moohtig(oatclbgh

irsgdedTt

E

DgTc

Genomics 56, 141–148 (1999)Article ID geno.1998.5699, available online at http://www.idealibrary.com on

Genomic Organization of the Human Hairless Gene (HR)and Identification of a Mutation Underlying Congenital

Atrichia in an Arab Palestinian Family

Wasim Ahmad, Abraham Zlotogorski,* Andrei A. Panteleyev, HaMut Lam,Mahmud Ahmad,† Muhammad Faiyaz ul Haque,†,‡ Husein M. Abdallah,§

Laryssa Dragan,¶ and Angela M. Christiano\ ,1

Department of Dermatology and \Department of Genetics and Development, Columbia University, New York, New York 10032;*Department of Dermatology, Hadassah University Hospital, Jerusalem, Israel; †Department of Biological Sciences, Quaid-i-Azam

University, Islamabad, Pakistan; ‡Division of Medical Genetics, Cedars-Sinai Research Institute, Los Angeles, California 90048; §Departmentof Public Health, Ramallah, Israel; and ¶Section of Dermatology, University of Chicago School of Medicine, Chicago, Illinois 60637

Received August 20, 1998; accepted November 23, 1998

Topepaetu

oiihdcpcrmmecctFteubdt1it

Congenital atrichia is a rare form of hereditary hu-an hair loss, characterized by the complete shedding

f hair shortly after birth, together with the formationf papular lesions on the skin. Recently, we cloned theuman homolog of the mouse hairless gene and iden-ified pathogenic mutations in several families withnherited congenital atrichia. Here, we present theenomic organization of the human hairless geneHGMW-approved symbol HR), which spans over 14 kbn chromosome 8p12 and is organized into 19 exons. Inddition, we report the identification of a 22-bp dele-ion mutation in exon 3 of the hairless gene in a largeonsanguineous Arab Palestinian family from a vil-age near Jerusalem, Israel. These findings extend theody of evidence implicating mutations in the hairlessene as an underlying cause of congenital atrichia inumans. © 1999 Academic Press

INTRODUCTION

Hair follicle morphogenesis and subsequent cyclingn adult mammals constitute a complex process thatequires a series of reciprocal epithelial–mesenchymalignals for the correct execution of an intricate pro-ram of developmental events. The initial message iserived from the dermis and instructs the overlyingpidermis to thicken, forming a placode and then aowngrowth into the dermis, known as the hair plug.his is followed by a second signal from the epidermishat instructs the dermis to form the dermal papilla.

Sequence data from this article have been deposited with theMBL/GenBank Data Libraries under Accession No. AF039196.

1 To whom correspondence should be addressed at Department ofermatology, Columbia University, College of Physicians and Sur-eons, 630 West 168th Street VC15-1526, New York, NY, 10032.elephone: (212) 305-9565. Fax: (212) 305-7391. E-mail: amc65@

lolumbia.edu.

141

he dermal papilla then stimulates the division ofverlying epithelially derived matrix cells in the hairlug. These cells divide rapidly and differentiate intoither inner root sheath cells or hair shaft cells, de-ending upon their position relative to the longitudinalxis of the hair follicle (Hardy, 1992). While thesevents have been described extensively in model sys-ems, the genes governing these processes are largelynknown.Hair growth proceeds in a cyclical fashion through-

ut life, having three defined phases, the first of whichs known as anagen, the stage during which the follicles regenerated and a new hair grows. In humans, eachair is governed by its own temporal cycle of indepen-ent growth, in contrast to mice, where all hairs areycling synchronously (Hardy, 1992). At a geneticallyredetermined time in each species, the follicles enteratagen, where hair elongation ceases and the follicleegresses due to the decrease in proliferation of theatrix cells. During catagen, the dermal papilla re-ains intact, but undergoes several remodeling

vents, including degradation of the elaborate extra-ellular matrix that is deposited during anagen. At thelose of catagen, the hair is loosely anchored in a ma-rix of keratin, with the dermal papilla residing below.inally, the follicle enters a quiescent phase known aselogen, during which the hair is usually shed. At thend of the resting phase, the dermal papilla migratespward toward the epidermal stem cells located in theulge region of the outer root sheath and recruits themownward again to form the hair matrix, thereby ini-iating a new cycle of hair growth (Costarelis et al.,990; Rochat et al., 1994). Currently, surprisingly littles known about the molecular control of the signalshat regulate progression through the hair cycle.

There are several forms of hereditary human hair

oss, which may represent a dysregulation of hair fol-

0888-7543/99 $30.00Copyright © 1999 by Academic Press

All rights of reproduction in any form reserved.

ltgpiapmmdatamgrer1wrsNpdiifisAcinic

hmtdltli

gll5Chutd

mgPtfOrGurggCmaFtt

yptC1(daaftb

f(wmnoc1pg

fiAtBtgePasGos

G

ladbi

i

142 AHMAD ET AL.

icle cycling (Hardy, 1992), yet the molecular basis ofhese disorders has remained largely unexplored. Con-enital atrichia (MIM 209500) is a rare form of com-lete hair loss together with papular skin lesions and isnherited in an autosomal recessive fashion (Landesnd Langer, 1956; Cantu et al., 1980). In 1989, it wasroposed that the hairless (hr) and rhino (hrrh) mouseutations, which are allelic and map to mouse chro-osome 14, bore striking resemblance to the human

isease papular atrichia (Sundberg et al., 1989). Wend others recently reported linkage of this phenotypeo chromosome 8p12 (Ahmad et al., 1998a; Nothen etl., 1998), and we cloned and subsequently identifiedutations in the human homolog of the mouse hairless

ene in several large atrichia families from differentegions of the world (Ahmad et al., 1998a,b; Zlotogorskit al., 1998), as well as in several alleles of hairless andhino mice (Ahmad et al., 1998c,d; Panteleyev et al.,998a). Cases resembling this disease from Pakistan,ith loss of hair over the entire body, were recently

eported under the name “congenital alopecia univer-alis” (OMIM 203655, Ahmad et al., 1993, 1998a;othen et al., 1998); however, “congenital atrichia withapules” (OMIM 209500) may represent a more preciseescription of the phenotype resulting from mutationsn the human hairless gene. The hairless gene products a putative transcription factor with a single zinc-nger domain, which is highly expressed in brain andkin (Cachon-Gonzalez et al., 1994; Thompson, 1996;hmad et al., 1998a). It appears to function in theellular transition to the first adult hair cycle, and ints absence, hair follicles disintegrate and a new hair isever induced (Panteleyev et al., 1998b,c,d). The result

s the complete form of inherited hair loss observed inongenital atrichia.

Here, we present the genomic organization of theuman hairless gene,2 which spans over 14 kb on chro-osome 8p12 and is organized into 19 exons. In addi-

ion, we report the identification of a complex 22-bpeletion mutation in exon 3 of the hairless gene in aarge Arab Palestinian family. These findings extendhe body of evidence implicating mutations in the hair-ess gene as an underlying cause of congenital atrichian humans.

MATERIALS AND METHODS

Identification of a genomic clone containing the human hairlessene. A BAC genomic clone (22-0-12) containing the human hair-ess gene was obtained using a commercially available human BACibrary screening service (Research Genetics Inc.) with the primers9-TGAGGGCTCTGTCCTCCTGC-39 (sense) and 59-GCTGGCTCC-TGGTGGTAGA-39 (antisense), designed to amplify exon 15 of theuman HR gene (Ahmad et al., 1998a). BAC DNA was preparedsing a ProPrep Plasmid Nucleic Acid Purification Kit with ProCipi-ate (LigoChem, Inc. Fairfield, NJ). Using a range of primer pairsesigned from the published human hairless cDNA sequence (Ah-

2 The HGMW-approved symbol for the gene described in this paper

hs HR.

ad et al., 1998a; GenBank Accession No. AFO39196) and theenomic structure of the mouse gene (Cachon-Gonzalez et al., 1994),CRs were performed to amplify segments of BAC DNA containinghe human hairless exons. PCR was carried out for 35 cycles: 95°Cor 1 min, annealing temperature for 1 min, and 72°C for 1 min, in anmniGene Thermal Cycler (Marsh Scientific, Rochester, NY) in a

eaction containing 100 ng of each primer, 13 buffer (Gibco BRL,aithersburg, MD), 50 ng of BAC DNA, 0.2 mM dNTPs, and 1.25nits Platinum Taq DNA polymerase (Gibco BRL) in each 50-mleaction. The PCR products were electrophoresed in a 1–2% agaroseel in 13TBE buffer. The PCR products were eluted from the agaroseel with the QIAquick gel extraction kit (Qiagen Inc., Santa Clarita,A) and sequenced on both strands using the ABI Prism dRhoda-ine Terminator Cycle Sequencing Ready Reaction Sequencing Kit

nd an ABI Model 310 DNA Sequencer (PE Applied Biosystems,oster City, CA). When necessary, subcloning was performed intohe BlueScript KSII vector (Stratagene, La Jolla, CA) according tohe manufacturer’s recommendations.

39 Rapid amplification of cDNA ends (RACE) and transcript anal-sis. To determine the 39 end of the hairless cDNA, 39 RACE waserformed using a Marathon Ready cDNA Amplification Kit (Clon-ech, Palo Alto, CA). The 59 forward primer (59-TCAGCGTCACT-AGCACTTCCTCTC-39) for the RACE PCR was derived from exon8, and the reaction product was cloned into the TA cloning vectorInvitrogen, San Diego, CA). Plasmid DNA was prepared from fiveifferent clones using Qiagen columns (Qiagen Inc.) and sequenceds above. The Human Master Dot Blot was obtained from Clontechnd hybridized using ExpressHyb solution according to the manu-acturer’s recommendations, with a probe spanning exons 13–18 ofhe hairless cDNA, generated by RT-PCR from human skin fibro-last total mRNA, as previously described (Ahmad et al., 1998a).

Nucleic acid preparation and genotyping. DNA was preparedrom peripheral blood leukocytes according to standard techniquesSambrook et al., 1989). For genotyping, one primer from each pairas labeled with [g-33P]dATP (NEN, Boston MA). The PCR for eacharker was performed in a 10 ml volume containing 50 ng of DNA, 50g of each primer, 200 mM dNTP, 13 PCR buffer (Gibco BRL) andne unit Platinum Taq DNA polymerase (Gibco BRL). PCR wasarried out for 35 cycles: 95°C for 1 min, 58°C for 1 min, and 72°C for

min, in an OmniGene Thermal Cycler (Marsh Scientific). PCRroducts were electrophoresed on 6% denaturing polyacrylamideels, and genotypes were assigned by visual inspection.

Mutation detection. Exons and splice junctions were PCR ampli-ed from genomic DNA and sequenced directly in an ABI Prism 310utomated Sequencer, using the ABI Prism dRhodamine Termina-

or Cycle Sequencing Ready Reaction Sequencing Kit (PE Appliediosystems), following purification in Centriflex Gel Filtration Car-

ridges (Edge Biosystems, Gaithersburg, MD). Exon 3 of the hairlessene was amplified with the following two sets of overlapping prim-rs A and B, amplifying ;600- and 500-bp fragments, respectively:rimer set A, 59-GGCTTCAGTATTCTCCCCTT-39 (sense primer),nd 59-TAGTGGGTGGGTAGGATGAA-39 (antisense primer); Primeret B, 59-CCTTGTTCATACTCTTGGCA-39 (sense primer), and 59-TGGTCCACTCATAAAGCCT-39 (antisense primer). Identificationf the mutation was performed by visual comparison of the patients’equence with that of an unrelated, unaffected control individual.

RESULTS

enomic Organization of Human Hairless Gene

A single clone containing the hairless gene was iso-ated from a human genomic BAC library. The positionnd size of each exon and intron was determined byirect PCR amplification from the BAC clone, followedy automated sequencing (Fig. 1). The sequences of thentron–exon borders for the 19 exons of the human

airless gene are shown in Table 1. All sites conform to

t3ssa

tsatmtGhst

Rsp6A1qp6aq

T

bttogci

C

p

AJbwswmiSiaspabAtmlgdghtdsngspdf1tc

G

mgt

bmh fo

143HUMAN HAIRLESS GENE (HR) AND MUTATION IN CONGENITAL ATRICHIA

he mammalian consensus sequences for 59 donor and9 acceptor splice sites. To obtain the sequences up-tream of exon 2, the BAC DNA was digested andubcloned into the BlueScript KSII vector (Stratagene)nd sequenced in the 59 direction upstream of exon 2.To identify putative cis-regulatory elements within

he 59-flanking DNA, 1058 bp of genomic DNA up-tream from exon 1 was sequenced. The results werenalyzed using the program Signal, which comparedhe hairless sequence with known eukaryotic cis-ele-ents. The sequences 59 to exon 1 contain several

ranscription factor-binding sites, including GATA-1,ATA-2, SP1, and AP1. Notably, the 59 flanking regionas a high G1C content and lacks consensus TATAequences. The initiating methionine residue is con-ained with exon 2.

To determine the 39 end of the hairless mRNA, 39ACE was performed using the AP1 primer and a 59ense primer from exon 18 of the gene. An 850-bp PCRroduct was cloned and sequenced, which revealed55-bp of noncoding sequence at the 39 end of the gene.10-kb subclone from the BAC clone, containing exons

8, 19, and the 39 end of the hairless gene, was se-uenced to ensure that no additional intron wasresent in the 39 untranslated region. Exon 19 contains0 bp of the open reading frame, the termination codon,nd 655 bp of 39 untranslated region. All genomic se-uences have been deposited with GenBank.

ranscript Analysis

A human RNA Master Blot filter containing immo-ilized human poly(A)1 RNA from a wide range ofissues and developmental stages was hybridized withhe hairless cDNA probe and showed the highest levelsf gene expression in various parts of the brain. Theene was also found to be expressed at lower levels inolon, stomach, pituitary gland, salivary gland, smallntestine, appendix, and fetal brain (Fig. 2).

linical Findings

To search for hairless gene mutations in atrichia

FIG. 1. Genomic organization of the human hairless gene. The geney proportional vertical bars, and the introns are represented by the hethionine, and exon 19 contains the 39 end of the coding sequence, th

ighlighted, as well as the LXXLL motifs in exons 5 and 10. Scale bars

atients, we studied six individuals from a large inbred r

rab Palestinian family originating from a village nearerusalem, Israel. In this family, a total of 12 mem-ers, including 8 females and 4 males, were affectedith congenital atrichia. The family pedigree is

trongly suggestive of autosomal recessive inheritanceith several consanguinity loops (Fig. 3A). Severalembers of the family, including an affected female

ndividual (V-7), immigrated to the midwestern Unitedtates, and the pedigree was ascertained through this

ndividual and traced back to Israel. The phenotypicppearance of congenital atrichia in this family istrikingly similar to that of patients reported in ourrevious studies (Ahmad et al., 1998a,b; Zlotogorski etl., 1998) and to that of patients described previouslyy others (Landes and Langer, 1956; Cantu et al., 1980;hmad et al., 1993). In affected individuals, hairs were

ypically absent from the scalp, and patients were al-ost completely devoid of eyebrows, eyelashes, axil-

ary hair, and pubic hair (Individual V-7, Fig. 3B). Ineneral, they are born with normal hair, which is sheduring the first months to years of life and never re-rows, similar to the pattern of hair loss observed inairless mice (Sundberg, 1994). Affected individuals inhis family also showed no growth or developmentalelay, normal teeth and nails, and no abnormalities inweating. Heterozygous members of the family hadormal hair and were clinically indistinguishable fromenotypically normal individuals in the family. A scalpkin biopsy from the affected individual showed a com-lete absence of hair follicles, and instead revealedeep dermal cysts and comedones reminiscent of thoseound in the skin of hairless mice (Montagna et al.,952) (Fig. 3C). Collectively, the clinical and his-opathological findings and pattern of inheritance wereonsistent with a diagnosis of congenital atrichia.

enotyping

To determine whether affected individuals were ho-ozygous for markers near the human hairless locus,

enotyping of the six members of the family includingwo affected and four unaffected individuals was car-

tains 19 exons spanning 14 kb. The sizes of the exons are representedontal line. Exon 1 contains the 59 UTR, exon 2 contains the initiatingrmination codon, and the 39 UTR. The zinc-finger domain in exon 6 isr intron and exon sizes are indicated on the lower right.

conorize te

ied out for the polymorphic markers D8S1786 and

Dsffet2h

c8g

M

egyip(egt(wc

hthmltmpoelsg

sAAotcCa

144 AHMAD ET AL.

8S298, closely linked to the hairless gene on chromo-ome 8p12 (Ahmad et al., 1998a). The markers wereully informative, and the two affected members of theamily (IV-2 and V-7) were homozygous for both mark-rs, suggesting linkage to the hairless locus. In addi-ion, we found that all four unaffected individuals (IV-9, V-4, V-5, and V-6) were carriers of the linkedaplotype (data not shown). Taken together, the clini-

TAB

Intron/Exon Borders of

Exon Exon size Intron size 39 Accep

1 364 bp 1223 bp —2 652 bp 727 bp tatgctccagG3 793 bp .1 kb ccctctttagG4 151 bp 70 bp gtcccctcagG5 194 bp 1524 bp ctctctccagA6 165 bp 770 bp tggtcagcag7 90 bp 183 bp tgccccacag8 116 bp 799 bp ccacccccag9 82 bp 388 bp ggtttaacagA

10 164 bp 99 bp tccctgacagA11 243 bp 208 bp ctctctgcagG12 166 bp 168 bp cccaccacag13 70 bp 212 bp cctcctgtagT14 131 bp 500 bp accctgacag15 120 bp 97 bp tgccatgcagG16 116 bp 1800 bp tcctcctcagA17 165 bp 446 bp cttctttgagGT18 129 bp 538 bp cccgacacag19 60 bp139UTR tttttcctagAT

FIG. 2. Transcript analysis of the human hairless gene. Expres-ion of hairless mRNA was noted in all areas of the brain including1, whole brain; A2, amygdala; A3, caudate nucleus; A4, cerebellum;5, cerebral cortex; A6, frontal lobe; A7, hippocampus; A8, medullablongata; B1, occipital lobe; B2, putamen; B3, substantia nigra; B4,emporal lobe; B5, thalamus; B6, subthalamic nucleus; B7, spinalord; and G1, fetal brain. Lower levels of expression were noted in4, colon; C8, stomach; D7, salivary gland; E3, small intestine; F1,

sppendix; and F3, trachea.

al presentation and suggestive linkage to chromosomep12 indicated that hairless was a strong candidateene to analyze for an underlying mutation.

utation Identification

To screen for a mutation in the human hairless gene,xons and splice junctions were PCR amplified fromenomic DNA and sequenced directly. Sequence anal-sis of exon 3 of the hairless gene from two affectedndividuals (IV-2 and V-7) revealed a homozygous com-lex 22-bp out-of-frame deletion consisting of a 1-bpdelC) at nucleotide position 1256 and a 21-bp (del21)xtending from nucleotide position 1261–1281. To-ether, the deletions led to a frameshift and prematureermination codon 77 bp downstream within exon 3Fig. 4). The mutation, designated 1256delC;1261del21,as present in the heterozygous state in the obligate

arriers in the family.

DISCUSSION

The genomic organization of the hairless gene isighly conserved between human and mouse. In addi-ion, the amino acid sequences of murine and primateairless are 85 and 95% identical to the human ho-olog, respectively (Ahmad et al., 1998a; and unpub-

ished results). Comparison of the intron–exon posi-ions of the human hairless gene with those of theouse homolog shows almost exact conservation of the

ositioning of the introns. The gene spans over 14 kbn human chromosome 8p12 and is encoded by 19xons ranging from 70 to 793 bp in size (Fig. 1). Simi-arly, no significant differences in intron size were ob-erved between the human and the mouse hairlessenes. Hairless is a putative single zinc-finger tran-

1

Human Hairless Gene

site 59 Donor site

GCCCAGgtaagcgccaCC C . . . . . . . . . . . . . . . AGCAAGgtgagtgcag

TT T . . . . . . . . . . . . . . . AGAAAGgtaagggggcCC C . . . . . . . . . . . . . . . GCGGAGgtgagccatt

GC C . . . . . . . . . . . . . . . GGGAAGgtgaacaggaCAA G . . . . . . . . . . . . . . . AAGCAGgtaggagaggTTT C . . . . . . . . . . . . . . . GCCAGGgtgagccatcTTG G . . . . . . . . . . . . . . . CAGCAGgtaagacccaGA A . . . . . . . . . . . . . . . AAGAGGgtgagcggctCC C . . . . . . . . . . . . . . . CCCAGTgtgagtgag

GA C . . . . . . . . . . . . . . . GGCCAGgtgaggcaccTGT G . . . . . . . . . . . . . . . CTGAGCgtaagtgtccGC C . . . . . . . . . . . . . . . CAGCAGgtgtgtatgtTGG A . . . . . . . . . . . . . . . CCTATGgtgagtgtccTG A . . . . . . . . . . . . . . . AGAAAGgtaggtcctc

TC C . . . . . . . . . . . . . . . CAGATGgtgaggaggcG C . . . . . . . . . . . . . . . CACCAGgtgctttccaGCA G . . . . . . . . . . . . . . . GCCCAGgtgagtgggaA C . . . . . . . . . . . . . . .

LE

the

tor

GAGCAC

TCGCGCCTAGGAATCCTCGG

TGCTGTGTGG

cription factor, with only two significant regions of

wVhrg

FIG. 3. Clinical and histological findings in the family with papular atrichia. (A) Pedigree of the family with obligate carriers indicatedith a dotted figure, and affected individuals as solid figures. Double lines represent consanguineous unions, and the proband (individual-7) is indicated by an arrow. (B) Clinical appearance of papular atrichia in individual V-7. The patient is nearly devoid of scalp hairs andas sparse eyebrows and eyelashes. (C) Histological findings reveal the complete absence of normal hair follicle structures, which are insteadeplaced by residual epithelial cell conglomerates and large dermal cysts. No excessive perifollicular infiltrate is visible, and the sebaceous

lands, sweat glands, and interfollicular epidermis are normal (hematoxylin & eosin, 1253 magnification).

hzasteitwstseagamTsm

nt(t7noiPt

nclcihap

ct ous

146 AHMAD ET AL.

omology to any known proteins. First, the six-cysteineinc-finger motif contained within exon 6 of the humannd mouse hairless genes (amino acids 600–625)hares weak homology with TSGA, a testis-specific pu-ative transcription factor of unknown function (Hoogt al., 1991). Supporting evidence for the functionalmportance of the zinc-finger domain comes from mu-ational studies in an Irish family with atrichia, inhich affected individuals are homozygous for a mis-

ense mutation between the fourth and the fifth cys-eines of the zinc-finger (Ahmad et al., 1998b). Theecond region of weak homology is found toward the 39nd of the gene, in the region extending from aminocids 704 to 1031 of the human sequence. In this re-ion, significant homology is found between hairlessnd a family of proteins known as TRIPs (thyroid hor-one receptor interacting proteins) (Lee et al., 1995).he signature motif (LXXLL) for TRIPs and other tran-criptional coactivators is necessary and sufficient to

FIG. 4. Sequence analysis of the hairless gene. (Top) The wildtarrier. (Bottom) The 22-bp deletion in the homozygous state in anhe top panel represent the sequence that is deleted in the homozyg

ediate binding of this class of proteins to liganded l

uclear receptors (Heery et al., 1997). It is noteworthyhat hairless contains two LXXLL motifs, one in exon 5LCRLL, amino acids 566–570) and a second withinhe region of TRIP homology (LCELL, amino acids58–762), adding evidence in support of functional sig-ificance of this region of the gene. Further implicationf the region spanning from 704 to 1031 in functionalntegrity of hairless comes from mutation analysis in aakistani atrichia family with a missense mutation inhe same region (Ahmad et al., 1998a).

This rare form of inherited human hair loss wasamed atrichia with papular lesions in 1950 and washaracterized by normal hair formation at birth fol-owed by hair loss associated with the formation ofomedones and follicular cysts (Fredrich, 1950). Later,n 1989, the human disease was first proposed as aomolog of the hairless mouse mutation (Sundberg etl., 1989). The molecular basis of the hairless mousehenotype was shown to be the result of a murine

sequence of exon 3. (Middle) Sequence analysis of a heterozygouscted individual. The arrow and bar above the wildtype sequence instate in the patient in the bottom panel.

ypeaffe

eukemia proviral insertion into intron 6 of the hairless

gssksmtpthsthswssitbttnaarCbtc

scalfspdhst

iirTattBetTbwmwf

cegad

hsdasptaptatidstrvttd

istgwivgg

tNND

A

A

A

147HUMAN HAIRLESS GENE (HR) AND MUTATION IN CONGENITAL ATRICHIA

ene, resulting in aberrant splicing and a moderatelyevere phenotype (Cachon-Gonzalez et al., 1994). Aecond, phenotypically more severe allelic mutation,nown as rhino, is the result of more deleterious non-ense and deletion mutations in the hairless gene (Ah-ad et al., 1998c,d; Panteleyev et al., 1998a). Recently,

he predicted connection between hairless mice andapular atrichia in humans was confirmed when mu-ations underlying this disorder were identified in theuman hairless gene (Ahmad et al., 1998a,b; Zlotogor-ki et al., 1998). The mutation described in this study ishe second reported deletion mutation in the humanairless gene. Since the mutation results in a frame-hift and a downstream premature termination codon,e predict an absence of functional mRNA due to non-

ense-mediated mRNA decay (Maquat, 1996) and con-equently, an absence of hairless protein. Interest-ngly, however, in contrast to rhino and hairless mice,here appears to be no difference in phenotypic severityetween human patients with different types of muta-ions in the hairless gene. It is intriguing that despitehe high levels of hairless gene expression in the brain,either rhino or hairless mice, nor any of the humantrichia patients we have studied, exhibit any detect-ble neurological phenotype or developmental delayeflecting aberrant hairless expression in developingNS. The findings presented in this study extend theody of evidence implicating different types of muta-ions in the hairless gene as the underlying cause ofongenital atrichia in humans.

Previously, it was shown that hairless gene expres-ion is primarily restricted to the skin and brain (Ca-hon-Gonzalez et al., 1994; Thompson, 1996; Ahmad etl., 1998a). To more fully characterize the sites of hair-ess expression, a dot blot containing poly(A)1 RNArom several human tissues at different developmentaltages was hybridized with the human hairless cDNArobe. In addition to high levels of gene expressionetected in various parts of the brain, lower levels ofairless gene expression were also observed in colon,tomach, pituitary gland, salivary gland, small intes-ine, and appendix (Fig. 2).

Although the precise function of hairless in the brains still elusive, hairless protein has been shown tonteract directly and specifically with thyroid hormoneeceptor, the same protein that induces its expression.hus, in the brain, hairless appears to function both asdownstream target and as an upstream regulator of

hyroid hormone action, potentially as a transcrip-ional corepressor (Thompson, 1996; Thompson andottcher, 1997). Further, a thyroid hormone responselement (TRE) was identified 9 kb upstream of theranscriptional start site in the rat hairless gene. TheRE in the human and mouse hairless genes has noteen identified as yet, and it remains to be determinedhether hairless is similarly regulated by thyroid hor-one in the skin. Interestingly, when hairless cDNAas amplified from human skin fibroblast total mRNA

or generating the probe for the dot blot, we noted the

onsistent and complete absence of exon 17 from sev-ral independent RT-PCR products. This finding sug-ests that hairless may be subject to tissue-specificlternative splicing events, which may in turn specifyifferential cell-type specific functions.The cellular events leading to the development of

airlessness involve a premature and massive apopto-is in the hair matrix cells, together with a concomitantecline in Bcl-2 expression, a loss of NCAM positivity,nd a disconnection with the overlying epithelialheath essential for the movement of the dermal pa-illa (Panteleyev et al., 1998b,c,d). As a consequence,he dermal papilla remains stranded in the dermis,nd indispensable messages between the dermal pa-illa and stem cells in the bulge are not transmitted,hus no further hair growth occurs. In hairless micend in humans with congenital atrichia, we postulatehat the absence of functional hairless protein leads tonitiation of a premature and aberrant catagen phaseue to abnormal apoptosis, dysregulation of cell adhe-ion, and defects in dermal papilla-derived signalinghat normally control catagen-associated hair follicleemodeling (Panteleyev et al., 1998b,c,d). These obser-ations suggest that a crucial role of the hairless pro-ein may be involved in maintaining the balance be-ween cell proliferation, differentiation, and apoptosisuring hair follicle cycling.The identification of mutations in the hairless gene

n humans and mice with congenital atrichia under-cores a crucial role of the hairless gene product inhe regulation of hair growth. Delineation of theenomic organization of the human hairless geneill not only facilitate the identification of mutations

n patients with congenital atrichia, but also ad-ance functional studies into the role of the hairlessene product in hair follicle morphogenesis, hairrowth, and hair cycling.

ACKNOWLEDGMENTS

We appreciate the generous participation of the family members inhis study. This work was supported in part by grants from theational Alopecia Areata Foundation (A.Z. and A.M.C.) and theIH-NIAMS Skin Disease Research Center (P30-AR44535) in theepartment of Dermatology at Columbia University.

REFERENCES

hmad, M., Abbas, H., and Ul Haque, S. (1993). Alopecia universalisas a single abnormality in an inbred Pakistani kindred. Am. J.Med. Genet. 46: 369–371.hmad, W., Ul Haque, M. F., Brancolini, V., Tsou, H. C., Ul Haque,S., Lam, H., Aita, V. M., Owen, J., deBlaquiere, M., Frank, J.,Cserhalmi-Friedman, P. B., Leask, A., McGrath, J. A., Peacocke,M., Ahmad, M., Ott, J., and Christiano, A. M. (1998a). Alopeciauniversalis associated with a mutation in the human hairlessgene. Science 279: 720–724.hmad, W., Irvine, A. D., Lam, H., Buckley, C., Bingham, E. A.,Panteleyev, A. A., Ahmad, M., McGrath, J. A., and Christiano,A. M. (1998b). A missense mutation in the zinc-finger domain ofthe human hairless gene underlines congenital atrichia in a family

of Irish travelers. Am. J. Hum. Genet. 63: 984–991.

A

A

C

C

C

F

H

H

H

L

L

M

M

N

P

P

P

P

R

S

S

S

T

T

Z

148 AHMAD ET AL.

hmad, W., Panteleyev, A., Sundberg, J. P., and Christiano, A. M.(1998c). Molecular basis for the rhino (hrrh8J) phenotype: Anonsense mutation in the mouse hairless gene. Genomics 53:383–386hmad, W., Panteleyev, A. A., Henson-Apollonio, V., Sundberg, J. P.,and Christiano, A. M. (1998d). Molecular basis of a novel rhino(hrrhChr) phenotype: A nonsense mutation in the mouse hairlessgene. Exp. Dermatol. 7: 298–301.achon-Gonzalez, M. B., Fenner, S., Coffin, J. M., Moran, C., Best,S., and Stoye, J. P. (1994). Structure and expression ofthe hairless gene of mice. Proc. Natl. Acad. Sci. USA 91: 7717–7721.antu, J. M., Sanchez-Corona, J., Gonzalez-Mendoza, A., Mar-tinez, Y., Martinez, R., and Garcia-Cruz, D. (1980). Autosomalrecessive inheritance of atrichia congenita. Clin. Genet. 17:209 –212.ostarelis, G., Sun, T.-T., and Lavker, R. M. (1990). Label retainingcells reside in the bulge area of pilosebaceous unit: Implications forfollicular stem cells, hair cycle, and skin carcinogenesis. Cell 61:1329–1337.

redrich, H. C. (1950). Zur kenntnis der kongenitale hypotrichosis.Dermatol. Wochenschr. 121: 408–410.ardy, M. (1992). The secret life of the hair follicle. Trends Genet. 8:55–61.eery, D. M., Kalkhoven, E., Hoare, S., and Parker, M. G. (1997). Asignature motif in transcriptional co-activators mediates bindingto nuclear receptors. Nature 387: 733–736.oog, C., Schalling, M., Grunder-Brundell, E., and Daneholt, B.(1991). Analysis of a murine male germ cell-specific transcript thatencodes a putative zinc finger protein. Mol. Reprod. Dev. 30: 173–181.

andes, E., and Langer, I. (1956). Ein beitrag zur hypotrichosiscongenita. Hautzart 7: 413–415.

ee, J. W., Choi, H.-S., Gyuris, J., Brent, R., and Moore, D. D. (1995).Two classes of proteins dependent on either the presence or ab-sence of thyroid hormone for interaction with the thyroid hormonereceptor. Mol. Endocrinol. 9: 243–254.aquat, L. E. (1996). Defects in RNA splicing and the consequence ofshortened translational reading frames. Am. J. Hum. Genet. 59:279–286.ontagna, W., Chase, H. B., and Melaragno, H. P. (1952). The skinof hairless mice. The formation of cysts and the distribution oflipids. J. Invest. Dermatol. 19: 83–94.othen, M. M., Cichon, S., Vogt, I. R., Hemmer, S., Kruse, R., Knapp,M., Holler, T., Ul Haque, M. F., Ul Haque, S., Propping, P., Ahmad,

M., and Rietschel, M. (1998). A gene for autosomal congenital

alopecia maps to chromosome 8p21–22. Am. J. Hum. Genet. 62:386–390.

anteleyev, A. A., Ahmad, W., Malashenko, A. M., Ignatieva,E. L., Paus, R., Sundberg, J. P., and Christiano, A. M. (1998a).Molecular basis for the rhino Yurlovo (hrrhY) phenotype: Severeskin abnormalities and female reproductive defects associ-ated with an insertion in the hairless gene. Exp. Dermatol. 7:281–288.

anteleyev, A. A., van der Veen, C., Rosenbach, T., Muller-Rover, S.,Sokolov, V. E., and Paus, R. (1998b). Towards defining the patho-genesis of the hairless phenotype. J. Invest. Dermatol. 110: 903–907.

anteleyev, A. A., Botchkareva, N. V., van der Veen, C., Chris-tiano, A. M., and Paus, R. (1998c). Pathobiology of the hairlessphenotype: Dysregulation of hair follicle apoptosis and topobi-ology during the initiation of follicle cycling. J. Invest. Dermatol.110: 577.

anteleyev, A. A., Paus, R., Ahmad, W., Sundberg, J. P., and Chris-tiano, A. M. (1998d). Molecular and functional aspects of the hair-less (hr) gene in laboratory rodents and humans. Exp. Dermatol. 7:249–267.ochat, A., Kobayashi, K., and Barrandon, Y. (1994). Location ofstem cells in human hair follicles by clonal analysis. Cell 76:1063–1073.

ambrook, J., Fritsch, E. G., and Maniatis, T. (1989). “MolecularCloning: A Laboratory Manual,” 2nd ed., Cold Spring Harbor Lab-oratory Press, Cold Spring Harbor, NY.

undberg, J. P. (1994). The hairless (hr) and rhino (hrrh) muta-tions, chromosome 14. In “Handbook of Mouse Mutations withSkin and Hair Abnormalities: Animal Models and BiomedicalTools” (J. P. Sundberg, Ed.), pp. 291–312, CRC Press, BocaRaton, FL.

undberg, J. P., Dunstan, R. W., and Compton, J. G. (1989). Hairlessmouse, HRS/J hr/hr. In “Monographs on Pathology of LaboratoryAnimals. Integument and Mammary Glands” (T. C. Jones, U. Mohr,and R. D. Hunt, Eds.), pp. 192–197, Springer-Verlag, Heidelberg.

hompson, C. C. (1996). Thyroid hormone-responsive genes in devel-oping cerebellum include a novel synaptotagmin and a hairlesshomolog. J. Neurosci. 16: 7832–7840.

hompson, C. C., and Bottcher, M. C. (1997). The product of a thyroidhormone-responsive gene interacts with thyroid hormone recep-tors. Proc. Natl. Acad. Sci. USA 94: 8527–8532.

lotogorski, A., Ahmad, W., and Christiano, A. M. (1998). Congenitalatrichia in five Arab Palestinian families resulting in a mutation

in the human hairless gene. Hum. Genet. 103: 400–404.