Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

© 2016. Published by The Company of Biologists Ltd.

Gene-targeted CEP164-deficient cells show a ciliation defect with intact

DNA repair capacity

Owen M. Daly1, David Gaboriau1,†, Kadin Karakaya2, Sinéad King1, Tiago J. Dantas1,¶,

Pierce Lalor3, Peter Dockery3, Alwin Krämer2 and Ciaran G. Morrison1,*

1Centre for Chromosome Biology, School of Natural Sciences and 3Anatomy, School of

Medicine, National University of Ireland Galway, Galway, Ireland; 2Clinical Cooperation Unit

Molecular Hematology/Oncology, German Cancer Research Center (DKFZ) and

Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 280,

69120, Heidelberg, Germany

Summary statement: Knockout of the CEP164 ciliopathy gene ablates ciliogenesis but

causes no increase in sensitivity to DNA damage induced by ionising or ultraviolet

irradiation.

Keywords: Primary cilium; Centrosome amplification; DNA damage response; DNA repair;

CEP164; ciliopathy

†Current address: Facility for Imaging by Light Microscopy, Sir Alexander Fleming

Building, Imperial College London, UK.

¶Current address: Department of Pathology and Cell Biology, Columbia University,

New York, USA

*Correspondence to: Ciaran.Morrison@nuigalway.ie

JCS Advance Online Article. Posted on 10 March 2016

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Abstract

Primary cilia are microtubule structures that extend from the distal end of the mature,

mother centriole. CEP164 is a component of the distal appendages carried by the

mother centriole that is required for primary cilium formation. Recent data have

implicated CEP164 as a ciliopathy gene and suggest that CEP164 plays some roles

in the DNA damage response (DDR). We used reverse genetics to test the role of

CEP164 in the DDR. We found that conditional depletion of CEP164 in chicken

DT40 cells using an auxin-inducible degron led to no increase in sensitivity to DNA

damage induced by ionising or ultraviolet irradiation. Disruption of CEP164 in human

retinal pigmented epithelial cells blocked primary cilium formation but did not affect

cellular proliferation or cellular responses to ionising or ultraviolet irradiation.

Furthermore, we observed no localisation of CEP164 to the nucleus using

immunofluorescence microscopy and analysis of multiple tagged forms of CEP164.

Our data suggest that CEP164 is not required in the DDR.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Introduction

Primary cilia are membrane-enclosed, microtubule-based organelles that extend like

antennae from the surface of most mammalian cell types to sense and transduce

various extracellular signals. They arise from the basal body, a template provided

when the mature, mother centriole docks to the plasma membrane (Goetz and

Anderson, 2010). Centrioles display structural polarity, with the proximal ends

containing microtubule triplets, which taper to doublets at the distal ends. The distal

ends of mature centrioles carry two sets of appendages, which anchor cytoplasmic

microtubules and which allow the docking of the mother centriole to the cell

membrane during the formation of the primary cilium (Goetz and Anderson, 2010).

The cilium core, the axoneme, consists of 9 microtubule doublets that extend from

the basal body.

In mammalian cells, cilium formation is closely regulated and linked to the cell cycle,

as cilia must be resorbed to allow the basal body to act as a centrosome and to

organise the mitotic spindle. Cellular quiescence, a temporary exit from the cell cycle

that can be induced by the removal of growth factors, facilitates ciliogenesis

(Kobayashi and Dynlacht, 2011). Current models associate primary cilia with cell

cycle exit and reduced proliferation, although the underlying mechanisms of such a

link are not well defined (Goto et al., 2013).

CEP164 encodes a centriolar appendage protein that is required for ciliogenesis

(Graser et al., 2007, Schmidt et al., 2012). It has also been implicated in modulating

the DNA damage response (DDR), particularly CHK1 (Sivasubramaniam et al., 2008).

CEP164 was initially identified in a proteomic analysis of the centrosome and later,

as a component of the distal appendages whose depletion by siRNA treatment

caused a marked reduction in primary cilium formation (Andersen et al., 2003,

Graser et al., 2007, Schmidt et al., 2012). Immuno- electron microscopy (EM)

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

demonstrated the localisation of CEP164 to the distal end of the mother centriole

(Graser et al., 2007). Dual PALM/STORM imaging localised CEP164 in a ring

around the centriole barrel with a periodic enrichment of the signal within the ring

(Sillibourne et al., 2011) and stimulated emission depletion microscopy found that the

enriched CEP164 signal corresponds to nine symmetrically-arranged clusters around

the centriole, indicative of its association with each of the nine distal appendages

(Lau et al., 2012).

Recent data have indicated CEP164 mutations in nephronophthisis-related ciliopathy

(as NPHP15), a rare recessive degenerative disease of the kidney, retina and brain,

suggesting a link between ciliopathy and a DDR role of CEP164 (Chaki et al., 2012).

We set out to explore the mechanisms that link ciliary dysfunction with DDR defects,

using gene targeting to ablate CEP164 function.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Results and Discussion

To analyse the roles of CEP164 in DNA repair, we used gene targeting in chicken

DT40 cells to insert a tag that combined GFP with an auxin-inducible degron (AID;

(Nishimura et al., 2009)) into the CEP164 locus of cells that stably expressed the

TIR1 E3 ligase component (Supplementary Figure 1A, B). As shown in Figure 1A,

AID-GFP-tagged CEP164 localised to the centrosome, although we observed no

localisation of CEP164 to the nucleus, even after UV irradiation of cells to levels that

induced robust formation of gamma-H2AX foci (Figure 1B). Upon addition of auxin,

AID-GFP-tagged CEP164 was depleted within 1 h (Figure 1C; Supplementary Figure

1C, D). CEP164-deficient cells showed doubling times of 8.3 h (clone 1) and 8.3 h

(clone 2), compared with control times of 8.4 h and 8.4 h for each clone, respectively,

and 8.3 h for wild-type cells. We observed no difference in sensitivity to ionising

radiation (IR) or UV treatment between CEP164-deficient and wild-type cells (Figure

1D, E). In keeping with this observation, IR-induced centrosome amplification, a

potential readout for the DDR (Bourke et al., 2007), occurred to the same levels in

both CEP164-deficient and wild-type cells (Supplementary Figure 1E). These data

show that CEP164 plays a limited role, if any, in nuclear responses to IR or UV-

induced DNA damage in DT40 cells.

Next, we cloned human CEP164 and expressed N- and C-terminally GFP- and

FLAG-tagged versions in human cell lines. As shown in Figure 2A-2D, we

consistently observed a centrosomal localisation for recombinant, overexpressed

CEP164, but saw no nuclear signal. Immunofluorescence microscopy with

previously-published anti-CEP164 antibodies also detected centrosomal, but not

nuclear signals (Figure 2E, 2F). Next, we generated a monoclonal antibody to

CEP164. As shown in Supplementary Figure 2A, monoclonal antibody 1F3G10

generated against amino acids 6-296 of CEP164 recognised a protein of

approximately 200 kDa in 3 human cell lines. We next confirmed 1F3G10 specificity

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

by siRNA-depleting CEP164 from RPE1 cells. After CEP164 depletion, the 1F3G10

signal disappeared, with no effect on a GAPDH control (Supplementary Figure 2B).

In immunofluorescence microscopy experiments, 1F3G10 detected a signal that

partly co-localised with ninein, a component of the subdistal appendages, but

localised adjacent to CEP135, a centriole proximal end component (Supplementary

Figure 2C), consistent with the known localisation of CEP164 at the distal

appendages (Graser et al., 2007). While we conclude from these experiments that

the 1F3G10 monoclonal antibody is specific for CEP164, there was no signal seen in

the nucleus of U2OS or RPE1 cells.

Previous data have indicated a role for CEP164 in primary ciliogenesis (Cajanek and

Nigg, 2014, Graser et al., 2007, Schmidt et al., 2012, Chaki et al., 2012). Despite the

feasibility of inducing ciliogenesis in DT40 cells (Prosser and Morrison, 2015), we

preferred to examine the roles of CEP164 in a cell line with high levels of primary

ciliation. Thus, we used CRISPR-Cas9 technology to disrupt CEP164 in hTERT-

RPE1 cells, which show high levels of primary cilium formation upon serum

starvation. We used a guide RNA designed to direct DNA double-strand breaks in

exon 9 (the 7th coding exon) of the human CEP164 locus and selected clones that

had lost CEP164 expression by immunoblot analysis (Figure 3A). Sequence

analysis demonstrated that CEP164-deficient clones had incurred mutations in the

CEP164 locus that led to premature stop codons being transcribed in-frame with the

gene (Supplementary Figure 3A). Immunofluorescence microscopy confirmed that

these clones no longer expressed CEP164, although they still carried intact

centrioles (Figure 3B). These cells proliferated as rapidly as wild-type cells, with

doubling times of 24.1 h (clone 1) and 23.6 h (clone 2), compared with 23.5 h for

wild-type cells. We saw no alteration in cell cycle distribution in the absence of

CEP164 (Supplementary Figure 3B). Strikingly, CEP164-deficient cells showed a

complete absence of primary ciliation capacity that was rescued by transgenic

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

expression of CEP164 (Figure 3C, 3D). Transmission EM analysis of the CEP164

null cells revealed no obvious structural defects in centriole structures, based on the

dimensions of the centriole barrels (Supplementary Figure 3C). 16 vesicles were

identified in proximity to the centrioles in 7 CEP164 null cells, but no docking was

observed, consistent with a defect at the vesicle docking stage in cilium formation

seen in siRNA knockdown experiments (Schmidt et al., 2012) (Figure 3E). Thus, our

disruption of the CEP164 locus confirms the findings made on CEP164’s roles in

primary ciliogenesis with siRNA experiments (Cajanek and Nigg, 2014, Graser et al.,

2007, Schmidt et al., 2012).

We next tested whether CEP164 deficiency impacted on cells’ ability to withstand

UV-induced DNA damage. A clonogenic survival assay showed that CEP164-

deficient RPE1 cells were no more sensitive than wild-type cells (Figure 4A). In a

positive control experiment, CETN2 null RPE1 cells (Prosser and Morrison, 2015)

showed an increased UV sensitivity, as had centrin-deficient chicken DT40 cells

(Dantas et al., 2011). Furthermore, we observed no localisation of CEP164 to

nuclear DNA damage foci of γ-H2AX after IR or UV treatment in RPE1 or HeLa cells

with either of two antibodies in immunofluorescence experiments (Figure 4B, C).

Taken together, these data indicate no defect in the response to DNA damage in

CEP164-deficient hTERT-RPE1 cells.

The results in the two models we have explored do not support a role for CEP164 in

the DDR. We did not see a proliferative decline, such as that described in IMCD3

cells after siRNA knockdown of CEP164 (Chaki et al., 2012) or an acceleration of cell

cycle progression, as has been described after siRNA knockdown of CEP164 in

RPE-FUCCI cells (Slaats et al., 2014). In our null lines, we observed no elevated

sensitivity to IR or UV irradiation in the absence of CEP164, which contrasts with the

phenotypes of UV sensitivity and loss of the G2-to-M checkpoint reported with siRNA

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

knockdown of CEP164 in HeLa cells (Sivasubramaniam et al., 2008, Pan and Lee,

2009). These discrepancies have potential implications for understanding how

CEP164 mutations cause disease.

There are clear technical differences in the approaches that we have used and those

previously reported. An obvious possibility is that the gradual or partial depletion

imposed by siRNA treatment may lead to cellular responses different to those seen

with the loss of a protein, although our degron-mediated experiment might have been

expected to address this. Another possibility is that off-target effects of the siRNA

treatments resulted in more marked phenotypes. While the proliferative decline and

cell cycle defects in IMCD3 cells were rescued by transgenic expression of human

CEP164 (Chaki et al., 2012, Slaats et al., 2014), it is worth noting that rescues for the

UV sensitivity and checkpoint defects seen in CEP164 knockdown cells were not

performed (Sivasubramaniam et al., 2008, Pan and Lee, 2009), so that the specificity

of these RNAi phenotypes cannot be assessed.

We have not seen any significant nuclear localisation of CEP164 during the normal

cell cycle or after DNA damage in 1 chicken and 3 human cell lines, using 3 different

antibodies and multiple, differently-tagged versions of transgenically-expressed

CEP164. Similarly to published results (Graser et al., 2007, Schmidt et al., 2012),

our experiments have detected only cytosolic or centrosomal signals, in contrast to

the predominantly nuclear signals reported with those antibodies generated in the

original study that implicated CEP164 in the DDR (Sivasubramaniam et al., 2008).

Tagging experiments and several antibodies used in a recently-published study

showed predominantly cytosolic or centrosomal CEP164 signals, although these

authors also observed nuclear signals using the original CEP164 antibodies (Chaki

et al., 2012). Controls for the specificity of the nuclear immunofluorescence signals

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

seen with these reagents after CEP164 knockdown or depletion have not been

detailed (Sivasubramaniam et al., 2008, Pan and Lee, 2009).

We have performed our DNA damage sensitivity and localisation analyses in cell

lines from different tissues. Thus, while we cannot exclude the possibility that

CEP164 contributes to the DDR in certain cell types, this does not appear to be a

general activity of the protein. Our data, which support a marked defect in primary

cilium formation, but normal levels of DNA repair capacity in the absence of CEP164,

suggest that the principal cellular defect associated with CEP164 deficiency is the

inability to undertake primary ciliogenesis.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Materials and Methods

Cell culture

Chicken DT40 cells were cultured as previously described (Takata et al., 1998).

hTERT-RPE1 cells were cultured as previously described (Prosser and Morrison,

2015). HeLa and U2OS cells were obtained from ATCC and cultured in DMEM

(Lonza or PAA/ GE Healthcare), supplemented with 10% FCS (Lonza or Biochrom).

Jurkat cells were from the European Collection of Animal Cell Cultures and were

grown in RPMI with 10% FCS (Lonza). Auxin (Sigma-Aldrich) was prepared at 0.5 M

in ethanol. IR treatments used a 137Cs source (Mainance Engineering). For UV-C

irradiation, cells were irradiated using an NU-6 254-nm UV-C lamp at 23 J/m2/min

(Benda). DT40 clonogenic survival assays were performed as previously described

(Takata et al., 1998), with 500M auxin added to the medium of cells 24 h prior to

irradiation where a degron-tagged protein was to be depleted, and retained in the

methylcellulose medium used for clonogenesis. For UV clonogenic survival assays

in hTERT-RPE1, cells were counted before being serially diluted and plated in 10 cm

dishes. The cells in each dish were allowed to adhere for 6 h before the medium

was siphoned off and they were irradiated. Conditioned medium (filtered media taken

from 50% confluent cells) was used to replenish the dishes before incubation.

Cloning

For targeting the chicken CEP164 locus, 5′ and 3’ homology arms and probe

sequence were amplified from DT40 genomic DNA with KOD polymerase

(Novagen/Merck) using the following primers:

5’ arm: 5’-gacgtcCAGACAACAAGCTAGGATATGTACCT-3’ and 5’-

ccgcggGTACCGGTACACTTTAATTTGTCTGT-3’

3’ arm: 5’-agatctAAGGTGGGACTTGGTGTTTTCAGCC-3’ and 5’-

cctaggTTTGGGTTTCAGTGCCATCCCGTG-3’

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

5’ probe: 5’-CTTCTGATTTCAGTCCTGCGTGTT-3’ and 5’-

CAGACATTAAATACAAGTCCCCTCC-3’

The probe for Southern analysis was labeled with digoxigenin using the PCR DIG

Probe Synthesis Kit (Roche). AID-encoding sequence (Eykelenboom et al., 2013)

was subcloned into pEGFP-N1 (BD Biosciences/ Clontech) and a TIR1-9myc

plasmid (pJE108 (Eykelenboom et al., 2013)) was stably cloned into DT40 cells to

control the degron.

For cloning human CEP164 cDNA, hTERT-RPE1 RNA was extracted using TRI

reagent (Invitrogen). Reverse transcription was performed using SuperScript First-

Strand (Invitrogen) and PCR with KOD Hot Start. cDNAs were cloned into pGEM-T

Easy (Promega), sequenced and then subcloned into pEGFP-N1, pEGFP-C1 (BD

Biosciences/ Clontech) or pCMV8 Tag 4A (Agilent Technologies, Santa Clara, CA,

USA). The primers used to amplify human CEP164 cDNA (isoform 1,

NP_055771.4 ) were as follows: 5′-aagcttATGGCTGGACGACCCCTCCGCA-3’ and

5’-gtcgacCAGAAGCGATACACCYYCACTC-3’. Isoform 2 (UniProtKB - Q9UPV0

(CE164_HUMAN)) was cloned by mutating CEP164 cDNA isoform 1 using the

QuickChange Lightning Site-Directed Mutagenesis Kit (#210518, Agilent) with the

following primers:

Deletion of GGAG: 5'-AGCAGTCCAAAGGCCTGGAAGGTTATCTCCTC-3' and 5'-

GAGGAGATAACCTTCCAGGCCTTTGGACTGCT-3'; Deletion of

GTGAGTGGTGGCGGCAGCAGAGGATCGACTCAA: 5'-

CCCCGCCTCACCCCCCGAGTCTCA-3' and 5'-

TGAGACTCGGGGGGTGAGGCGGGG-3'; Insertion of GGAGAGGTACCAT: 5'-

AGCAGTCCAAAGGCCTGGAGGAGAGGTACCATAGGTTATCTCCTC-3' and 5'-

GAGGAGATAACCTATGGTACCTCTCCTCCAGGCCTTTGGACTGCT-3'; Insertion

of TCGACTCAA:

5'-CCCCGCCTCACCTCGACTCAACCCCGAGTCTCA-3'; 5'-

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

TGAGACTCGGGGTTGAGTCGAGGTGAGGCGGGG-3'.

CRISPR/Cas9 targeting of CEP164 in hTERT-RPE1 cells

Primers targeting exon 9 (Mali et al., 2013) were cloned into pX330-U6-

Chimeric_BB-CBh-hSpCas9 (plasmid 43330; Addgene (Cong et al., 2013)): 5′-

CACCGCTGTTGGCAAAGGGCGACA-3′ and 5′-

AAACTGTCGCCCTTTGCCCACAGC-3′. Transfections used Lipofectamine 2000

(Invitrogen). Genomic PCR products obtained with the diagnostic primer pair, 5′-

CTGGGTGATTGATAACCATTGGG -3’ and 5′-CGCAAATGAAGCTCCTGACTCAGT

-3′ were cloned into pGEM-T-Easy and sequenced.

Monoclonal antibody generation

cDNA sequence encoding CEP164 amino acids 6-296 was cloned into pGEX-4T1

(GE Healthcare) and the bacterially-expressed GST fusion product was purified over

a glutathione column prior to thrombin cleavage. Purified CEP164 protein fragment

was used for hybridoma generation (Dundee Cell Products). Individual supernatants

were screened by immunoblot and microscopy and then concentrated antibody was

purified from the best-performing 1F3G10 supernatant (Proteogenix).

RNA-mediated interference

Cells were transfected with 50 nmol custom siRNA targeting CEP164 from Qiagen

CAGGUGACAUUUACUAUUUCA or Silencer Select siRNA targeting GAPDH

UGGUUUACAUGUUCCAAUATT using Oligofectamine (Invitrogen).

Immunofluorescence microscopy

Cells were fixed for analysis as previously described (Prosser and Morrison, 2015).

Donkey and goat secondary antibodies were labeled with Cy3, Alexa Fluor 488 or

Alexa Fluor 594 (Jackson ImmunoResearch or Molecular Probes). Rabbit polyclonal

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

antibodies used were as follows: γ-tubulin (T3559, Sigma) γ-H2AX (Ab2893, Abcam),

CEP135 (1420 739 (Bird and Hyman, 2008)), CEP164 (HPA037606, Sigma),

CEP164 (R171 (Graser et al., 2007)), detyrosinated α-tubulin (Ab48389, Abcam) and

ninein (ab4447, Abcam). Mouse monoclonal antibodies used were γ-tubulin (GTU88,

Sigma or TU-30/11–465-C100, Exbio), γ-H2AX (JBW301, Upstate), CEP164

(1F3G10) and centrin (20H5, Millipore). Images of DT40 and hTERT-RPE1 cells

were captured on an IX71 microscope (Olympus) with a 100× oil objective, NA 1.35,

using Volocity software (PerkinElmer), and are presented as maximum intensity

projections of Z-stacks after deconvolution. Alternatively, images of U2OS cells were

captured and processed using an Axiovert 200 M microscope equipped with a Plan-

Apochromat 63x, NA 1.4 objective and AxioVision software (Carl Zeiss Microscopy)

and are presented as single sections.

Electron microscopy

hTERT-RPE1 cells were serum-starved in 0.1% FCS for 24h prior to harvest. Cell

pellets were prepared for transmission EM and imaged with an H-7000 Electron

Microscope (Hitachi) as described (Prosser and Morrison, 2015).

Immunoblotting

Whole-cell extracts were prepared using RIPA buffer (50mM Tris-HCl pH7.4, 1% NP-

40, 0.25% sodium deoxycholate, 150mM NaCl, 1mM EDTA and protease inhibitor

cocktail). Immunoblot analyses used the following primary antibodies: α-tubulin

(B512, Sigma), CEP164 (IF3G10), GFP (11814460001, Roche) and GAPDH (14C10,

Cell Signalling).

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Flow cytometry

Cells were fixed in 70% ice-cold ethanol overnight at 4°C, washed twice in PBS, and

incubated in 40 µg/ml propidium iodide and 200 µg/ml RNase A in PBS for 1 h.

Cytometry was performed on a FACSCanto (BD).

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Competing interests

No competing interests declared.

Author contributions

Project conception and direction: O.M.D., K.K., A.K., C.G.M. Data analysis: O.M.D.,

D.G., K.K., S.K., T.J.D, P.D., A.K., C.G.M. Experimental work: O.M.D., T.J.D, K.K.

(cell biology); D.G., S.K. (monoclonal antibody); P.L. (EM). Writing the paper: O.M.D.

and C.G.M.

Funding

We acknowledge the National Biophotonics and Imaging Platform Ireland and the

NCBES Flow Cytometry core facility, which were supported by Irish Government

Programme for Research in Third-Level Institutions cycles 4 and 5. This work was

funded by Science Foundation Ireland Principal Investigator award 10/IN.1/B2972

and European Commission SEC-2009-4.3-02, project 242361 ‘BOOSTER’.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

References

Andersen, J. S., Wilkinson, C. J., Mayor, T., Mortensen, P., Nigg, E. A. & Mann, M.

2003. Proteomic characterization of the human centrosome by protein

correlation profiling. Nature, 426, 570-4.

Bird, A. W. & Hyman, A. A. 2008. Building a spindle of the correct length in human

cells requires the interaction between TPX2 and Aurora A. J Cell Biol, 182,

289-300.

Bourke, E., Dodson, H., Merdes, A., Cuffe, L., Zachos, G., Walker, M., Gillespie, D. &

Morrison, C. G. 2007. DNA damage induces Chk1-dependent centrosome

amplification. EMBO Rep, 8, 603-9.

Cajanek, L. & Nigg, E. A. 2014. Cep164 triggers ciliogenesis by recruiting Tau tubulin

kinase 2 to the mother centriole. Proc Natl Acad Sci U S A, 111, E2841-50.

Chaki, M., Airik, R., Ghosh, A. K., Giles, R. H., Chen, R., Slaats, G. G., Wang, H.,

Hurd, T. W., Zhou, W., Cluckey, A., Gee, H. Y., Ramaswami, G., Hong, C. J.,

Hamilton, B. A., Cervenka, I., Ganji, R. S., Bryja, V., Arts, H. H., Van

Reeuwijk, J., Oud, M. M., Letteboer, S. J., Roepman, R., Husson, H.,

Ibraghimov-Beskrovnaya, O., Yasunaga, T., Walz, G., Eley, L., Sayer, J. A.,

Schermer, B., Liebau, M. C., Benzing, T., Le Corre, S., Drummond, I.,

Janssen, S., Allen, S. J., Natarajan, S., O'toole, J. F., Attanasio, M., Saunier,

S., Antignac, C., Koenekoop, R. K., Ren, H., Lopez, I., Nayir, A., Stoetzel, C.,

Dollfus, H., Massoudi, R., Gleeson, J. G., Andreoli, S. P., Doherty, D. G.,

Lindstrad, A., Golzio, C., Katsanis, N., Pape, L., Abboud, E. B., Al-Rajhi, A. A.,

Lewis, R. A., Omran, H., Lee, E. Y., Wang, S., Sekiguchi, J. M., Saunders, R.,

Johnson, C. A., Garner, E., Vanselow, K., Andersen, J. S., Shlomai, J.,

Nurnberg, G., Nurnberg, P., Levy, S., Smogorzewska, A., Otto, E. A. &

Hildebrandt, F. 2012. Exome capture reveals ZNF423 and CEP164 mutations,

linking renal ciliopathies to DNA damage response signaling. Cell, 150, 533-

48.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X.,

Jiang, W., Marraffini, L. A. & Zhang, F. 2013. Multiplex genome engineering

using CRISPR/Cas systems. Science, 339, 819-23.

Dantas, T. J., Wang, Y., Lalor, P., Dockery, P. & Morrison, C. G. 2011. Defective

nucleotide excision repair with normal centrosome structures and functions in

the absence of all vertebrate centrins. J Cell Biol, 193, 307-18.

Eykelenboom, J. K., Harte, E. C., Canavan, L., Pastor-Peidro, A., Calvo-Asensio, I.,

Llorens-Agost, M. & Lowndes, N. F. 2013. ATR activates the S-M checkpoint

during unperturbed growth to ensure sufficient replication prior to mitotic

onset. Cell Rep, 5, 1095-107.

Goetz, S. C. & Anderson, K. V. 2010. The primary cilium: a signalling centre during

vertebrate development. Nat Rev Genet, 11, 331-44.

Goto, H., Inoko, A. & Inagaki, M. 2013. Cell cycle progression by the repression of

primary cilia formation in proliferating cells. Cell Mol Life Sci, 70, 3893-905.

Graser, S., Stierhof, Y. D., Lavoie, S. B., Gassner, O. S., Lamla, S., Le Clech, M. &

Nigg, E. A. 2007. Cep164, a novel centriole appendage protein required for

primary cilium formation. J Cell Biol, 179, 321-30.

Kobayashi, T. & Dynlacht, B. D. 2011. Regulating the transition from centriole to

basal body. J Cell Biol, 193, 435-44.

Lau, L., Lee, Y. L., Sahl, S. J., Stearns, T. & Moerner, W. E. 2012. STED microscopy

with optimized labeling density reveals 9-fold arrangement of a centriole

protein. Biophys J, 102, 2926-35.

Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., Dicarlo, J. E., Norville, J. E. &

Church, G. M. 2013. RNA-guided human genome engineering via Cas9.

Science, 339, 823-6.

Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T. & Kanemaki, M. 2009. An

auxin-based degron system for the rapid depletion of proteins in nonplant

cells. Nat Methods, 6, 917-22.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Pan, Y. R. & Lee, E. Y. 2009. UV-dependent interaction between Cep164 and XPA

mediates localization of Cep164 at sites of DNA damage and UV sensitivity.

Cell Cycle, 8, 655-64.

Prosser, S. L. & Morrison, C. G. 2015. Centrin2 regulates CP110 removal in primary

cilium formation. J Cell Biol, 208, 693-701.

Schmidt, K. N., Kuhns, S., Neuner, A., Hub, B., Zentgraf, H. & Pereira, G. 2012.

Cep164 mediates vesicular docking to the mother centriole during early steps

of ciliogenesis. J Cell Biol, 199, 1083-101.

Sillibourne, J. E., Specht, C. G., Izeddin, I., Hurbain, I., Tran, P., Triller, A., Darzacq,

X., Dahan, M. & Bornens, M. 2011. Assessing the localization of centrosomal

proteins by PALM/STORM nanoscopy. Cytoskeleton (Hoboken), 68, 619-27.

Sivasubramaniam, S., Sun, X., Pan, Y. R., Wang, S. & Lee, E. Y. 2008. Cep164 is a

mediator protein required for the maintenance of genomic stability through

modulation of MDC1, RPA, and CHK1. Genes Dev, 22, 587-600.

Slaats, G. G., Ghosh, A. K., Falke, L. L., Le Corre, S., Shaltiel, I. A., Van De Hoek, G.,

Klasson, T. D., Stokman, M. F., Logister, I., Verhaar, M. C., Goldschmeding,

R., Nguyen, T. Q., Drummond, I. A., Hildebrandt, F. & Giles, R. H. 2014.

Nephronophthisis-associated CEP164 regulates cell cycle progression,

apoptosis and epithelial-to-mesenchymal transition. PLoS Genet, 10,

e1004594.

Takata, M., Sasaki, M. S., Sonoda, E., Morrison, C., Hashimoto, M., Utsumi, H.,

Yamaguchi-Iwai, Y., Shinohara, A. & Takeda, S. 1998. Homologous

recombination and non-homologous end-joining pathways of DNA double-

strand break repair have overlapping roles in the maintenance of

chromosomal integrity in vertebrate cells. Embo J, 17, 5497-508.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figures

Figure 1 Wild-type DNA damage sensitivity after AID-mediated depletion of

CEP164

A. Centrosomal localisation of AID-GFP-CEP164 in chicken DT40s (green). Co-

staining was for γ-tubulin (red). DNA was labelled with DAPI (blue). Scale bar, 2 µm.

B. Absence of nuclear AID-GFP-tagged CEP164 signal. Cells were treated with 10

J/ m2 UV irradiation 1 h prior to fixation and staining for γ-H2AX (red) and DNA (blue).

Scale bar, 2 µm.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

C. Auxin-mediated depletion of AID-GFP-CEP164. Immunoblot shows total cell

extracts from cells of the indicated genotype before and 24 h after treatment with 500

µM auxin. α-tubulin was used as a loading control.

D., E. Clonogenic survival assay of cells of the indicated genotype after (D.) IR or

(E.) UV irradiation. Curves show mean + s.d. of three independent experiments.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figure 2 Centrosomal, but not nuclear, localisation of CEP164 in human cells

Localisation of the indicated transiently-transfected tagged CEP164 isoform (green)

in A. hTERT-RPE1 cells and B-D. U2OS cells. Co-staining was for CEP135 or γ-

tubulin (red). Iso., isoform.

E. Immunofluorescence localisation of CEP164 (green) in U2OS cells using rabbit

polyclonal antibodies (Graser et al., 2007). Co-staining was with antibodies for γ-

tubulin (red).

F. Immunofluorescence localisation of CEP164 (red) in hTERT-RPE1 cells using

rabbit polyclonal antibodies (Sigma). Co-staining was for γ-tubulin (green). DNA

was labelled with DAPI (blue). Scale bars, 5 µm.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figure 3 Absence of primary ciliation in CEP164 null hTERT-RPE1 cells

A. Immunoblot analysis of CRISPR-disrupted CEP164 null clones.

B. Absence of CEP164 signal in CEP164 null cells. Cells were stained with mouse

monoclonal 1F3G10 (m) or polyclonal rabbit (r) antibodies to CEP164 then co-

stained with antibodies to CEP135 or centrin2 and for DNA (blue). Scale bar, 5 µm.

C. Immunofluorescence microscopy analysis of primary cilia in cells of the indicated

genotype. After 72 h serum starvation, cells were fixed and stained for detyrosinated

tubulin (green) and centrin2 (red). DNA was visualised with DAPI (blue). Scale bar,

5 µm.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

D. Quantitation of primary ciliation frequency in wild-type, CEP164 null cells and

CEP164 nulls that were stably transfected with CEP164. Cilia were quantitated by

microscopy of detyrosinated tubulin and bar graph indicates the mean + s.d. of three

independent experiments in which at least 100 cells were counted. AS,

asynchronous; SS, serum-starved.

E. TEM analysis of ciliogenesis in cells of the indicated genotype. Panel 1 shows an

assembled primary cilium in wild-type cells; Panel 2 a docked ciliary vesicle; Panels

3 and 4 show mother centrioles in proximity to vesicles without any docking in serum-

starved CEP164-deficient cells. Scale bars, 500 nm.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figure 4 Intact DDR in CEP164 null hTERT-RPE1 cells

A. Clonogenic survival assay of cells of the indicated genotype after UV irradiation.

Curves show mean + s.d. of three independent experiments.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

B., C. Absence of nuclear CEP164 signals after DNA damage. hTERT-RPE1 (B.) or

HeLa (C.) cells were treated with 10 Gy IR or 20 J/m2 UV 1h prior to fixation and

staining for CEP164 (green), γ-H2AX (red) and DNA (blue). Scale bar, 5 µm.