genetic deletion of the tnf receptor p60 or p80 sensitizes ... · yasunari takada and bharat b....

Takada &Aggarwal etal 3/19/03 1

Genetic Deletion of the TNF Receptor p60 or p80 Sensitizes Macrophages to

Lipopolysaccharide-induced Nuclear Factor-kB, Mitogen-Activated Protein Kinases

and Apoptosis

Yasunari Takada and Bharat B. Aggarwal¶

Cytokine Research Section, Department of Bioimmunotherapy, Box 143,

The University of Texas M. D. Anderson Cancer Center,

1515 Holcombe Boulevard, Houston, Texas 77030.

Running title: Deletion of TNFR1 and TNFR2 sensitizes cells to LPS signaling.

Key Words: LPS, TNF, Receptors, NF-kB, MAPK, Apoptosis

¶ To whom correspondence should be addressed:

Phone: 713-792-3503/6459 FAX: 713-794-1613

Email: [email protected]

Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on April 14, 2003 as Manuscript M213237200 by guest on February 18, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Takada etal 3/19/03 2

Abbreviations used: NF-kB, nuclear factor-kB; EMSA, electrophoretic mobility shift

assay; IkB, inhibitory subunit of NF-kB; JNK, c-jun NH2-terminal kinase; MAPK,

mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; LPS,

lipopolysaccharide; TNFR1, TNF receptor type 1 (also called p60); TNFR2, TNF receptor

2 (also called p80); TLR4, toll-like receptor 4; COX2, cyclooxygenase-2; iNOS, inducible

NO synthase; NO, nitric oxide.

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Abstract

Whether deletion of TNF receptor 1 or 2 affects LPS-mediated signaling is not

understood. In this report, we used macrophages derived from wild-type (wt) mice

and from mice null for the type 1 receptor (p60-/-), the type 2 receptor (p80-/-) or both

(p60-/-p80-/-) to investigate the effect of these receptors on LPS-mediated activation of

NF-kB, MAPKs, and apoptosis. LPS activated NF-kB by 3-4 fold in wt cells but by 9-10

fold in p60-/-, p80-/-, and p60-/- p80-/- macrophages. These results correlated with the

IkBa kinase activation which is needed for NF-kB activation. LPS-induced COX2 and

iNOS proteins, and NO production were maximum in p60-/-p80-/- macrophages and

minimum in wt cells. LPS activated JNK, p38MAPK and ERK1/2 in wt cells, but levels

were much higher in p60-/-, p80-/-, or p60-/- p80-/- cells. LPS-induced cytotoxicity,

PARP cleavage, and Annexin V staining, were also highest in p60-/-p80-/- cells and

lowest in wt cells. The difference in LPS signaling was unrelated to the expression of

LPS receptors, CD14 or TLR4. Overall, our studies indicate that deletion of either of the

TNF receptors sensitizes the macrophages to LPS and provide an evidence for a cross-

talk between TNF and LPS signaling.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Introduction

It has been known for decades that Gram-negative bacteria and their component

lipopolysaccharides (LPS) have antitumor properties in vivo, and that these properties

are mediated primarily through production of tumor necrosis factor (TNF) (1, 2). LPS

or endotoxin is a glycolipid, and is an integral component of the outer membrane of

Gram-negative bacteria. LPS mediates a number of biologic manifestations of sepsis,

including fever, hypotension, multiple organ failure, shock, and death (3). These effects

of endotoxin are believed to result from an uncontrolled production of

proinflammatory cytokines produced by cells of the reticuloendothelial system,

particularly macrophages. LPS-dependent macrophage activation results in the release

of TNF, interleukin-1 (IL-1), IL-6, IL-8, IL-10, and IL-12.

LPS interacts with most cells through CD14, a 55-kDa glycophosphatidyl-

inositol-anchored protein expressed on the surface of monocytes and neutrophils (4, 5).

The binding of LPS to CD14 is enhanced by the LPS binding protein (LBP) present in the

serum (5, 6). Mice that lack the CD14 gene show resistance to LPS-induced shock (7).

LPS is then transferred to the transmembrane signaling receptor toll-like receptor 4

(TLR4) and its accessory protein MD2 (8-10). LPS stimulation of human monocytes

activates several intracellular signaling pathways that include the IkB kinase (IKK)-NF-

kB pathway (11-15) and three mitogen-activated protein kinase (MAPK) pathways:

p44/p42MAPK/extracellular signal-regulated kinases 1 and 2 (ERK1/2) (16-21), stress-

activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) (22), and p38MAPK (23,

24).

Both LPS and TNF display several overlapping and nonoverlapping cellular

responses. TNF induces apoptosis in a wide variety of tumor cells (for references see

Ref. 25) whereas LPS is known to induce apoptosis only in certain types of endothelial


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


cells (26). Like TNF, however, LPS also stimulates ceramide release (27), activates

ceramide-activated protein kinase (28) and caspase-1 (29), and induces SAPK/JNK

pathway (17). Both LPS and TNF activate the nuclear transcription factor NF-kB, but

through pathways consisting of similar and dissimilar steps (30). For instance the

inhibitory subunit of NF-kB, IkBb, is more profoundly affected by LPS than by TNF,

whereas IkBa is affected equally by both agents (31).

While LPS is a potent inducer of TNF and some of the apoptotic effects of LPS are

mediated through TNF (32), we have shown that, through the activation of NF-kB, LPS

can suppress TNF-induced apoptosis (33). How TNF modulates LPS-induced cell

signaling is not known. Genetic deletion of TNF receptor 1 (also called p60) or TNF

receptor 2 (also called p80) has been shown to protect mice from low doses of LPS but

not from high doses (34-36). Whether genetic deletion of TNF receptor 1 or 2 also

affects the LPS-mediated signaling is not known. In this report, we used macrophages

derived from wild-type (wt) mice and from mice with genetic deletions of the type 1

receptor gene (p60-/-), the type 2 receptor gene (p80-/-), or both receptor genes (p60-/-

p80-/-) (37). Our goal was to investigate the effect of these genetic deletions on LPS-

mediated activation of NF-kB, MAPKs, and apoptosis. Our results show that the

deletion of TNF receptors sensitizes the cells to LPS-induced signaling, thus providing

evidence of cross-talk.

Experimental Procedures

Materials: LPS (Escherichia coli, 055: B5) and 3-(4, 5-dihydro-6-(4-(3, 4-dimethoxy

benzoyl)-1-piperazinyl)-2(1 H)-quinolinone (MTT) were purchased from Sigma

Chemical (St. Louis, MO). Penicillin, streptomycin, RPMI 1640 medium, and FBS were

obtained from GIBCO BRL (Grand Island, NY). Antibodies to IkBa, p50, p65, cyclin D1,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


p38MAPK, PARP, TLR4, and JNK1 were purchased from Santa Cruz Biotechnology

(Santa Cruz, CA). Antibodies against the phospho-p38MAPK, phospho-ERK1/2 and

ERK1/2 were obtained from Cell Signaling Technology (Beverly, MA). Antibody

against CD14 was purchased from Cell Sciences (Norwood, MA).

Cell lines and culture: Mice with genetic deletion of p60, p80, or both TNF receptors

have been described (34, 35). p80-/-, and p60-/-p80-/- mice were obtained from

Genentech Inc. (South San Francisco, CA), and p60-/- mice were obtained from Jackson

Laboratories (Bar Harbor, ME). Immortalized macrophage cell lines were established

from the bone marrow of wt C57BL/6J mice and its TNFR knockout homozygous mice

(p60-/-, p80-/-, and p60-/-p80-/-) as previously described (37). By using RT-PCR, FACS

analysis, and Western blot analysis, the cells have been shown to lack expression of

TNF receptors as expected (37). All cell lines were cultured in RPMI 1640 medium

supplemented with 10 % FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin.

Cytotoxicity assay (MTT assay): The cytotoxic effects of LPS were determined by the

MTT uptake method as described (38). This assay utilizes the tetrazolium dye, 3-(4, 5-

dihydro-6-(4-(3, 4-dimethoxy benzoyl)-1-piperazinyl)-2(1 H)-quinolinone (MTT), which

is converted enzymatically in mitochondria of viable cells to a blue dye that is insoluble

in water. The resulting crystalline formazan deposits are then solubilized in the

extraction buffer (20 % SDS in 50 % N, N-dimethylformamide) and absorbance is

measured at 580 nM.

Briefly, 5000 cells were incubated in duplicate in 96-well plates in the presence of LPS

for 72 hr at 37 °C. Thereafter, the MTT solution was added to each well. After a 2-hr

incubation at 37 °C, extraction buffer was added, the cells incubated overnight at 37 °C,

and then the OD was measured at 580 nm using a 96-well multiscanner (Dynex Tech.,

MRX Revelation; Chantilly, VA).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Western blot analysis: Thirty to fifty micrograms of cytoplasmic protein extract,

prepared as described (39), was resolved on SDS-PAGE. Then the proteins were

electrotransferred to a nitrocellulose membrane, blocked with 5 % nonfat dry milk, and

probed with first antibodies for 2 hr at 4 oC. The blotting membrane was washed,

exposed to horseradish peroxidase-conjugated secondary antibodies for 1 hr, and the

blots finally detected by chemiluminescence (ECL, Amersham Pharmacia Biotech.

Arlington Heights, IL). For first antibody, we used anti-phospho-p38MAPK, phospho-

ERK1/2, p38MAPK, ERK1/2, iNOS, COX2, CD14, TLR4, and b-actin antibodies.

Electrophoretic mobility shift assay (EMSA): NF-kB activation was analyzed by EMSA

as described previously (40). In brief, 8-mg nuclear extracts prepared from LPS-treated

or untreated cells were incubated with 32P end-labeled 45-mer double-stranded NF-kB

oligonucleotide from human immunodeficiency virus-1 long terminal repeat (5’-

TTGTTACAAGGGACTTTCCGCTGGGGACTTTCCAG GGAGGCGTGG- 3’; underlined

sequence is binding site) for 15 min at 37 oC, and the DNA-protein complex resolved in

a 6.6 % native polyacrylamide gel. The specificity of binding was examined by

competition with unlabeled 100-fold excess oligonucleotide and with mutant

oligonucleotide. The composition and specificity of binding was also determined by

supershift of the DNA-protein complex using specific and irrelevant antibodies. For

supershift experiment, the antibody-treated samples of NF-kB were resolved on a 5.0 %

native gel. The radioactive bands from the dried gels were visualized and quantitated

by PhosphorImager (Molecular Dynamics, Sunnyvale, CA) using ImageQuant

software.

IKK assay: The IKK assay was performed by a method described previously (41).

Briefly, IKK complex from cytoplasmic extract was precipitated with antibody against


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


IKKa followed by treatment with protein A/G-Sepharose beads (Pierce; Rockford, IL).

After a 2-hr incubation, the beads were washed with lysis buffer and then assayed in

kinase assay mixture containing 50 mM HEPES (pH 7.4), 20 mM MgCl2, 2 mM DTT, 20

mCi [g-32P] ATP, 10 mM unlabeled ATP, and 2 mg of substrate GST-IkBa. After incubation

at 30 oC for 30 min, the reaction was terminated by boiling with SDS sample buffer for 5

min. Finally, the protein was resolved on 10 % SDS-PAGE, the gel was dried, and the

radioactive bands were visualized by PhosphorImager. To determine the total

amounts of IKK in each sample, 30 mg of the cytoplasmic extract was resolved by 7.5 %

SDS-PAGE, electrotransferred to nitrocellulose membrane, and then blotted with either

anti-IKKa or IKKb antibodies.

c-Jun Kinase assay: The c-Jun kinase assay was performed by a modified method as

described earlier (38). Briefly, 200 mg of whole-cell extract was treated with anti-JNK1

antibodies, and the immunecomplexes so formed were precipitated with protein A/G-

Sepharose beads (Pierce Chemical). The kinase assay was performed using washed

beads as source of enzyme and GST-Jun (1-79) as substrate (2 mg/sample) in the

presence of 10 mCi [g-32P]ATP per sample. The kinase reaction was carried out by

incubating the above mixture at 30 oC in the kinase assay buffer for 15 min. The

reaction was stopped by adding SDS sample buffer, followed by boiling. Finally,

protein was resolved on a 10 % reducing gel. The radioactive bands of the dried gel

were visualized and quantitated by phosphorImager as described above.

NO production assay: The concentration of stable nitrite, the end product from NO

generation by macrophages, was determined by Griess reaction (42). Equal volumes of

test supernatant and Griess reagent (Sigma Chemical) were mixed and kept at room

temperature for 15 min in 96-well plates. The absorbance at 530 nm was then


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


determined, quantified by extrapolation from a sodium nitrite standard curve in each

experiment and expressed as mM/mg protein.

Anexin V staining: To determine the LPS-induced apoptosis, annexin V staining was

performed. Cells were treated with 0.1 mg/ml LPS for 12 hr, and then incubated with

FITC-conjugated Annexin V in reaction buffer (Santa Cruz) for 15 min. Cells were

trypsinized, and analyzed using FACScaliber flow cytometer (Becton Dickinson, San

Jose, CA).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Results

Genetic deletion of either p60 TNF receptor 1 or p80 TNF receptor 2 has been

shown to protect mice from low doses of LPS but not from high doses (34-36).

Therefore the aim of the present study was to investigate the role of TNF receptor in

LPS-induced cell signaling. To understand the role of each type of TNF receptor, we

used macrophage cell lines isolated from mice in which the genes for either or both

receptors were deleted. We have recently characterized and these cells and described

the TNF signaling in them (37).

Deletion of TNF receptors sensitizes macrophages to LPS-induced activation of NF-

kB: Activation of NF-kB is one of the earliest events induced by LPS in most cells.

Whether LPS-induced NF-kB activation is modulated by individual TNF receptors was

investigated. We treated a wt macrophage cell line and its TNF receptor-deficient

variants with LPS, prepared the nuclear extracts, and analyzed them by EMSA for NF-

kB. Dose-dependent activation of NF-kB occurred in wt cells, in single-gene knockout

cells, and in double-gene knockout cells (Fig. 1A, left panel). The level of NF-kB

activation, however, varied. Maximum activation observed with wt, p60-/-, p80-/-, and

p80-/-p60-/- cells was 3.2-fold, 8.7-fold, 7.1-fold, and 9.7-fold, respectively. As shown in

Fig. 1A (right panel), time-dependent activation of NF-kB occurred in all cell types, but

again the level of NF-kB activation varied. Maximum activation observed with wt, p60-

/-, p80-/-, and in p80-/-p60-/- cells, was 4.7-fold, 10.4-fold, 9.6-fold, and 9.9-fold,

respectively. The dose-response and time-course of LPS-induced NF-kB activation

clearly show that wt cells are least sensitive to LPS and those with TNF receptor

deletion (p60, p80 or both) are maximally sensitive (Fig. 1B).

EMSA of nuclear extracts prepared from LPS-treated cells showed that either anti-


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


p50 or anti-p65 antibodies supershifted the NF-kB/DNA complex, whereas preimmune

sera (PIS) or irrelevant anti-cyclin D1 antibodies had no effect (Fig. 1C). Thus, NF-kB

induced by LPS in macrophages derived from C57BL/6J mice contained both the p50

and p65 (RelA) subunits. The specificity of the LPS-induced NF-kB/DNA complex was

further confirmed by demonstrating that the binding was disrupted in the presence of a

100-fold excess of unlabeled kB-oligonucleotide (Fig. 1C, Competitor) but not by mutant

oligonucleotide (Mutant oligo). Additionally, when compared with wt, the p60-/-, p80-/-,

and p80-/-p60-/- cells showed an induction of an additional NF-kB band by LPS (see Fig.

1A). This band consisted of p50-p50 homodimer as revealed by supershift analysis

(data not shown).

Deletion of TNF receptors sensitizes macrophages to LPS-induced activation of

IkBa kinase: Activation of NF-kB requires the activation of IkBa kinase (IKK).

Whether LPS-induced IKK activation is modulated by individual TNF receptors was

investigated. We treated wt and TNF receptor-deficient variants with 0.1 mg/ml of LPS

for different times, prepared the whole extracts, and analyzed them for IKK by

immunecomplex kinase assays. As shown in Fig. 2, time-dependent activation of NF-

kB occurred in wt cells and in all TNFR knockout cells. The level of IKK activation,

however, varied. Maximum activation observed with wt, p60-/-, p80-/- and in p60-/-p80-

/- cells, was 2.5-fold, 3.1-fold, 5.8-fold, and 4.5-fold, respectively. The kinetics of IKK

activation was slightly slower in wt cells (15 min) than in TNF receptor-deleted cells (15

min). The lower panels represent loading controls and indicated that IKK activation in

cells was not due to change in the expression of IKKa and IKKb proteins. These results

suggest that LPS-induced IKK activation was enhanced by the deletion of the TNF

receptors, and this enhancement correlated with NF-kB activation.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Deletion of TNF receptors sensitizes macrophages to LPS-induced NO production: The

LPS-inducible NO synthase (iNOS) in macrophages is known to be regulated by NF-kB

(43). We first determined whether TNF receptor had any effect on LPS-induced NO

production in macrophages. Macrophages were cultured for 48 hr in the presence of

different concentrations of LPS, and NO production was assayed by using Griess

reagent. LPS induced NO production in a dose-dependent manner in all macrophage

cell lines, but the induction was lowest in wt cells and highest in cells where both TNF

receptors were deleted (Fig 3A). Maximum induction observed was 12.6-fold 20.1-fold

39.6-fold and 45.5-fold in wt, p60-/-, p80-/- and p60-/-p80-/- cells at an LPS concentration

of 1 mg/ml.

We also investigated the effect of TNF receptors on LPS-induced iNOS protein

expression. Cells were treated with 0.01 mg/ml of LPS for different times or with

various concentrations of LPS for 24 hr, and iNOS expression was determined by

Western blot analysis. LPS induced iNOS expression in dose- and time-dependent

manner (Fig. 3 B). The induction was less in wt and in p60-/- cells as than in p80-/- or

p60-/-p80-/- cells. These results are in agreement with those for NO production, and

demonstrate that TNF receptors suppressed LPS-induced activation of macrophages.

The deletion of p80 receptor had a more pronounced effect on LPS-induced NO

production and iNOS expression, than deletion of the p60 receptor.

Deletion of TNF receptors sensitizes macrophages to LPS-induced COX2 expression:

Cyclooxygenase-2 (COX2) is another inflammatory gene that is regulated by NF-kB

and induced by LPS (44). Whether LPS-induced COX2 expression is modulated by TNF

receptors was investigated. Western blot analysis indicated that LPS induced COX2

expression in a dose- and time-dependent manner (Fig. 4). The induction was least in


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


wt and p60-/- cells and greatest in p80-/- or p60-/-p80-/- cells. These results demonstrate

that the presence of TNF receptors suppressed LPS-induced activation of macrophages.

Deletion of TNF receptors sensitizes macrophages to LPS-induced activation JNK:

Activation of JNK is one of the earliest events induced by LPS in most cells (22). To

explore the specific role of TNF receptors in LPS-induced JNK activation, we treated the

wt macrophage cell line and its TNF receptor-deficient variants with LPS (0.1 mg/ml) for

various times, prepared whole-cell extracts, immunoprecipitated the JNK, and analyzed

them for JNK by immunecomplex kinase assay. Time-dependent activation of JNK

occurred in all cell types (Fig 5), but the level of JNK activation, varied. Maximum

activation observed with wt, p60-/-, p80-/-, and p80-/-p60-/- cells was 2-fold, 3.4-fold, 4.1-

fold and 4.2-fold, respectively. Thus our results suggest that, like NF-kB activation,

activation of JNK by LPS is modulated by both TNF receptors.


p38MAPK: Like JNK, p38MAPK is a Ser/Thr protein kinase activated rapidly by LPS

(23). To explore the specific role of TNF receptors in LPS-induced p38MAPK activation,

we treated the wt macrophage cell line and its TNF receptor-deficient variants with LPS

(0.1 mg/ml) for various times and performed Western blot analysis using phospho

(Tyr/Thr)-specific p38MAPK antibodies. As shown in Fig. 6, time-dependent activation

of p38MAPK occurred in all cell types. Maximum activation observed with wt, p60-/-,

p80-/-, and p80-/-p60-/- cells, was 2.6-fold, 3.4-fold, 3.4-fold and 3.8-fold, respectively.

Once again, our results suggest that, activation of a kinase by LPS is modulated by both

TNF receptors.


ERK1/2: Through the Ras/Raf/MAPK kinase (MEK) cascade, LPS can activate ERK1/2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


(21). To explore the specific role of TNF receptors in LPS-induced ERK1/2 activation,

we treated the wt macrophage cell line and its TNF receptor-deficient variants with LPS

(0.1 mg/ml) for different times, and performed western blot analysis using phospho

(Tyr/Thr)-specific ERK1/2 antibody. As shown in Fig. 7, time-dependent activation of

ERK1/2 occurred in all cell types. Maximum activation observed with wt, p60-/-, p80-/-,

and p80-/-p60-/- cells, was 1.6-fold, 1.6-fold, 3.1-fold and 3.1-fold, respectively.

Activation could be seen as early as 5 min. Thus, activation of still another kinase by

LPS is modulated by both TNF receptors.

Deletion of TNF receptors sensitizes macrophages to LPS-induced apoptosis: LPS is

known to induce apoptosis in certain cell types (26, 32). To determine the effect of TNF

receptors on LPS-induced cytotoxicity, all cell types were incubated for 72 hr in the

presence of different concentrations of LPS, and then cell viability was assayed by MTT

uptake. LPS decreased cell viability in all cell types in a dose-dependent manner (Fig.

8A). The maximum cytotoxicity observed on treatment of wt, p60-/-, p80-/-, and p80-/-

p60-/- cells with 1 mg/ml LPS, was 10 %, 30 %, 50 %, and 70 %, respectively. As little as

0.01 mg/ml LPS killed 60 % of the p60-/-p80-/- cells. These results suggest that TNF

receptors protect cells from LPS-induced cytotoxicity.

The cytotoxic effects of LPS in most cells are mediated through the activation of

caspases, which degrade various substrates including PARP. To determine the effect of

TNF receptors on LPS–induced caspase activation, cells were treated with LPS at a

concentration of 0.03 mg/ml for various times and then examined for PARP cleavage by

Western blot analysis. LPS cleaved PARP in a dose-dependent manner in all cell types

(Fig. 8B). The amount of 85-kDa protein gradually increased until the 24 hr point, being

highest in p80-/- and in p60-/-p80-/- cells at 12 hr. These results indicate that TNF


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


receptor-deletion also sensitizes the cells to LPS-induced caspase activation.

We also investigated the effect of TNF receptors on the LPS-induced apoptosis

using Annexin V staining. On treatment of wt, p60-/-, p80-/-, and p80-/-p60-/- cells with

0.1 mg/ml LPS for 12 h, Annexin V-positive cells increased to 0.7 %, 15.3 %, 33.7%, and

55.9 %, respectively. Thus the cells in which both receptors were deleted were

maximally sensitive to LPS as indicated also by the Annexin V staining assay (Fig. 8C).

Deletion of TNF receptors have no effect on the expression of CD14 and TLR4: Our

results to this point indicated that deletion of TNF receptors sensitized macrophages to

LPS-induced activation of NF-kB, IKK, JNK, p38MAPK, ERK1/2, and apoptosis. It was

possible, however, that this sensitization was due to the upregulation of LPS receptor

induced by the deletion of TNF receptors, in an as yet undiscovered compensatory

mechanism. Previous studies reported that LPS mediates its signaling through CD14

and TLR4 (7, 8). To determine the expression of CD14 and TLR4 in our TNF receptor-

deleted macrophages, we prepared whole-cell extracts and performed Western blot

analysis using anti-CD14 and TLR4 antibodies. All the macrophage cell lines expressed

both CD14 and TLR4 (Fig. 9), and there were no significant differences in the expression

of these proteins between different cell types. These results thus indicate that the

difference in responsive of different cell types to LPS is independent of the expression

levels of LPS receptors, CD14 and TLR4.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Discussion

Gene deletion studies have shown that deletion of TNF receptor p60 or p80 induces

resistance in mice to low levels of LPS. We investigated how LPS signaling is affected

by the individual TNF receptors. We demonstrate that LPS-induced activation of NF-

kB, IKK, JNK, p38MAPK, and ERK1/2 were potentiated in macrophages in which the

p60 TNF receptor or p80 TNF receptor or both receptors were deleted. Deletion of

TNF receptors also enhanced the LPS-induced NO production, iNOS and COX2

expression. LPS-induced apoptosis as indicated by cell viability, PARP cleavage and

Annexin V staining was also increased in TNF receptor-deleted cells. The difference in

LPS signaling between wt and TNF receptor-deleted cells was unrelated to the

expression of the LPS receptors TLR4 and CD14. These studies indicate that deletion of

either of the TNF receptors sensitizes the cells to LPS and suggests a cross-talk between

TNF and LPS signaling.

The deletion of p60 and p80 receptors had variable effects on LPS signaling. The

deletion of p60 receptor had more pronounced effect than deletion of p80 receptor on

LPS-induced NF-kB activation; while reverse was the case for LPS-induced JNK

activation, NO production and for apoptosis. The precise basis for this differential effect

is not clear.

How TNFR potentiates LPS-induced NF-kB activation is not clear. LPS activates NF-

kB through sequential interaction with CD14, TLR4, Myeloid differentiation factor 88

(MyD88), MyD88-adapter-like (Mal), IL-1 receptor-associated kinase-1 (IRAK-1), TRAF6,

NF-kB-inducing kinase (NIK), and IKK, thus leading to NF-kB activation (15, 45). In

contrast TNF activates NF-kB through sequential interactions with TNFR p60 with TNF

receptor-associated death domain (TRADD), receptor-interacting protein (RIP), and IKK

leading to NF-kB activation (46-49). How TNFR p80 which lacks the death domain and


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


thus does not interact with TRADD, activates NF-kB is not understood. The

sensitization of the TNFR-depleted cells does not appear to have been mediated

through the lack of either CD14 or TLR4, as these receptors were expressed to equal

extents in all cells. It is possible, however, that TNFR negatively regulates LPS-induced

NF-kB activation by sequestering the LPS signaling proteins leading to NF-kB

activation. For instance TNFR1 has a death domain that can potentially interact with

other death domain-containing proteins such as MyD88 and IRAK-1. This possibility,

however, seems unlikely since deletion of TNFR2, which does not have a death domain,

was at least as effective as deletion of TNFR1 in potentiating the LPS-induced NF-kB

activation. Another possibility is that LPS induces negative regulators of cell signaling

that binds to TNF receptors such as suppressor of death domain (SODD; (50)).

We found that deletion of TNF receptors sensitized the cells to LPS-induced JNK,

p38MAPK, and ERK1/2. The activation of JNK, p38MAPK, and ERK1/2 by LPS has

been shown to require interaction with TNF receptor-associated factor 6 (TRAF6); and

that by TNF to require TRAF2. It is possible that enhanced sensitivity of cells to LPS

was due to enhanced production of TNF resulting from higher NF-kB activation in

TNFR-deleted cells. This is unlikely, however, firstly because the kinetics of NF-kB

activation and MAPKs is comparable; secondly, even if TNF is produced it would be

nonfunctional due to lack of TNFR.

We demonstrated that LPS-induced NO production and iNOS expression, was

enhanced in TNF receptor-deleted cells. The deletion of p80 receptor had more

pronounced effect on NO production than the deletion of p60 receptor (see Fig. 3A).

These results may explain why animals with deleted TNF receptors are protected from

LPS-mediated toxicity (34-36). This protection may be provided by the higher levels of

NO being produced. Additionally we found that LPS-induced COX2 expression, was


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


enhanced in TNF receptor-deleted cells, which may result in enhanced prostaglandin E 2

(PGE2) production and protection of animals from LPS-mediated toxicity. We found

that LPS-induced apoptosis was also enhanced by the deletion of TNF receptors.

Interestingly, p80 receptor deletion (which lacks a death domain) was more effective

than p60 receptor deletion (see Fig. 8A) in enhancing LPS-induced cytotoxicity; deletion

of both receptors was maximally effective. How TNF receptor-deletion enhances the

LPS-induced cytotoxcity is unclear. LPS has been shown to induce apoptosis in

macrophages mostly through the autocrine production of TNF (32). This mechanism,

however, is unlikely because if TNF is produced in an autocrine fashion, it would be

nonfunctional without the TNF receptors.

The presence of the p60 receptor is required for resistance to Listeria

monocytogenes, Mycobacterium tuberculosis, and Toxoplasma gondii (34, 36, 51, 52). Like our

wt controls, TNFR p80-/- mice were resistant to L. monocytogenes (35). However, in

contrast to control mice, they were found to be resistant to TNF-induced skin necrosis

(35). TNF signaling appears to be critical for protection against a large number of other

infections by microorganisms (53-55). It is possible that some of these effects are

mediated through cross-talk between TNF and LPS. Our results show that the deletion

of TNF receptors makes the cells hypersensitive to LPS. Overall, our results clearly

demonstrate that in macrophages, the deletion of either of the TNF receptors sensitizes

the cells to the LPS-induced activation of NF-kB, JNK, p38MAPK, ERK1/2 and for the

apoptosis.

Acknowledgment: We will like to thank Walter Pagel for careful review of the

manuscript. This research was conducted with support from The Clayton Foundation


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


for Research.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


References

1. Carswell, E.A., L.J. Old, R.L. Kassel, S. Green, N. Fiore, and B. Williamson. 1975.

Proc Natl Acad Sci U S A 72:3666-3670.

2. Goeddel, D.V., B.B. Aggarwal, P.W. Gray, D.W. Leung, G.E. Nedwin, M.A.

Palladino, J.S. Patton, D. Pennica, H.M. Shepard, B.J. Sugarman, and Wong, G.H.W

1986. Cold Spring Harb Symp Quant Biol 51 Pt 1:597-609.

3. Morrison, D.C., and J.L. Ryan. 1987. Annu Rev Med 38:417-432.

4. Haziot, A., S. Chen, E. Ferrero, M.G. Low, R. Silber, and S.M. Goyert. 1988. J

Immunol 141:547-552.

5. Wright, S.D., R.A. Ramos, P.S. Tobias, R.J. Ulevitch, and J.C. Mathison. 1990.

Science 249:1431-1433.

6. Hailman, E., H.S. Lichenstein, M.M. Wurfel, D.S. Miller, D.A. Johnson, M. Kelley,

L.A. Busse, M.M. Zukowski, and S.D. Wright. 1994. J Exp Med 179:269-277.

7. Haziot, A., E. Ferrero, F. Kontgen, N. Hijiya, S. Yamamoto, J. Silver, C.L.

Stewart, and S.M. Goyert. 1996. Immunity 4:407-414.

8. Poltorak, A., X. He, I. Smirnova, M.Y. Liu, C.V. Huffel, X. Du, D. Birdwell, E.

Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton,

and B. Beutler. 1998. Science 282:2085-2088.

9. Qureshi, S.T., L. Lariviere, G. Leveque, S. Clermont, K.J. Moore, P. Gros, and D.

Malo. 1999. J Exp Med 189:615-625.

10. Yang, H., D.W. Young, F. Gusovsky, and J.C. Chow. 2000. J Biol Chem 275:20861-

20866.

11. Muller, J.M., H.W. Ziegler-Heitbrock, and P.A. Baeuerle. 1993. Immunobiology

187:233-256.

12. Swantek, J.L., L. Christerson, and M.H. Cobb. 1999. J Biol Chem 274:11667-11671.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


13. O'Connell, M.A., B.L. Bennett, F. Mercurio, A.M. Manning, and N. Mackman.

1998. J Biol Chem 273:30410-30414.

14. Hawiger, J., R.A. Veach, X.Y. Liu, S. Timmons, and D.W. Ballard. 1999. Blood

94:1711-1716.

15. Fischer, C., S. Page, M. Weber, T. Eisele, D. Neumeier, and K. Brand. 1999. J Biol

Chem 274:24625-24632.

16. Liu, M.K., P. Herrera-Velit, R.W. Brownsey, and N.E. Reiner. 1994. J Immunol

153:2642-2652.

17. Swantek, J.L., M.H. Cobb, and T.D. Geppert. 1997. Mol Cell Biol 17:6274-6282.

18. Marie, C., S. Roman-Roman, and G. Rawadi. 1999. Infect Immun 67:688-693.

19. Durando, M.M., K.E. Meier, and J.A. Cook. 1998. J Leukoc Biol 64:259-264.

20. van der Bruggen, T., S. Nijenhuis, E. van Raaij, J. Verhoef, and B.S. van Asbeck.

1999. Infect Immun 67:3824-3829.

21. Geppert, T.D., C.E. Whitehurst, P. Thompson, and B. Beutler. 1994. Mol Med 1:93-

103.

22. Hambleton, J., S.L. Weinstein, L. Lem, and A.L. DeFranco. 1996. Proc Natl Acad Sci

U S A 93:2774-2778.

23. Han, J., J.D. Lee, L. Bibbs, and R.J. Ulevitch. 1994. Science 265:808-811.

24. Ono, K., and J. Han. 2000. Cell Signal 12:1-13.

25. Aggarwal, B.B., and K. Natarajan. 1996. Eur Cytokine Netw 7:93-124.

26. Haimovitz-Friedman, A., C. Cordon-Cardo, S. Bayoumy, M. Garzotto, M.

McLoughlin, R. Gallily, C.K. Edwards, 3rd, E.H. Schuchman, Z. Fuks, and R.

Kolesnick. 1997. J Exp Med 186:1831-1841.

27. Wright, S.D., and R.N. Kolesnick. 1995. Immunol Today 16:297-302.

28. Joseph, C.K., S.D. Wright, W.G. Bornmann, J.T. Randolph, E.R. Kumar, R.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Bittman, J. Liu, and R.N. Kolesnick. 1994. J Biol Chem 269:17606-17610.

29. Schumann, R.R., C. Belka, D. Reuter, N. Lamping, C.J. Kirschning, J.R. Weber,

and D. Pfeil. 1998. Blood 91:577-584.

30. Baeuerle, P.A., and V.R. Baichwal. 1997. Adv Immunol 65:111-137.

31. Thompson, J.E., R.J. Phillips, H. Erdjument-Bromage, P. Tempst, and S. Ghosh.

1995. Cell 80:573-582.

32. Xaus, J., M. Comalada, A.F. Valledor, J. Lloberas, F. Lopez-Soriano, J.M. Argiles,

C. Bogdan, and A. Celada. 2000. Blood 95:3823-3831.

33. Manna, S.K., and B.B. Aggarwal. 1999. J Immunol 162:1510-1518.

34. Pfeffer, K., T. Matsuyama, T.M. Kundig, A. Wakeham, K. Kishihara, A.

Shahinian, K. Wiegmann, P.S. Ohashi, M. Kronke, and T.W. Mak. 1993. Cell

73:457-467.

35. Erickson, S.L., F.J. de Sauvage, K. Kikly, K. Carver-Moore, S. Pitts-Meek, N.

Gillett, K.C. Sheehan, R.D. Schreiber, D.V. Goeddel, and M.W. Moore. 1994.

Nature 372:560-563.

36. Rothe, J., W. Lesslauer, H. Lotscher, Y. Lang, P. Koebel, F. Kontgen, A. Althage,

R. Zinkernagel, M. Steinmetz, and H. Bluethmann. 1993. Nature 364:798-802.

37. Mukhopadhyay, A., J. Suttles, R.D. Stout, and B.B. Aggarwal. 2001. J Biol Chem

276:31906-31912.

38. Manna, S.K., H.J. Zhang, T. Yan, L.W. Oberley, and B.B. Aggarwal. 1998. J Biol

Chem 273:13245-13254.

39. Majumdar, S., and B.B. Aggarwal. 2001. J Immunol 167:2911-2920.

40. Chaturvedi, M.M., A. Mukhopadhyay, and B.B. Aggarwal. 2000. Methods Enzymol

319:585-602.

41. Ashikawa, K., S. Majumdar, S. Banerjee, A.C. Bharti, S. Shishodia, and B.B.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Aggarwal. 2002. J Immunol 169:6490-6497.

42. Ding, A.H., C.F. Nathan, and D.J. Stuehr. 1988. J Immunol 141:2407-2412.

43. Xie, Q.W., Y. Kashiwabara, and C. Nathan. 1994. J Biol Chem 269:4705-4708.

44. Hwang, D. 2001. Faseb J 15:2556-2564.

45. Fitzgerald, K.A., E.M. Palsson-McDermott, A.G. Bowie, C.A. Jefferies, A.S.

Mansell, G. Brady, E. Brint, A. Dunne, P. Gray, M.T. Harte, D. McMurray, D.E.

Smith, J.E. Sims, T.A. Bird, and L.A. O'Neill. 2001. Nature 413:78-83.

46. Hsu, H., J. Xiong, and D.V. Goeddel. 1995. Cell 81:495-504.

47. Hsu, H., H.B. Shu, M.G. Pan, and D.V. Goeddel. 1996. Cell 84:299-308.

48. Hsu, H., J. Huang, H.B. Shu, V. Baichwal, and D.V. Goeddel. 1996. Immunity

4:387-396.

49. Takeuchi, M., M. Rothe, and D.V. Goeddel. 1996. J Biol Chem 271:19935-19942.

50. Jiang, Y., J.D. Woronicz, W. Liu, and D.V. Goeddel. 1999. Science 283:543-546.

51. Flynn, J.L., M.M. Goldstein, J. Chan, K.J. Triebold, K. Pfeffer, C.J. Lowenstein, R.

Schreiber, T.W. Mak, and B.R. Bloom. 1995. Immunity 2:561-572.

52. Yap, G.S., T. Scharton-Kersten, H. Charest, and A. Sher. 1998. J Immunol 160:1340-

1345.

53. Nashleanas, M., S. Kanaly, and P. Scott. 1998. J Immunol 160:5506-5513.

54. Vieira, L.Q., M. Goldschmidt, M. Nashleanas, K. Pfeffer, T. Mak, and P. Scott.

1996. J Immunol 157:827-835.

55. Deckert-Schluter, M., H. Bluethmann, A. Rang, H. Hof, and D. Schluter. 1998. J

Immunol 160:3427-3436.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Legend to Figures

Fig. 1. Deletion of TNF receptors enhances LPS-induced activation of NF-kB. A.

Dose- and time-dependent NF-kB activation by LPS in wild-type and TNF receptor-

deleted macrophages. One million cells were treated with various concentrations of

LPS for 15 min or for the indicated times with LPS (1 mg/ml). Nuclear extracts were

prepared and analyzed for NF-kB activation by EMSA as described in Materials &

Methods. B. Graphical representation of the results shown in panel A. C. Supershift

and specificity of NF-kB. Nuclear protein was extracted from untreated or LPS-treated

(1 mg/ml) wild-type macrophages, incubated for 15 min with different antibodies and

nonlabeled NF-kB oligo probe, and then assayed for NF-kB activity by EMSA as

described.

Fig. 2. Deletion of TNF receptors enhances the LPS-induced activation of IkBa kinase.

One million cells were treated with 0.03 mg/ml of LPS for the indicated times. Two

hundred micrograms of cytoplasmic extract was treated with anti-IKKa antibody and

then immunoprecipitated with protein A/G-Sepharose beads. The beads were washed

and subjected to kinase assay as described under Experimental Procedures. Thirty

micrograms of the same protein extracts was fractionated on 7.5 % SDS-PAGE and

electrotransferred to a nitrocellulose membrane. Western blot analysis was performed

using anti-IKKa and IKKb antibodies.

Fig. 3. Deletion of TNF receptors potentiates LPS-induced NO production and

induction of iNOS expression. A. Effect of LPS on the production of NO in wild-type

and on TNF receptor-deleted macrophages. One million cells were treated with various


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


concentrations of LPS for 48 hr. Cultured medium was collected, and NO production

was determined using Griess reagent as described in Experimental Procedures. B.

Effect of LPS on the expression of iNOS in wt and TNF receptor-deleted macrophages.

One million cells were treated with 0.01 mg/ml LPS for the indicated times (left panel) or

various concentrations of LPS for 24 hr (right panel). Thirty micrograms of whole-cell

extract was fractionated on 7.5 % SDS-PAGE and electrotransferred to a nitrocellulose

membrane. Western blot analysis was performed using anti-iNOS antibody as

described in Experimental Procedures.

Fig. 4. Deletion of TNF receptors potentiates LPS-induced COX2 expression. One

million wild-type or TNF receptor deleted cells were treated with 0.01 mg/ml LPS for

the indicated times (left panel) or with the indicated concentrations of LPS for 24 hr

(right panel). Thirty micrograms of whole-cell extract was fractionated on 7.5 % SDS-

PAGE and electrotransferred to a nitrocellulose membrane. Western blot analysis was

performed using anti-COX2 antibody as described in Experimental Procedures.

Fig. 5. Deletion of TNF receptors sensitizes LPS-induced activation JNK. One million

wild-type or TNF receptor-deleted cells were treated with 0.03 mg/ml of LPS for the

indicated times. Two hundred micrograms of whole-cell lysate was treated with anti-

JNK1 antibody and then immunoprecipitated with protein A/G-Sepharose beads. The

beads were washed and subjected to kinase assay as described under Experimental

Procedures. Thirty micrograms of the same protein extract was fractionated on 10 %

SDS-PAGE and electrotransferred to a nitrocellulose membrane. Western blot analysis

was performed using anti-JNK1 antibody.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Fig. 6. Deletion of TNF receptors sensitizes macrophages to LPS-induced activation

p38MAPK. One million wild-type and TNF receptor-deleted cells were treated with

0.03 mg/ml of LPS for the indicated times. Thirty micrograms of whole-cell extract was

fractionated on 10 % SDS-PAGE and electrotransferred to a nitrocellulose membrane.

Western blot analysis was performed using phospho-specific anti-p38MAPK antibody

as described in Experimental Procedures. The same membrane was reblotted with anti-

p38MAPK antibody.

Fig. 7. Deletion of TNF receptors sensitizes macrophages to LPS-induced activation

ERK1/2. One million wild-type or TNF receptor-deleted cells were treated with 0.03

mg/ml of LPS for the indicated times. Thirty micrograms of whole-cell extract was

fractionated on 10 % SDS-PAGE and electrotransferred to a nitrocellulose membrane.

Western blot analysis was performed using phospho-specific anti-ERK1/2 antibody as

described in Experimental Procedures. The same membrane was reblotted with anti-

ERK1/2 antibody.

Fig 8. Deletion of TNF receptors sensitizes macrophages to LPS-induced apoptosis. A.

Effect of LPS on the cell viability of wild-type and TNF receptor-deleted macrophages.

Five thousand cells were in 0.1 ml in 96-well plates were exposed to the indicated

concentrations of LPS for 72 hr in duplicate, and cell viability was determined using the

MTT assay as described under Experimental Procedures. B. Effect of LPS on PARP

cleavage in wild-type and TNF receptor-deleted macrophages. One million cells were

treated with LPS (0.03 mg/ml) for the indicated times. Whole-cell lysates were

extracted, and 30 mg samples of each were fractionated on 7.5 % SDS-PAGE and

electrotransferred to a nitrocellulose membrane. Western blot analysis was then


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


performed using anti-PARP antibody. The bands shown in the figure were at 116-kDa,

which was cleaved into 85-kDa. C. Effect of LPS on apoptosis in wild-type and TNF

receptor-deleted mouse macrophages. Cells were treated with 0.1 mg/ml LPS for 12 hr

(Annexin V) and then analyzed by Annexin V staining using FACSCaliber.

Fig. 9. Deletion of TNF receptors has no effect on the expression of CD14 and TLR4.

Whole-cell extracts were prepared from wild-type and TNF receptor-deleted

macrophages, 50 mg protein was fractionated on SDS-PAGE and electrotransferred to a

nitrocellulose membrane, and analyzed by Western blot analysis using anti-CD14 and

anti-TLR4 antibodies.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

p60-/-

p60-/-p80-/-

Wt

p80-/-

0 15 30 60 120 time (min)

NF-kB

1 4.1 4.3 4.7 3.3

1 10.4 10.5 7.2 5.7

1 9.6 7.7 7 5.7

1 9.3 9.9 8.8 6.7

0 0.01 0.1 1 10 (mg/ml)

1 1.2 5.5 9.7 8.8

1 1.3 2.5 3.2 3.3

1 1.2 8.5 8.7 8.6

1 2 5.8 7.1 7

Fold

Fold

Fold

Fold

F1A

A


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

0

4

8

12

0 0.01 0.1 1 10LPS (mg/ml)

Fold

NF-

kB a

ctiv

atio

n

0

4

8

12

0 15 30 60 120Time (min)

B

Free

pro

be

Unt

reat

ed

TNF

Ant

i-p65

Ant

i-p50

Ant

i-p65

/p50

Ant

i-Cyc

lin D

1

PIS

Com

petit

or

Mut

ant o

ligo

NF-kB

C

F1B, 1C

(EM

SA)

Wt

p60-/-p80-/-

p60-/-

p80-/-

Wt

p60-/-

p80-/-

p60-/-p80-/-


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

p60-/-

p60-/-p80-/-

Wt

p80-/-

1 1 1.2 2.4 2.5 Fold

0 5 10 15 30 time (min)

GST-IkBa

IKKa

IKKb

1 1.3 3 3.1 2.6

0 5 10 15 30 time (min)

1 1.9 5.8 2.3 2.3

0 5 10 15 30 time (min)

1 1.6 3.4 4.5 3.1

0 5 10 15 30 time (min)

F2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

LPS (mg/ml)

Wt

p60-/-

p80-/-

p60-/-p80-/-

A

B

F3

b-actin

NO

pro

duct

ion

(fol

d)

0 0.01 0.03 0.3 1 (mg/ml)iNOS

0 6 12 24 48 time (hr)

Wt

p60-/-

p80-/-

p60-/p80-/-

0 0.01 0.03 0.1 0.3 10

10

20

30

40

50


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

F4

0 0.01 0.03 0.3 1 (mg/ml)

Wt

p60-/-

p80-/-

p60-/-p80-/-

0 4 8 16 24 time (hr)

b-actin

COX2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

p60-/-

p60-/-p80-/-

Wt

p80-/-

0 5 10 15 30 time (min)

1 1.8 2.8 3.4 3

F5

1 1 1.4 1.7 2 Fold

0 5 10 15 30 time (min)

GST-Jun (1-79)

JNK 1

1 2.1 3.5 4.1 3.2

1 2 3.9 4.2 4.2

0 5 10 15 30 time (min)

0 5 10 15 30 time (min)


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

phospho-p38MAPK

p38MAPK

Wt

p60-/-

p80-/-

p60-/-p80-/-

1 1.2 1.4 2.6 2.4 Fold

1 3.4 3.2 3.8 2.8

1 3.4 3 3.2 3.2

1 1.8 2.4 3.4 3.2

0 5 10 15 30 time (min)

0 5 10 15 30 time (min)

0 5 10 15 30 time (min)

0 5 10 15 30 time (min)

F6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

0 5 10 15 30 time (min)

phospho-ERK1/2

ERK1/2

Wt

p60-/-

p80-/-

p60-/-p80-/-

1 1.1 1.3 1.4 1.6 Fold

1 1.6 1.4 0.8 0.6

1 3.1 2.4 1.2 0.7

1 3.1 3.1 1.8 2.1

F7

0 5 10 15 30 time (min)

0 5 10 15 30 time (min)

0 5 10 15 30 time (min)


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

0

20

40

60

80

100

120

0 0.01 0.03 0.1 0.3 1

LPS (mg/ml)

Cel

l via

bilit

y (%

)

5000 c/well, 72 hr

Wt

p80-/-

p60-/-

p60-/-p80-/-

F8

116-kDa85-kDa

p60-/-

Wt

p60-/-p80-/-

p80-/-

PARP cleavage

C.

A.

0 4 8 12 24 time (hr)

FITC intensity

Cel

l num

ber

Wt p60-/-

p80-/- p60-/-p80-/-

0.7% 15.3%

33.7% 55.9%

B.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

F9

Wt

CD14

b-actin

p60-/-

p80-/-

p60-/-

p80-/-

TLR4

1 0.9 0.9 0.9 Fold

1 1.1 1 1.1 Fold


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Yasunari Takada and Bharat B. Aggarwalapoptosis

B, mitogen-activated protein kinases andκlipopolysaccharide-induced nuclear factor-Genetic deletion of the TNF receptor p60 or p80 sensitizes macrophages to

published online April 14, 2003J. Biol. Chem.

10.1074/jbc.M213237200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M213237200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M213237200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/04/14/jbc.M213237200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2003/04/14/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/04/14/jbc.M213237200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

genetic deletion of the tnf receptor p60 or p80 sensitizes ... · yasunari takada and bharat b....

Documents