BP Cloning of large PCR products (≥5 kb), and for transfer of diverse populations of genes, such ascDNA libraries.


19

3.2 Creating an Entry Clone

Entry clones can be created in one of four ways: 1) Cloning into Entry Vectors with restrictionendonucleases and ligase, 2) cloning cDNA libraries into Entry Vectors using restriction endonucleasesand ligase, 3) transferring genes from Expression Clones into Entry Vectors via the BP Reaction, or 4)cloning attB-PCR products via the BP Reaction.

Restriction endonuclease fragments or PCR products can be cloned into an Entry vector. The PCRfragment will be either cloned as a blunt-end fragment or require digestion with restriction endonucleases(e.g., at sites incorporated into the primer).

All the Entry Vectors contain the ccdB gene as a stuffer between the “left” and “right” restriction sites.The advantage of this arrangement is that there is virtually no background from vector that has not beendigested with both restriction endonucleases, because the presence of the ccdB gene will inhibit thegrowth of all standard E. coli strains. Thus, it is necessary to cut each Entry Vector twice in order toremove the ccdB gene fragment during cloning.

It is strongly recommended that after digestion of the Entry Vector with the second restrictionendonuclease, the reaction be treated with phosphatase (calf intestine alkaline phosphatase, CIAP orthermosensitive alkaline phosphatase, TSAP). The phosphatase can be added directly to the reactionmixture, incubated for an additional time, and inactivated. This step dephosphorylates both the vectorand ccdB fragments, so that during subsequent ligation there is less competition between the ccdBfragment and the DNA of interest for the termini of the Entry Vector.

3.2.1 Cloning Genes into Entry Vectors using Restriction Endonucleases and Ligase

A. Cloning of a Restriction Endonuclease DNA Fragment:

1. Prepare Entry Vector and the DNA fragment to be cloned by digesting 0.5-1.0 µg DNA with theselected restriction endonucleases under the appropriate conditions.

2. De-phosphorylate the Entry Vector DNA.3. DNA fragments to be cloned can be purified by agarose gel electrophoresis and the fragments of

interest recovered from the gel using the CONCERT Matrix Gel Extraction System.4. Ligate the prepared Entry Vector and insert fragments under appropriate conditions.5. Transform into LIBRARY EFFICIENCY DH5α Competent Cells using standard conditions and plate

transformants on LB plates containing 50 µg/ml kanamycin.

B. Blunt Cloning of PCR products:

Prepare the Entry Vector so that the cloning ends are blunt. Digest Entry Vector with appropriaterestriction endonuclease as described in the previous section. If the restriction endonucleases are notblunt-cutters, make ends flush with either T4 DNA Polymerase or Klenow Fragment. Dephosphorylatethe Entry Vector.

Generally PCR products do not have 5′ phosphates (because the primers are usually 5′-OH), and they arenot necessarily blunt. (On this latter point, see Brownstein, M.J., Carpten, J.D., and Smith, J.R. (1996)Biotechniques 20, 1004 for a discussion of how the sequence of the primers affects the addition of single3′ bases.) The following protocol repairs these two defects.

1. In a 0.5-ml tube, ethanol-precipitate about 40 ng of PCR product (as judged from an agarose gel).


20

2. Dissolve the precipitated DNA in 10 µl comprising 1 µl 10 mM rATP, 1 µl mixed 2 mM dNTPs (i.e.,2 mM each dATP, dCTP, dTTP, and dGTP), 2 µl 5X T4 Forward Reaction Buffer (350 mMTris-HCl (pH 7.6), 50 mM MgCl2, 500 mM KCl, 5 mM 2-mercaptoethanol), 10 units T4polynucleotide kinase, 1 µl T4 DNA polymerase, and water to 10 µl.

3. Incubate the tube at 37°C for 10 min, then at 65°C for 15 min, cool, centrifuge briefly to bring anycondensate to the tip of the tube.

4. Add 5 µl of 30% PEG 8000/30 mM MgCl2, mix and centrifuge at room temperature for 10 min.Carefully remove and discard supernatant.

5. Dissolve the invisible precipitate in 10 µl containing 2 µl 5X T4 DNA ligase buffer, 0.5 units T4DNA ligase, and about 50 ng of blunt, dephosphorylated Entry Vector.

6. Incubate at 25°C for 1 h, then at 65°C for 10 min.7. Add 40 µl TE, transform 2 µl into 100 µl of of LIBRARY EFFICIENCY DH5α Competent Cells

following the suggested protocol. [TE is 10 mM Tris-HCl (pH 7.5), 1 mM EDTA.]8. Plate on LB plates containing 50 µg/ml kanamycin.9. Isolate miniprep DNA from single colonies (Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989)

Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press,Cold Spring Harbor, New York). Treat the miniprep with RNase A and store in TE. Cut with theappropriate restriction endonuclease to determine the orientation of the PCR fragment. Chooseclones with the attL1 site next to the amino end of the open reading frame.

Note: In the above protocol, the ends of the PCR product are simultaneously polished (through the exoand polymerase activities of T4 DNA polymerase) and the 5' ends phosphorylated (using T4polynucleotide kinase). It is necessary to inactivate the kinase, so that the blunt, dephosphorylated vectorcannot self-ligate. The PEG precipitation removes all small molecules (primers, nucleotides), and canimprove the colony output of cloned PCR product by 50-fold.

C. Cloning PCR Products Digested with Restriction Endonucleases:

The Entry Vector is prepared as described in Section A or B above.

Efficient cloning of PCR products that have been digested with restriction endonucleases includes threesteps: inactivation of Taq DNA polymerase, efficient restriction endonuclease cutting, and removal ofsmall DNA fragments.

Inactivation of Taq DNA Polymerase: Carryover of Taq DNA polymerase and dNTPs into a restrictionendonuclease digestion significantly reduces the success in cloning a PCR product [Fox, D., Nathan, M.,Natarajan, P., Bracete, A., and Mertz, L. (1998) FOCUS

® 20, 15], because Taq DNA polymerase can fillin sticky ends and add bases to blunt ends. Either TAQUENCH™ PCR Cloning Enhancer or extractionwith phenol can be used to inactivate the Taq DNA polymerase.

Option A: Inactivation with TAQUENCH PCR Cloning Enhancer

A1. Add 2 µl TAQUENCH PCR Cloning Enhancer.

A2. Perform restriction digest, using 10 to 50 units of restriction endonuclease and standard protocols,and incubate for at least 1 h.

A3. Dilute reaction four-fold with TE.


21

A4. Add 1/2 volume of 30% PEG 8000/30 mM MgCl2. Mix well and immediately centrifuge at roomtemperature for 10 min. Discard the supernatant (pellet is usually invisible), centrifuge again for afew seconds, and discard any remaining supernatant.

A5. Dissolve the DNA in a suitable volume of TE (depending on the amount of PCR product in theoriginal amplification reaction) and apply an aliquot to an agarose gel to confirm recovery. Applyto the same gel 20-100 ng of the appropriate Entry Vector that will be used for the cloning.

Option B: Extraction with Phenol

B1. Dilute the PCR reaction to 200 µl with TE. Add an equal volume of phenol:chloroform:isoamylalcohol, vortex vigorously for 20 s, and centrifuge for 1 min at room temperature. Discard thelower phase.

B2. Extract the phenol from the DNA and concentrate as follows: Add an equal volume of 2-butanol(colored red with “Oil Red O” from Aldrich, if desired), vortex briefly, centrifuge briefly at roomtemperature. Discard the upper butanol phase. Repeat the extraction with 2-butanol. This time thevolume of the lower aqueous phase should decrease significantly. Discard the upper 2-butanolphase.

B3. Ethanol-precipitate the DNA from the aqueous phase of the above extractions. Dissolve in 200 µlof a suitable restriction endonuclease buffer. Then digest with the appropriate restrictionendonuclease, followed by inactivation of the restriction endonuclease, and ligation of the DNA tothe Entry Vector.

Efficient Restriction Endonuclease Cutting: Extra bases on the 5′-end of each PCR primer help therestriction endonucleases cut near ends of PCR products. With the availability of inexpensive primers,adding six to nine bases on the 5′ sides of the restriction sites is a good investment to ensure that most ofthe ends are digested. Incubation of the DNA with a five-fold excess of restriction endonuclease for anhour or more helps ensure success.

Removal of Small Molecules before Ligation: Primers, nucleotides, primer-dimers, and small fragmentsproduced by the restriction endonuclease digestion, can all inhibit or compete with the desired ligation ofthe PCR product to the cloning vector. This protocol uses PEG precipitation to remove small molecules.

1. Add 150 µl of TE to 50 µl PCR reaction2. Add 100 µl 30% PEG 8000/30 mM MgCl2. Mix well and centrifuge immediately at 10,000 × g for

10 min at room temperature. Remove the supernatant (pellet is clear and nearly invisible)3. Dissolve the pellet in 50 µl TE and check recovery on a gel.

3.2.2 Cloning cDNA Libraries into Entry Vectors using Restriction Endonucleases and Ligase

The cDNA library can be constructed using standard methodology such as the SUPERSCRIPT™ PlasmidSystem for cDNA Synthesis and Plasmid Cloning with an oligo(dT) primer adapter containing a Not Isite for first strand synthesis and ligation of Sal I adapters after second strand synthesis. The EntryVector is digested with Sal I and Not I which removes the ccdB gene and the cDNA library is ligated intothe vector. The Sal I-Not I sites in the Entry vectors are oriented so that the 5'-end of the cDNA (Sal Iend) is closest to the attL1 site.


22

3.2.3 Transferring DNA from an Expression Clone into an Entry Vector via the BP Reaction

The BP Reaction converts an Expression Clone to an Entry Clone. This reaction is useful whentransferring a gene present in an attB Expression Clone into other expression vectors. After convertingthe gene into an attL Entry Clone, via the BP Reaction, the gene can be subcloned into new expressionvectors by performing an LR Reaction, thereby obtaining new attB Expression Clones.

An Expression Clone has the gene of interest flanked by attB sites. Expression Clones (attB) can be usedas supercoiled or relaxed (i.e., nicked or treated with Topoisomerase I) molecules, but will react mostefficiently when linearized. To linearize Expression Clones, the Expression Vector must cut outside theattB region.

1. Digest 1-2 µg of the Expression Clone with a unique restriction endonuclease that does not cut withinthe gene of interest.

2. Ethanol-precipitate the DNA after digestion and dissolve DNA in TE.

The most common cause of an unsuccessful BP Cloning Reaction is failure to plate thereaction transformations on plates containing kanamycin.

Materials needed:• BP Reaction Buffer• attB Expression Clone DNA, ≥10 ng/µl, in TE• pEXP7-tet Positive Control, linearized with Sca I, 50 ng/µl. The tetR insert is 1.4 kb, and includes

its own promoter.• pDONR201 Vector, 150 ng/µl, supercoiled• BP CLONASE Enzyme Mix (stored at -70°C)• Proteinase K Solution• pUC19 DNA, 10 pg/µl• LIBRARY EFFICIENCY DH5α Competent Cells (≥1 × 108 CFU/µg)• S.O.C Medium for culturing transformations• LB plates containing 50 µg/ml kanamycin


23

NegativeControl

PositiveControl

Test

Component Tube 1 Tube 2 Tube 3

pEXP7-tet Positive Control, 50 ng/µl - 2 µl -

attB Expression Clone DNA, linearized, ≥10 ng/µl - - 1 - 10 µl

pDONR201 Vector, 150 ng/µl 2 µl 2 µl 2 µl

BP Reaction Buffer 4 µl 4 µl 4 µl

TE 10 µl 8 µl To 16 µl

BP CLONASE Enzyme Mix (store at -70°C, addlast)

4 µl 4 µl 4 µl

Total Volume 20 µl 20 µl 20 µl

Procedure:1. Compose the reactions on ice.2. Add TE, BP Reaction Buffer, Donor Vector, and attB DNAs, and mix well.3. Remove the BP CLONASE Enzyme Mix from the -70°C freezer and allow to thaw on ice (~2 min).4. Vortex BP CLONASE Enzyme Mix briefly (2 s) twice.5. Add 4 µl of BP CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return vial to -70°C

freezer.6. Incubate tubes at 25°C for 60 min.7. Add 2 µl Proteinase K Solution. Incubate for 10 min at 37°C.8. Transform 1 µl of BP Reaction into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells using

Falcon® 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42°C for 30 s. Place on icefor 1-2 min. Add 450 µl S.O.C. Medium and incubate at 37°C for 1 h.

9. Spread 10 µl and 100 µl on LB plates containing 50 µg/ml kanamycin. (If the E. coli cells have atransformation efficiency of 108 CFU/µg, the BP Reaction should give about 3,000 colonies if theentire transformation is plated.)

10. Also transform 2 µl of pUC19 DNA into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells, asabove. Plate 10 µl and 100 µl on LB plates containing 100 µg/ml ampicillin . (Cells with atranformation efficiency of 108 CFU/µg should yield about 2,000 colonies if the entire transformationis plated.)

3.2.4 Cloning of attB-PCR Products via the BP Reaction

Addition of 5′-terminal attB sequences to PCR primers allows synthesis of a PCR product that is anefficient substrate for recombination with a Donor Vector in the presence of BP CLONASE Enzyme Mix.This reaction produces an Entry Clone of the PCR product (See Figure 10).


24

A. Preparation of attB-PCR Products:

The attB1 and attB2 primer sequences are given in Figure 13. The four guanine (G) residues at the5′ end of these primers are required to make the minimal 25-bp attB sequences an efficient GATEWAY

Cloning System substrate.

For generating N-fusion proteins the attB1 site must maintain the reading frame register shown above. Inthis reading frame, the six As of the attB1 sequence are read as -AAA - AAA- , and translated into -Lys-Lys-. Because all of the N-terminal fusion Destination Vectors available from Life Technologies adhereto this convention, all subclones into these Destination Vectors will automatically align the reading frameof the N-terminal coding sequence in phase with the correct reading frame of your gene.

Likewise, to join the PCR product in the correct reading frame with a C-terminal fusion DestinationVector, the C-terminal coding sequences of these vectors must be aligned in phase with the -TTT-GTA-sequence of the attB2 primer sequence, shown above. This means that the complementary strand, whichis the sense strand, will be read as -TAC-AAA-, translating into Tyr-Lys- (See Figure 15). For thispurpose, any in-phase termination codons present between the coding region of the PCR sequence andthe attB2 region will also need to be eliminated.

Note that it is possible to install a protease cleavage sequence, such as that for the highly specific TEVProtease, to permit the removal of N-terminal or C-terminal peptides from the fusion proteins. To dothis, you will need to include such a sequence between the gene-specific portion and the attB portion ofyour PCR primers. As a result, the cleavage sequence will reside between the att sequence and the genesequence, and consequently will always transfer together with the cDNA into various DestinationVectors. For examples of attB-PCR primer sequences used to construct native and fusion proteinexpression clones for use in different cellular contexts, refer to Section 2.7.3.)

Standard PCR conditions and polymerases may be used to prepare the attB-PCR product. Likewise,genomic DNA, mRNA, cDNA libraries, and cloned DNA sequences have all been used successfully assubstrates for amplification with attB-containing primers. The suggested polymerase for amplification ofPCR products <5-6 kb is PLATINUM

® Pfx DNA Polymerase due to its high fidelity, robustness and

Figure 13. attB Sequences to Add to Primers for PCR Cloning into an Entry Vector

attB1: 5′-GGGG -ACA-AGT-TTG -TAC-AAA-AAA -GCA-GGC-TNN--(template-specific sequence)-3′

attB2: 5′-GGGG -AC -CAC- TTT- GTA- CAA-GAA-AGC-TGG- GTN--(template-specific sequence)-3′

Add the attB1 sequence to the amino (forward) primer and the attB2 sequence to the carboxy (reverse)primer.

Note: These GATEWAY attB1 and attB2 modifications to primers are available from Life Technologies.

Note: The attB1 primer ends with a single thymidine (T), which requires the donation of two additionalnucleotides from the remainder of the primer sequence to maintain proper reading frame. These twonucleotides cannot be AA, AG, or GA, because these additions would create a termination codon.Similarly, for C-terminal fusions, the attB2 primer requires one nucleotide from the rest of the primer tomaintain the proper reading frame into the attB2 region.


25

automatic "hot start" capabilities. For templates >5-6 kb, or those unsuccessfully amplified by the Pfxpolymerase, PLATINUM Taq DNA Polymerase High Fidelity is recommended. Appropriate buffers andconditions for amplification that are provided with each polymerase should be utilized.

Following the PCR reaction, apply 1-2 µl to an agarose gel, together with size standards (1 Kb PLUS

DNA LADDER™) and appropriate quantitation standards (Low DNA MASS™ Ladder or Low DNAMASS Ladder), to assess the yield and uniformity of the product.

If the starting PCR template is a plasmid that contains the gene for Knr, it is advisable to treat thecompleted PCR reaction with the restriction endonuclease Dpn I to degrade the plasmid. Suchplasmid is a potential source of false-positive colonies from the transformation of the GATEWAY

Cloning System reaction. Adding 5 µl of 10X REACT® 4 Buffer plus ~5 units of Dpn I to the

completed PCR reaction and incubating for 15 min at 37°C will eliminate this potential problem.Heat-inactivate the Dpn I at 65°C for 15 min before doing the PEG/MgCl2 purification, describedbelow, or before using the PCR product in the GATEWAY Cloning System reaction.

Purification of the PCR product is recommended to remove attB primer-dimers which can cloneefficiently into the Entry Vector. The following protocol is fast and will remove DNA <300 bp in size:

1. Add 150 µl of TE to 50 µl PCR reaction.2. Add 100 µl 30% PEG 8000/30 mM MgCl2. Mix well and centrifuge immediately at 10,000 × g for

15 min at room temperature. Remove the supernatant (pellet is clear and nearly invisible).3. Dissolve the pellet in 50 µl TE and check recovery on a gel.

Longer centrifugation times and faster centrifugation speeds will increase the amount of PCR productrecovered from the PEG precipitation.

Note: Standard PCR product clean-up protocols don't efficiently remove large primer-dimer productsand are therefore not recommended for cleaning up attB-PCR products.

The conditions of the BP PCR Cloning reaction with an attB PCR substrate are similar to those of the BPReaction (Section 3.2.3), except that the attB-PCR product substitutes for the Expression Clone. B. The BP Reaction with attB-PCR Products:

Materials needed: • The PCR product with terminal attB1 and attB2 sequences(>10 ng/µl)

In general, increasing the amount of PCR product results in proportionately more colonies (do notexceed ~500 ng/20 µl reaction). As a starting point, use 40-100 fmol of PCR product/20 µl reaction(where a 1-kb PCR product is ~0.65 ng/fmol).

Note: For PCR products >4 kb, the number of colonies obtained per fmol of PCR DNA addeddecreases with increasing size. Thus for larger PCR products we recommend increasing the amountof DNA to at least 100 fmol of PCR product per 20-µl reaction, and using incubations longer thanone hour, such as 6 h or overnight.

• BP Reaction Buffer• Donor Vector, pDONR201, 150 ng/µl, supercoiled.• pEXP7-tet Positive Control (linearized with Sca I), 50 ng/µl. The tetR insert is 1.4 kb, and includes

its own promoter.


26

• BP CLONASE Enzyme Mix (stored at -70°C)• Proteinase K Solution• pUC19 DNA, 10 pg/µl (for transformation control)• LIBRARY EFFICIENCY DH5α Competent Cells (≥1 × 108 CFU/µg)• S.O.C. Medium for culturing transformations• LB plates containing 100 µg/ml ampicillin• LB plates containing 50 µg/ml kanamycin

The most common cause of an unsuccessful BP Cloning Reaction is failure to plate thereaction transformations on plates containing kanamycin.

Tube 1 Tube 2 Tube 3

Component NegativeControl

PositiveControl

Test

BP Reaction Buffer 4 µl 4 µl 4 µl

attB-PCR product, ≥10 ng/µl - - 1-8 µl

pEXP7-tet, Positive Control, 50 ng/µl - 2 µl

pDONR201, Donor Vector, 150 ng/µl 2 µl 2 µl 2 µl

TE 10 µl 8 µl To 16 µl

BP CLONASE Enzyme Mix 4 µl 4 µl 4 µl


Procedure:1. Compose reactions on ice.2. Add TE, BP Reaction Buffer, Donor Vector, and appropriate attB-PCR DNA, and mix well.3. Remove BP CLONASE Enzyme Mix and thaw on ice (~2 min).4. Vortex BP CLONASE Enzyme Mix briefly (2 s) twice.5. Add 4 µl of BP CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return vial to

-70°C.6. Incubate at 25°C for 60 min.7. Add 2 µl Proteinase K Solution to all reactions. Incubate for 10 min at 37°C.8. Transform 1 µl of BP Reaction into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells using

Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42°C for 30 s. Place on icefor 1-2 min. Add 450 µl S.O.C. Medium and incubate at 37°C for 1 h.

9. Select on LB plates containing 50 µg/ml kanamycin. (If the E. coli cells have a transformationefficiency of 108 CFU/µg, the BP Reaction should give about 3,000 colonies if the entiretransformation is plated.)

10. Also transform 2 µl of pUC19 DNA into 50 µl of LIBRARY EFFICIENCY DH5α Competent Cells, asabove. Spread 10 µl and 100 µl on LB plates containing 100 µg/ml ampicillin . (Cells with atranformation efficiency of 108 CFU/µg should yield about 2,000 colonies if the entire transformationis plated.)

11. If desired, the percent correct clones in the positive control reaction can be confirmed by streakingthe kanamycin-resistant colonies onto LB plates containing 20 µg/ml tetracycline.


27

Alternatively, electroporation can be used to transform 1-2 µl of the BP Reaction, followingaddition of the Proteinase K Solution, directly into 25-40 µl electocompetent E. coli.

3.3 Creating Expression Clones (Transferring Genes from Entry Clones into DestinationVectors via the LR Reaction)

The reaction of an Entry Clone (attL) with a Destination Vector (attR) creates a new Expression Clone(attB).

Materials needed:• LR Reaction Buffer• Destination Vector (linearized) ~150 ng/µl. Destination Vectors from Life Technologies are provided

linearized and at a concentration of 150 ng/µl. For preparation and use of Destination Vector DNA,see Section 5. Use approximately 300 ng per 20-µl reaction.

• Entry Clone (≥30 ng/µl). Use 100-300 ng of Entry Clone per 20-µl reaction.• pENTR-gus Positive Control at 50 ng/µl. The coding sequence of gus has been cloned with

translational start and stop signals permitting expression in E. coli, as well as in eukaryotic cells.• LR CLONASE Enzyme Mix (stored at -70°C)• Proteinase K Solution• pUC19 DNA, 10 pg/µl• LIBRARY EFFICIENCY DH5α (≥1 × 108 CFU/µg) or BL21-SI Competent Cells (≥1 × 107 CFU/µg)• S.O.C. Medium• LB Plates containing 100 µg/ml ampicillin.

Tube 1 Tube 2 Tube 3

Component Neg. Control Pos. Control YourClone

LR Reaction Buffer 4 µl 4 µl 4 µl

pENTR-gus, 50 ng/µl - 2 µl -

Entry Clone (100-300 ng/20-µlreaction)

- - 1-11 µl

Destination Vector for your gene,(~300 ng/20-µl reaction)

1-11 µl 1-11 µl 1-11 µl

TE To 16 µl To 16 µl To 16 µl

LR CLONASE Enzyme Mix 4 µl 4 µl 4 µl


Procedure:1. Assemble reactions on ice.2. Add TE, LR Reaction Buffer, and the appropriate Entry Clone and Destination Vector DNAs. Mix

well.3. Remove LR CLONASE Enzyme Mix from the -70°C freezer, and thaw on ice (~2 min).


28

4. Vortex LR CLONASE Enzyme Mix briefly (2 s) twice.5. Add 4 µl of LR CLONASE Enzyme Mix and mix well by vortexing briefly twice.6. Return LR CLONASE Enzyme Mix to -70°C freezer.7. Incubate tubes at 25°C for 60 min.8. Add 2 µl of Proteinase K Solution to all reactions. Incubate for 10 min at 37°C.9. Transform 1 µl into 50 µl LIBRARY EFFICIENCY DH5α or BL21-SI Competent Cells using Falcon

2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42°C for 30 s. Add 450 µl S.O.C.Medium and incubate at 37°C for 1 h. (If the E. coli cells have a transformation efficiency of108 CFU/µg, the LR Reaction should give about 8,500 colonies if the entire transformation is plated.)

10. Plate 20 µl and 100 µl on LB plates containing 100 µg/ml ampicillin .11. Also transform 2 µl of pUC19 DNA into 50 µl of LIBRARY EFFICIENCY DH5α or BL21-SI

Competent Cells, as above. Spread 10 µl and 100 µl on LB plates containing 100 µg/ml ampicillin .(Cells with a tranformation efficiency of 108 CFU/µg should yield about 2,000 colonies if the entiretransformation is plated.)

Alternatively, electroporation can be used to transform 1-2 µl of the LR Reaction, followingaddition of the Proteinase K Solution, directly into 25-40 µl electrocompetent E. coli.


29

4. Troubleshooting

Problem Possible Cause Suggested Solution

LR Reaction:

Few or no coloniesobtained from reaction;expected numbers ofpUC19 control coloniesobtained

Transformation plated on LBplates with incorrect antibiotic

Plate the reaction transformations on LB ampplates (required for reactions using all but a fewtypes of Destination Vectors).

Reaction not treated withProteinase K

Repeat reaction using Proteinase K Solution.

Used attB and/or attP DNAinstead of attL and attR DNAs

Repeat reactions using Entry Clone (attL) andDestination Vector (attR).

Destination Vector not linearized Linearize within the attR Cassette, avoiding theccdB gene.

LR CLONASE Enzyme Mix isinactive

Test another aliquot or lot of LR CLONASE EnzymeMix.

Check that LR CLONASE Enzyme Mix is beingstored at -70°C.

Prepare small aliquots of LR CLONASE EnzymeMix that will each be refrozen and opened no morethan ten times to minimize loss of activity.

Few or no coloniesobtained either from LRReaction or pUC19control

Used BP CLONASE Enzyme Mixinstead of LR CLONASE EnzymeMix, transformation procedureperformed incorrectly, orcompetent cells have lostefficiency or are dead

Test transformation using pUC19 DNA andcompetent cells known to be active. Verify thatcompetent cells are stored at -70°C.

Dilutions were performedincorrectly

Repeat transformation paying special attention todilution steps.

Two distinct types ofcolonies appear, largeand small

Unreacted Entry Clone plasmid(co-transformed with ExpressionClone) occasionally gives rise tocolonies that grow slowly on LBamp plates. When these smallcolonies are restreaked onto LBkan (50-100 µg/ml) and LB amp(100 µg/ml) plates, they oftenwill grow only on the LB kanplates.

Reduce the amount of Entry Clone from 300 ng to100 ng per 20-µl reaction. Also reduce the volumeof sample used for transformation from 2 µl to 1 µl.

Increase the concentration of ampicillin in the LBamp plates to 300 µg/ml.

Plasmids carrying large genesand/or genes toxic to E. coli maybe deleted during culture, leadingto two populations of colonies.Generally the larger coloniescontain the deleted plasmids.

Incubate plates at 30°C instead of at 37°C.

Confirm whether deletion is occurring by analyzingthe DNA present in cultures derived from thecolonies.


30


Tiny colonies appearafter incubating the LBamp plates for more than24 h

Unreacted Entry Clone plasmid

Plasmids carrying large or lethalgenes

Tiny satellite colonies appearingaround larger ampR colonies thatare releasing β-lactamase

See above.


High background inabsence of Entry Clone.

Contamination of one or moresolutions with another plasmidcarrying the same antibioticresistance marker, or by bacteriacarrying a resistance plasmid

Test for plasmid contamination by transformingwith aliquots of each of the separate solutions usedin the LR Reaction. Test for bacterialcontamination by plating an aliquot of eachsolution directly onto LB amp plates.

Some Destination Vectors havean inherently higher backgroundthan others, possibly due totendency to delete some or all ofthe ccdB gene

Prepare miniprep DNA from one or morebackground colonies. Unstable DestinationVectors often reveal multiple bands on agarosegels. If this is the case, try using a different vectorbackbone in your Destination Vector.

BP Reaction:

Few or no coloniesobtained using attBExpression Clone; attBpositive control andpUC19 transformationcontrol gave expectednumbers of colonies

Transformation of BP testreaction plated on LB plates withincorrect antibiotic

Plate the BP Reaction transformations on LB kanplates.



The attB Expression Clone issupercoiled, and thereforereacting less efficiently

Linearize the attB Expression Clone outside theattB sites with an appropriate restrictionendonuclease or relax with Topoisomerase I.

Linearized (attP) Donor Plasmid Repeat reactions using supercoiled Donor Plasmid.

Few or no coloniesobtained with either newattB plasmid or attBpositive control; pUC19transformation controlyielded expectednumbers of colonies.

BP CLONASE Enzyme Mix isinactive

Test another aliquot or lot of BP CLONASE EnzymeMix.

Check that BP CLONASE Enzyme Mix is beingstored at -70°C.

Prepare small aliquots of BP CLONASE EnzymeMix that will each be refrozen and opened no morethan 10 times, to minimize loss of activity.

Few or no coloniesobtained from either BPReaction or pUC19control

Transformation procedureperformed incorrectly, orcompetent cells have lostefficiency or are dead

Test transformation using pUC19 DNA andcompetent cells known to be active. Verify thatcompetent cells are stored at –80°C.


31


BP Reaction or attB-PCR Cloning:

Two distinct types ofcolonies appear, largeand small

Plasmids carrying large genesand/or genes toxic to E. coli maybe deleted during culture, leadingto two populations of colonies.Generally the larger coloniescontain the deleted plasmids.Confirm whether deletion isoccurring by analyzing the DNApresent in cultures derived fromthe colonies.


Deletions or point mutations ofthe ccdB gene within the attPPlasmid can reduce the lethalityof ccdB, allowing E. coli togrow, although at lower rates. Inthis case, a negative controlreaction that omits the attB-containing DNA will give asimilar number of colonies.

Obtain a new sample of attP Plasmid.

Tiny colonies appearafter incubating the LBamp plates for more than24 h

Unreacted Entry Clone plasmidor plasmids carrying large orlethal genes

Tiny satellite colonies appearingaround larger ampR colonies thatare releasing β-lactamase

See above.


attB-PCR Cloning:

Few or no coloniesobtained from BP testreaction and attBpositive control; pUC19control gives expectednumber of colonies.

Transformation of BP Reactionplated on LB plates withincorrect antibiotic

Plate BP Reaction transformations on LB kanplates.

BP CLONASE Enzyme Mix isinactive

Test another aliquot or lot of BP CLONASE EnzymeMix.

Verify that BP CLONASE Enzyme Mix is beingstored at -70°C.

Few or no coloniesobtained from BPReaction with new attB-PCR product; attB-positive control andpUC19 control giveexpected number ofcolonies.

attB-PCR primers have a mistakein the attB1 or attB2 sequences,or lack 5'-terminal four Gs

Replace with correct attB-PCR primers.

Long (>70 nucleotides) attB-PCR primers shouldbe purified by PAGE, due to higher likelihood ofprimers with incomplete sequence and primers withadducts resulting from repeated deprotection.


32


Few or no coloniesobtained from either BPReaction or pUC19control.

Transformation procedureperformed incorrectly, orcompetent cells have lostefficiency


Test transformation using pUC19 DNA andcompetent cells known to be active. Verify thatcompetent cells are stored at -70°C.


Entry Clones appear tolack inserts, migrating as2.2 kb supercoiledplasmids

BP recombination reaction mayhave cloned primer-dimers

Confirm by either sequence analysis of Entry Cloneor by demonstrating that Entry Clone is active inLR Reaction in presence of LR Clonase andDestination Vector.

For PCR products >500 bp, purify by precipitatingwith one-half volume of 30% PEG 8000/30 mMMgCl2 Solution, excise the correct size DNAproduct band from an agarose gel, and use theeluted, purified DNA in BP Reaction.

Use PLATINUM Taq DNA Polymerase HighFidelity, or use "hot-start PCR".

Redesign primers to minimize potential mutualpriming sites leading to primer-dimers.

Low cloning efficiencyof attB- PCR products

AttB-PCR primers may contain ahigh percentage of incomplete orincorrect attB sites (most likelywith primers > 60 nucleotides inlength)

For problematic primers >60 nucleotides in length,purify by PAGE.

Alternatively, use nested primers, with the secondset of primers containing the 25-bp attB sites plus4 Gs at the 5'-terminus.

Very low cloningefficiency of large(>5 kb) attB PCRproducts

Too few PCR molecules addedto BP Reaction

Incubation time needs to beincreased for cloning large PCRproducts.

Adjust the amount (ng) of PCR product used to 40-80 fmol of PCR DNA per 20-µl reaction. (Forexample, for an 8 kb DNA, 1 fmol ~ 5 ng.)

Caution: >400 ng PCR DNA per 20-µl reactionmay inhibit the BP Reaction.

Increase incubation time to 6-18 h.

Low yield of PCRproduct from PEGprecipitation

PCR product not diluted with TEbefore addition of 30% PEG8000/30 mM MgCl2 Solution

Centrifugation step too short orcentrifugation speed too low

Loss of PEG pellet

Dilute with 150 µl TE before adding 30% PEG8000/30 mM MgCl2 Solution.

Increase time and speed of the centrifugation step.

Take care when removing the tube from themicrocentrifuge and keep track of the orientation ofthe outer edge of the tube where the pellet islocated.


33


Preparing Entry Clones with Restriction Endonucleases and Ligase:

Few or no kanR coloniesobtained; pUC19positive control gaveexpected number ofcolonies.

ccdB Cassette still present withinEntry Vector

Excise with appropriate restriction endonuclease(s).

Ligation did not work Include ligation positive control linearized plasmid,with and without ligase.

Protein Synthesis using attB Expression Clones:

No native protein bandof expected MW visibleon SDS-PAGE

Protein is being degraded byendogenous proteases

Use lon- strains of E. coli.


Compare expression using different N-terminaland/or C-terminal fusion tags, and in other types ofhost cells, such as yeast, insect, or mammaliancells.

Protein contains secondarymodifications that increaseapparent MW

Compare expression in other types of host cells,such as yeast, insect, or mammalian cells.

No fusion protein bandof expected MW visibleon SDS-PAGE

Incorrect reading frame of EntryClone

Verify that attB PCR primers were designed withgene in correct reading frame.

Verify that Entry Clone was constructed with genein correct reading frame.

Verify that Destination Vector was constructedwith correct reading frame.

Proteins of MW>100 kDa mayexpress poorly or as partiallydegraded protein in manylaboratory strains of E. coli.

Perform transformation using BL21-SI CompetentCells.


34

5. Additional Information

5.1 Converting a Vector into a GATEWAY Destination Vector

Destination Vectors function in the GATEWAY Cloning System because they have two recombinationsites, attR1 and attR2, flanking a chloramphenicol resistance (CmR) gene and a ccdB gene. TheGATEWAY Cloning System recombination reactions exchange the entire Cassette (except for the fewbases that contribute to the attB sites) for the DNA segment of interest from the Entry Vector. BecauseattR1, CmR, ccdB gene, and attR2 are contiguous, they can be moved on a single DNA segment. If thiscassette is cloned into a plasmid, the plasmid becomes a Destination Vector. Figure 14 shows aschematic of the three GATEWAY Cloning System Reading Frame Cassettes. Three cassettes are availableto allow construction of Destination Vectors in any reading frame.

Mlu I (reading frame A, 897)Bgl II (reading frame B, 898)

Xba I (reading frame C, 1040)

attR1 Cmr ccdB attR2

0 a = 1.7 kbb = 1.7 kbc = 1.8 kb

Not IPvu II

EcoR INco I

Sca IBssH I

AlwN ISma I Sal ISfc I

Figure 14. Schematic of the GATEWAY Cloning System Reading Frame Cassettes. Threeblunt-end cassettes are available to convert standard expression vectors into Destination Vectors.Each cassette contains an attR1 site at the 5'-end followed by the chloramphenicol resistance gene(Cmr) and ccdB gene. The attR2 site is at the 3'- end of the cassette. Each of the cassettesprovides N-terminal and C-terminal fusions in one of three possible reading frames. The uniquerestriction sites listed above the line (Mlu I, Bgl II, and Xba I) distinguish the reading framecassettes. Restriction endonucleases common to all the cassettes are presented in Table 3.


35

Table 3. Location of Cleavage Sites for a Selection of Restriction Endonucleases.

Restriction Endonuclease Cleavage Site

DNA Not I Pvu II EcoR I Nco I Sca I BssH II AlwN I Sma I Sfc I Sal I

Rfa 129 348 450 751 865 944 1224 1319 1572 1578

Rfb 130 349 451 752 866 945 1225 1320 1573 1579

Rfc 131 491 593 894 100 1087 1367 1462 1715 1721

The protocol for constructing a Destination Vector is presented below. Keep in mind the followingpoints:

• Destination Vectors must be constructed and propagated in a gyrA462 strain of E. coli, such asLIBRARY EFFICIENCY DB3.1 Competent Cells, available from Life Technologies, because the ccdBgene will be lethal to any other strain.

• If the Destination Vector will be used to make a fusion protein, a GATEWAY Cloning SystemReading Frame Cassette with the correct translation reading frame must be used, as discussed inSection 5.2. The nucleotide sequences at the ends of the cassettes are shown in Figure 15.

• Note that each reading frame cassette has a different unique restriction site between thechloramphenicol resistance and ccdB genes (Mlu I for reading frame A, Bgl II for reading frame B,and Xba I for reading frame C).

• Because the reading frame cassettes are blunt-ended, they will clone in both orientations.

Most standard vectors can be converted to Destination Vectors, by inserting the GATEWAY ReadingFrame Cassette into the multiple cloning site (MCS) of that vector. If you are converting a vector thatencodes kanamycin resistance, you will need to use the resulting Destination Vector with Entry Clonesthat carry a selection marker other than kanR. For this purpose, you can make your Entry Clone in a BPReaction using a Donor Vector with a marker other than kanR, such as tetR or genR (available byrequest).

5.2 Protocol for Making a Destination Vector

The following steps are required to construct a Destination Vector that will create N-terminal proteinfusions to genes in Entry Clones, via an LR Reaction.

1. If the vector will make an amino-terminal fusion protein, it is necessary to keep the -AAA-AAA-triplets in attR1 (see Figure 15) in phase with the translation reading frame of the fusion protein,since this is the reading frame convention employed in all of the N-terminal fusion DestinationVectors available from Life Technologies and in the construction of attB Expression Clones and attBPCR products.

Similar considerations are required to construct Destination Vectors that create C-terminal proteinfusions. The C-terminal coding sequences of these vectors should be aligned in phase with -TAC-AAA- of the attR2 sequences as shown in Figure 15.


36

Figure 15. Sequences at Ends of GATEWAY Reading Frame Cassettes. The terminalsequences of the attR1-Cmr-ccdB-attR2 cassettes are shown, including the terminal portionsof the flanking attR sites (boxed). The staggered cleavage sites for Int are indicated in theboxed regions. Following recombination with an Entry Clone, only the outer (unshaded)sequences in attR sites contribute to the resulting attB sites in the Expression Clone.

Figure 16. Examples of How to Choose the Correct GATEWAY Reading Frame Cassettefor N-Terminal Fusions.

N-Fusion protein codon Reading Frame Cassette A

--- NNN NNN ATC ACA AGT TTG TAC AAA AAA GCT ------ NNN NNN TAG TGT TCA AAC ATG TTT TTT CGA ---

attR 1

Reading Frame Cassette B

--- NNN NNN NNA TCA ACA AGT TTG TAC AAA AAA GCT ------ NNN NNN NNT AGT TGT TCA AAC ATG TTT TTT CGA ---

*cannot be TG or TA

Reading Frame Cassette C

--- NNN NNN NAT CAA ACA AGT TTG TAC AAA AAA GCT ------ NNN NNN NTA GTT TGT TCA AAC ATG TTT TTT CGA ---

*


37

2. Determine which GATEWAY Cloning System Reading Frame Cassette to use as follows:

—Write out the nucleotide sequence of the existing vector near the restriction site into which theGATEWAY Cloning System Reading Frame Cassette will be cloned. These must be written intriplets corresponding to the amino acid sequence of the fusion domain.

—Draw a vertical line through the sequence that corresponds to the restriction site end, after it hasbeen cut and made blunt, i.e., after filling in a protruding 5′-end or polishing a protruding 3′-end.

For N-terminal fusions:—If the coding sequence of the blunt end terminates after a complete codon triplet, use the Reading

Frame Cassette A. (See Figure 16)—If the coding sequence of the blunt end encodes two bases of a complete codon triplet, use the

Reading Frame Cassette B.—If the coding sequence of the blunt end encodes one base of a complete codon triplet, use the

Reading Frame Cassette C.For C-terminal fusions:—If the coding sequence of the blunt end terminates after a complete codon triplet, use the Reading

Frame Cassette B. (See Figure 16)—If the coding sequence of the blunt end encodes two bases of a complete codon triplet, use the

Reading Frame Cassette C.—If the coding sequence of the blunt end encodes one base of a complete codon triplet, use the

Reading Frame Cassette A.

For preparing a vector that encodes both an N- and C-terminal fusion, care must be taken whenchoosing appropriate restriction enzymes for cutting the vector. The resultant ends (after generatingblunt ends) need to be compatible with one of the three cassettes shown in Figure 16.

3. Cut one to five micrograms of the existing plasmid at the position where you wish your gene (flankedby att sites) to be after the recombination reactions. Note: It is better to remove as many of the MCSrestriction sites as possible at this step. This makes it more likely that restriction endonuclease siteswithin the GATEWAY Cloning System Reading Frame Cassette will be unique in the new plasmid,which is important for linearizing the Destination Vector (Section 5.3).

4. If necessary, convert the ends of the vector to flush double-stranded DNA, so that the vector iscompatible with the blunt ends of the cassette, using either T4 DNA Polymerase or Klenow Fragment(See protocol in Section 3.2.1B.)

5. Remove the 5′ phosphates with alkaline phosphatase. This increases the probability of success bydecreasing background associated with self-ligation of the vector.

6. Remove dNTPs and small DNA fragments by ethanol precipitation. Dissolve wet precipitate in

200 µl TE, add 100 µl of 30% PEG 8000/30 mM MgCl2, mix well, immediately centrifuge for10 min at room temperature, discard supernatant, centrifuge again a few seconds, discard anyresidual liquid.

7. Dissolve the DNA to a final concentration of 10 - 50 ng per microliter. Apply 20 - 100 ng to a gelnext to Low DNA MASS Ladder and linear size standards to confirm cutting and recovery.

8. In a 10-µl ligation reaction combine 10 - 50 ng vector, 10 - 20 ng of GATEWAY Cloning SystemReading Frame Cassette, and 1 unit T4 DNA ligase in ligase buffer. Incubate for 1 h at roomtemperature (or overnight at 16°C, whichever is most convenient). Transform 1 µl into 100 µl DB3.1


38

Competent Cells. (The ccdB gene on the GATEWAY Cloning System Reading Frame Cassette will belethal to any other strain.)

9. After expression in S.O.C. Medium, plate 10 µl, 100 µl, and remaining cells on agar platescontaining 30 µg/ml chloramphenicol; incubate at 37°C for 16-20 h.

10. Isolate miniprep DNA from single colonies (Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989)Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press,Cold Spring Harbor, New York). Treat the miniprep with RNase A and store in TE. Cut with theappropriate restriction endonuclease to determine the orientation of the cassette. Choose cloneswith the attR1 site next to the amino end of the protein expression function of the plasmid.

11. To demonstrate that the ccdB gene is functioning properly in a newly constructed Destination Vectorperform the following test.

—Transform equal amounts (10 - 50 pg) of Destination Vector into 100 µl of LIBRARY EFFICIENCY

DH5α and DB3.1 Competent Cells using the protocol provided with the cells. Plate dilutionsonto LB plates containing the appropriate antibiotic.

—As a control for transformation efficiency, transform pUC19 (50 pg) into both strains. Platedilutions onto LB plates containing 100 µg/ml ampicillin.

—Normalize the transformation efficiency of both strains to the pUC19 positive control using thefollowing calculation:

Transformation efficiency (CFU/µg) = colonies/pg of DNA × (1 × 106 pg/µg) × dilution factor(s)

For example, if 50 pg of pUC19 yields 100 colonies when 100 µl of a 1:10 dilution of thetransformation mix is plated, then:

CFU/µg = 100 CFU/50 pg × (1 × 106 pg/µg) × (1 ml/0.1 ml plated) × 10 = 2 × 108

—Calculate the number of colonies obtained in both strains from transformations using the

Destination Vector.—An acceptable Destination Vector transformed into the permissive strain LIBRARY EFFICIENCY

DB3.1 Competent Cells should give greater than 10,000 times the number of colonies that it willif transformed into LIBRARY EFFICIENCY DH5α Competent Cells. Any ratio less than 10,000suggests contamination of the plasmid prep with another ampicillin-resistant plasmid, or aninactive ccdB gene, or both. DNA with lower ratios can be used, but higher background will likelybe observed.

5.3 Using the Destination Vector in the GATEWAY Cloning System

About ten-fold more colonies result from a GATEWAY Cloning System reaction if the Destination Vectoris linear or relaxed. If the competent cells used are highly competent (>108 per microgram), linearizingor relaxing the Destination Vector is less essential.

The site or sites used for linearization must be within the GATEWAY Cloning System Reading FrameCassette, but not within the ccdB gene. A sampling of the sites that cut within a cassette is shown inFigure 14. The complete sequence is available on the website.

Mini-prep (alkaline lysis) DNA preparations are adequate for GATEWAY reactions; however, in general,such DNA can not be quantitated by UV absorbance due to contaminating RNA and nucleotides.


39

Concentrations can be estimated by gel electrophoresis in comparison with standard DNA, i.e., DNAMASS Ladder. Alternatively, DNA purified by CONCERT DNA purification systems is recommended.

5.4 "One-Tube" Protocol: A Protocol for Cloning attB-PCR Products Directly into DestinationVectors.

1. Perform the BP Reaction in 20 µl at 25°C as described in Section 3.2.4, except incubate for 3-4 h.

2. Following incubation add:

1 µl of 0.75 M NaCl3 µl of Destination Vector (150 ng/µl)6 µl of LR CLONASE Enzyme Mix

The final volume should be 30 µl.

3. Mix reaction. Immediatelyremove 5 µl of the mixture to aseparate tube and to this aliquotadd 0.5 µl of Proteinase KSolution. Incubate for 10 minat 37°C. Label as Tube A; placeon ice or store at -20°C. Thisaliquot will be used to recoverEntry Clones containing thecloned PCR product. Transform1 µl of this reaction into 50 µlof LIBRARY EFFICIENCY DH5αCompetent Cells using Falcon2059 tubes. Incubate on ice for30 min. Heat-shock the cells at42°C for 30 s. Add 450 µlS.O.C. Medium and incubate at37°C for 1 h. Plate 20 µl and100 µl on LB plates containing50 µg/ml kanamycin.

4. Incubate the remaining 25 µlmixture at 25°C for 1-2 h.

5. Add 2.5 µl of Proteinase KSolution. Incubate for 10 minat 37°C. Label as Tube B.

6. Transform 1 µl of thecompleted reaction into 50 µlLIBRARY EFFICIENCY DH5α or

BL21-SI Competent Cells using Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cellsat 42°C for 30 s. Add 450 µl S.O.C. Medium and incubate at 37°C for 1 h.

L2

Entry Clone

L1

Knr

Gene

Apr

B2

Expression Clone

B1Gene

R2

Destination Vector

R1

Apr

ccdB

B1 B2Gene

P2

pDONR

P1

Knr

+

BP Reaction

LR Reaction

Stop reaction andTransform

( )

Figure 17. One-Tube Protocol for Cloning PCR ProductsDirectly into Destination Vectors. PCR product made withattB oligonucleotides can be directly moved into anExpression Clone via a two-step reaction in one tube. Initiallythe BP Reaction transfers the attB-PCR product into an EntryClone. Subsequent addition of Destination Vector and LRCLONASE Enzyme Mix generates an Expression Clone via theLR Reaction. No purification of the intermediate Entry Cloneis required.


40

7. Plate 100 µl and 400 µl on LB plates containing 100 µg/ml ampicillin.

5.5 Transferring Clones from cDNA Libraries Made in GATEWAY Vectors

When working with a clone isolated from a cDNA library constructed in a GATEWAY vector, such asSUPERSCRIPT cDNA libraries supplied in pCMV•SPORT6 (which contains attB sites), severalconsiderations must be made before the cDNA clone can be used for protein expression. These includewhether the clone is full-length and how it is to be expressed, either as a native protein, an amino-terminal (N-terminal) fusion protein, or as a carboxy-terminal (C-terminal) fusion protein.

The following considerations must be kept in mind for expression of a native protein. Life Technologiessupplies many libraries containing full-length open reading frames. Some clones, however, may containonly a partial reading frame, or may contain not only the entire ORF but 5' untranslated (5' UTR)sequence as well. Contained within the 5' UTR of a cDNA is the ribosome recognition sequence for theorganism from which the cDNA was derived. Therefore, a full-length cDNA derived from mammaliancells can be used for native expression in mammalian cells without prior characterization but cannot beused for native expression in E. coli, as no Shine-Dalgarno sequence is present. When attempting toexpress a mammalian cDNA in E. coli, a Shine-Dalgarno sequence must be supplied. This can be doneeither by cloning the cDNA into an Entry Vector that contains a Shine-Dalgarno sequence, or byintroducing a Shine-Dalgarno sequence by PCR when amplifying the cDNA with primers also containingattB sequences and cloning the PCR product by recombination. (See Section 3.2.4 for cloning of PCRproducts).

The length and content of the clone is also important in expressing fusion proteins. If the cDNA is full-length then the 5' UTR will also be translated as a part of the fusion protein. This may present problemsas the additional codons may interfere with the expression or function of the protein. Additionally, the5' UTR may contain stop codons, which would prevent expression of the protein of interest. If the ORFis not full-length then a truncated portion of the protein of interest will be expressed within the fusion. Toexpress any cDNA isolated from a library as an N-terminal fusion protein, the reading frame of the genemust be in frame with the reading frame of the attB1 site (see Figure 13). In this case, there is onechance in three that the cDNA will be in frame with the attB1 site and therefore allow for fusion proteinexpression. A researcher can construct three Destination Vectors representing all three possible readingframes through the attB1 sites so that any give cDNA clone can be expressed in one of the three vectors.Alternatively, to assure that the ORF encoded by the cDNA will be in frame with an N-terminal fusionprotein sequence, PCR may be used to install attB sites, so that the AAA-AAA sequence within attB1 isin phase with the ORF.

The major consideration in generating C-terminal fusion proteins from cDNAs is the fact that all cDNAswill contain one or more stop codons, which must be removed before C-terminal fusion expression ispossible. This may be done by subcloning the gene into an Entry Vector so that no stop codon is present.Alternatively, it may be done by amplifying the gene by PCR using attB primers where the stop codonhas been eliminated from the gene specific sequence.


41

5.6 Detailed Descriptions of the Vectors of the GATEWAY Cloning System

Figure 18. Vector Map of Typical Entry Vector

All Entry Vectors consist of the same vector backbone (outside of the attL sites) but differ in thesequences and cloning sites provided between the attL sites.

The vector map of pENTR1A, shown here, displays the single-cut restriction enzyme sites in thisprototype vector.


42

NOTE: In the following figures the amino acids shown before the ccdB gene can be added to the N-terminus of your protein only if a translation start site is provided in the Destination Vector (such as withan N-terminal His6 or GST fusion).

NOTE: If a blunt-ended fragment containing a 5′-ATG is cloned into the Xmn I site of pENTR1A, 2B,3C, or 4, the adenine at position –3 of the underlined ACC sites provides a Kozak eukaryotic ribosomerecognition sequence for initiation of translation.

Figure 19. Cloning Sites of the Entry Vector pENTR1A

Figure 20. Cloning Sites of the Entry Vector pENTR2B


43

Figure 21 Cloning Sites of the Entry Vector pENTR3C

Figure 22. Cloning Sites of the Entry Vector pENTR4

Figure 23. Cloning Sites of the Entry Vector pENTR11

The underlined AAGGAG/A and ACC sites correspond to the Shine-Dalgarno (prokaryotes) and Kozakeukaryotic ribosome recognition sequences preceding the initiating ATG.

www.lifetech.com/gatewayThe designated reading frame for attB1 and attB2 are provided in Figure 5.

The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used toconstruct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be foundin the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.

44

Figure 24. pDEST8Polyhedron Promoter, Baculovirus Transfer Plasmid

Map of GATEWAY pDEST8 Vector. DNA from the Entry Clone replaces the region betweennucleotides 168 and 1990.

Recombination Region of the Expression Clone resulting from pDEST8 ×××× Entry Clone:

Features of the Recombination Region:

• The sequence shown extends from nucleotides 60-167 and 1991-2069 on the pDEST8 map. Thenucleotides marked with * and ♦ correspond to bases 167 and 1991, respectively, of the pDEST8sequence.

• The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 24-64.The start of transcription is indicated by the arrow at nt 67.

• Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST8by recombination. Non-shaded regions are derived from pDEST8.



45

Figure 25. pDEST10Polyhedron Promoter with N-His6, Baculovirus Transfer Plasmid




• The sequence shown extends from nucleotides 155-344 and 2168-2226 on the pDEST10 map. The nucleotidesmarked with * and ♦ correspond to bases 344 and 2168, respectively, of the pDEST10 sequence.

• The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 116-156. Thestart of transcription is indicated by the arrow at nt 159.

• Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST10 byrecombination. Non-shaded regions are derived from pDEST10.



46

Figure 26. pDEST12.2CMV Promoter for Mammalian Expression, SV40 Promoter/orifor Neo Resistance

Map of GATEWAY pDEST12.2 Vector. DNA from the Entry Clone replaces the region betweennucleotides 738 and 2419.

Recombination Region of the Expression Clone resulting from pDEST12.2 ×××× Entry Clone:


• The sequence shown extends from nucleotides 630-737 and 2420-2498 on the pDEST12.2 map. Thenucleotides marked with * and ♦ correspond to bases 737 and 2420, respectively, of the pDEST12.2sequence.

• The black box represents the sequence from nucleotides 15-629 and contains the CMV promoter (nt15-535), the start of transcription at nt 537, and a portion of the 5'-untranslated region.

• Shaded regions correspond to those DNA sequences transferred from the Entry Clone intopDEST12.2 by recombination. Non-shaded regions are derived from pDEST12.2.



47

Figure 27. pDEST14Native Protein Expression in E. coli, T7 Promoter




• The position of the T7 promoter is shown. The start of transcription is indicated by the arrow.• Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST14

by recombination. Non-shaded regions are derived from pDEST14.• The nucleotides marked with * and ♦ correspond to bases 74 and 1898, respectively, of the

pDEST14 sequence.

*



48

Figure 28. pDEST15Glutathione-S-transferase Amino-Fusion in E. coli, T7 Promoter




• The position of the T7 promoter is shown. The start of transcription is indicated by the arrow.• Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST15


pDEST15 sequence.

*



49

Figure 29 pDEST176X Histidine Affinity Tag Amino-Fusion in E. coli, T7 Promoter



Features of the Recombination Region:• The position of the T7 promoter is shown. The start of transcription is indicated by the arrow.• Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST17


pDEST17 sequence.

*



50

Figure 30. pDEST20Glutathione-S-transferase Amino-Fusion with Polyhedron Promoter forBaculovirus Expression




• The sequence shown extends from nucleotides 6295-6403, 7060-13, and 1696-1754 on the pDEST20 map. Thenucleotides marked with * and ♦ correspond to bases 13 and 1696, respectively, of the pDEST20 sequence.

• The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 6257-6297. Thestart of transcription is indicated by the arrow at nt 6300.




51

Figure 31. pDEST26CMV Promoter for Mammalian Expression, 6X Histidine AffinityTag Amino-Fusion SV40 Promoter/ori for Neo Resistance




• The sequence shown extends from nucleotides 615-678 and 2361-2499 on the pDEST26 map. The nucleotidesmarked with * and ♦ correspond to bases 678 and 2361, respectively, of the pDEST26 sequence.

• The black box represents the sequence from nucleotides 15-614 and contains the CMV promoter (nt 15-535),the start of transcription at nt 537, and a portion of the 5'-untranslated region.




52

Figure 32. pDEST27CMV Promoter for Mammalian Expression, Glutathione-S-Transferase Amino-Fusion SV40 Promoter/ori for Neo Resistance




• The sequence shown extends from nucleotides 630-643, 1301-1320, and 3003-3081 on the pDEST27 map. Thenucleotides marked with * and ♦ correspond to bases 1320 and 3003, respectively, of the pDEST27 sequence.

• The black box represents the sequence from nucleotides 15-619 and contains the CMV promoter (nt 15-535),the start of transcription at nt 537, and a portion of the 5'-untranslated region.



53

Table 4. Restriction Endonucleases That Do Not Cleave the Destination Vectors, or Cleave Twice

Restriction endonucleases that do not cleave pDEST8 DNA:

Aat II Cla I Hind III Nsp V SexA I Sst IAfl II Cvn I Kpn I Pac I Sfi I Stu IApa I Eco47 III Nar I PinA I Sgf I Sun IAsc I Eco72 I Nde I Pme I SgrA I Swa IBpu1102 I EcoN I Nhe I PshA I Spe I Xba IBsg I EcoO109 I Nru I Psp5 II Sph I Xcm IBstE II Fse I Nsi I Rsr II Sse8387 I Xho I

Restriction endonucleases that cleave pDEST8 DNA twice:

AlwN I 1521 4496 Bst1107 I 2 1280 Nsp I 4910 5892Ban I 2837 4069 BstX I 1728 5356 PflM I 406 973Bgl II 5193 5663 Dra III 2876 6224 Rca I 3182 4190BspLU11 I 4910 5892 Eam1105 I 2522 4017 Tfi I 1097 4936BssS I 3353 4737 Gsu I 848 3932 Xmn I 3418 6443


Aat II BstE II EcoO109 I Nsi I SexA I Swa IAfl II Cla I Fse I Pac I Sfi I Xcm IApa I Cvn I Nar I PinA I Sgf IAsc I Eco47 III Nde I Pme I SgrA IBpu1102 I Eco72 I Nhe I PshA I Sse8387 IBsg I EcoN I Nru I Psp5 II Sun I

Restriction endonucleases that cleave pDEST10 DNA twice:AlwN I 1698 4770 BstX I 1905 5630 Not I 462 2233BamH I 1377 2191 Dra III 3150 6498 PflM I 583 1150Ban II 2220 3077 Eam1105 I 2795 4291 Pst I 2046 2256Bgl II 5467 5937 EcoR I 924 2198 Rca I 3456 4464BspLU11 I 5184 6166 EcoR V 298 5743 Sal I 2052 2214BssS I 3627 5011 Gsu I 1025 4206 Xmn I 9 3692Bst1107 I 94 1457 Nco I 1225 2187

Restriction endonucleases that do not cleave pDEST12.2 DNA:

Apa I BstE II EcoR V PshA I Sun IAsc I Cvn I Fse I Psp5 II Swa IBgl II Eco47 III Pac I Sgf I Xba IBpu1102 I Eco72 I PinA I SgrA I Xcm IBsg I EcoN I Pme I Spe I Xho I

Restriction endonucleases that cleave pDEST12.2 DNA twice:

Acc I 1709 2304 Cla I 3048 5066 Sca I 1591 5779Afl III 1623 7150 EcoO109 I 2781 5281 Sst I 518 7275AlwN I 1950 6736 Kpn2 I 605 1172 Stu I 669 4089Avr II 617 4092 Kpn I 719 3742 Vsp I 3059 6086Bsa I 2179 6190 Nde I 187 2662 Xma III 856 4192BssH II 1670 4683 NgoA IV 3301 4786BstX I 2157 5000 Pvu I 3132 5890


54


Afl II BstE II Kpn I PinA I SnaB I Sun IApa I Cvn I Mun I Pme I Spe I Swa IAsc I Dra III Nde I Rsr II Sse8387 I Xcm IAvr II Eco72 I Nsi I SexA I Sst I Xho IBcl I Fse I Nsp V Sfi I Sst IIBseR I Hpa I Pac I Sgf I Stu I


Afl III 1101 4313 Bst1107 I 1187 4544 Pvu I 3053 6139 AlwN I 1428 3899 Drd I 4205 4620 Pvu II 552 4724 Apo I 654 2427 Ear I 2631 4435 Sca I 1069 2942 Ava I 1523 5363 Eco57 I 2738 3786 Ssp I 964 2618 Ban II 6307 6321 EcoR I 654 2427 Vsp I 19 3249 BsaA I 345 4563 EcoR V 2049 2240 Xma III 193 5849 BspM I 1778 5725 Psp5 II 5307 5349 Xmn I 2821 4755 BsrB I 2581 4382 Pst I 1776 3179


Afl II Cvn I Mlu I Rsr II Sse8387 I Xho IApa I Dra III Mun I SexA I Sst IAsc I Eco72 I Nsi I Sfi I Sst IIAvr II Fse I Pac I Sgf I Stu IBseR I Hpa I PinA I SnaB I Sun IBstE II Kpn I Pme I Spe I Xcm I


Afl III 343 4908 Eco57 I 3333 4381 Pvu II 1136 5319AlwN I 2012 4494 EcoN I 111 6760 Sap I 189 5030Apo I 1238 3022 EcoR I 1238 3022 Sma I 2107 2506Ban II 6902 6916 EcoR V 2644 2835 Ssp I 1548 3213Bsg I 370 5733 Esp3 I 1456 5261 Vsp I 23 3844BspLU11 I 343 4908 Nco I 777 1539 Xba I 63 1685BspM I 2362 6320 Psp5 II 5902 5944 Xma III 918 6444Bst1107 I 1771 5139 Pst I 2360 3774Drd I 4800 5215 Pvu I 3648 6734


Afl II BstE II Kpn I PinA I SnaB I Sun IApa I Cvn I Mlu I Pme I Spe I Swa IAsc I Dra III Mun I Rsr II Sse8387 I Xcm IAvr II Eco72 I Nsi I SexA I Sst I Xho IBcl I Fse I Nsp V Sfi I Sst IIBseR I Hpa I Pac I Sgf I Stu I


AlwN I 1360 3831 Bst1107 I 1119 4476 Pst I 1708 3111Apo I 586 2359 Drd I 4137 4552 Pvu I 2985 6071Ava I 1455 5295 Ear I 2563 4367 Pvu II 484 4656BamH I 336 1039 Eco57 I 2670 3718 Sca I 1001 2874Ban II 6239 6253 EcoR I 586 2359 Ssp I 896 2550Bgl II 1 1033 EcoR V 1981 2172 Vsp I 19 3181BspM I 1710 5657 Esp3 I 804 4598 Xma III 266 5781BsrB I 2513 4314 Psp5 II 5239 5281 Xmn I 2753 4687


55


Aat II Cvn I Nar I Pme I SgrA I Xcm IAfl II Eco47 III Nde I PshA I Spe I Xho IApa I Eco72 I Nhe I Psp5 II Sph IAsc I Fse I Nru I Rsr II Sse8387 IBpu1102 I Hind III Nsi I SexA I Sst IBstE II Kpn I Pac I Sfi I Stu ICla I Mlu I PinA I Sgf I Sun I


AlwN I 1226 4203 Bst1107 I 985 6235 Gsu I 553 3639Bcl I 1979 6825 BstX I 1433 5063 Nco I 753 6389Bgl II 4900 5370 Dra III 2583 5931 Rca I 2889 3997BsmF I 1228 6368 Eam1105 I 2229 3724 Sap I 4739 6475BssS I 3060 4444 Esp3 I 670 5529 Tfi I 802 4643


Apa I Cvn I Fse I Pme I Spe I Xho IAsc I Eco47 III Mlu I PshA I Sse8387 IBpu1102 I Eco72 I Nru I Psp5 II Sun IBsg I EcoN I Pac I Sgf I Swa IBstE II EcoR V PinA I SgrA I Xcm I


Acc I 1650 2245 BstX I 2098 4942 Pst I 2239 4277AlwN I 1891 6678 Cla I 2990 5008 Pvu I 3074 5832Avr II 617 4034 Kpn2 I 605 1113 Sca I 1532 5721Bsa I 2120 6132 Nde I 187 2604 Xma III 797 4134BssH II 1611 4625 NgoA IV 3243 4728


Apa I Eco47 III Nru I Psp5 II Sun IAsc I Eco72 I Pac I Sgf I Xcm IBpu1102 I EcoR V PinA I SgrA I Xho IBstE II Fse I Pme I Spe ICvn I Mlu I PshA I Sse8387 I


Acc I 2292 2887 BspLU11 I 870 7734 NgoA IV 3885 5370Afl III 870 7734 BssH II 2253 5267 Nsp V 1028 5551AlwN I 2533 7320 BstX I 2740 5584 Pst I 2881 4919Avr II 617 4676 Cla I 3632 5650 Pvu I 3716 6474Bcl I 1066 3393 Kpn2 I 605 1755 Xma III 1439 4776Bsa I 2762 6774 Nde I 187 3246 Xmn I 1021 6242


56

Figure 33. Donor Vector for BP Reactions: pDONR201


57

6. Related Products

Product Size Cat. No.

Systems

PCR Cloning System (with GATEWAY Technology)(Contains: GATEWAY BP CLONASE™ Enzyme Mix, reaction buffers, pDONR201 vector,Proteinase K Solution, 30% PEG/Mg Solution, LIBRARY EFFICIENCY DH5α CompetentCells, positive control and protocol)

20 reactions 11821-014

E. coli Expression System (with GATEWAY Technology) (with LIBRARY

EFFICIENCY DH5α Competent Cells)

(Contains: GATEWAY LR CLONASE™ Enzyme Mix, reaction buffers, pDEST14, pDEST15,pDEST17 vectors, Proteinase K Solution, LIBRARY EFFICIENCY DH5α Competent Cells,positive control and protocol)


E. coli Expression System (with GATEWAY Technology) (with BL21-SICompetent Cells)(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST14, pDEST15,pDEST17 vectors, Proteinase K Solution, BL21-SI Competent Cells, positive control andprotocol)


Mammalian Expression System (with GATEWAY Technology)(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST12.2, pDEST26,pDEST27 vectors, Proteinase K Solution, LIBRARY EFFICIENCY DH5α Competent Cells,positive control and protocol)


Baculovirus Expression System (with GATEWAY Technology) 1

(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST8, pDEST10,pDEST20 vectors, Proteinase K Solution, LIBRARY EFFICIENCY DH5α Competent Cells,positive control and protocol)


GATEWAY Vector Conversion System(Contains: GATEWAY rfA, rfB and rfC Cassettes, LIBRARY EFFICIENCY DB3.1 CompetentCells, positive control and protocol)


PCR Cloning Vectors

GATEWAY pDONR201 Vector[attP sites, knr]

40 µl

(150 ng/µl)

11798-014

Enzymes

GATEWAY BP CLONASE Enzyme Mix(Contains: enzyme mix, reaction buffer, Proteinase K Solution, and 30% PEG/Mg Solution)


GATEWAY LR CLONASE Enzyme Mix(Contains: enzyme mix, reaction buffer, Proteinase K Solution)


1 The Baculovirus Expression System (with GATEWAY Technology) provides all the components necessary toconstruct the GATEWAY version of the pFASTBAC™ clone. Once constructed, this clone can be used in conjunctionwith the BAC-TO-BAC

® Baculovirus Expression System to generate (by in vivo recombination with a bacmid) arecombinant baculovirus vector for expression in insect cells. Components from the BAC-TO-BAC BaculovirusExpression System that are also required include MAX EFFICIENCY

® DH10BAC® cells, CELLFECTIN® Reagent, and

insect cells for expression. Refer to the BAC-TO-BAC® Baculovirus Expression System manual (which can be found

on our web site) for more information regarding this system.


58

Product Size Cat. No.

Entry Vectors (for entry via restriction enzyme and ligase cloning)

GATEWAY pENTR1A Vector[attL sites, rf 0, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions inE. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene containsendogenous ribosome binding sites]

20 µl

(500 ng/µl)

11813-011

GATEWAY pENTR2B Vector[attL sites, rf +1, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions inE. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene containsendogenous ribosome binding sites]

20 µl

(500 ng/µl)

11816-014

GATEWAY pENTR3C Vector[attL sites, rf +2, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions inE. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene containsendogenous ribosome binding sites]

20 µl

(500 ng/µl)

11817-012

GATEWAY pENTR4 Vector[attL sites, 1st site Nco I, Kozak, no Shine-Dalgarno; for N-terminal or C-terminal fusions inE. coli or eukaryotic cells; native expression in eukaryotic cells; native expression in E. coli ifgene contains endogenous ribosome binding sites]

20 µl

(500 ng/µl)

11818-010

GATEWAY pENTR11 Vector[attL sites, blunt and Nco I sites both preceded by Shine-Dalgarno and Kozak, for native, N-terminal or C-terminal fusions in E. coli or eukaryotic cells]

20 µl

(500 ng/µl)

11819-018

Competent Cells

LIBRARY EFFICIENCY DB3.1 Competent Cells[For propagating plasmids containing the ccdB gene (e.g., Destination Vectors)]

5 × 0.2 ml 11782-018

Destination Vectors

GATEWAY pDEST14 Vector[For native expression in E. coli: T7 promoter, attR sites]

40 µl 11801-016

GATEWAY pDEST15 Vector[For prokaryotic expression: T7 promoter, N-terminal GST tag, attR sites]

40 µl 11802-014

GATEWAY pDEST17 Vector[For prokaryotic expression: T7 promoter, N-terminal 6X histidine affinity tag, attR sites]

40 µl 11803-012

GATEWAY pDEST8 Vector[For baculovirus expression: pFASTBAC vector with polyhedron promoter, attR sites]

40 µl 11804-010

GATEWAY pDEST10 Vector[For baculovirus expression: pFASTBAC HT vector with polyhedron promoter, N-terminal 6Xhistidine affinity tag, attR sites]

40 µl 11806-015

GATEWAY pDEST20 Vector[For baculovirus expression: pFASTBAC vector with polyhedron promoter, N-terminal GSTtag, attR sites]

40 µl 11807-013

GATEWAY pDEST12.2 Vector[For mammalian expression: pCMV•SPORT vector, neor, attR sites]

40 µl 11808-011

GATEWAY pDEST26 Vector[For mammalian expression: pCMV•SPORT vector, neor, N-terminal 6X histidine affinitytag, attR sites]

40 µl 11809-019

GATEWAY pDEST27 Vector[For mammalian expression: pCMV•SPORT vector, neor, N-terminal GST tag, attR sites]

40 µl 11812-013


59

Product Size Cat. No.Competent Cells, Media, and Antibiotics:

LIBRARY EFFICIENCY DH5α Competent Cells 5 × 0.2 ml 18263-012BL21-SI Competent Cells 5 × 0.2 ml 11665-015MAX EFFICIENCY DH10BAC Competent Cells 5 × 0.1 ml 10361-012Bluo-gal 100 mg 15519-010X-gal 100 mg 15520-034IPTG 1 g 15529-019S.O.C. Medium 10 × 10 ml 15544-034Ampicillin Sodium salt, lyophilized 5 ml 13075-015Kanamycin Sulfate 1 g 11815-016

Products for Mammalian and Insect Expression:

BAC-TO-BAC Baculovirus Expression System 5 reactions 10359-016LIPOFECTAMINE™ 2000 Reagent 1.5 ml 11668-019CELLFECTIN Reagent 1 ml 10362-010Sf-900 II SFM (1X), liquid 500 ml 10902-096Sf9 Cells, SFM Adapted 3 ml 11496-015Sf21 Cells, SFM Adapted 3 ml 11497-013CD-CHO Medium 500 ml 10743-011CHO-S Cells 3 ml 11619-012293 SFM II 500 ml 11686-011293-F Cells 3 ml 11625-019VP SFM 1,000 ml 11681-020COS-7L Cells 3 ml 11622-016Liquid GENETICIN® 20 ml 10131-035

PCR/RT-PCR Products:

Custom Primers-Gateway attB modifications*PLATINUM Pfx DNA Polymerase 50 units 11708-047PLATINUM Taq DNA Polymerase High Fidelity 500 units 11304-029TAQUENCH PCR Cloning Enhancer 100 units 11265-014THERMOSCRIPT™ RT-PCR System plus PLATINUM Taq 100 reactions 11146-040 DNA Polymerase High Fidelity

DNA Purification Products:CONCERT High Purity Plasmid Miniprep System 25 reactions 11449-014CONCERT High Purity Plasmid Midiprep System 25 reactions 11451-010CONCERT High Purity Plasmid Maxiprep System 10 reactions 11452-018Nucleic Acid Purification Rack each 11494-010CONCERT Rapid Plasmid Miniprep System 50 reactions 11453-016CONCERT Rapid Plasmid Midiprep System 25 reactions 11454-014CONCERT Rapid Plasmid Maxiprep System 10 reactions 11455-011CONCERT Rapid Gel Extraction System 50 reactions 11456-019CONCERT Matrix Gel Extraction System 150 reactions 11457-017Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) 100 ml 15593-031


60

Product Size Cat. No.Cloning Reagents:

SUPERSCRIPT II RNase H- Reverse Transcriptase 10,000 units 18064-014SUPERSCRIPT Plasmid System for cDNA Synthesis and Plasmid Cloning 3 reactions 18248-013PROQUEST™ Two-Hybrid cDNA Libraries**SUPERSCRIPT cDNA Libraries**Calf Intestinal Alkaline Phosphatase (CIAP) 1,000 units 18009-019Dpn I 100 units 15242-019Nco I 200 units 15421-019Thermosensitive Alkaline Phosphatase (TsAP) 1,000 units 10534-014T4 DNA Ligase 100 units 15224-017T4 DNA Polymerase 50 units 18005-017T4 Polynucleotide Kinase 200 units 18004-010Topoisomerase I 200 units 38042-016Proteinase K 100 mg 25530-015Plasmid pUC19 10 µg 15364-011

DNA Analysis Products:

CLONECHECKER™ System 100 reactions 11666-0131 Kb PLUS DNA LADDER 250 µg 10787-018Low DNA MASS Ladder 200 µl 10068-013High DNA MASS Ladder 200 µl 10496-016Low Melting Point Agarose 50 g 15517-014Kodak Digital Science™ EDAS 120 System, Windows version each 10947-042 Macintosh version each 10947-059

Protein Analysis Products:

BENCHMARK™ Protein Ladder 2 × 250 µl 10747-012BENCHMARK Prestained Protein Ladder 2 × 250 µl 10748-010

*See our website (lifetech.com) for information about Custom Primers.**See our website for an updated list of GATEWAY-compatible libraries.

Additional sizes of these products are also available.

gateway cloning manual

Documents