genética del caballo colombiano de paso, filogenia

Genética del Caballo Colombiano de

paso, filogenia, biotipo y andares

(Genetics of the Colombian paso horse, phylogenetics, biotype, and

gaits)

Miguel Adriano Novoa Bravo

Universidad Nacional de Colombia

Facultad de Ciencias

Área Curricular de Biología

Bogotá, Colombia

2018

Genética del Caballo Colombiano de paso, filogenia, biotipo y andares

(Genetics of the Colombian paso horse, phylogenetics, biotype, and

gaits)

Miguel Adriano Novoa Bravo

Dissertation submitted in partial fulfillment of the requirements for the degree of:

Doctor in Sciences (Biology)

Supervisor and reviewer:

Ph.D. Luis Fernando García

Research area:

Animal genetics

Research groups:

Genética Animal Aplicada

Biodiversidad y Ecología Molecular

Universidad Nacional de Colombia

Facultad de Ciencias

Área Curricular de Biología

Bogotá, Colombia

2018

To my family, Eleonora, Sergio Adrian,

Antonio, parents Mabel and Miguel and

siblings Nidya Isabel, Delfin, Andrés y Juan.

Acknowledgements I want to thank all the persons involved to achieve this study, specially to:

To my supervisor Luis Fernando García and also to Gabriella Lindgren, for all the

knowledge that you share with me, for your time and endeavor, for accepting me as a

doctoral student and a foreign student respectively, and for being agreed with my research

initiatives. It has been a huge enriching experience for me, work with you both. Also, I thank

to Ernie Bailey and Samantha Brooks for your valuable comments during the first part of

this project, and thanks to the juries Dr. Cristina Luis, Dr. Luz Alvarez, and Dr. Oscar Cortés

for your suggestions at the end of this work.

Also, I thank the Federación Nacional de Asociaciones Equinas - Fedequinas for providing

the pedigree, kinematic and microsatellite data, and their support during the last years,

especially to Enrique Neira, Eliseo Cárdenas, Beatriz Salgado, Yovanny Avendaño, Eliana

Serrano, Alirio Galvis and Fabio Jaramillo. Also, I want to thank to Mr. Carlos Uribe for their

comments.

In addition, I want to thank the Colfuturo-Colciencias, National PhD program 6172

https://www.colfuturo.org/scolciencias for my scholarship.

Thanks to my close friends William Usaquén and his family, and David Yaya for sharing

and for inspiring me to be a better professional and person. Also, to Kim Jäderkvist, Laura

Bas, Maria Rosengren, Juan Cordero, and Cano Merkan for your friendship and support

during my internship in Sweden.

To my wife Eleonora and sons Sergio Adrian y Antonio for your unconditional love,

perseverance, and huge effort during these years of a fantastic and an unlikely journey.

Also, to my parents Nidya Mabel, Miguel Angel, my siblings Nidya Isabel, Delfín, Andrés

Felipe, Juan Miguel and to the Eleonora’s family Análida, Augusto, Jimena, Fernando,

Camilo and Paula, thanks for all your love and support.

VIII Genetics of Colombian paso horse, phylogenetics, biotype, and gaits

Abstract and resumen IX

Abstract The Colombian paso horse, also known as Colombian creole paso horse, the most

important horse breed in Colombia, has been selected for conformation and gaits for at

least the last 50 years. We hypothesize that this selection has led to the formation of two

differentiated breeds. Hence, the aim of the study was to establish whether or not the

Colombian paso horse corresponds to one or more breeds based on pedigree, genetic,

and phenotypic data. To test our hypotheses, data from Colombian paso horses (220,000

pedigree records, 132,637 autosomal microsatellite genotypes, 900 X chromosome

microsatellite genotypes, 198 mitochondrial d-loop sequences, conformation and kinematic

measurements for 172 horses, and a DMRT3 nonsense mutation genotypes for 153

horses) were analyzed. The results indicated that there are significant genetic and

phenotypic differences between the Colombian paso horses, where a continuum genetic

differentiation has been occurring during the last 3 generations traced, in particular

between the Colombian paso fino and the other groups. Also, there are significant

kinematic and DMRT3 differences between the Colombian paso horse’s gaits, and those

parameters can be used partially to select and control the horses’ gait performance. Finally,

phylogenetic analyzes showed that the Colombian paso horses had a complex breed origin

and that these horses share an evolutionary history with specific haplotypes, even, some

of those haplotypes represent an ancestral Iberian haplogroup which had been described

in just few modern horses until the present study. Hence, all the results strongly suggested

that the Colombian paso horse breed became two breeds: the Colombian paso fino horse

breed and the Colombian trocha and trot horse breed. In addition, the DMRT3 gene does

not play a major role in controlling the trocha and the Colombian trot gaits. Therefore,

additional genes or other DMRT3 mutations likely influence these gaits. This study has

settled down the genetic and phenotypic foundations of these Colombian paso horse

breeds; and also, has evidenced for the first time a breed formation process where the role

of the microevolutionary process was registered by means of genetic data and phenotypic

differentiation.

X Genetics of Colombian paso horse, phylogenetics, biotype, and gaits

Key words: breed, evolution, gait, genetics, horse, phenotype, phylogenetics.

Resumen El Caballo Colombiano de paso, conocido también como Caballo criollo Colombiano de

paso, la raza de caballos más importante de Colombia, ha sido seleccionada por su

conformación y andar durante al menos los últimos 50 años. Nuestra hipótesis es que esta

selección ha llevado a la formación de dos razas diferenciadas. Por lo tanto, el objetivo del

estudio fue establecer si el Caballo Colombiano de paso corresponde a una o más razas

basadas en datos de pedigrí, genéticos y fenotípicos. Para probar nuestras hipótesis,

datos de Caballos Colombianos de paso (220,000 registros de pedigrí, 132,637 genotipos

autosómicos de microsatélites, 900 genotipos de microsatélites de cromosoma X, 198

secuencias mitocondriales d-loop, mediciones de conformación y cinemáticas para 172

caballos y genotipos de la mutación sin sentido del gen DMRT3 para 153 caballos) fueron

analizados. Los resultados indicaron que hay diferencias genéticas y fenotípicas

significativas entre los caballos colombianos de paso, donde se ha producido una

diferenciación genética continua durante las últimas 3 generaciones, en particular entre el

Caballo Colombiano de paso fino y los otros grupos. Además, hay diferencias cinemáticas

y del gen DMRT3 significativas entre los andares del Caballo Colombiano de paso y esos

parámetros se pueden usar parcialmente para seleccionar y controlar el rendimiento de

los andares de los caballos. Finalmente, los análisis filogenéticos mostraron que los

Caballos Colombianos de paso tuvieron un origen racial complejo y que estos caballos

comparten una historia evolutiva con haplotipos específicos, incluso, algunos de estos

haplotipos representan un haplogrupo ibérico ancestral que se había descrito en unos

pocos caballos modernos hasta el presente estudio. Por lo tanto, todos los resultados

sugieren contundentemente que la raza Caballo Colombiano de paso se convirtió en dos

razas: el Caballo Colombiano de paso fino y el Caballo Colombiano de trocha y trote.

Además, el gen DMRT3 no juega un papel importante en el control de los andares de la

trocha y el trote colombiano. Por lo tanto, es posible que genes adicionales u otras

Abstract and resumen XI

mutaciones en el gen DMRT3 probablemente influyan en estos andares. Este estudio ha

establecido los fundamentos genéticos y fenotípicos de estas razas Colombianas de

caballos de paso; y también ha evidenciado por primera vez un proceso de formación de

razas donde el papel del proceso microevolutivo se registró por medio de datos genéticos

y diferenciación fenotípica.

Palabras claves: andar, caballos, evolución, fenotipo, filogenética, genética, raza.

Content XIII

Content

Page

Abstract ............................................................................................................................ IX

Resumen ........................................................................................................................... X

1. Introduction ................................................................................................................ 1 1.1 Genetics of populations ........................................................................................ 1

1.1.1 Mendel´s principles. ........................................................................................... 1 1.1.2 Hardy-Weinberg principle .................................................................................. 2 1.1.3 Evolutionary process ......................................................................................... 2 1.1.4 Genetic Structure ............................................................................................... 4 1.1.5 Breed ................................................................................................................. 5 1.1.6 Phylogenetics .................................................................................................... 5 1.1.7 Genetic distances .............................................................................................. 6 1.1.8 Maximum Parsimony ......................................................................................... 7 1.1.9 Maximum Likelihood .......................................................................................... 7 1.1.10 Bayesian Inference ............................................................................................ 7

1.2 The horse ............................................................................................................. 8 1.2.1 Origin of the horse ............................................................................................. 8 1.2.2 The Colombian Paso Horse ............................................................................ 10 1.2.3 Genetics of the horse ...................................................................................... 11 1.2.4 Gait of horses – DMRT3 gene ......................................................................... 12 1.2.5 Genomics of the horse .................................................................................... 13

1.3 Hypotheses ........................................................................................................ 14 1.4 Objectives of this research ................................................................................. 14

2. Chapter 1. Divergent evolution of the Colombian paso horse reveals evidence for breed formation process. .......................................................................................... 17

2.1 Abstract .............................................................................................................. 17 2.2 Introduction ........................................................................................................ 18

2.2.1 The Colombian paso horse ............................................................................. 18 2.2.2 The modern horse, breed formation, one or more CPH breeds? .................... 19

2.3 Materials and methods ....................................................................................... 21 2.3.1 Genetic sampling ............................................................................................. 21 2.3.2 Phenotypic sampling ....................................................................................... 24 2.3.3 Phenotypic analyses ........................................................................................ 25 2.3.4 Pedigree analyses ........................................................................................... 27 2.3.5 Population genetics analyses .......................................................................... 27 2.3.6 Phylogenetics analyses ................................................................................... 28

XIV Genetics of Colombian paso horse, phylogenetics, biotype, and gaits

2.4 Results ................................................................................................................ 29 2.4.1 Phenotypic analyses ....................................................................................... 29 2.4.2 Pedigree analyses ........................................................................................... 39 2.4.3 Population genetics analyses .......................................................................... 41 2.4.4 Phylogenetics analyses ................................................................................... 45

2.5 Discussion ........................................................................................................... 49 2.6 Conclusions ......................................................................................................... 53 2.7 Acknowledgments ............................................................................................... 53

3. Chapter 2. Selection on the Colombian paso horse’s gaits has produced kinematic differences partly explained by the DMRT3 gene ....................................... 55

3.1 Abstract ............................................................................................................... 55 3.2 Introduction ......................................................................................................... 56

3.2.1 The Colombian paso horse ............................................................................. 56 3.2.2 The gaits in the Colombian paso horses ......................................................... 57 3.2.3 The DMRT3 gene ............................................................................................ 58 3.2.4 Aims of the study ............................................................................................. 59

3.3 Materials and methods ........................................................................................ 59 3.3.1 Sampling ......................................................................................................... 59 3.3.2 Kinematic measurements ................................................................................ 60 3.3.3 SNP genotyping .............................................................................................. 62 3.3.4 Statistical analyses .......................................................................................... 62

3.4 Results ................................................................................................................ 66 3.4.1 Statistical analyses .......................................................................................... 66 3.4.2 Genetic analyses ............................................................................................. 75

3.5 Discussion ........................................................................................................... 76 3.5.1 Asymmetry ....................................................................................................... 76 3.5.2 Kinematic parameters of the CPH breed ......................................................... 77 3.5.3 Kinematic differences between the CPH gaits ................................................ 77 3.5.4 Genetic differences in the CPH gaits .............................................................. 78

3.6 Conclusions ......................................................................................................... 80 3.7 Acknowledgments ............................................................................................... 81

4. Chapter 3. Conclusions and recommendations .................................................... 83 4.1 Conclusions ......................................................................................................... 83 4.2 Recomendations ................................................................................................. 85

A. Appendix: Colombian paso horse gaits ................................................................. 87

References ....................................................................................................................... 89

Content XV

Figure list Page

Figure 2-1: Anatomical landmarks location and angles measured on the Colombian paso horses. .............................................................................................................................. 25 Figure 2-2: Discriminant analysis for the Colombian paso horse groups using conformation parameters. ................................................................................................. 37 Figure 2-3: Canonical scores and the parameters that were selected for the first dimension of the discriminant analysis of the Colombian paso horse groups. ................. 38 Figure 2-4: Discriminant analysis between the Colombian paso gaits using conformation parameters. ...................................................................................................................... 39 Figure 2-5: Inbreeding coefficient for each Colombian paso horse group per year of birth. .......................................................................................................................................... 40 Figure 2-6: Percentage of horse group ancestors for each Colombian horse group in the last 3 generations. ............................................................................................................ 40 Figure 2-7: DAPC analysis for the last 3 generations of the Colombian paso horse groups using microsatellite data. .................................................................................................. 42 Figure 2-8: FST values between Colombian paso fino group and the other horse groups in the last 3 generations analyzed. ....................................................................................... 43 Figure 2-9: DAPC analysis for the last generation of the Colombian paso horse groups using X chromosome microsatellite data. ......................................................................... 44 Figure 2-10: Bar plot of the STRUCTURE analysis, K=2, of the Colombian paso horse groups using X chromosome microsatellite data. ............................................................. 44 Figure 2-11: Haplotype network between 26 Colombian paso horse (blue) haplotypes and 88 haplotypes from others 48 horse breeds (Table 2-1). .......................................... 46 Figure 2-12: Bayesian tree based on 355 bp mitochondrial d-loop haplotypes of the 26 Colombian paso horse and 88 haplotypes described in a previous study (Achilli et al., 2012).. .............................................................................................................................. 47 Figure 3-1: Anatomical landmarks location and angles measured on the horses in motion. .......................................................................................................................................... 61 Figure 3-2: Protraction and retraction limbs angle measurements in a sample of the Colombian paso horse. ..................................................................................................... 61 Figure 3-3: Flowchart of the procedures performed to select one of the kinematic parameters (left or right side of the horse) based on asymmetry analysis for each kinematic parameter in the Colombian paso horses. ....................................................... 63 Figure 3-4: Discriminant analysis for the CPH groups using kinematic parameters. ....... 73

XVI Genetics of Colombian paso horse, phylogenetics, biotype, and gaits

Figure 3-5: Canonical scores and the parameters that were selected for the first dimension of the discriminant analysis of the Colombian paso horse groups. .................. 74 Figure 3-6: Discriminant analysis between the Colombian paso gaits using kinematic parameters. ....................................................................................................................... 74 Figure 3-7: Bar plot of genetic structure analysis of the Colombian paso horse groups based on microsatellite data. ............................................................................................. 75

Content XVII

Table list Page

Table 2-1: Mitochondrial D-loop haplotypes (466) of 49 horse breeds used for the phylogenetic analyses. ..................................................................................................... 22 Table 2-2: Mean and variation for length and angles parameters by gait and sex in a sample of Colombian paso horse breed1. ......................................................................... 29 Table 2-3: Correlations between pairs of conformation parameters measured for each CPH group (P<0.01, r>+-0.5). .......................................................................................... 34 Table 2-4: Differences between the CPH horse groups or sex on the conformation parameters analyzed. ....................................................................................................... 36 Table 2-5: Mitochondrial d-loop haplotypes of the Colombian paso horse found in 198 samples based on haplogroups described in a previous work (Achilli et al., 2012). ........ 45 Table 3-1: The kinematic parameters selected based on the asymmetry analysis performed in the CPH breed. ............................................................................................ 66 Table 3-2: Mean and variation for kinematic parameters by horse group and sex in a sample of Colombian paso horse breed1. ......................................................................... 67 Table 3-3: The moderate to high significant (P<0.05) correlations between the kinematics parameters1 measured for each CPH group. ................................................................... 70 Table 3-4: Differences among the CPH groups or sex on the kinematic parameters analyzed. .......................................................................................................................... 72 Table 3-5: Genotype frequencies of the DMRT3 mutation in a sample of Colombian paso horses. .............................................................................................................................. 76 Table 3-6: Number of diagonally gaited horses with different DMRT3 genotypes that perform a clear or unclear gait footfall pattern. ................................................................. 76

1. Introduction

The Colombian paso horse (CPH) is the principal horse breed in Colombia. However, there

is no consensus about if these horses are one or more breeds (Fedequinas, 2006) (i.e.

according to the FAO (http://dad.fao.org), the CPH is divided into three breeds based on

the gaits they perform) nor a breed standard. This is because there are no specific scientific

studies which explore these and other questions in this breed so far. The absence of this

information has repercussions on economic and cultural issues. The lack of a breed

standard negatively affects the international market, mainly because it is not recognized as

a breed (or breeds) by different countries (Bowling & Ruvinsky, 2000). Otherwise, the

knowledge, conservation and improvement of this genetic autochthonous resource

contribute to the cultural richness of Colombia and Latin-America.

1.1 Genetics of populations

1.1.1 Mendel´s principles.

Gregor Mendel laid the foundations of heredity in his article describing the principles or laws

that govern it (Mendel, 1866). First, he described that there are characters that dominate

over others (recessive) when crossing two 'pure' lines of peas with two different characters,

all these hybrid plants showed the dominant character. Second, when crossing these

hybrids, he obtained a ratio of 3:1 of the dominant characters over the recessives ones, so

he inferred the segregation of characters. That meant that during the formation of

reproductive cells (gametes) each cell has one or another variant (allele) of the two

characteristics that distinguish one attribute, where interbreeding the recessive form and

the homozygous dominant form will always throw the same form on their descendants

2 Error! Reference source not found.

(heterozygous). When the other two heterozygous dominant forms interbreed again

produce offspring at 3:1 form ratio.

Finally, he found that mating different forms of several characteristics at once, the

proportion of the forms in the descendants (described in the earlier experiments) for each

characteristic is independent of the presence of the other, so there is independence among

the characters are inheriting, this under the current concept that the genes are in gametic

equilibrium.

1.1.2 Hardy-Weinberg principle

Together with the principles outlined by Mendel in 1908, G.H. Hardy (Hardy, 1908) in

England and W. Weinberg in Germany argued that "after one generation of random mating,

the genotype frequencies of a single locus could be represented by a binomial function

(when two alleles) or multinomial (with multiple alleles) of allele frequencies" this is known

as the principle of Hardy & Weinberg (H & W). This principle together with the synthetic

theory of evolution, among others, laid the foundations of population genetics. Population

genetics study what causes allele frequencies changes on populations, as well as how

evolution occurs at a microevolutionary scale. There are different evolutionary factors

playing important roles, these include:

1.1.3 Evolutionary process

Mutation – Mutations are the raw material of evolution because they are the original source

of genetic variation in a population (Hedrick, 2011). Mutations occur at multiple levels and

they may involve single nucleotide changes, part of a gene, an entire gene, part of a

chromosome, an entire chromosome or a set of chromosomes (Hedrick, 2011).

The mutations in a gene may involve substitutions at a single base pair in the DNA due to

random errors in DNA synthesis or random errors in the repair of damaged sites by

chemical agents or high-energy radiation (Griffiths, 2002). These types of changes are

generally produced by reactions catalyzed by the DNA polymerase (Griffiths, 2002). Also,

if the mutations are insertions or deletions of one or more nucleotide, they are called indels.

The consequences of the latter will depend on the gene region in which they occurred so

that it could alter the protein reading frame causing likely a nonfunctional protein. In

Error! Reference source not found. 3

microsatellites, mutations generally correspond to an increase or decrease of one or more

base pairs caused by the "polymerase slippage". This model of gain or loss of one or more

repeat units is called "Stepwise model" or mutation step model (Reviewed by (Estoup &

Cornuet, 1999)).

Gene flow – this indicates movement of organisms among groups resulting in genetic

exchange (Hedrick, 2011). It differs from the migration term, since there are several

examples of migratory movements per se that do not involve gene exchange among

subpopulations. There are several models of gene flow, for example the island model,

where gene flow between two populations, and allele frequency changes will depend on

the difference in the size (effective size) and the original allelic frequencies of the

populations (Freeman & Herron, 2007). When a population consists of a number of different

subdivisions of populations in specific habitat patches whose absence is determined by

extinction and whose presence is determined by recolonization of other subpopulations, it

is called a metapopulation (Hedrick, 2011).

Selection - The difference in fitness among phenotypically similar individuals (Futuyma,

2013) is called natural selection. Understood as fitness, overall, the reproductive success

of an organism which can be measured as the number of progeny on the average

population in the second generation (Futuyma, 2013). In the case of domestic species, the

human being has directed the selection processes for economic traits, health or aesthetic

interests; in this case the term refers to artificial selection. The selection can be evaluated

at the molecular level as a process that changes the allelic frequencies in a population.

Then, the strength of selection depends on differences in the effects of the genes or alleles

within genes on the fitness of organisms (Hedrick, 2011).

Genetic drift - Genetic drift is the change in allele frequencies resulting from sampling

gametes from generation to generation in a finite population (Hedrick, 2011). It turns out

that when the populations have a small number of individuals or they reduce their

population sizes, the effect of genetic drift increases. When reduction of the number of

individuals in a population is given by periods during which only a few individuals survive to

continue its existence, it is called "bottleneck" (Hedrick, 2011). Additionally, when a

population grows from a few founding individuals, it is called "founder effect" (Hedrick,

2011).


The effective size of a population, related to evolution, broadly refers to the number of

reproductive individuals within a population, which in many cases can be very different to

the total number of individuals in the population. However, under the influence of certain

factors such as variation in sex ratio, number of offspring by individuals and number of

reproductive individuals per generation, the number of breeding animals in a population

may not be indicative of the effective population size. The concept of effective size, Ne,

considers a population of size N in which every parent has the same probability of being

the parent of any progeny (Hedrick, 2011). This implies that these individuals can produce

diploid male and female gametes at once (monoecious) and includes the possibility of

autogamy. Given these considerations, the effective size is an idealized population that

would produce the same amount of inbreeding, variance in allele frequencies or loss of

heterozygosity in the population studied (Hedrick, 2011). Thus the loss of heterozygosity

from one generation to another may indicate the effective size of the population (Nei, 1987),

and the behavior of allele frequencies among generations (Waples & Yokota, 2007).

Thus, the genetic differences and genetic structure are evaluated with statistics by linking

genetic variability in populations relative to the population as a whole. These statistics

include the F Wright, multivariate statistical techniques, similarity measures, genetic

distance and genetic structure models based on Bayesian inference.

1.1.4 Genetic Structure

One of the causes of genetic structuring is the non-random mating in the population, in

which mating among more or less related individuals occur more frequently than expected

by chance in the population (Hedrick, 2011). These two types of matings are called

inbreeding or outbreeding respectively. These mating types do not change allele

frequencies, but they do rearrange genotypes in the population, so in an inbred population

there is a heterozygote deficiency regarding expected under H&W equilibrium conditions.

The inbreeding can be quantified as the inbreeding coefficient, F, which is the probability

that two "equal" alleles of a genotype are identical by descent.

The F is estimated using genealogies, however, an analogous F can be estimated with

genetic markers, also known as fixation index, the FIS. Wright initially developed this index

in 1951 along with other coefficients partitioning the genetic variation in three levels, total


(T), subpopulation (S) and individuals (I) as measures of genetic differentiation or genetic

structure (Hedrick, 2011).

1.1.5 Breed The concept of "breed" is controversial. Different authors (Dobzhansky, 1941; Carter & Cox,

1982; Köhler-Rollefson, 1997; Rodero & Herrera, 2000; Alfranca, 2001; Rege, 2001;

Colino-Rabanal et al., 2018) and nongovernmental organizations such as FAO (FAO,

1999), define a breed based on different biological and cultural parameters, and even

though there is no consensus on these parameters, there seems to be some common

elements. Based on these different concepts, breed is a group of animals which share

defined and identifiable external characteristics (FAO, 1999), characters which are

inheritable (Dobzhansky, 1941) representing largely a closed gene pool (Köhler-Rollefson,

1997). The animals which belong to a breed are originated and located in a particular

habitat/distribution area (Köhler-Rollefson, 1997), share a common ancestry or evolutionary

history (Carter & Cox, 1982) and they are different from other groups of the same specie

as a result of natural and artificial selection on specific traits (Rodero & Herrera, 2000;

Alfranca, 2001). The breed could be as an initial state of intraspecific genetic differentiation

of non-natural populations, which subsequently leads to selective matings, genetic

isolation, reproductive incompatibility; and as a result, after an indefinite period, speciation

events may take place. However, it is important to establish certain values of genetic and

phenotypic parameters to define the nature of a “breed”, since the levels of genetic and

phenotypic differences could be a key indicator of the existence of a breed. For the CPH

case, there would be significant differences on both phenotypic and genetic parameters,

which imply both intra (CPH groups) and inter genetic structure relative to other horse

breeds (Dovc et al., 2006; Khanshour et al., 2013; Petersen et al., 2014; Cortés et al.,

2017).

1.1.6 Phylogenetics

In terms of phylogenetic relationships, the breed itself is not an Operational Taxonomic Unit,

OUT. This because in the breed, as intraspecific level, there is no hierarchical relationships

among the genes sampled from individuals of different breeds, there is low divergence,


ancestral copies are expected to persist in the samples, multifurcation could occurs, there

is hybridization among lineages etc. (Posada & Crandall, 2001). So, several of the

principles for phylogenetics analysis are violated, therefore these analyses with breeds

deserve to be carefully treated.

To estimate these evolutionary trees, it is necessary to begin with assumptions of the

evolutionary processes of the observed data, which form a "conceptual model" (Kelchner

& Thomas, 2007). These conceptual models share several assumptions, for example

mutations are independent of each other, evolution occurs by divergence without

crosslinking, mutational processes are consistent over time (seasonality), mutations can

revert to previous states (reversibility) and mutation events are not influenced by previous

mutations at that site (Kelchner & Thomas, 2007). Furthermore, these conceptual models

are formalized through nucleotide substitution models. These models in phylogenetic are

used as estimators of evolutionary change in a nucleotide given a site over time (Kelchner

& Thomas, 2007). These models consider parameters as: the frequencies of the bases, the

transition or transversion rates, heterogeneity of mutations along the sequence, the

proportion of invariable sites, the mutation rate heterogeneity within a lineage in time and

other parameters associated with the secondary and tertiary structure of the chains (Lio &

Goldman, 1998; Lemey, Salemi & Vandamme, 2009). These models include the JC69

(Jukes & Cantor, 1969), K80 (Kimura, 1980), F81 (Felsenstein, 1981), and T93 (Tamura &

Nei, 1993).

There are several methods for reconstructing phylogenies based on the above models, the

most used are: genetic (or evolutionary) distances, Maximum Likelihood and Bayesian

inference (Lio & Goldman, 1998; Graur & Li, 1999; Kelchner & Thomas, 2007; Lemey et

al., 2009).

1.1.7 Genetic distances

The method of genetic distances is the simplest approach to measure the divergence

between two aligned DNA sequences by counting sites that differ between them (Lemey et

al., 2009). The proportion of sites that differ is called observed distance or p-distance, and

it is expressed in terms of the number of nucleotide differences per site (Lemey et al., 2009).

However, this observed distance is less than the genetic or evolutionary distance because

some nucleotide positions may have experienced multiple substitution events (Lemey et


al., 2009). To estimate these genetic distances, it is necessary to apply a priori model of

nucleotide substitution, which makes specific assumptions about the nature of evolutionary

changes (Lio & Goldman, 1998; Lemey et al., 2009). When all pairwise distances have

been computed, a tree topology can be inferred by various methods (Lemey et al., 2009).

1.1.8 Maximum Parsimony

The maximum parsimony applies a set of algorithms to find the tree that requires the

minimum number of evolutionary changes (transformation from one state to another one)

observed among studied operational taxonomic units (OTU) (Farris, 1970; Fitch, 1971). The

objective of minimizing the evolutionary change is often defended on philosophical areas,

where an argument is that when two hypotheses provide equally valid explanations for a

phenomenon, the simplest one should be preferred. This position is known as Ockham

reason: to get rid of everything unnecessary (Lemey et al., 2009). The problem of finding

optimal trees under parsimony criterion can be separated into two sub problems: 1.

Determine the amount of change characters or tree length, required for any given tree; 2-

Search in all possible tree topologies that minimize this length (Lemey et al., 2009).

1.1.9 Maximum Likelihood

The likelihood can be defined as the probability that the data arising under certain hypothesis (Baum & Smith, 2013). Thus, the application of Maximum Likelihood (ML) in

phylogenetics is related to the search of the tree that has the highest probability of getting

the observed data (Baum & Smith, 2013).

1.1.10 Bayesian Inference

Unlike the ML, Bayesian Inference (BI) judges trees based on their posterior probability, the probability that the tree is true, given the data, and the substitution models (Lemey et

al., 2009). Bayes' theorem can be summarized in the following equation:

where Pr refers to the probability and D the data. The

posterior probability is proportional to the product of the likelihood of the data, since the

hypothesis is correct and the prior probability of the hypothesis before any data has been

collected (Alfaro, 2003).


In Bayesian phylogenetic, parameters such as the topology, length of branches, and

substitution parameters are modeled as probability distributions. Based on Bayes' theorem,

the posterior probability of any of these parameters can be expressed as the marginal

distribution of the remaining (Alfaro, 2003). To Solve analytically the posterior probability

requires the integration of the likelihood function over all possible values of the remaining

parameters (Alfaro, 2003). Bayesian methods currently use methods of Markov chains and

Monte Carlo to approximate the integration through the simulation based on the joint

posterior distribution of all parameters of the model, where the posterior probabilities of the

parameters of interest are calculated using Markov chain samples (Alfaro, 2003).

1.2 The horse The Colombian Paso horse, also known as Colombian Paso Creole Horse, belongs to the

Phylum: Chordata, Class: Mammalia, Order: Perissodactyla, Family: Equida, specie Equus

caballus (L., 1753) (Wilson & Reeder, 2005) and is part of one of 8 species or groups of

equine species (Wilson & Reeder, 2005) including the asses (Subgenus Asinus) and zebras

(Equus zebra).

1.2.1 Origin of the horse

The genus Equus appeared 2 (with fossil records (Forsten, 1989)) to 4.5 million years ago (MYA) (with molecular data George & Ryder, 1986; Orlando et al., 2013) in North America

and it descended from a clade of mammals of the genus Hyracotherium that diversified 58

MY ago in the same region (Bennett & Hoffmann, 1999). From this group of organisms

several dozens of horse type species appeared, but only the genus Equus persists today.

One of the hypothesis of the origin of the modern horse is that it is a descendent from a

mixture of 4 lineages, or subspecies mainly the Tarpan (Equus caballus ferus), the Turkish-

African sub species (Equus caballus pumpelli), the draft subspecies (Equus caballus

caballus) and believed as the main line, the Central European (Equus caballus

mosbachensis) (Bennett & Hoffmann, 1999). These subspecies survived after the

extinction of sister species that were in North America, as E. caballus mexicanus and E.

caballus alaskae. These were extinct at the end of the last ice age, about 10,000 years ago,

which it was probably prompted by the horse hunt of human populations that crossed into

America (Bennett & Hoffmann, 1999). Indeed the horse populations surviving today were


domesticated in the middle of human hunting activities (Bennett, 2014). Another species,

which was considered as the ancestor of the modern horse corresponds to Equus

przewalskii. There are specimens in captivity of this species, and it is the last surviving wild

horse. However, currently there is consensus that this species diverged from modern horse

(Bennett, 2014) between 38 and 72 thousand years ago according to the latest published

evidence (Orlando et al., 2013).

The horse’s lineages that survived and were also domesticated are phenotypically different

through a process based on isolation, adaptation, mutation, as well as natural and artificial

selection, but failed to create reproductive barriers that impede their mating. This occurred

at different times in the history of modern humans. So, the current equine breeds possibly

arose from the mating of these 4 lineages mentioned.

The most accepted hypothesis about horse domestication is that probably there were

several centers of domestication in the formation of the modern horse based on analysis of

mitochondrial sequences (Vila et al., 2001; Jansen et al., 2002; Achilli et al., 2012),

evidenced by a wide haplotype diversity, which suggests the use of wild horses from a large

number of populations. The nearly 500 current breeds with an estimated 54 million horses

population (Petersen et al., 2013a) emerged from the process of domestication, which

began 5000-6000 years ago in the Eurasian steppes during several domestication events

(Lippold et al., 2011).

The horse came to America until the second Columbus trip (Rodero, Delgado & Rodero,

1992). At that time, several populations of horses existed in the Iberian Peninsula and were

probably the ancestors of the CPH (Colombian Paso Horse). Some of these populations

were Berber horses, Haca type, Carthusian, and predecessors to the Spanish Purebred

horse (Rodero et al., 1992). There are many conjectures about how many and what equine

specimens came in the second voyage of Columbus. However, several written sources

indicate that about a couple of dozens of common horses, of poor quality, product of several

breeds from southern Spain, were the ones that arrived to America (Rodero et al., 1992).

These Columbus horses arrived to Hispaniola, currently Santo Domingo, with later

introductions it became a horse reproduction center to the neighboring islands and the

Americas; the horse became indispensable tool for the conquest (Rodero et al., 1992). At

first, the breeding and equine import in America was handled by the Spanish royalty

specimens were imported with much higher quality for the royalty breeding; later private


trade was allowed, leading to an increase of the equine population proportional to a high

demand. Rodrigo de Bastidas brought the first horses to Colombia in 1526, forming the first

horse breeding center, later Gonzalo Jiménez de Quesada, Sebastian de Belalcazar and

Nicolas de Federman, in expeditions to the center of the country, were the people that

shaped the emerging national stud (Rodero et al., 1992).

1.2.2 The Colombian Paso Horse

This breed is likely derived from a mix of Spanish horses brought by the conquerors to

America starting in 1493. This group of horses included the Spanish Jennet horse, which

was known to perform ambling gaits (Hendricks, 2007). In the beginning of the 20th century,

the CPH population consisted of a mix of horses that performed several different walking

gaits (Fedequinas, 2006). The Colombian paso horses have been intensively selected for

their gaits (paso fino, trocha and trot) since the 1980´s (Fedequinas, 2006). Currently, the

CPH breed is traditionally divided into four groups: Colombian paso fino (CPF), Colombian

trocha (CTR), Colombian trocha and gallop (CTRG) and Colombian trot and gallop (CTG)

(www.fedequinas.org). Recently, the CPF group has been declared as a national genetic

patrimony in Colombia (Law 1842 of 2017, http://es.presidencia.gov.co/normativa). The

CPF group had the largest population size during the 20th century and has been the first

CPH group distinguished outside Colombia.

The studbook, Federación Colombiana de Asociaciones Equinas - Fedequinas, was

created in 1984 and has over 220,000 registered horses (21% CTG, 5% CTRG, 46% CTR,

and 28% CPF). Fedequinas is composed of 24 CPH associations around Colombia and it

groups several hundred breeders in the country. Since 1995, all registered horses are

parentage tested and each horse is also examined by qualified representatives from horse

associations in order to look for basic conformation parameters of the breed. In addition,

the examiners also guarantee the origin of the hair samples used for parentage testing. The

horses, which are registered in Fedequinas, have the possibility to participate in

competitions in Colombia. For each competition, the horses are separated by horse group

(CPH, CTR, CTRG or CTG), sex, age (three categories: 33-42 months, 42-60 months, and

more than 60 months), and evaluated by three judges. This gives subjective qualifications

of the conformation and gait traits evaluated (www.fedequinas.org).


The definitions of CPH groups are based on subjective measurements and partial

observations (Fedequinas, 2006), without any formal study to support them. In addition to

the lack of clear CPH phenotypic parameters, genetic diversity has been barely measured

and cannot be tracked. These issues could threaten the viability of the breed itself, and

genetic improvement programs cannot be implemented without these basic phenotypic and

genetic parameters.

1.2.3 Genetics of the horse

The horse genome was reported in 2009 (Wade et al., 2009a). However, the annotation

was made based on the genome of other species, including humans, because there was

little information about the genes expressed in the horse (Bailey & Brooks, 2013). Of the

nearly 2,430 million base pairs sequenced, it is estimated that there are about 20,000 genes

in the genome of the horse (Bailey & Brooks, 2013), similar to the average found in most

mammals. Additionally, the specie E. caballus has 32 pairs of chromosomes, 2n = 64,

including the sexual pair (Wade et al., 2009a; Naranjo, 2012; Chowdhary, 2013).

Only a few genetic studies exist on this breed and none of them to determine whether or

not the CPH corresponds to one or more breeds. Colombian paso fino horse populations

have been studied on blood protein groups (Bowling & Clark, 2009), microsatellite

microsatellite (Cothran et al., 2011; Cortés et al., 2017) and mitochondrial d-loop sequences

(Luis et al., 2006; Jimenez et al., 2012). A previous study (Cortés et al., 2017) included all

CPH groups, however sample size was reduced and probably do not represent the whole

genetic variation in the CPH. This study evidenced that the CPH is a highly differentiated

horse breed between the ibero-american horse breeds.

Significant genetic differences across populations of single breeds in horses (Dovc et al.,

2006; Khanshour et al., 2013; Petersen et al., 2014) and cattle (Novoa-Bravo, 2010;

Strucken et al., 2015) have been documented as a result of intensive artificial selection on

some traits and/or geographic isolation. However, these genetic parameters have not been

measured through time, neither it is clear how fast allelic frequencies may change in these

populations, which could be part of the breed formation process.


1.2.4 Gait of horses – DMRT3 gene

The ability to move by lateral gait is not common in mammals, some examples of animals

are the giraffes, some dog breeds like the Brazilian Fila, and some horse breeds as

Icelandic and Paso Fino. Currently, there has been hypothesized that that gait could be

heritable: using as model horses and mice, a previous study (Andersson et al., 2012b)

suggested that a transversion in the DMRT3 gene at nucleotide position chr23: 22999655

causes a premature stop at codon 301 (DMRT3_Ser301STOP), affecting the capacity to

move laterally these animals.

This gene is part of a transcription factors family (Double Sex Map Related Transcriptors -

DMRT) which translates a protein of 474 aa (wild allele) and a 300 aa for the mutation

described. This protein has a DNA-binding module zinc-finger like and a protein binding

domain of unknown function present in DMRT proteins (Andersson et al., 2012a). It has

been shown that DMRT3 gene is necessary (at least in mice) for the normal development

of a coordinated locomotion network in the spinal cord (Andersson et al., 2012a), so the

loss of expression of transcription factors within origin domains results in neuronal

specification defects, presumably by suppressing different routes operating in adjacent

domains (Goulding, 2009). Additionally, in both wild and mutant mice that are DMRT3

homozygous, these expression levels were similar, and also mRNA was found in a small

population of neurons for both types (Andersson et al., 2012a). The mutant protein

maintains its cellular localization and DNA binding profile, therefore may be a dominant

negative form with a binding DNA normal site but defective protein interactions (Andersson

et al., 2012a).

Furthermore, based on this mutation, Promerová et al., (2014) analyzed 4396 animals of

141 breeds, most of them classified as pass gait. Within these samples there was 186

samples of CPHs: 80 Colombian Paso Fino, 67 Colombian Trocha, 4 Colombian Trocha

and Gallop, and 35 Colombian Trot and Gallop horses. It was found that many breeds

classified as gaited breeds, the mutation is at high frequency or fixed. However, animals of

several breeds, including the CPH, despite not having lateral gait, were homozygous for

the mutation, or animals having lateral gait were homozygous for the wild-type allele. This

leads to several questions about the penetrance of the mutation or that other loci could be

involved in lateral gait expression and other diagonal gaits.


1.2.5 Genomics of the horse A Thoroughbred mare, named Twilight was chosen for genome sequencing at the Broad

Institute of MIT and Harvard at Boston, Massachusetts

(http://www.broadinstitute.org/mammals/horse, accessed 2018-11-05). Her genome was

sequenced and made publicly available for research in 2006 (Bailey & Brooks, 2013),

followed by the publication with the annotated genome (Wade et al., 2009b). The genome

assembly for Twilight contained 2.3 Gb. In the beginning, the horse genome was annotated

using information from other species, estimating 20,322 genes by ENSEMBL and 17,610

by NCBI (Bailey & Brooks, 2013). Using 7 horses from different breeds a SNP map of more

than one million SNPs was developed (Wade et al., 2009b). The most recent update of the

Equine genome (EquCab3) was completed in 2018 which contained 2.4 Gb (Kalbfleisch et

al., 2018). A SNP is a specific nucleotide in the genome which varies between individual

into a population. The number of SNPs in the horse genome is around 23 million SNPs

(Schaefer et al., 2017). During the last decade, several SNP arrays for 50,000 up to

2,000,000 SNPs were developed (McCue et al., 2012; Schaefer et al., 2017), this last array

was made using 24 horse breeds.

To identify which genes, loci or regions may be associated with phenotypes, one approach

is by Genome-wide association studies (GWAS). To perform a GWAS are required a

sample with genetic variation (SNPs, indels, STRs, VNPs) and a variable phenotype

(categorical or quantitative measures). SNPs are traditionally used for GWAS. The GWAS

method is based on Linkage Disequilibrium (LD), where two or more alleles from two or

more loci segregate in a dependent way, or that there is non-random association between

alleles at two or more loci. The LD depends of what so close are the alleles in the genome

and can be affected by selection, migration, genetic drift, and mutation (Hedrick, 2011). In

case of a monogenic trait, once a genetic variant is verified as associated with the

phenotype of interest, the next step is look for another genetic variant(s) in LD with the

genetic variant associated, which can be affecting a gene or genes as causative of the

phenotype of interest. For that, studies focused on gene transcription, translation, gene

expression and protein-protein interaction are made, what is called functional genomics.


In horses, several genomic studies have been done during the last decades focused on

health and performance traits, i.e. mutations have been discovered in the hereditary equine

regional dermal asthenia (HERDA) and polysaccharide storage myopathy (PSSM)

diseases based on gene mapping (Finno, Spier & Valberg, 2009); a DMRT3 mutation

(Andersson et al., 2012a) and several mutations at the MSTN gene (i.e. Hill et al., 2010)

are associated with locomotion patterns and performance in horses.

1.3 Hypotheses H0. The Colombian paso horse is a single genetically structured breed based on the

homogeneity of phenotypic traits analyzed, the inheritance of its gaits and a common

genetic origin based on mitochondrial DNA.

- There are two genetic groups within the Colombian paso horses that correspond to the

horses classified with a lateral gait (paso fino) and the other diagonal gaits (trocha and trot).

- The gaits in the Colombian paso horse are discrete groups based on kinematic and the

mendelian inheritance of the DMRT3 mutation associated with locomotion patterns in

horses.

-The Colombian paso horse evidences a common matrilineal origin, with a high frequency

haplotype shared with Iberian horse breeds.

1.4 Objectives of this research

General

To evaluate whether or not the Colombian paso horse is a breed based on genetic and

phenotypic evidence.

Specifics

To define the genetic structure of the Colombian paso horse.


To demonstrate Mendelian inheritance and differences of the Colombian paso horse gaits. To infer the evolutionary history of the Colombian paso horse. To achieve these objectives, pedigree, genetic and phenotypic data from Colombian paso

horses (220,000 pedigree records, 132,637 autosomal microsatellite genotypes, 900 sex

chromosome microsatellite genotypes, 198 mitochondrial d-loop sequences, conformation

and kinematic measurements of 172 horses, and DMRT3 nonsense mutation genotypes of

153 horses) were analyzed throughout statistical, population genetics, and phylogenetic

analyses. Finally, this study will settle down the genetic and phenotypic foundations of these

Colombian horses. This study will allow implementing quantitative genetic improvement

programs and will protect this Colombian genetic resource. Furthermore, this research will

contribute to the understanding of breed formation mechanisms throughout intensive

artificial selection at the framework of a continuum evolutionary process in the domestic

species.

This thesis is composed of two chapters, the first one “Divergent evolution of the Colombian

paso horse reveals evidence for breed formation process.” is in submission process. The

second one “Selection on the Colombian paso horse’s gaits has produced kinematic

differences partly explained by the DMRT3 gene” was published in the PLOS ONE

journal. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0202584

2. Chapter 1. Divergent evolution of the Colombian paso horse reveals evidence for breed formation process.

Miguel Novoa-Bravo1,2, Eleonora Bernal Pinilla1, Luis Fernando García2

1 Genética Animal de Colombia Ltda. Bogotá, Colombia. 2 Department of Biology, National University of Colombia, Bogotá, Cundinamarca,

Colombia.

* Corresponding author

E-mail: [email protected] (MNB)

2.1 Abstract The Colombian paso horse, the most important horse breed in Colombia, also known as

Colombian creole paso horse, has been selected for conformation and gaits for at least the

last 50 years. We hypothesize that this selection has led the Colombian paso horse become

two different horse breeds. Therefore, the aims of this study were: 1. To evaluate the

existence of one or more CPH breeds based on genetic, pedigree, and phenotypic data. 2.

To establish the genetic structure of the CPH through several generations, and 3. To

estimate a phylogenetic reconstruction of the CPH by including other horse breeds. To

evaluate the hypothesis, microsatellites (132,637 genotypes from 13 autosomal markers

and 900 genotypes of 8-10 X-chromosome markers), pedigree (220,000 records),

mitochondrial (198 sequences of d-loop and 466 d-loop haplotypes from 49 horse breeds),

and conformation (anatomical lengths and angles measurements from 172 horses) data of

Colombian paso horses were analyzed. The results showed that there are significant

18 Genetics of Colombian paso horse, phylogenetics, biotype, and gaits

genetic differences between Colombian paso fino and the other groups, and those

differences have been increasing through the 30 years tracked. These genetic differences

agreed with phenotypic and pedigree data, where the Colombian paso fino is the most

differentiated group. Also, the phylogenetic reconstruction showed that the Colombian paso

horses had a complex breed origin and that these horses share an evolutionary history with

specific haplotypes, even, some of those haplotypes represent an ancestral Iberian

haplogroup which had been described in just few modern horses until the present study.

Thus, these different sorts of evidence reveal that the Colombian paso horse was a single

breed which became two breeds. The present study is the first to evidence a breed

formation process in domestic animals where the role of microevolutionary forces by means

of recorded genetic data, also revealed phenotypic differentiation. Nevertheless, further

studies are required to understand the genetic bases which separate and define the breeds.

2.2 Introduction

2.2.1 The Colombian paso horse The Colombian paso horse (CPH), also known as Colombian criollo paso horse, is the most

important breed in Colombia and it is likely that it has become two different horse breeds

during the last century. This breed probably originated from a mix of Spanish horses

brought by the conquerors to America in 1493, which could have included the Spanish

Jennet horse, known to perform ambling gaits (Hendricks, 2007). In the beginning of the

20th century, the CPH population consisted of a mix of horses that performed several

different stepping gaits (Fedequinas, 2006).

The CPHs have been intensively selected for their gait and conformation since the 1950´s

(Fedequinas, 2006). Currently, the CPH breed is traditionally divided into four groups based

on their gaits: Colombian paso fino (CPF), Colombian trocha (CTR), Colombian trocha and

gallop (CTRG) and Colombian trot and gallop (CTG) (www.fedequinas.org). Recently, the

CPF group was declared as a national genetic patrimony in Colombia (Law 1842 of 2017,

http://es.presidencia.gov.co/normativa). The studbook, Federación Colombiana de

Asociaciones Equinas - Fedequinas, was created in 1984 and has over 220,000 registered

horses. Fedequinas is composed of 24 CPH associations around Colombia and it groups

several hundreds of breeders in the country. Since 1995, all registered horses are

parentage tested and each horse is also examined by representatives from the breeding

Chapter 1 Divergent evolution of the Colombian paso horse reveals evidence

for breed formation process.

19

associations, for basic conformation parameters of the breed. CPHs are judged in national

competitions in Colombia, Puerto Rico, United States, Ecuador, Dominican Republic,

Panamá, Venezuela and Aruba (www.confepaso.net). For each competition, the horses are

separated by horse groups (CPH, CTR, CTRG or CTG), sex, age (three categories: 36–48

months, 48–60 months, and more than 60 months) and evaluated by 3 judges. This gives

subjective qualifications of the conformation and gait traits evaluated

(www.fedequinas.org). The CPH’s gaits have been described in a recent study (Novoa-

Bravo et al., 2018).

The definitions of the CPH groups are based mainly on subjective measurements and

partial observations (Fedequinas, 2006), without any formal study to support them, except

a recent study which analyzed kinematic data and the DMRT3 gene of a CPH sample

(Novoa-Bravo et al., 2018). Thus, there is an absence of CPH phenotypic parameters and

the genetic diversity has been scarcely measured. These issues could threaten the viability

of the breed itself, and genetic improvement programs cannot be implemented without

these basic phenotypic and genetic parameters.

2.2.2 The modern horse, breed formation, one or more CPH breeds?

The history of the modern horse can be traced until the earliest recognized ancestor which

belonged to a species of the clade hyracothere (genus Hyracotherium) 58 MYA (Bailey &

Brooks, 2013). This clade spread through North America to Europe, and some populations

in America were isolated when rising waters submerged the land bridges between America

and the rest of the world (Bailey & Brooks, 2013). There were posterior migrations of

descendants of clade hyracothere from America to Asia in several waves (15-20 MYA and

5-10 MYA), and the genus Equus appeared in America approximately 4 MYA (Bailey &

Brooks, 2013). The genus Equus became extinct in America about 12,000 years ago

possibly by human predation and/or climate change (Bailey & Brooks, 2013).

The domestication of the horse probably corresponds to a model that holds that “when

people determined that a particular species of wild animal could be domesticated, the

animals were captured and domesticated throughout the natural range of the animal”


(Bailey & Brooks, 2013). This model implies a wide genetic diversity as registered in

mitochondrial DNA studies in horses (Jansen et al., 2002; Achilli et al., 2012). Likely, mares

from different populations were included during different domestications events. Otherwise,

a recent Y chromosome study shows a limited genetic diversity in horses (Wallner et al.,

2017), where it is hypothesized that all modern horses (patrilineal origin) came from the

same ancestor. This shows a different selection pattern in stallions compared to mares,

where a few of those stallions have been selected during the development, for most, of the

actual horse breeds.

Significant genetic differences across populations of single breeds in horses (Dovc et al.,

2006; Khanshour et al., 2013; Petersen et al., 2014) and cattle (Novoa-Bravo, 2010;

Strucken et al., 2015) have been documented because of intensive artificial selection on

some traits and/or geographic isolation. However, these genetic parameters have not been

measured through time, neither it is clear how fast allelic frequencies may change in these

populations, which could be part of the breed formation process.

One controversial issue is the concept of "breed". Different authors (Dobzhansky, 1941;

Carter & Cox, 1982; Köhler-Rollefson, 1997; Rodero & Herrera, 2000; Alfranca, 2001;

Rege, 2001; Colino-Rabanal et al., 2018) and nongovernmental organizations such as FAO

(FAO, 1999), define a breed based on different biological and cultural parameters, and even

though there is no consensus on these parameters, there seems to be some common

elements. Based on these different concepts, breed is a group of animals which share

defined and identifiable external characteristics (FAO, 1999), characters which are

inheritable (Dobzhansky, 1941) representing largely a closed gene pool (Köhler-Rollefson,

1997). The animals which belong to a breed are originated and located in a particular

habitat/distribution area (Köhler-Rollefson, 1997), share a common ancestry or evolutionary

history (Carter & Cox, 1982) and they are different from other groups of the same species

as a result of natural and artificial selection on specific traits (Rodero & Herrera, 2000;

Alfranca, 2001). The breed could be as an initial state of intraspecific genetic differentiation

of non-natural populations, which subsequently leads to selective matings, genetic

isolation, reproductive incompatibility; and as a result, after an indefinite period, speciation

events may take place. However, it is important to establish certain values of genetic and

phenotypic parameters to define the nature of a “breed”, since the levels of genetic and

phenotypic differences could be a key indicator of the existence of a breed. For the CPH

case, there would be significant differences on both phenotypic and genetic parameters,



21

which imply both intra (CPH groups) and inter genetic structure relative to other horse

breeds (Dovc et al., 2006; Khanshour et al., 2013; Petersen et al., 2014; Cortés et al.,

2017).

Only a few genetic studies exist on the CPH breed and none of them determined whether

the CPH corresponds to one or more breeds. The CPF groups have been studied on blood

protein groups (Bowling & Clark, 2009), microsatellite (Cothran et al., 2011; Cortés et al.,

2017) and mitochondrial d-loop sequences (Luis et al., 2006; Jimenez et al., 2012). A

previous study based on microsatellites markers (Cortés et al., 2017) included all the CPH

groups but sample size was reduced and probably do not represent the whole genetic

variation in the CPH. This study (Cortés et al., 2017) evidenced that the CPH is a highly

differentiated horse breed among the ibero-american horse breeds.

We hypothesize that the evolution of the Colombian paso horses became two different

Colombian horse breeds, the Colombian paso fino horse breed and the Colombian trocha

and trot horse breed. These breeds would have had a common origin and they would have

diverged during at least the last 50 years. Hence, the aims of this study were: 1. To evaluate

the existence of one or more CPH breeds based on genetic, pedigree, and phenotypic data.

2. To establish the genetic structure of the CPH through several generations, and 3. To

estimate a phylogenetic reconstruction of the CPH by including other horse breeds.

2.3 Materials and methods

2.3.1 Genetic sampling A database provided by the Fedequinas consisted of about 220,000 records of animals with

their parentage and birth dates, horse group, gait, color, and sex, which were used for

pedigree analyses. A second database provided by Fedequinas consisted of 132,637

genotypes from 13 microsatellite markers (AHT4, AHT5, ASB17, ASB2, ASB23, HMS3,

HMS6, HMS7, HTG10, HTG4, LEX3, LEX33, VHL20) for all the CPH groups (Colombian

paso fino (CPF), Colombian trocha (CTR), Colombian trocha and gallop (CTRG) and

Colombian trot and gallop (CTG)) were used for genetic analyses. The microsatellites were

chosen based on FAO (FAO, 1999) and ISAG guidelines for genetic diversity and

parentage testing in horses (van de Goor, Panneman & van Haeringen, 2010) respectively.


Additionally, hair samples from 900 CPH horses were randomly selected from the

repository of Fedequinas. The samples were genotyped for 8 up to 10 horse X-chromosome

microsatellites: LEX022, CA428, CA502, LEX027, COR074, LEX013, LEX024, VHL81,

LEX10, LEX026 according to (Raudsepp et al., 2002).

Finally, hair samples from 198 horses from different CPH’s maternal lineages were selected

based on the pedigree analysis. Genomic DNA was extracted following a previous study

(Jäderkvist et al., 2014). One hundred microliters Chelex 100 Resin (Bio-Rad Laboratories,

Hercules, CA) and 1 μL of proteinase K (20 mg/mL; Bioline, London, UK) were added to

the sample. The mix was incubated at 56°C for 90 minutes and the proteinase K was

inactivated for 10 min at 95°C. A fragment containing the hypervariable region of about 500

bp between tRNAThr and the d-loop central domain was amplified (Ishida et al., 1994). The

primers used were chosen according to (Mirol et al., 2002) and the PCR conditions were

set up as previously described (Lopes et al., 2005). Fragments were sequenced on an ABI

PRISM 3700 capillary sequencer using the BigDye Terminator v3.1 cycle sequencing kit

(Applied Biosystems).

For the phylogenetic analyses, 466 haplotypes (345 bp) (Table 2-1) were used. This data

set included haplotypes of 49 horse breeds from GeneBank

(https://www.ncbi.nlm.nih.gov/genbank), and 26 CPH haplotypes found in the present

study. The breeds were selected by the data availability around the world focused on

America and Western Europe as possible breeds related with the CPH. The nucleotidic

positions were established according to the RefSeq NC001640 (Xu & Arnason, 1994), in

order to compare the variants found in the present study with other studies, the haplogroup

nomenclature was based on a previous study (Achilli et al., 2012).

Table 2-1: Mitochondrial D-loop haplotypes (466) of 49 horse breeds used for the

phylogenetic analyses.

Breed Abbreviature Haplo-types GenBank Accession numbers

Akhal teke AKHALT 15 AY246174-9, DQ327950, DQ327952-3, DQ327956-60, DQ327963.



23

Arabian ARAB 60

AF465995-5, AY246180-1, AY246184, KC840701-5, KC840707-9, KC840711-16, KC840718, KC840724, KC840727, KC840732, KC840735-9, KC840744, KC840746-9, KC840751, KC840754-8, KC840763, KC840767-9, KC840773-4, KC840778-81, KC840783, KC840790, KC840795.

Asturcón AST 9 AF466006, AY519871-4, AY519876-8, HQ827087.

Belgian BELG 4 AY246186-7, AY246190, AY246192. Argentinean creole ARC 6 AF465986-90, AY997128.

Campolina CAMPOL 4 AY997139-40, AY997142-3.

Caspian CASPIAN 5 AY246195-8, AY246200. Colombian paso horse CPH 26 MH318582-MH318607.

Caballo de corro CCO 5 AY519883, AY519893, AY519894, AY519896,

AY519889. Cheju CHEJU 6 AY246201-3, AY246206-8.

Chilean creole CHILC 4 AY997131-4.

Chilote CHILOT 3 AY997136-8.

Cleveland bay CLEVBY 3 AY246209, AY246211-2.

Clydesdale CLYD 3 AY246214, AY246217-8.

Cartujano CTJ 4 AY519897-8 AY519900-1.

Exmoor EXMOOR 4 AY246219-22.

Florida cracker FLCR 2 AY997150-1.

Friesian FRIESIAN 4 AY246227-30.

Garrano GARR 13 AY246231-5, AY519914-5, AY519917-18, AY519920-23.

Guan montain GUANMT 9 DQ327838-40, DQ327842-7.

Haflinger HAFL 5 AY246236-7, AY246239-41.

Irish draught ID 32 DQ327891-3, DQ327898-900, DQ327902-5, DQ327909-10, DQ327914-6, DQ327918-23, DQ327925-8, DQ327933-6, DQ327938, DQ327944-5, DQ327948.

Jaca navarra JN 15 HQ827104-18.

Kerry bog pony KBP 17

DQ327851-6, DQ327858, DQ327860, DQ327862, DQ327864, DQ327869, DQ327871-2, DQ327874, DQ327876, DQ327879-81.

Kiger mustang KM 3 AY997152, AY997154-5.

Losino LOS 15 AF466008-9, AY519924-5, AY519927-8, AY519930, AY519932-3, HQ827120-2, HQ827124-5, HQ827128.

Lusitano LUS 28 AY246246, AY293975-91, AY525091-6, AY805641-4. Mallorquina MALLOR 2 AF466013-4.

Maremmano MAREMA 2 AY519939-AY519945.

Marismeño MARIS 10 AY519936, AY519938-9, HQ827136, HQ827138, HQ827141-5.

Menorquina MENORQ 10 AF466015-6, HQ827146-7, HQ827149-50, HQ827152-5.

Merens MERENS 11 AY519946-50, AY519952-7.


Table 2-1: (Continued).

Breed Abbreviature

Haplotypes GenBank Accession numbers

Mesenskay MESENK 11 DQ327968-71, DQ327973-4, DQ327976, DQ327981-4. Mangalarga marchador MMBR 5 AY997130, AY997156-9.

Mongol MONGOL 5 DQ327986-7, DQ327989-90, DQ327993.

Noriker NORIK 4 AY246248-50, AY246252.

Orlov OH 9 DQ328002-5, DQ328007, DQ328012-3, DQ328015, DQ328018.

Pantaneiro PANTAN 4 AY997160, AY997162-4.

Pottoka POT 19 AF466010-1, AY519958-70, HQ827156-9. Peruano de paso PP 6 AF465991-4, AY997169, AY997172.

Pure spanish horse PRE 21 AF466007, AY519907, AY519909, AY805645-8, AY805650,-

AY805652-64. Puertorrican paso fino PRPF 4 AY997174-7.

Shetland pony SHETL 4 AY246253, AY246255-7.

Sorraia SOR 2 AY246259, AY246261. Sulphur mustang SUMUST 3 AY997178, AY997181, AY997187.

Thoroughbred TB 3 AY246266, AY246271, NC001640.

Vyatskaya VH 11 DQ328020-1, DQ328023, DQ328025-8, DQ328032, DQ328034-5, DQ328037.

Venezuelan spanish VSP 3 AY997182-3, AY997186.

Yakut YH 13 DQ328038, DQ328040, DQ328042-5, DQ328050, DQ328052-7.

2.3.2 Phenotypic sampling Conformation measurements were provided by Fedequinas. A total of 172 Colombian paso

horses (CPF=48, CTR=50, CTRG=34, CTG=40, 95 males and 77 females) born between

2000-2013 were selected based on their participation in Fedequinas national competitions

and their performed gait. The sampling included horse farms in Cundinamarca, Antioquia,

Quindío, Risaralda, Caldas, Cauca, and Valle del Cauca departments of Colombia, South

America. Pedigree, CPH group, sex, DNA parentage tests, and microsatellite data per

horse were also provided by the Fedequinas.

The following measurements (cm) were taken by the same operator: Atlas-neck length,

body length, chest width, croup length and, neck base circumference. In addition, 13

anatomical landmarks were placed on the horses by the same operator (Figure 2-1) and



25

were tracked using Quintic Biomechanics® software. The measurements were taken for

each side (left and right) with the horse standing. These were recorded by a high-speed

camera with 240 frames per second. A metallic square of 1 m by 1 m was used in all the

videos to calibrate the lengths of the measurements. The software automatically calculated

the conformation variables. These variables were direct measurements on certain

anatomical landmarks, such as lengths and angles described in Figure 2-1.

Figure 2-1: Anatomical landmarks location and angles measured on the Colombian paso

horses1.

2.3.3 Phenotypic analyses § Mean and variation of the conformation parameters

1 P1: Coronary band front, P2: Fetlock front (metacarpophalangeal joint), P3: Carpal (carpometacarpal joint), P4: Elbow (head of radius), P5: Shoulder, P6: Scapula (top of the withers), P7: Coronet hind, P8: Fetlock hind (metacarpophalangeal joint), P9: Tarsus (tuber calcanei), P10: Stifle (tibial tuberosity), P11: Hip joint (summit of trochanter major), P12: Sacro-iliac joint (tuber coxae), P13: Head (wings of atlas bone). Angles, PI-F – Pastern inclination front respect to the horizontal, PI-H – Pastern inclination hind respect to the horizontal, HI – Humerus inclination respect to the horizontal, SC-I – Scapula inclination respect to the vertical, SH-A – Shoulder angle, and HA – Hock angle. Dash points show the angles measured.


The selection of one of the conformation parameters measured per side (left or right), was

based on an asymmetry analysis as proposed by a recent study (Novoa-Bravo et al., 2018),

except for the atlas-neck base, body, chest width, croup, and neck base circumference

measurements. This preliminary evaluation was performed to exclude measurements from

asymmetric limbs and to avoid possible bias in further statistical analyses of the

conformation parameters.

The statistical analyses for the conformation parameters were performed in R (R Core

team, 2016) using the Rwizard software (Guisande, Vaamonde & Barreiro, 2014). The

mean, confidence interval (CI 95%), standard error (SE), standard deviation (SD), variation

coefficient (VC), skewness and kurtosis were calculated for each variable stratified by horse

group and sex using the STATR package (Guisande et al., 2014). The normality of all

parameters was evaluated with Shapiro-Wilk test using the function shapiro.test of the base

stats package.

§ Correlations The relationships between all variables were estimated with the Pearson’s correlation

coefficient using the function XI1 of the StatR package (Guisande et al., 2014). The strength

of the correlations (r) was interpreted based on the guidelines proposed by (Hinkle,

Wiersma & Jurs, 2003): 0 to 0.3 (0 to -0.3)=negligible, 0.3 to 0.5 (-0.3 to -0.5)=low, 0.5 to

0.7 (-0.5 to -0.7)=medium, 0.7 to 0.9 (-0.7 to -0.9)= high, 0.9 to 1 (-0.9 to -1)=very high.

§ Analysis of variance The effects of CPH groups (CPF, CTR, CTRG, and CTG) and sex (females and males) on

the phenotypic parameters, were estimated with analysis of variance (ANOVA) using the

canova function of the CAR package (Fox et al., 2014). The following model was assumed

for each measurement: 𝑦"#$ = 𝑢 + 𝑔𝑟𝑜𝑢𝑝" + 𝑠𝑒𝑥# + 𝑔𝑟𝑜𝑢𝑝 ∗ 𝑠𝑒𝑥"# + 𝑒"#$, where y is a

conformation measurement for the nth horse, µ is the population mean, groupi is the effect

of the ith CPH group (i=1,…,4), sexj is the effect of the jth sex (j=1,2), and group*sexij is the

interaction effect when the ith level of group and jth level of sex are combined, and eijn is a

random residual effect. Also, a Kruskal-Wallis test was performed for non-normally

distributed parameters using the package dunn.test. The posthoc Tukey contrast test was

performed using the function glhtdel of the package multcomp (Hothorn et al., 2014) for

normally distributed parameters. Dunn’s post hoc test was done after Kruskal-Wallis test



27

using the package dunn.test. The homoscedasticity of all parameters was evaluated using

the Levene test (levene.test function, lawstat package (Gastwirth et al., 2013)).

§ Multivariate analysis

Discriminant analysis was performed by using stepwise selection to obtain a subset of the

phenotypic parameters which best summarizes the differences among CPH groups, using

the function candisc of the package candisc (Friendly, 2007; Friendly & Fox, 2013) and the

ida function of the MASS package (Venables & Ripley, 2002; Ripley et al., 2014). The figure

of one dimension was obtained with the function plot.cancor of the candisc package

(Friendly, 2007; Friendly & Fox, 2013).

2.3.4 Pedigree analyses The animals were classified according to the year of birth in each horse group. Pedigree

depth was measured by the percentage of known ancestors per generation. The

generational interval (GI) was defined as the time (in years) of the last generation (Falconer

& Mackay, 1996) and corresponds to the average age of the parents at the birth of their

offspring. These offspring also became parents in posterior generations. The completed

pedigree, the distribution of horses and their individual inbreeding coefficient, the number

of inbred horses, the inbreeding coefficients (F) of all horses and inbred horses, and the

effective population size (Ne) were also calculated using the POPREP software

(Groeneveld et al., 2009).

In addition, to determine the breeding level among the CPH groups in the last three

generations, the proportion of horse group ancestors per group and per generation were

calculated.

2.3.5 Population genetics analyses The genetic structure of the CPH groups for the last 3 CPH generations (based on the

generation interval estimated in the pedigree analysis, the data was divided in 10 years

periods consisted in horses which born in each period), was estimated using the

microsatellite data through: 1). Discriminant Analysis of Principal Components (DAPC)

(Jombart, Devillard & Balloux, 2010) implemented in the package Adegenet (Jombart &

Ahmed, 2011) using R software (R Core team, 2016). 2) Bayesian inference models


(Pritchard, Stephens & Donnelly, 2000) were used to estimate the number of possible

populations using the software STRUCTURE 2.3.4. 3) The Wright FST (Weir & Cockerham,

1984) and Fisher's exact test were performed for genic and genotypic differentiation using

the GENEPOP v.4.3 software (Raymond & Rousset, 1995; Rousset, 2008). 4) Analysis of

molecular variance was performed using the Arlequin v3.5 software (Excoffier & Lischer,

2010).

Based on the results of genetic structure, the observed and expected heterozygosity, the

Fisher exact tests, and gametic disequilibrium for each locus were estimated in the last

generation analyzed using the GENEPOP v.4.3 software. (Raymond & Rousset, 1995;

Rousset, 2008). The level of random mating was estimated based on the FIS for each

population using the GENEPOP v.4.3 software (Weir & Cockerham, 1984).

2.3.6 Phylogenetics analyses A fragment of 405 bp of 195 (from the 198 total sequences) CPH animals were manually

edited with the software BIOEDIT v 7.2 (http://www.mbio.ncsu.edu/bioedit/bioedit.html).

Three sequences were excluded because of low resolution. The 195 sequences and the

two data sets for phylogenetic analyses (See materials and methods, genetic sampling)

were aligned in the software CLUSTAL Omega implemented in BIOEDIT v 7.2

(http://www.mbio.ncsu.edu/bioedit/bioedit.html), a value penalty to open gaps of 50, and a

value penalty to extension gaps of 1, were established in the analysis.

Two phylogenetics analyses were performed. First, an haplotype network was estimated,

using the Median Joining method (Bandelt, Forster & Röhl, 1999) using the software

SplitsTree v4.14 (Huson & Bryant, 2006).

The second analysis comprised a phylogenetic reconstruction using Bayesian inference

using the CPH haplotypes found in the present study, the haplotypes which were not

located to any known cluster, and the haplotypes described in a previous study (Achilli et

al., 2012). The JModelTest 2 software (Guindon & Gascuel, 2003; Darriba et al., 2012) was

used to define the model of nucleotide substitution that best fit the data. Once the model

was selected, a phylogenetic reconstruction based on Bayesian inference was performed

using MRBAYES v 3.2 (Ronquist et al., 2012). This analysis was performed with 2 ́000,000

of generations and sampling each 1,000 samples, for a 2,000 total samples. The E. asinus

(GenBank no. NC_001788.1) was used as an outgroup.



29

2.4 Results

2.4.1 Phenotypic analyses § Mean and variation of the conformation parameters

All the parameters were selected between the right or left side (except atlas-neck length,

body length, chest width, croup length, and neck base circumference), according to the

methodology proposed in a previous study (Novoa-Bravo et al., 2018). There were

differences between symmetric and asymmetric limbs for both sides (left and right) only for

the humerus inclination parameter. Therefore, the humerus inclination measurements from

the asymmetric horses (left=3, right=5) were removed, and then, both sides presented

significant correlation between them (r>0.5, P<0.05), hence one of them was randomly

selected for further statistical analyses.

The variation and mean for the conformation parameters stratified by horse group and sex

are presented in Table 2-2. All the parameters, except coronet-fetlock front, fetlock-knee,

and shoulder-scapula, followed a normal distribution. These parameters are the first

standard published in these horses, and they can be used as a reference to implement

genetic improvement programs too.

Table 2-2: Mean and variation for length and angles parameters by gait and sex in a sample

of Colombian paso horse breed1.

Parameter Group Sex n Mean CI 95% SE SD CV (%) Skwe. Kurt.

Length measurements

Atlas-neck base CPF F 17 76.65 (74.28;79.02) 1.25 4.98 6.70 -0.52 -0.01

Atlas-neck base CPF M 24 80.38 (78.69;82.06) 0.88 4.20 5.34 -0.16 -1.24

Atlas-neck base CTG F 17 78.47 (76.48;80.46) 1.05 4.19 5.50 0.14 -0.52

Atlas-neck base CTG M 20 82.15 (80.34;83.96) 0.95 4.13 5.15 -0.23 0.10

Atlas-neck base CTR F 20 76.90 (75.01;78.79) 0.99 4.32 5.77 0.09 -1.39

Atlas-neck base CTR M 22 82.27 (80.48;84.06) 0.94 4.29 5.33 -0.29 -0.44

Atlas-neck base CTRG F 15 77.27 (75.26;79.28) 1.06 3.97 5.32 -0.05 -1.21

Atlas-neck base CTRG M 15 81.53 (79.09;83.98) 1.29 4.83 6.13 -0.50 -0.84

Body CPF F 17 113.18 (112.16;114.2) 0.54 2.15 1.96 0.57 -0.68




Body CPF M 25 112.88 (111.72;114.04) 0.61 2.97 2.69 0.06 -0.12

Body CTG F 17 114.82 (113.07;116.57) 0.92 3.68 3.31 0.04 -1.17

Body CTG M 18 113.28 (111.72;114.83) 0.82 3.36 3.06 -0.36 -0.25

Body CTR F 22 112.05 (110.56;113.53) 0.78 3.56 3.25 0.10 -0.40

Body CTR M 21 110.38 (108.77;111.99) 0.84 3.77 3.50 0.74 0.05

Body CTRG F 15 113.80 (112.08;115.52) 0.91 3.39 3.08 0.48 -1.50

Body CTRG M 14 111.43 (109.3;113.56) 1.13 4.07 3.79 0.32 -1.13

Chest width CPF F 17 39.06 (38.16;39.96) 0.47 1.89 5.00 -0.41 -1.30

Chest width CPF M 25 40.08 (39.32;40.84) 0.40 1.94 4.93 -0.42 -0.18

Chest width CTG F 17 39.59 (38.42;40.75) 0.61 2.45 6.38 0.66 0.48

Chest width CTG M 20 42.00 (40.9;43.1) 0.58 2.51 6.13 0.12 -1.04

Chest width CTR F 22 39.45 (38.45;40.46) 0.53 2.41 6.24 0.02 -0.79

Chest width CTR M 22 41.64 (40.66;42.61) 0.51 2.33 5.72 -0.11 -1.06

Chest width CTRG F 15 40.73 (39.86;41.61) 0.46 1.73 4.40 0.51 -1.43

Chest width CTRG M 15 41.80 (40.95;42.65) 0.45 1.68 4.16 0.13 -1.30

Croup CPF F 17 65.71 (64.58;66.83) 0.59 2.37 3.72 -0.11 -1.04

Croup CPF M 25 66.20 (64.75;67.65) 0.75 3.70 5.70 0.58 0.20

Croup CTG F 17 64.59 (63.14;66.04) 0.76 3.05 4.87 0.31 -1.29

Croup CTG M 20 67.55 (66.51;68.59) 0.55 2.38 3.61 -0.68 -0.70

Croup CTR F 22 65.36 (63.75;66.98) 0.84 3.87 6.06 -0.24 -0.29

Croup CTR M 22 66.18 (64.82;67.55) 0.71 3.27 5.06 0.27 0.05

Croup CTRG F 15 64.60 (61.8;67.4) 1.48 5.54 8.87 -0.97 0.44

Croup CTRG M 15 64.93 (63.47;66.39) 0.77 2.89 4.60 -0.56 -1.09

Neck base circumference CPF F 17 110.18 (107.71;112.64) 1.30 5.18 4.85 0.26 -1.24

Neck base circumference CPF M 24 116.21 (114.55;117.87) 0.87 4.15 3.65 0.68 0.10

Neck base circumference CTG F 17 113.00 (110.51;115.49) 1.31 5.25 4.79 0.50 -0.62

Neck base circumference CTG M 20 119.35 (117.68;121.02) 0.87 3.81 3.28 0.31 -0.99

Neck base circumference CTR F 22 111.27 (109.43;113.12) 0.96 4.41 4.06 -0.61 -0.44

Neck base circumference CTR M 22 119.73 (117.43;122.02) 1.20 5.50 4.70 0.20 0.12

Neck base circumference CTRG F 15 113.00 (110.93;115.07) 1.10 4.10 3.75 0.45 -0.91

Neck base circumference CTRG M 15 117.00 (114.68;119.32) 1.22 4.58 4.05 0.66 -0.08

Coronary band-fetlock front (P1-P2) CPF F 17 8.97 (8.71;9.23) 0.14 0.55 6.38 0.34 -0.99

Coronary band-fetlock front (P1-P2) CPF M 25 9.26 (9.02;9.5) 0.12 0.60 6.64 0.28 -1.26

Coronary band-fetlock front (P1-P2) CTG F 17 9.35 (9.16;9.55) 0.10 0.41 4.54 0.54 -1.47

Coronary band-fetlock front (P1-P2) CTG M 20 9.53 (9.29;9.76) 0.12 0.54 5.77 -0.09 -1.38



31



Coronary band-fetlock front (P1-P2) CTR F 22 8.89 (8.67;9.1) 0.11 0.52 6.00 -0.02 -0.71

Coronary band-fetlock front (P1-P2) CTR M 22 9.16 (8.95;9.37) 0.11 0.51 5.68 0.34 -1.14

Coronary band-fetlock front (P1-P2) CTRG F 15 9.30 (9.1;9.5) 0.11 0.40 4.45 0.06 -0.85

Coronary band-fetlock front (P1-P2) CTRG M 15 9.50 (9.27;9.73) 0.12 0.45 4.87 0.00 -1.91

Fetlock-Carpal (P2-P3) CPF F 16 24.31 (23.94;24.69) 0.20 0.77 3.26 0.21 -0.59

Fetlock-Carpal (P2-P3) CPF M 21 24.83 (24.56;25.11) 0.14 0.64 2.65 0.22 -0.85

Fetlock-Carpal (P2-P3) CTG F 17 25.12 (24.8;25.44) 0.17 0.68 2.77 -0.13 -1.07

Fetlock-Carpal (P2-P3) CTG M 19 25.26 (24.98;25.55) 0.15 0.64 2.59 -0.27 -0.92

Fetlock-Carpal (P2-P3) CTR F 22 24.36 (24.02;24.71) 0.18 0.83 3.48 -0.26 -1.00

Fetlock-Carpal (P2-P3) CTR M 22 25.09 (24.76;25.42) 0.17 0.79 3.23 -0.66 -0.05

Fetlock-Carpal (P2-P3) CTRG F 15 24.80 (24.42;25.18) 0.20 0.75 3.12 0.31 -1.39

Fetlock-Carpal (P2-P3) CTRG M 15 25.13 (24.88;25.39) 0.13 0.50 2.05 0.23 0.14

Carpal-elbow (P3-P4) CPF F 17 37.59 (37.07;38.11) 0.27 1.09 2.98 0.29 -0.71

Carpal-elbow (P3-P4) CPF M 25 37.32 (36.7;37.94) 0.33 1.59 4.36 0.78 -0.65

Carpal-elbow (P3-P4) CTG F 17 37.41 (36.85;37.98) 0.30 1.19 3.28 0.38 -0.98

Carpal-elbow (P3-P4) CTG M 19 37.26 (36.68;37.84) 0.30 1.29 3.56 -0.32 -0.98

Carpal-elbow (P3-P4) CTR F 22 37.32 (36.71;37.93) 0.32 1.46 4.00 0.30 -0.21

Carpal-elbow (P3-P4) CTR M 22 37.82 (37.21;38.43) 0.32 1.47 3.97 0.54 -0.99

Carpal-elbow (P3-P4) CTRG F 14 37.57 (36.87;38.28) 0.37 1.35 3.72 0.57 -1.19

Carpal-elbow (P3-P4) CTRG M 15 37.20 (36.41;37.99) 0.42 1.56 4.33 0.08 -1.34

Elbow-shoulder (P4-P5) CPF F 17 26.18 (25.65;26.7) 0.27 1.10 4.32 -0.08 -1.04

Elbow-shoulder (P4-P5) CPF M 25 26.40 (25.97;26.83) 0.22 1.10 4.23 -0.62 -0.46

Elbow-shoulder (P4-P5) CTG F 17 27.41 (26.65;28.18) 0.40 1.61 6.06 -0.01 -0.19

Elbow-shoulder (P4-P5) CTG M 20 27.75 (27.15;28.35) 0.32 1.37 5.08 -0.54 0.42

Elbow-shoulder (P4-P5) CTR F 22 26.64 (25.87;27.4) 0.40 1.82 7.00 -0.25 0.12

Elbow-shoulder (P4-P5) CTR M 22 27.18 (26.56;27.81) 0.33 1.50 5.64 0.39 -1.17

Elbow-shoulder (P4-P5) CTRG F 15 27.00 (26.33;27.67) 0.35 1.32 5.05 0.63 -0.64

Elbow-shoulder (P4-P5) CTRG M 15 27.40 (26.36;28.44) 0.55 2.06 7.78 0.29 -1.07

Shoulder-scapula (P5-P6) CPF F 17 47.59 (46.91;48.26) 0.35 1.42 3.07 0.69 -0.03

Shoulder-scapula (P5-P6) CPF M 25 48.80 (48.29;49.31) 0.26 1.30 2.71 -0.27 -0.85

Shoulder-scapula (P5-P6) CTG F 17 49.18 (48.37;49.98) 0.42 1.69 3.54 -0.19 -1.21

Shoulder-scapula (P5-P6) CTG M 19 49.68 (49.1;50.27) 0.31 1.30 2.69 -0.64 -0.39




Shoulder-scapula (P5-P6) CTR F 21 49.10 (48.64;49.55) 0.24 1.06 2.22 0.26 -0.72

Shoulder-scapula (P5-P6) CTR M 22 49.32 (48.79;49.84) 0.27 1.26 2.61 0.07 -0.62

Shoulder-scapula (P5-P6) CTRG F 14 50.00 (49.37;50.63) 0.33 1.20 2.48 -0.67 0.14

Shoulder-scapula (P5-P6) CTRG M 15 49.47 (48.92;50.02) 0.29 1.09 2.28 0.22 -1.49

Coronary band-fetlock hind (P7-P8) CPF F 17 8.97 (8.67;9.27) 0.16 0.63 7.23 0.26 -1.16

Coronary band-fetlock hind (P7-P8) CPF M 24 9.25 (9;9.5) 0.13 0.63 6.95 0.12 -1.02

Coronary band-fetlock hind (P7-P8) CTG F 17 9.44 (9.21;9.67) 0.12 0.48 5.26 0.58 -1.11

Coronary band-fetlock hind (P7-P8) CTG M 20 9.48 (9.2;9.75) 0.14 0.62 6.74 -0.49 -0.69

Coronary band-fetlock hind (P7-P8) CTR F 22 8.84 (8.61;9.07) 0.12 0.55 6.39 0.04 -0.93

Coronary band-fetlock hind (P7-P8) CTR M 22 9.16 (8.95;9.37) 0.11 0.51 5.68 0.34 -1.14

Coronary band-fetlock hind (P7-P8) CTRG F 15 9.33 (9.11;9.55) 0.12 0.43 4.82 0.08 -1.12

Coronary band-fetlock hind (P7-P8) CTRG M 15 9.53 (9.25;9.82) 0.15 0.56 6.10 0.90 0.09

Fetlock-tarsus (P8-P9) CPF F 17 31.06 (30.42;31.7) 0.34 1.35 4.48 -1.15 1.82

Fetlock-tarsus (P8-P9) CPF M 25 31.60 (31.13;32.07) 0.24 1.19 3.85 0.11 -0.36

Fetlock-tarsus (P8-P9) CTG F 17 31.12 (30.56;31.68) 0.30 1.18 3.92 0.18 -1.20

Fetlock-tarsus (P8-P9) CTG M 20 31.70 (31.31;32.09) 0.21 0.90 2.91 0.96 -0.30

Fetlock-tarsus (P8-P9) CTR F 22 30.59 (30.2;30.98) 0.20 0.94 3.14 -0.09 -1.06

Fetlock-tarsus (P8-P9) CTR M 22 31.32 (30.89;31.74) 0.22 1.02 3.33 -0.14 -0.55

Fetlock-tarsus (P8-P9) CTRG F 15 31.13 (30.19;32.07) 0.50 1.86 6.17 -1.98 4.10

Fetlock-tarsus (P8-P9) CTRG M 15 31.60 (31.24;31.96) 0.19 0.71 2.33 -0.32 -0.46

Tarsus-stifle (P9-P10) CPF F 17 34.82 (33.99;35.66) 0.44 1.76 5.20 0.66 -0.21

Tarsus-stifle (P9-P10) CPF M 25 34.60 (34.17;35.03) 0.22 1.10 3.23 0.27 -0.95

Tarsus-stifle (P9-P10) CTG F 17 35.41 (34.8;36.02) 0.32 1.29 3.74 -0.12 -0.52

Tarsus-stifle (P9-P10) CTG M 20 35.50 (34.92;36.08) 0.30 1.32 3.82 0.42 0.25

Tarsus-stifle (P9-P10) CTR F 22 34.64 (34.11;35.16) 0.28 1.26 3.73 -0.22 -0.94

Tarsus-stifle (P9-P10) CTR M 22 35.05 (34.46;35.63) 0.30 1.40 4.08 0.02 -0.59

Tarsus-stifle (P9-P10) CTRG F 15 34.47 (33.75;35.18) 0.38 1.41 4.23 -0.13 -0.98

Tarsus-stifle (P9-P10) CTRG M 15 34.47 (33.83;35.1) 0.34 1.26 3.78 0.07 -0.70

Stifle-hip joint (P10-P11) CPF F 17 38.35 (37.42;39.29) 0.49 1.97 5.29 -0.29 -1.32

Stifle-hip joint (P10-P11) CPF M 25 38.94 (38.35;39.53) 0.31 1.51 3.96 -0.36 -0.38

Stifle-hip joint (P10-P11) CTG F 17 38.41 (37.42;39.4) 0.52 2.09 5.60 -0.90 0.09

Stifle-hip joint (P10-P11) CTG M 20 39.55 (38.86;40.24) 0.36 1.56 4.06 0.13 -1.46

Stifle-hip joint (P10-P11) CTR F 22 38.73 (37.89;39.56) 0.44 2.00 5.30 -1.01 0.88

Stifle-hip joint (P10-P11) CTR M 22 39.18 (38.44;39.92) 0.39 1.77 4.64 -0.39 -0.65

Stifle-hip joint (P10-P11) CTRG F 15 39.40 (38.39;40.41) 0.53 1.99 5.24 0.86 1.38

Stifle-hip joint (P10-P11) CTRG M 15 39.13 (38.62;39.65) 0.27 1.02 2.71 0.09 -0.39



33



Hip joint-sacro iliac joint (P11-P12) CPF F 17 34.56 (33.95;35.17) 0.32 1.28 3.82 -0.58 -0.81

Hip joint-sacro iliac joint (P11-P12) CPF M 25 34.74 (34.26;35.22) 0.25 1.23 3.60 -0.64 -0.20

Hip joint-sacro iliac joint (P11-P12) CTG F 17 35.24 (34.71;35.76) 0.28 1.11 3.26 -1.13 1.29

Hip joint-sacro iliac joint (P11-P12) CTG M 20 35.45 (34.92;35.98) 0.28 1.20 3.48 -1.33 1.20

Hip joint-sacro iliac joint (P11-P12) CTR F 22 35.23 (34.52;35.94) 0.37 1.70 4.95 0.49 -0.79

Hip joint-sacro iliac joint (P11-P12) CTR M 22 36.05 (35.34;36.75) 0.37 1.69 4.80 0.30 -0.47

Hip joint-sacro iliac joint (P11-P12) CTRG F 15 35.53 (34.92;36.14) 0.32 1.20 3.51 0.86 -0.50

Hip joint-sacro iliac joint (P11-P12) CTRG M 15 35.60 (34.87;36.33) 0.39 1.45 4.22 0.41 -0.32

Angles

Hock (P8-P9-P10) CPF F 16 146.88 (145.73;148.02) 0.61 2.34 1.65 -0.42 -1.26

Hock (P8-P9-P10) CPF M 23 146.05 (144.66;147.45) 0.73 3.41 2.39 -0.05 -0.4

Hock (P8-P9-P10) CTG F 16 146.12 (144.5;147.73) 0.85 3.29 2.33 1.11 1.44

Hock (P8-P9-P10) CTG M 20 149.18 (147.97;150.39) 0.63 2.75 1.89 -0.4 -1.26

Hock (P8-P9-P10) CTR F 21 149.63 (147.99;151.27) 0.86 3.84 2.63 0.04 -1.34

Hock (P8-P9-P10) CTR M 22 149.26 (147.86;150.65) 0.73 3.34 2.29 0.13 -0.86

Hock (P8-P9-P10) CTRG F 15 150.03 (148.85;151.21) 0.62 2.33 1.61 0.05 -1.43

Hock (P8-P9-P10) CTRG M 15 150.66 (149.22;152.1) 0.76 2.84 1.95 -0.26 -0.69

Humerus inclination CPF F 17 40.29 (39.05;41.54) 0.65 2.62 6.69 0.27 -1.04

Humerus inclination CPF M 25 39.19 (37.34;41.04) 0.96 4.72 12.3 -0.01 -0.59

Humerus inclination CTG F 16 40.62 (38.69;42.55) 1.02 3.94 10.01 -0.6 -1

Humerus inclination CTG M 20 40.82 (39.3;42.34) 0.8 3.47 8.73 1 0.27

Humerus inclination CTR F 19 40.26 (38.83;41.69) 0.75 3.18 8.12 -0.51 -0.51

Humerus inclination CTR M 22 39.75 (38.59;40.91) 0.61 2.79 7.18 0.31 -0.38

Humerus inclination CTRG F 15 41.57 (40.09;43.05) 0.78 2.93 7.29 -0.35 -0.6

Humerus inclination CTRG M 15 41.76 (40.5;43.02) 0.67 2.49 6.17 -0.52 -0.8

Pastern inclination - front CPF F 17 56.59 (55.35;57.83) 0.65 2.61 4.76 0.58 -0.57

Pastern inclination - front CPF M 25 55.36 (53.91;56.81) 0.75 3.7 6.82 0.54 -0.44

Pastern inclination - front CTG F 16 53.31 (51.7;54.93) 0.85 3.29 6.38 -0.15 -1.13

Pastern inclination - front CTG M 19 54.89 (53.47;56.32) 0.74 3.16 5.92 0.03 -1.63

Pastern inclination - front CTR F 22 53.59 (52.23;54.95) 0.71 3.26 6.22 -0.75 -0.68

Pastern inclination - front CTR M 22 55.68 (54.48;56.89) 0.63 2.88 5.3 -0.42 -1.01

Pastern inclination - front CTRG F 15 52.93 (51.66;54.21) 0.67 2.52 4.92 0.29 -0.92

Pastern inclination - front CTRG M 15 54.47 (53.07;55.86) 0.74 2.75 5.23 -0.36 -0.87

Pastern inclination - hind CPF F 17 55.00 (53.16;56.84) 0.97 3.88 7.27 -0.69 -0.83




Pastern inclination - hind CPF M 25 55.40 (54.07;56.73) 0.69 3.39 6.25 -0.14 -0.5

Pastern inclination - hind CTG F 16 50.25 (48.01;52.49) 1.18 4.58 9.4 0.04 -0.55

Pastern inclination - hind CTG M 19 52.37 (51.07;53.67) 0.68 2.89 5.67 -0.24 -1.24

Pastern inclination - hind CTR F 22 49.86 (48.22;51.5) 0.86 3.92 8.05 0.12 -0.79

Pastern inclination - hind CTR M 22 53.77 (52.3;55.24) 0.77 3.52 6.69 -0.13 -0.08

Pastern inclination - hind CTRG F 15 51.47 (49.73;53.2) 0.91 3.42 6.88 0.23 -0.86

Pastern inclination - hind CTRG M 15 53.87 (51.44;56.3) 1.28 4.8 9.23 0.53 -0.77

Scapula inclination CPF F 17 31.68 (30.85;32.5) 0.43 1.73 5.63 0.04 -0.56

Scapula inclination CPF M 25 33.19 (32.01;34.38) 0.62 3.03 9.31 0.58 -0.95

Scapula inclination CTG F 13 32.15 (31.14;33.17) 0.54 1.87 6.05 0.85 0.63

Scapula inclination CTG M 19 34.07 (32.93;35.2) 0.6 2.53 7.62 0.09 -1.34

Scapula inclination CTR F 20 33.08 (31.8;34.36) 0.67 2.91 9.04 0.53 -1.14

Scapula inclination CTR M 22 34.89 (33.68;36.09) 0.63 2.88 8.45 -0.22 -0.9

Scapula inclination CTRG F 15 32.85 (31.22;34.47) 0.86 3.22 10.14 -0.37 -1.38

Scapula inclination CTRG M 15 34.82 (33.63;36.01) 0.63 2.35 6.97 0.77 0.05

Shoulder (P4-P5-P6) CPF F 17 98.92 (97.33;100.52) 0.84 3.35 3.49 -0.25 -0.86

Shoulder (P4-P5-P6) CPF M 25 95.10 (93.67;96.53) 0.74 3.64 3.91 -0.16 -1.02

Shoulder (P4-P5-P6) CTG F 15 97.87 (96.43;99.31) 0.76 2.84 3.01 0.15 -1.16

Shoulder (P4-P5-P6) CTG M 20 95.65 (94.35;96.94) 0.68 2.96 3.18 0.8 0.5

Shoulder (P4-P5-P6) CTR F 21 97.41 (95.83;99) 0.83 3.71 3.9 0.08 -0.45

Shoulder (P4-P5-P6) CTR M 22 94.77 (93.49;96.04) 0.67 3.05 3.3 -0.81 0.34

Shoulder (P4-P5-P6) CTRG F 15 99.02 (97.47;100.57) 0.82 3.06 3.2 0.09 -0.94

Shoulder (P4-P5-P6) CTRG M 15 96.84 (94.76;98.92) 1.1 4.1 4.39 0.51 -0.93

1 Lengths in cm, angles in degrees. Colombian Paso Fino group, CPF; Colombian trocha

group, CTR; Colombian trocha and gallop group, CTRG; Colombian trot and gallop group,

CTG; n, number of horses; CI, confidence interval; SE, standard error; SD, standard

deviation; VC, variation coefficient; Skew., skewness; Kurt., kurtosis; The positions of the

landmarks (P1-P12) are described in the Figure 2-1.

§ Correlations Moderate and significant correlations between each pair of parameters for each group

were found (Table 2-3).

Table 2-3: Correlations between pairs of conformation parameters measured for each

CPH group (P<0.01, r>+-0.5).



35

Group1 Parameter 1 Parameter 2 r Length2 measurements CTG Chest width Atlas-neck base 0.5 CPF Chest width Croup 0.5 CTG Chest width Croup 0.7 CPF Chest width Neck base circumference 0.5 CTR Chest width Neck base circumference 0.5 CTG Chest width Neck base circumference 0.6 CTR Croup Neck base circumference 0.6 CTG Croup Neck base circumference 0.6 CTR Elbow-shoulder (P4-P5) Croup 0.5 CTR Elbow-shoulder (P4-P5) Hock-stifle (P9-P10) 0.5 CPF Elbow-shoulder (P4-P5) Stifle-hip joint (P10-P11) 0.5 CTRG Fetlock-knee (P2-P3) Croup 0.5 CPF Fetlock-knee (P2-P3) Fetlock-hock (P8-P9) 0.6 CTR Fetlock-knee (P2-P3) Fetlock-hock (P8-P9) 0.6 CTR Fetlock-knee (P2-P3) Hock-stifle (P9-P10) 0.5 CTR Fetlock-knee (P2-P3) Neck base circumference 0.5 CTRG Fetlock-knee (P2-P3) Neck base circumference 0.5 CTR Hock-stifle (P9-P10) Stifle-hip joint (P10-P11) -0.5 CTRG Knee-elbow (P3-P4) Croup 0.5 CPF Neck base circumference Atlas-neck base 0.5 CTR Neck base circumference Atlas-neck base 0.7 CTG Neck base circumference Atlas-neck base 0.5 CTG Shoulder-scapula (P5-P6) Croup 0.6 CTRG Stifle-hip joint (P10-P11) Croup -0.6 CTG Stifle-hip joint (P10-P11) Croup 0.5 CTG Stifle-hip joint (P10-P11) Neck base circumference 0.5 Angle2 measurements CPF Scapula inclination Humerus inclination -0.5 Length measurements - Angle measurements CTG Chest width Scapula inclination 0.5 CTRG Hip joint-sacro iliac joint (P11-P12) Hock (P8-P9-P10) -0.5 CTG Knee-elbow (P3-P4) Scapula inclination -0.5 CTG Neck base circumference Scapula inclination 0.5

1 CPF-Colombian Paso Fino group, CTR-Colombian trocha group, CTRG-Colombian

trocha and gallop group, CTG-Colombian trot and gallop group. 2 Length in cm and angles in degrees.


§ Analysis of variance

There were significant differences between the CPH horse groups and sex for most of the

conformation parameters analyzed (Table 2-4). Sexual dimorphism was found in CPH

horses (Table 2-4), as it has been observed in several horse breeds, including: Lipizzan,

Mangalarga Marchador, Menorquina, and Lusitano (Zechner et al., 2001; Pinto et al., 2008;

Sole et al., 2014; Bartolomé, Milho & Prazeres, 2019). The traits which showed sex

dimorphism are similar between the studies mentioned, where there are conformation traits

as body length (except Menorquina), croup, chest width have higher values in males than

females which are the most differentiated traits between sex. Also, some angles (Shoulder,

Scapula inclination, and Pastern inclination) in CPH horses have higher values in males

(except Scapula inclination) than females. Significant interactions effects (P<0.05) between

horse groups and sex were also found for the hock angle parameter for all horse groups.

Overall, most of the significant differences were found between CPF and the other horse

groups.

Table 2-4: Differences between the CPH horse groups or sex on the conformation

parameters analyzed.

Parameter1 Group2 Sex Group *Sex Post-hoc3

Lengths Atlas-neck base ***

Neck base circumference ***

Chest width ***

Croup *

Body ** * CTR-CTG**

Coronet-fetlock front (P1-P2)4 *** * CPF-CTRG**, CPF-CTG**, CTR-CTRG**, CTR-CTG**

Fetlock-knee (P2-P3)4 ** *** CPF-CTRG*, CPF-CTG***, CTR-CTG**

Elbow-shoulder (P4-P5) * CPF-CTG*

Shoulder-scapula (P5-P6)4 *** * CPF-CTR**, CPF-CTRG**, CPF-CTG***

Coronet-fetlock hind (P7-P8) *** * CPF-CTG**, CTR-CTG***, CTR-CTRG**

Hock-stifle (P9-P10) * CTRG-CTG* Hip joint-sacro iliac joint (P11-P12) ** CPF-CTR*, CPF-CTRG* Angles Pastern inclination - front * CPF-CTRG* Shoulder (P4-P5-P6) *** Scapula inclination * *** CPF-CTR*

Pastern inclination - hind *** *** CPF-CTR***, CPF-CTRG*, CPF-CTG***

Hock (P8-P9-P10) *** * CPF-CTR***, CPF-CTRG***, CTRG-CTG**



37

1 Length in cm and angles in degrees. 2 CPF-Colombian paso fino, CTR-Colombian trocha, CTRG-Colombian trocha and gallop,

CTG-Colombian trot and gallop. 3 For a non-normally distributed parameter a Kruskal-Wallis test was performed. 4 Tukey’s post hoc tests for normally distributed parameter, Dunn’s tests for non-normally

distributed parameters after a significant (P<0.05) Kruskal-Wallis test. These tests were

performed between every pair of horse groups.

§ Multivariate analysis The discriminant analyses resumed 90.31% of the variance in the two first axes based on

15 selected parameters (fetlock-carpal (P2-P3), elbow-shoulder (P4-P5), shoulder-scapula

(P5-P6), fetlock-tarsus (P8-P9), hip joint-sacro iliac joint (P11-P12), chest width, croup

length, atlas-neck base, neck circumference, body length, pastern inclination – front,

pastern inclination – hind, scapula inclination, humerus inclination, hock angle) (Figure 2-

2). The contribution of each parameter to the first dimension is presented in Figure 2-3. The

Colombian paso fino group was the most differentiated group in the CPH breed based on

conformation parameters. The parameters with the highest contributions to the first

discriminant function were shoulder-scapula, pastern inclination – hind, and hock angle.

Furthermore, there were no differences between the CTG, the CTRG, and CTR groups,

except for body length, hock angle, and coronet-fetlock (front and hind), as seen in the

ANOVA analysis.

Figure 2-2: Discriminant analysis for the Colombian paso horse groups using conformation parameters2.

2 Each point represents an individual classified in one of the Colombian paso horse groups: CPF-Colombian paso fino; CTR-Colombian trocha; CTRG-Colombian trocha and gallop; CTG-Colombian trot and gallop. Fetlock-carpal (P2-P3), elbow-shoulder (P4-P5), shoulder-scapula (P5-P6), fetlock-tarsus (P8-P9), hip joint-sacro iliac joint (P11-P12). Inc, inclination. Ellipses represent 0.8 level of significance for each horse group.


Figure 2-3: Canonical scores and the parameters that were selected for the first dimension

of the discriminant analysis of the Colombian paso horse groups3.

3 CPF-Colombian paso fino; CTR-Colombian trocha; CTRG-Colombian trocha and gallop; CTG-Colombian trot and gallop. Fetlock-carpal (P2-P3), elbow-shoulder (P4-P5), shoulder-scapula (P5-P6), fetlock-tarsus (P8-P9), hip joint-sacro iliac joint (P11-P12). Inc, inclination.



39

Figure 2-4 shows the discriminant analysis per gait instead of horse groups. This analysis

resumed 100% of the variance in the two first axes based on the same parameters selected

in the horse groups analysis (Figure 2-2).

Figure 2-4: Discriminant analysis between the Colombian paso gaits using conformation

parameters4.

2.4.2 Pedigree analyses A total of 226,000 animals born between 1956 and 2015 were analyzed. The percentage

of ancestors known up to 2015 was 93% for the 1st generation and 60% for the 6th

generation. The average GI estimated was 10. The average level of completed pedigree

for the last 10 years was 87,3% for the 1st generation to 46.5% for the 1st to 6th generation.

The calculated F evidenced an increasing tendency over all the populations (Figure 2-5),

remarkably, the F of the CPF turned out to be 3.8% for the last year analyzed.

4 Each point represents an individual classified per gait. Fetlock-carpal (P2-P3), elbow-shoulder (P4-P5), shoulder-scapula (P5-P6), fetlock-tarsus (P8-P9), hip joint-sacro iliac joint (P11-P12). Inc, inclination. Ellipses represented 0.8 level of significance for each gait.


Figure 2-5: Inbreeding coefficient for each Colombian paso horse group per year of birth5.

The percentages of horse group ancestors for each Colombian horse group in the last 3

generations are presented in Figure 2-6. The estimated GI (10 years) was used to establish

the years per generation. The CPF group was the group with more ancestors from the same

group than from the other groups in the last 3 generation analyzed. The CTRG group was

the group with more ancestors from the other groups than from the same group in the last

3 generations.

Figure 2-6: Percentage of horse group ancestors for each Colombian horse group in the

last 3 generations6.

5 P1: Colombian trot and gallop, P2: Colombian trocha and gallop, P3: Colombian trocha, and P4: Colombian paso fino. 6 First generation, horses born between 1986 and 1995; second generation, horses born between 1996 and 2005; and third generation, horses born between 2006 and 2015. CPF-Colombian paso fino, CTR-Colombian trocha, CTRG-Colombian trocha and gallop, CTG-Colombian trot and gallop. UNKN-Unknown horse group. i.e. for the CPF, in the generation between 1986 and 1995, 50% of the ancestors in the CPF group were CPF horses, 42% were unknown horses, 4% were Colombian trocha horses, 1% were Colombian trot horses, and less than 1% were Colombian trocha and gallop horses.



41

2.4.3 Population genetics analyses A total of 132,637 genotypes (13 autosomal STRs per animal) were chosen from animals

born from 1986-2015, these included the 3 last generations based on the generation

interval previously estimated (12,151 genotypes from horses born between 1986 and 1995;

54,953 genotypes from horses born between 1996 and 2005; and 65,533 genotypes from

horses born between 2006 and 2015).The DAPC analysis (Figure 2-7) and STRUCTURE

analysis (estimated K=3),, evidenced the CPF group was the most differentiated group vs

the other groups.

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

Perc

enta

ge o

f hor

se g

roup

anc

esto

rs

Generation

Colombian trocha

UNKN

CTG

CTRG

CTR

CPF

2006-20151996-20051986-1995

0

0.1

0.2

0.3

0.4

0.5

0.6

Generation

Colombian trocha and gallop

UNKN

CTG

CTRG

CTR

CPF

2006-20151996-20051986-1995

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1Pe

rcen

tage

of h

orse

gro

up a

nces

tors

Generation

Colombian paso fino

UNKN

CTG

CTRG

CTR

CPF

2006-20151996-20051986-1995

0

0.1

0.2

0.3

0.4

0.5

0.6

Generation

Colombian trot and gallop

UNKN

CTG

CTRG

CTR

CPF

2006-20151996-20051986-1995


Figure 2-7: DAPC analysis for the last 3 generations of the Colombian paso horse groups

using microsatellite data7.

7 The superior, middle and inferior figures correspond to the DAPC results performed for the generations of horses born between 1986 and 1995, 1996 and 2005, and 2006 and 2015 respectively. The line represented a minimum spanning tree based on the (squared) distances between horse groups in the entire space. CPF-Colombian paso fino group, CTR-Colombian trocha group, CTRG-Colombian trocha and gallop group, CTG-Colombian trot and gallop group.

1986-1995

1996-2005

2006-2015



43

The FST analyses also evidenced the genetic difference between the CPF group and the

other horse groups, which has been increasing over the last 3 generations (Figure 2-8)

(Average FST: 1986-1995=0.010, P<0.05; 1996-2005=0.014, P<0.05, 2006-2015=0.026,

P<0.05). In contrast, the FST between CTG, CTR and CTRG groups was low (FST<=0.0018)

in all the three generations analyzed.

Figure 2-8: FST values between Colombian paso fino group and the other horse groups in

the last 3 generations analyzed8.

The genic and genotypic differentiation analyses in the last generation showed a significant

difference (P<<0.0001) among all the pairs of horse groups. On the other hand, the results

of genetic differentiation using X chromosome markers showed that were significant genetic

differences (P<<0.05) between CTG males and CPF males, and CTR males and CPF-

males. Also, the DAPC analysis for X chromosome markers showed that CPF male group

is the most genetic differentiated group (Figure 2-9). In addition, the STRUCTURE analysis

showed that the genetic differences among the Colombian (Figure 2-10) horse groups were

8 First generation, horses born between 1986 and 1995; second generation, horses born between 1996 and 2005; and third generation, horses born between 2006 and 2015. CTR-Colombian trocha, CTRG-Colombian trocha and gallop, CTG-Colombian trot and gallop.


not significant with X chromosome markers, in contrast with autosomal markers, where the

CPF group was the most differentiated.

Figure 2-9: DAPC analysis for the last generation of the Colombian paso horse groups

using X chromosome microsatellite data9.

Figure 2-10: Bar plot of the STRUCTURE analysis, K=2, of the Colombian paso horse

groups using X chromosome microsatellite data10.

Finally, the heterozygous deficit was observed in all horse groups, but at different loci: CTG

(6 out of 12), CTRG (1 of 12), CTR (9 of 12), CPF (11 of 12, (P<0.05). The average CPF

FIS was 0.083, and for the other horse groups was 0.002: All loci were in gametic

disequilibrium (P<<0.0001).

9 The line represented a minimum spanning tree based on the (squared) distances between horse groups in the entire space. CPF-Colombian paso fino group, CTR-Colombian trocha group, CTRG-Colombian trocha and gallop group, CTG-Colombian trot and gallop group. M-males; F-females. 10 1 - Colombian trot and gallop male group, 2 - Colombian trot and gallop female group, 3 - Colombian trocha and gallop male group, 4 - Colombian trocha and gallop female group, 5 - Colombian trocha male group, 6 - Colombian trocha female group, 7 - Colombian paso fino male group, 8 - Colombian paso fino female group.



45

2.4.4 Phylogenetics analyses Twenty six haplotypes were found in the CPH population (Table 2-5), which coincide with

the haplogroups described in horses in previous studies (Jansen et al., 2002; Achilli et al.,

2012).

Table 2-5: Mitochondrial d-loop haplotypes of the Colombian paso horse found in 198

samples based on haplogroups described in a previous work (Achilli et al., 2012).

Nomenclature Nuclueotide position CPH Group

Haplotype Achilli et al. (2012)

Jansen et al.

(2002)

111111111111111111111111111111111 555555555555555555555555555555555 444455555566666666666677777888888 999933348900001233455601278001223 045634625712347635909638015670678

CPF CTR CTRG CTG Total

Reference CTCAACTCGATTTGTAACAATGTCATCCCAAAC CPH01 M* C1* .C............C.....C......T...G. 1 1 CPH02 L2 D2 .C.G.T..A..CC.....G.............. 2 2 1 5 CPH03 L1/L3 D1* .C.G.T..A...CA....G.............. 1 1 CPH04 L1 D1* .C.G.T..A...C.....G.............. 8 14 1 3 26 CPH05 L D1* .C.G.T......C.....G.............. 20 25 4 12 61 CPH06 L1 D1* .C.G.T......C.....G............G. 3 1 1 5 CPH07 L* D1* .C.G.T......C...G.G.............. 1 1 CPH08 L* D1* .C.G.T...G..C.....G.............. 2 2 CPH09 N C2 ........A.C................T...GT 1 4 5 CPH10 B1 A3 ........A..C.......G.A...C...GG.. 4 4 3 11 CPH11 B* A3 ........A..C...G...G.A...C...GG.. 1 1 2 CPH12 M* C1 ........A.....C.....C......T...G. 1 1 CPH13 N C2 ..........C................T...GT 1 1 CPH14 B A3 ...........C.......G.A...C....G.. 13 8 2 1 24 CPH15 M C1 ..............C.....C......T...G. 2 4 1 1 8 CPH16 F'G'* A7* .......TA..........G.A........... 1 1 CPH17 G1 A1 .......TAG.......T.G.AC..C....... 1 5 1 2 9 CPH18 G1* A1 .......TAG.......T.G.AC..CT...... 1 1 CPH19 G* A1 .......T.G.......T.G.ACT.C....... 1 1 2 CPH20 ....-.C.A....A...........C....... 1 7 1 2 11 CPH21 ....-.C.A....A...........C.....G. 1 1 CPH22 A1* A5* ..T.....A..C............GC....... 1 1 CPH23 A* A5* ..T........C.............C..T.... 1 1 CPH24 A1* A5 ..T........C............GC....... 1 1 2 CPH25 B* A3 T..........C.......G.A...C..T.G.. 1 9 1 11 CPH26 B* A3 T..........C.......G.A...C.TT.G.. 1 1

63 89 11 32 195 CPF-Colombian paso fino group, CTR-Colombian trocha group, CTRG-Colombian trocha

and gallop group, CTG-Colombian trot and gallop group. * New haplotypes described in

those haplogroups. The reference haplotype corresponds to a sequence reported in (Achilli

et al., 2012) GenBank accession number JN398377. The CPH haplotypes are reported in

the GenBank, accession numbers: MH318582-MH318607. The haplotypes CPH20 and

CPH21 correspond to the “Lusitano group C” described in previous studies (Lopes et al.,

2005; Lira et al., 2010).


The haplogroup L (Achilli et al., 2012) or D (Jansen et al., 2002) is the most frequent of the

CPH (Table 2-5, frequency = 51%), in which the CPH shares haplogroups with some Iberian

ancestral horse breeds (Jansen et al., 2002; Achilli et al., 2012). Additionally, another

frequent haplogroup of the CPH was the haplogroup B (Achilli et al., 2012) or A3 (Jansen

et al., 2002) (frequency = 25%). This haplogroup B has been reported in Europe (in the

present study, haplotypes from: Asturcón, Garrano, Jaca Navarra, Kerry bog pony, Losino,

Lusitano, Maremmano, Marismeño, Menorquina, Pottoka, Pure Spanish horse), and the

Middle east (in the present study, haplotypes from: Arabian, Vyatskaya) as well as in

American horse breeds (Achilli et al., 2012) (in the present study, haplotypes from: Chilean

creole, Florida Cracker, Peruano de paso and Venezuelan Spanish). The next most

frequent haplogroup correspond to the haplogroup G (frequency=6%) which correspond to

Asian center, middle east and south European horse breeds (Achilli et al., 2012), in the

present study correspond also to haplotypes from: Akhal teke, Arabian, Asturcon, Belgian,

Cartujano, Cleveland bay, Garrano, Hafflinger, Irish draught, Jaca Navarra, Kerry bog pony,

Losino, Lusitano, Orlov, Pottoka, and Pure Spanish horse). The next most frequent

haplogroup corresponded to the CPH20 and the CPH21 haplotypes (frequency=6%), which

belong to a haplogroup described in a previous studies (Lopes et al., 2005; Lira et al., 2010)

named “Lusitano group C” found in Neolithic horses, including other haplotypes of some

ibero-american horse breeds (Argentinean creole: AF465988; Lusitano: AY293985,

AY525095; Marismeño: HQ827143; Puerto Rican paso fino: AY997175) (Figure 2-11).

Finally, specific haplogroups per horse group were not found, but some haplotypes were

unique for some CPH groups (CPH07, and CPH26 for the CTR; CPH03, CPH12, CPH13,

CPH16, CPH23 for CPF, and CPH01 and CPH21 for CTG horse group).

Figure 2-11: Haplotype network between 26 Colombian paso horse (blue) haplotypes and

88 haplotypes from others 48 horse breeds (Table 2-1)11.

11 CPH-Colombian paso horse; the names of haplogroups are in bold, which were described in a previous study (Achilli et al., 2012). CPH-Colombian paso horse; the names of haplogroups are in bold, which were described in a previous study (Achilli et al., 2012). The left square shows haplotypes of the Colombian paso horse (CPH20 and 21) and other haplotypes from ibero-american horse breeds which belong to an ancestral Iberian lineage (Lira et al., 2010).



47

To confirm the presence of the ancestral lineage reported previously (Lopes et al., 2005;

Lira et al., 2010), a second phylogenetic reconstruction was performed (see material and

methods) considering the haplotypes which were located to that cluster (CPH20, CPH21,

Argentinean creole: AF465988; Lusitano: AY293985, AY525095; Marismeño: HQ827143;

Puerto Rican paso fino: AY997175). The tree (Figure 2-12) showed that the haplotypes

CPH20, CPH21 and the other haplotypes which were grouped together in the haplotypic

network, were not located in another known cluster, which can be explained as a basal

group, supporting the ancestral hypothesis lineage.

Figure 2-12: Bayesian tree based on 355 bp mitochondrial d-loop haplotypes of the 26

Colombian paso horse and 88 haplotypes described in a previous study (Achilli et al., 2012).



49

2.5 Discussion The Colombian paso horse is a recent developed breed (less than a century) which is the

result of multiple crossings among Iberian and related breeds. The intensive and continuous

human selection in the CPH for the at least 50 years has had intensive effects on

morphological and genetic traits according to the evidence in this study. Also, a recent study

showed that selection for the CPH gaits has likely produced kinematic differences in the

CPH (Novoa-Bravo et al., 2018). Thus, we hypothesize that CPHs became into two different

horse breeds: the Colombian paso fino horse breed (CPF) and the breed composed by the

CTR, CTRG and CTG horse groups (CTT).

To support this hypothesis, we showed that the inbreeding coefficient (F) has increased

significantly during the last 20 years (Figure 2-5), likely as a result of a selective pressure,

particularly in the CPF. This F agreed with the FIS index, based on STR data, FIS=0.083 and

0.002 for the CPFH breed and the CTTH breed respectively. On the other hand, this

decrease of genetic diversity can affect the viability of the breed in a few years according

to the FAO guidelines (FAO, 1999). This fact must be taken into account by the CPH

Federation to provide tools for the breeders in order to decrease the inbreeding level (i.e.

including coefficient inbreeding information into the pedigree system).

Also, the 2-breed hypothesis is sustained on the genetic structure of the CPH (Figure 2-7),

as a result of the breeding practices between horse groups during the history of the CPH

(Figure 2-6). It has been more frequent to breed CPF horses with CPF horses, and CTT

horses (CTR, CTRG and CTG horse groups) with CTT horses. This genetic structure has

increased during the last 30 years (Figure 2-6, 2-7, and 2-8), which evidenced an intensive

artificial selection effect within the CPF and the diagonal gait horse groups (CTT). Finally,

the genetic structure results based on X chromosome markers data showed that the genetic

differences were significant (P<0.05) between CPFH-males and CTTH-males but not in

females (Figure 2-9 and Figure 2-10). This likely reflects the breeding bias to intensively

select more males than females, which also produces significant (P<0.0001) genetic

differences between sexes within each horse group.


Additionally, a recent study (Cortés et al., 2017) using microsatellite data from Iberian,

Arabian, Celtic, Colombian paso horses (including all the 4 horse groups: CPF, CTR,

CTRG, and CTG), and the other American “criollo” breeds supports our hypothesis

regarding 2-breed in the CPH. The bayesian genetic structure, the dendrogram, and FST

analyses performed in that study (Cortés et al., 2017), showed a high genetic difference

between Colombian paso horse groups and the rest of the American horse breeds. Also,

the FST between CPF and CTT (CTR, CTRG, and CTG groups) in the present study is

higher than other breed comparisons in that study (i.e. Mangalarga vs Monchino;

Marismeño vs Cr. Paraguayo; Burguete vs Hispano-Breton; Burguete vs Jaca Navarra;

Burguete vs Pirinenc Catalá, etc.) (Cortés et al., 2017).

The conformation traits analyses also reinforced the difference between CPF and CTT

breeds. Those morphological differences (Table 2-4) are likely the outcome of different

biomechanical pressures because of the human selection for gaits (Novoa-Bravo et al.,

2018) and conformation traits, which has affected the size and length of several parts of

the body of the CPHs evidenced in this study (Table 2-4). This hypothesis is also supported

on the multivariate analysis of the conformation parameters (Figure 2-2 and 2-4), where the

separation between CPF and CTT is significant, in particular the Chest width and neck base

circumference (CTT is wider than CPF), pastern inclination front and hind (CPF is higher

than CTT), hock and scapula inclination angle (CTT is higher than CPF), Shoulder-scapula

length, Hip joint-sacro iliac joint lenght, Fetlock-Carpal (cannon) length, and Elbow-shoulder

length (for all these lengths CTT is higher than CPF). In addition, the sexual dimorphism

found in CPH horses (Table 2-4), on some lengths and angles variables, may also reflect

the different selection pressure per sex, considering each sex is separately evaluated in

competitions.

The phylogenetic analyses showing the evolutionary history of the CPH also support the

uniqueness of the CPH horses and the 2-breed hypothesis. The only phylogenetic study in

the CPH (Jimenez et al., 2012) reported 9 haplotypes in the CPF group; however, none of

the other Colombian paso horse groups (CTR, CTRG, and CTG) had been included so far.

At the present study, 26 haplotypes were found in all samples collected for the CPH (Table

2-5). The differences between the previous and the present study can be attributed to a

larger sample size and wider pedigree data used herein.



51

The high mitochondrial diversity of the CPH (Table 2-5) is comparable with old well-

established breeds as Thoroughbred, Icelandic horses, Lusitano, Pura Raza Española and

others, which evidence the complexity of several possible breed origins in the CPH. It also

reflects the evolutionary history of horses which involved a massive incorporation of

maternal lines, possibly through recurrent restocking of wild mares (Lira et al., 2010;

Librado et al., 2016).

The CPH haplotypes belonged to most of the haplogroups described in horses, particularly

Iberian ones (haplogroup L (Achilli et al., 2012) or D (Jansen et al., 2002)), which is

expected (Cortés et al., 2017). The second haplogroup most frequent, B, was present in

some Mediterranean horse breeds (Achilli et al., 2012) (i.e. Italian Maremmano) and the

haplogroup G belonged to Asian, middle east and, at low frequency, to south Europe horse

breeds (Achilli et al., 2012) (i.e. Arabian, Akhal-Teke, Syrian, and Italian horse breeds).

Also, in our analysis, the haplotypes found in the haplogroups L, B, G, the most frequent in

the CPH, belonged to ancestral Spanish horses (i.e. Cartujano, Garrano, Jaca Navarra,

Losino, Marismeño, Menorquina…), some European horse breeds (i.e. Cleveland bay,

Kerry bog pony, Hafflinger…), and ancestral Asian and middle east horse breeds (i.e. Akhal

Teke and Arabian). The presence of these multiple haplogroups L, B, G, M, A, E, and N,

evidenced the multiple origin of the maternal lineages of the CPH.

The cluster named “Lusitano group C” (Lopes et al., 2005; Lira et al., 2010) was found in

horse samples from Neolithic period, where the haplotypes CPH20, CPH21, and other

ibero-american haplotypes (Argentinian creole AF465988 (AR1_C3); Lusitano AY293985

(LUS_H11) and AY525095 (LUS_H22); Puerto Rican paso fino AY997175 (PRPF_PF2);

Marismeño haplotype HQ827143 (MARIS_S08) (Figure 2-11 and 2-12) correspond to that

ancestral group. Most of these ibero-american haplotypes were not easily grouped to any

horse haplogroup described in these studies (Mirol et al., 2002; Lopes et al., 2005; Luis et

al., 2006) owing to this “Lusitano group C” was distinctively described until 2010 (Lira et al.,

2010) (the deletion in the position 15533 was noticed in this study) and the frequencies of

these haplotypes are very low in these breeds. In contrast, in the CPH the frequency of

these haplotypes is more than 6% (12 horses had these haplotypes). The present study

confirms that this ancestral lineage is present exclusively in modern horses of Iberian origin

and the frequency of this ancestral group in the CPH it could be explained by a genetic drift


process or that some horses during the CPH history have been selected increasing this

frequency. In addition, some of those haplotypes (AR1_C3, LUS_H22, PRPF_PF2, and

CPH21) are derived from the CPH20, LUS_H11 and MARIS_S08 haplotypes. One of the

derived haplotypes corresponds to a Puerto Rican Paso fino horse, which would support

that likely the Colombian paso horse breed is an ancestor for the Puerto Rican Paso fino

horse breed.

The haplotype CPH16 was grouped close to F’G’ (Achilli et al., 2012) or A6 (Jansen et al.,

2002) group. This haplotype CPH16 is one mutation away from other ancestral haplotypes

(Lira et al., 2010) ATA10, ATA11 (position 15585) and 3 mutations away from “Lusitano

group C”, describing a possible intermediate position between A6 haplogroup and “Lusitano

group C”. The haplotype CPH16 could represent an ancestral lineage in a modern horse

breed, however the presence of this haplotype was represented by just one horse and it is

necessary a wider sampling to confirm this hypothesis.

To our knowledge, there is not a report of a breed formation process until the present study.

A previous study in cattle (Strucken et al., 2015) showed genetic differences between

Korean cattle groups, suggested as evidence for a breed formation process. However,

according to their results (Strucken et al., 2015), we think the genetic differences between

those cattle groups are likely an outcome of a bottleneck effect of a group of the same

breed, contrary to a breed formation process hypothesis suggested in that study. In

contrast, the present study showed that the Colombian paso horses, which share a

common evolutionary history, have likely been subjected to an intensive artificial selection

on phenotypic traits during at least 50 years which has produced significant genetic

(autosomal and X microsatellite markers) and phenotypic (conformation (the present study)

and kinematic traits (Novoa-Bravo et al., 2018)) differences, which has led two different

breeds: Colombian paso fino horse breed and the breed composed by the diagonal gait

horse groups (CTR, CTRG, and CTG). Therefore, the present study is the first to evidence

a breed formation process tracking the allelic frequencies changes across the last 3

generations of CPHs.

Finally, additional genetic and phenotypic data could support the hypothesis of a breed

formation process, i.e. genomic data, mitochondrial DNA haplotype frequencies, Y

chromosome markers, and other phenotypic traits as: reproductive, physiological, and



53

performance parameters. In particular, what differences between CPH breeds are found in

genetic variants as coat color (MC1R), performance (MSTN), and size (IGF1, NCAPG, and

HMGA2) (Petersen et al., 2013b). Also, future studies could reveal genetic bases of a

recent breed formation process: i.e. are there genes related with reproductive isolation?,

the genetic differences in recent breeds are more related with non-coding sequences with

regulatory gene functions, than coding sequences of genes? as evidenced between equid

species (Librado et al., 2016). Therefore, further studies are required to understand the

genetic bases which separate and define the breeds.

2.6 Conclusions We found significant genetic and phenotypic differences between Colombian paso fino and

the other groups, and those differences have been increasing through the 30 years tracked.

These genetic differences agreed with phenotypic and pedigree data. Also, the

phylogenetic reconstruction showed that the Colombian paso horses had a complex breed

origin showing the presence of 9 haplogroups described in horses and that these horses

share an evolutionary history with specific haplotypes. Moreover, some of those haplotypes

likely represent an ancestral Iberian haplogroup which had been described in just few

modern horses, in contrast with the 6% found in CPH horses.

Our findings strongly suggest that the CPH was a breed which became two breeds, the

Colombian paso fino horse breed and the Colombian trocha and trot horse breed. The

development of these recent CPH breeds has likely arisen from intensive selection on gait

and conformation traits during at least the last 50 years. Therefore, the present study is the

first to evidence a breed formation process tracking the allelic frequencies changes across

the last 3 generations of CPHs. Nevertheless, further studies are required to understand

the genetic bases which separate and define the breeds.

2.7 Acknowledgments To the Federación Nacional de Asociaciones Equinas (FEDEQUINAS) and all persons

involved for providing the samples, the phenotypic data, microsatellite data, pedigree


database and the support during the project. Also, we want to acknowledge to Dr. Gabriella

Lindgren, Dr. Cristina Luis, and Dr. Jaime Lira for their comments.

3. Chapter 2. Selection on the Colombian paso horse’s gaits has produced kinematic differences partly explained by the DMRT3 gene

Miguel Novoa-Bravo1,2,5, Kim Jäderkvist Fegraeus2, Marie Rhodin3, Eric Strand4, Luis

Fernando García5, Gabriella Lindgren2.

1 Genética Animal de Colombia Ltda. Bogotá, Colombia.

2 Department of Animal Breeding and Genetics, Swedish University of Agricultural

Sciences, Uppsala, Uppsala, Sweden.

3 Department of Anatomy, Physiology and Biochemistry, Swedish University of Agricultural

Sciences, Uppsala, Uppsala, Sweden.

4 Department of Companion Animal Clinical Sciences, Norwegian University of Life

Sciences, Oslo, Norway.

5 Department of Biology, National University of Colombia, Bogotá, Cundinamarca,

Colombia.

* Corresponding author

E-mail: [email protected] (MNB)

3.1 Abstract

The Colombian paso horse, the most important horse breed in Colombia, performs specific

and particular gaits (paso fino, trocha, and Colombian trot), which display different footfall

patterns and stride frequencies. The breed has been selected for gait and conformation for

more than 50 years and we hypothesize that this selection has led to kinematic differences


of the gaits that can be explained by different genetic variants. Hence, the aims of the study

were: 1. To identify if there are any differences in the kinematic and genetic variants

between the Colombian paso horse’s gaits. 2. To evaluate if and how much the gait

differences were explained by the nonsense mutation in the DMRT3 gene and 3. To

evaluate these results for selecting and controlling the horses gait performance. To test our

hypotheses, kinematic data, microsatellites and DMRT3 genotypes for 187 Colombian paso

horses were analyzed. The results indicated that there are significant kinematic and DMRT3

differences between the Colombian paso horse’s gaits, and those parameters can be used

partially to select and control the horses gait performance. However, the DMRT3 gene does

not play a major role in controlling the trocha and the Colombian trot gaits. Therefore,

modifying genes likely influence these gaits. This study may serve as a foundation for

implementing a genetic selection program in the Colombian paso horse and future gene

discovery studies for locomotion pattern in horses.

3.2 Introduction

3.2.1 The Colombian paso horse The Colombian paso horse breed (CPH), also known as Colombian criollo paso horse, is

the most important horse breed in Colombia. This breed is likely derived from a mix of

Spanish horses brought by the conquerors to America starting in year 1493. This group of

horses included the Spanish Jennet horse, which was known to perform ambling gaits

(Hendricks, 2007). In the beginning of the 20th century, the CPH population consisted of a

mix of horses that performed several different stepping gaits (Fedequinas, 2006). The

Colombian paso horses have been intensively selected for their gaits (paso fino, trocha and

trot) since the 1980´s (Fedequinas, 2006). Currently, the CPH breed is traditionally divided

into four groups based mainly on their gaits: Colombian paso fino (CPF), Colombian trocha

(CTR), Colombian trocha and gallop (CTRG) and Colombian trot and gallop (CTG)

(www.fedequinas.org). Recently, the CPF group has been declared as a national genetic

patrimony in Colombia (Law 1842 of 2017, http://es.presidencia.gov.co/normativa). This

was the first CPF group distinguished outside Colombia and in the 20th century it was the

group with the largest population size.

Chapter 2. Selection on the Colombian paso horse’s gaits has produced

kinematic differences partly explained by the DMRT3 gene

57

The studbook, Federación Colombiana de Asociaciones Equinas - Fedequinas, was

created in 1984 and has over 220,000 registered horses (21% CTG, 5% CTRG, 46% CTR,

and 27% CPF). Fedequinas is composed of 24 CPH associations around Colombia and it

groups several hundreds of breeders in the country. According to Fedequinas, 30-50% of

all CPHs in the population are registered in the studbook (Personal communication). Since

1995, all registered horses are parentage tested and each horse is also examined for basic

conformation parameters of the breed by educated representatives from the breeding

associations. In addition, the examiners also guarantee the origin of the hair samples used

for parentage testing. All horses registered in Fedequinas have the possibility to participate

in competitions in Colombia. For each competition, the horses are separated by horse

group (CPH, CTR, CTRG or CTG), sex and age (three categories: 36-48 months, 48-60

months, and more than 60 months), and evaluated by three judges. This gives subjective

qualifications of the conformation and gait traits evaluated (www.fedequinas.org).

3.2.2 The gaits in the Colombian paso horses A large number of gaits and gait variations can be observed in horses, including the walk,

trot, canter, and gallop (Barrey, 2013). There are three breed specific gaits within the

Colombian paso horses: paso fino, trocha, and Colombian trot. These walking and

symmetric gaits (Back & Clayton, 2013) are performed with at least one limb in stance

phase and they are highly collected with a high stride frequency. All the gaits of these

horses exhibit a high animation and energy expenditure.

The paso fino gait is performed only by the Colombian Paso Fino (CPF) group. It is a lateral

sequence four-beat and laterally coupled gait, which has an isochronal beat pattern, and

an independent limb movement. Often, there are three limbs in stance phase at the same

time (Appendix A: S1 Video). There are some gaits, in other horse breeds, with the same

footfall pattern to paso fino as for example the tölt in Icelandic horses (Kristjansson et al.,

2014), marcha picada in Mangalarga-marchador (Patterson, Staiger & Brooks, 2015), paso

fino in Puerto Rican paso fino horses, and peruvian paso in Peruvian paso horses

(Nicodemus & Clayton, 2003).


The trocha gait is performed only by the Colombian trocha (CTR) and Colombian trocha

and gallop (CTRG) groups. It is a lateral sequence four-beat and diagonally coupled gait

(Nicodemus & Clayton, 2003), in which the forelimb hit the ground before the contra lateral

hind limb, and it has a non-isochronal beat pattern. Often, there are two limbs in stance

phase at the same time (Appendix A: S2 Video). Other gaits with a similar footfall pattern

as the trocha are foxtrot in Missouri Foxtrotter (Clayton & Bradbury, 1995) and marcha

batida in Mangalarga-marchador (Patterson et al., 2015).

The trot gait is performed by the Colombian trot and gallop (CTG) group and can be

considered a variant of the regular trot. It consists of an isochronal two-beat and diagonally

coupled gait, which is highly collected. There are either two or four limbs in stance phase

(this is the main difference from regular trot, which has aerial phase) (Appendix A: S3

Video). Additionally, in competitions, CTRG and CTG horses are judged for gallop, which

is a variant of the traditional canter. This asymmetric gait is a highly collected canter and it

has a non-isochronal beat pattern, with at least one limb, always, in stance phase (this is

the main difference from the regular canter) (Appendix A: S4 Video).

3.2.3 The DMRT3 gene The ability to perform alternative gaits is partly due to genetics. In 2012 a premature stop

codon in the doublesex and mab-3-related transcription factor 3 gene

(DMRT3_Ser301STOP) caused by the Chr23:g.22999655C>A SNP was described to

affect locomotion pattern in horses (Andersson et al., 2012a). The DMRT3 gene is part of

the DMRT gene family which includes some important developmental regulators in animals.

These are mainly, but not exclusively, involved in sex differentiation and/or sex

determination (Hong, Park & Saint-Jeannet, 2007). The DMRT3 gene encodes a

transcription factor involved in the coordination of locomotor system in vertebrates

(Andersson et al., 2012a) and has been associated with gait performance and harness

racing performance in several gaited and harness racing horse breeds (Jäderkvist et al.,

2014; Jäderkvist Fegraeus et al., 2015, 2017; Ricard, 2015). Furthermore, Promerová et

al. (Promerová et al., 2014) analyzed 141 horse breeds for the DMRT3 nonsense mutation,

including the four CPH groups (CPF: 80, CTR: 67, CTRG: 4, and CTG: 35), however the

DMRT3 genotypes were not compared with performance nor kinematic data. The frequency



59

of the mutant “A” allele in the four CPH horse groups was 0.94 (CPF), 0.1 (CTR), 0.25

(CTRG), and 0.14 (CTG), respectively (Promerová et al., 2014).

3.2.4 Aims of the study The Colombian paso gaits display different footfall patterns, stride frequency, and they have

been selected for more than half a century. Also, to our knowledge, there are no reports on

kinematic parameters of Colombian paso horse gaits, i.e. whether those gaits should be

considered discrete or continuum gaits, as reported for the Icelandic horse breed

(Robilliard, Pfau & Wilson, 2007). In addition, the genotype frequencies for the nonsense

mutation in the DMRT3 gene differed between the four CPH horse groups in a previous

study (Promerová et al., 2014). Therefore, we hypothesize that the selection on the gaits

performed by the Colombian paso horse breed has led to kinematic differences that can be

explained, at least partly, by the nonsense mutation in the DMRT3 gene.

Hence, the aims of the study were: 1. To identify if there are any differences in the kinematic

variables and genetic variants between the Colombian paso horse’s gaits. 2. To evaluate if

and how much the gait differences were explained by the nonsense mutation in the DMRT3

gene, and 3. To evaluate these results for selecting and controlling the horses gait

performance.

Finally, based on the gait variation in the CPH horses, the breed provides an opportunity to

gain new knowledge about the effect of the DMRT3 “Gait keeper” mutation on the

kinematics of gaited horses.

3.3 Materials and methods

3.3.1 Sampling A total of 187 CPH (CPF=52, CTR=58, CTRG=34, CTG=43, in total 99 males and 88

females evenly distributed among the groups), born between 2000-2013 were selected

based on their participation in Fedequinas national competitions and their performed gait.

A visual examination using slow motion videos was performed to confirm the gait

classification of the horses. Kinematic measurements for 172 of the 187 horses were taken


at several horse farms in Cundinamarca, Antioquia, Quindío, Risaralda, Caldas, Cauca,

and Valle del Cauca departments of Colombia, South America. Information about

genealogy, horse groups (CPF, CTR, CTRG, and CTG), gaits, sex, birthdate, results from

the DNA parentage tests, and microsatellite data (13 markers: AHT4, AHT5, ASB17, ASB2,

ASB23, HMS3, HMS6, HMS7, HTG10, HTG4, LEX3, LEX33, VHL20) were provided by

Fedequinas. All the horses in this study were used in a previous study on the CPH breed

that analyzed microsatellite genotypes from all registered CPH horses (Novoa & García,

2016). Also, for most of the animals selected (n=130), at least five different videos of the

gaits performed in the competitions were analyzed to establish whether the horses

performed a clear footfall pattern or not. This study was approved by the Ethics Committee

for Animal Experiments in Uppsala, Sweden with permit number 5.8.18-15453/2017.

3.3.2 Kinematic measurements All the kinematic measurements were provided by Fedequinas. Thirteen anatomical

landmarks were placed on the horses by the same operator (Figure 3-1). The landmarks

were tracked using the Quintic Biomechanics® software. Measurements were taken for

each side of the horse when the horse was in motion. A route was defined for each horse

farm and every horse performed (by different riders) its gaits through that route 10 times.

Five measurements per side were taken when the horse was perpendicular to the camera.

This was recorded by a high-speed camera taking 240 frames per second. A metallic

square of 1 X 1 meters was used in all the videos to calibrate the lengths of the

measurements. The software automatically calculated the kinematic parameters. These

were direct measurements on certain variables in locomotion, such as the angles of the

fetlock joint flexion and extension, carpal joint flexion, elbow joint flexion and tarsal joint

flexion (Figure 3-1). Also, the following parameters were measured: stride frequency

(strides per minute), stride length (cm), fetlock front speed (cm/s), fetlock hind speed (cm/s)

and hock speed (cm/s). The speeds were the mean (per side, left and right) of the maximum

speeds registered for each route. The protraction and retraction measurements were

defined as explained in Figure 3-2.



61

Figure 3-1: Anatomical landmarks location and angles measured on the horses in motion12.

Figure 3-2: Protraction and retraction limbs angle measurements in a sample of the

Colombian paso horse13.

12 P1: Coronary band front, P2: Fetlock front (Metacarpophalangeal joint), P3: Carpal (Carpometacarpal joint), P4: Elbow (Head of radius), P5: Shoulder, P6: Scapula (Top of the withers), P7: Coronary band hind, P8: Fetlock hind (Metatarsophalangeal joint), P9: Tarsus (Tuber calcanei), P10: Stifle (Tibial tuberosity), P11: Hip joint (Summit of trochanter major), P12: Sacro-iliac joint (Tuber coxae), P13: Head (Wings of atlas bone). Angles measured during locomotion, FF - maximum fetlock flexion during the swing phase, FE - maximum fetlock extension during the stance phase, CF - maximum carpal flexion during the swing phase, EF – maximum elbow flexion during the swing phase, and TF – maximum tarsal flexion during the swing phase. 13 P1: Coronary band front; P6: Scapula (Top of the withers), P7: Coronary band hind, P12: Sacro-iliac joint (Tuber coxae). The dashed points show the angles measured when the horses were trotting without a rider. Protraction was the maximum angle between P1-P6 and the vertical plane when the


3.3.3 SNP genotyping Hair samples from 152 horses of the 187 horses described before (including 15 horses

without phenotypic data), were selected from the repository in Fedequinas. To obtain DNA

from the hair follicles, a previously reported Chelex – proteinase K protocol was used

(Jäderkvist et al., 2014). SNP genotyping was carried out with the StepOnePlus™ Real-

Time PCR System (Life Technologies) using custom designed TaqMan SNP Genotyping

Assays (Applied Biosystem) as previously described (Andersson et al., 2012a).

3.3.4 Statistical analyses § Selection of the kinematic parameters using asymmetry analysis

The selection of one of the kinematic parameters measured per side (left or right) was

based on asymmetry analyses. This preliminary evaluation was done to exclude

measurements from lame horses, where asymmetries between kinematic measures from

the left and right side can be expected, to avoid possible bias in the further statistical

forelimb was extended forward. Retraction was the maximum angle between P7-P12 and the vertical plane when the hind limb was extended backwards.



63

analyses of the kinematic parameters. The flowchart of the process performed is presented

in the Figure 3-3.

Figure 3-3: Flowchart of the procedures performed to select one of the kinematic

parameters (left or right side of the horse) based on asymmetry analysis for each kinematic

parameter in the Colombian paso horses.

The asymmetric limb was identified by comparing the fetlock extension, carpal flexion and

tarsal flexion angles between the left and right limb (fore and hind separately) for each


horse. The asymmetry per horse and limb was established if the differences between the

angles, for any of those parameters, were larger than 8 degrees, and the asymmetric limb

was the one with the highest angle (it implies a decrease of the flexion (tarsal and carpal)

or the extension (fetlock) of the joints).

Furthermore, the mean of the measurements for all the kinematic parameters (angles,

speed or length) between symmetric and asymmetric horse limbs for all the parameters

(left and right side independently), were compared by an analysis of variance (ANOVA)

using the canova function of the CAR package (Fox et al., 2014), stratified by horse group

and sex. There were three possible scenarios for the ANOVA analysis of all the parameters.

1. There were no differences between symmetric and asymmetric horse limbs (left and right

side). 2. There were differences between symmetric and asymmetric horse limbs for one

side (left or right). In this scenario, the parameter of the side which presented no differences

was chosen for further statistical analyses. 3. There were differences between symmetric

and asymmetric horse limbs for both sides (left and right). In this scenario, the asymmetric

horse limbs were removed.

For the scenarios 1 and 3 (Figure 3-3), a Pearson’s correlation coefficient between the left

and right side was calculated using the function XI1 of the StatR package (Guisande et al.,

2014) . If the correlation was larger than r>+-0.5 and significant (P<0.05), one of the

parameters (left or right) was randomly selected for further statistical analyses. If both sides

were uncorrelated, that parameter was discarded from further analyses.

§ Mean and variation of the parameters The statistical analyses was performed in R using the Rwizard software (Guisande et al.,

2014). The mean, confidence interval (CI 95%, using t distribution for size samples < 30),

standard error (SE), standard deviation (SD), variation coefficient (VC), skewness and

kurtosis were calculated for each variable stratified by horse group and sex, using the StatR

package (Guisande et al., 2014). The normality of all parameters was evaluated with the

Shapiro-Wilk test using the function shapiro test of the base stats package.

§ Correlations The relationships among all variables were estimated with the Pearson’s correlation

coefficient using the function XI1 of the StatR package (Guisande et al., 2014). The strength



65

of the correlations (r) was interpreted based on the guidelines proposed by (Hinkle et al.,

2003): 0 to 0.3 (0 to -0.3)=negligible, 0.3 to 0.5 (-0.3 to -0.5)=low, 0.5 to 0.7 (-0.5 to -

0.7)=medium, 0.7 to 0.9 (-0.7 to -0.9)= high, 0.9 to 1 (-0.9 to -1)=very high.

§ Multivariate analysis A discriminant analysis was performed by using a stepwise selection to obtain a subset of

the kinematic parameters that best summarized the differences among the groups. This

was done with the function candisc of the package candisc (Friendly, 2007; Friendly & Fox,

2013), and ida function of the MASS package (Venables & Ripley, 2002; Ripley et al.,

2014). The figure of one dimension was obtained with the function plot.cancor of the

candisc package (Friendly, 2007; Friendly & Fox, 2013).

§ Genetic analyses

A genetic structure analysis based on 13 autosomal microsatellite markers (AHT4, AHT5,

ASB17, ASB2, ASB23, HMS3, HMS6, HMS7, HTG10, HTG4, LEX3, LEX33, VHL20) for

149 of the 187 horses (horses that were genotyped for the DMRT3 mutation) was

performed to evaluate whether the horses were grouped in the same way as in a previous

study that analyzed the microsatellite data of the whole registered CPH population (Novoa

& García, 2016). This was done by estimating the number of possible populations in the

sample based on Bayesian inference models (Pritchard et al., 2000) used by the software

STRUCTURE 2.3.4. Also, the analysis of molecular variance (AMOVA) was performed to

evaluate the genetic differentiation among CPH groups (CPF, CTR, CTRG, and CTG) with

the Arlequin v3.5 software (Excoffier & Lischer, 2010).

A Hardy-Weinberg equilibrium (HWE) test for the DMRT3 genotypes was performed to

estimate exact P-values using the Markov chain method with the GENEPOP v.4.3 software

(Raymond & Rousset, 1995; Rousset, 2008). The associations between DMRT3 genotypes

and the different CPH groups were evaluated with the Pearson’s chi-squared test using the

function VIII1 of the StatR package (Guisande et al., 2014). The associations between

DMRT3 genotypes and the footfall pattern (whether the horses performed a clear gait or

not) in the diagonal gaits (trocha and Colombian trot gaits) were evaluated with Fisher’s

exact test using the function VIII2 of the StatR package (Guisande et al., 2014).


3.4 Results

3.4.1 Statistical analyses § Selection of the kinematic parameters using asymmetry analysis

Sixty-nine out of 172 horses with at least one asymmetric limb were found. The kinematic

parameters selected for further statistical analyses, based on our method described (Figure

3-3), are presented in Table 3-1. The parameters which presented no differences between

symmetric and asymmetric limbs (within the left and right side) were highly correlated

between both sides (r>+-0.5, P<0.05). Therefore, one side was randomly selected for

further statistical analyses (Table 3-1). Also, for the parameters that presented differences

between symmetric and asymmetric limbs for one of the sides (left or right), the parameter

that presented no differences between symmetric and asymmetric limbs was selected for

further statistical analyses (Table 3-1). The fetlock extension front in Colombian paso fino-

CPF males group was the only parameter that presented differences between symmetric

and asymmetric limbs for both sides (left and right). Therefore, the measurements of the

asymmetric limbs (n=5 for the left side and n=2 for the right side) were removed. After that,

both sides were correlated (r>+-0.5, P<0.001), therefore, one of the sides was randomly

selected for further statistical analyses (Table 3-1).

Table 3-1: The kinematic parameters selected based on the asymmetry analysis performed

in the CPH breed.

1 CPH-Colombian paso horse breed, CPF-Colombian paso fino group, CTR-Colombian

trocha group, CTRG-Colombian trocha and gallop group, CTG-Colombian trot and gallop

group. 2 Level of significance: * P<0.05

Parameters which presented no differences for both sides in all the groups.

Parameters which presented significant* differences for only one side per group1.

Parameters which presented significant2 differences for both sides per group.

Carpal flexion Elbow flexion Fetlock flexion - front Fetlock flexion - hind Hock speed Protraction Retraction Stride length - hind

Fetlock extension front in CTG females, and CTR males Fetlock extension front in CTRG females and males, and CTR females Fetlock extension hind in CPF females and CTRG males Fetlock front speed in CTRG males Fetlock hind speed CTRG males and CTG males Stride frequency TRGC males Stride length - front in CTRG females Tarsal flexion in CPF males and CTRG males

Fetlock extension front in CPF males



67

§ Mean and variation of the kinematics traits

The variation and mean for the kinematic parameters stratified by horse group and sex, are

presented in Table 3-2. The SD for kinematics parameters was in the range of 0.33-6.07,

the largest was found in stride length - hind in CTRG females, and the lowest in protraction

- front in CPF males. In general, the variation coefficient for all the parameters was 3.52 -

33.95. All the parameters, except fetlock front speed (cm/s) and stride length for the front

limb (cm) followed a normal distribution.

Table 3-2: Mean and variation for kinematic parameters by horse group and sex in a

sample of Colombian paso horse breed1.

Parameter Group Sex N Mean CI 95% SE SD CV (%) Skwe. Kurt.

Fetlock flexion - front (P1-P2-P3) CPF F 13 137.48 (133.17-141.78) 6.84 1.98 5.18 0.31 -1.26

Fetlock flexion - front (P1-P2-P3) CPF M 17 133.35 (127.91-138.8) 10.28 2.57 7.95 -0.26 -0.42

Fetlock flexion - front (P1-P2-P3) CTR F 8 127.43 (120.9-133.95) 7.30 2.76 6.12 -0.06 -1.41

Fetlock flexion - front (P1-P2-P3) CTR M 12 125.82 (120.9-130.74) 7.41 2.24 6.15 0.13 -1.47

Fetlock flexion - front (P1-P2-P3) CTRG F 6 130.47 (118.12-142.82) 10.74 4.80 9.02 0.37 -1.04

Fetlock flexion - front (P1-P2-P3) CTRG M 10 126.32 (119.37-133.27) 9.21 3.07 7.69 0.19 -1.63

Fetlock flexion - front (P1-P2-P3) CTG F 9 125.76 (119.77-131.74) 7.34 2.60 6.19 -0.64 -1.44

Fetlock flexion - front (P1-P2-P3) CTG M 9 127.71 (121.39-134.03) 7.75 2.74 6.44 -0.08 -1.45

Fetlock extension - front (P1-P2-P3) CPF F 17 123.40 (119.99-126.81) 6.43 1.61 5.37 -0.36 -1.42

Fetlock extension - front (P1-P2-P3) CPF M 22 124.07 (121.44-126.71) 5.80 1.27 4.79 0.58 -0.44

Fetlock extension - front (P1-P2-P3) CTR F 20 118.40 (115.23-121.57) 6.61 1.52 5.73 -0.20 -0.63

Fetlock extension - front (P1-P2-P3) CTR M 22 122.08 (119.29-124.87) 6.15 1.34 5.16 -0.05 -1.11

Fetlock extension - front (P1-P2-P3) CTRG F 15 118.60 (115.17-122.03) 5.99 1.60 5.23 0.24 -0.23

Fetlock extension - front (P1-P2-P3) CTRG M 15 122.35 (119.35-125.35) 5.23 1.40 4.43 0.19 0.14

Fetlock extension - front (P1-P2-P3) CTG F 13 117.52 (113.55-121.49) 6.31 1.82 5.59 -0.02 -1.13

Fetlock extension - front (P1-P2-P3) CTG M 20 121.20 (117.89-124.51) 6.89 1.58 5.83 -1.38 2.73

Carpal flexion (P2-P3-P4) CPF F 16 119.43 (115.71-123.14) 6.75 1.74 5.83 -0.50 -0.78

Carpal flexion (P2-P3-P4) CPF M 24 122.43 (120.52-124.35) 4.43 0.92 3.70 -0.17 -1.04

Carpal flexion (P2-P3-P4) CTR F 21 109.55 (105.34-113.77) 9.04 2.02 8.46 0.01 -0.75

Carpal flexion (P2-P3-P4) CTR M 22 115.34 (112.53-118.15) 6.19 1.35 5.50 -0.11 0.30

Carpal flexion (P2-P3-P4) CTRG F 15 107.73 (102.58-112.89) 8.99 2.40 8.64 0.31 -0.68

Carpal flexion (P2-P3-P4) CTRG M 15 112.29 (108.96-115.63) 5.82 1.56 5.37 -0.64 0.05




Carpal flexion (P2-P3-P4) CTG F 15 109.73 (104.02-115.44) 9.96 2.66 9.40 0.23 -1.50

Carpal flexion (P2-P3-P4) CTG M 20 112.94 (110.02-115.86) 6.08 1.39 5.52 -0.14 -0.12

Elbow flexion (P3-P4-P5) CPF F 16 90.25 (87.21-93.29) 5.53 1.43 6.33 -0.07 -1.16

Elbow flexion (P3-P4-P5) CPF M 20 88.84 (86.39-91.29) 5.10 1.17 5.89 -0.30 -0.62

Elbow flexion (P3-P4-P5) CTR F 19 81.39 (78.79-83.99) 5.25 1.24 6.62 0.18 -1.61

Elbow flexion (P3-P4-P5) CTR M 17 83.19 (80.24-86.14) 5.57 1.39 6.90 1.13 0.50

Elbow flexion (P3-P4-P5) CTRG F 14 80.81 (77.75-83.88) 5.12 1.42 6.58 0.23 -1.59

Elbow flexion (P3-P4-P5) CTRG M 13 82.32 (77.8-86.84) 7.18 2.07 9.08 -0.13 -1.55

Elbow flexion (P3-P4-P5) CTG F 13 78.42 (73.18-83.65) 8.32 2.40 11.05 0.70 -0.79

Elbow flexion (P3-P4-P5) CTG M 18 78.47 (74.37-82.56) 8.01 1.94 10.50 0.45 0.53

Fetlock flexion - hind (P7-P8-P9) CPF F 12 107.05 (102.3-111.8) 7.15 2.16 6.98 0.18 -1.26

Fetlock flexion - hind (P7-P8-P9) CPF M 14 109.07 (103.37-114.77) 9.51 2.64 9.05 0.03 -1.13

Fetlock flexion - hind (P7-P8-P9) CTR F 8 101.88 (96.19-107.56) 6.36 2.40 6.68 -0.04 -1.54

Fetlock flexion - hind (P7-P8-P9) CTR M 12 104.65 (101.78-107.52) 4.33 1.30 4.32 0.02 -1.32

Fetlock flexion - hind (P7-P8-P9) CTRG F 6 104.87 (101-108.74) 3.37 1.51 3.52 0.63 -1.04

Fetlock flexion - hind (P7-P8-P9) CTRG M 10 103.70 (97.1-110.3) 8.75 2.92 8.89 0.02 -1.38

Fetlock flexion - hind (P7-P8-P9) CTG F 9 94.36 (87.02-101.69) 9.00 3.18 10.12 1.11 0.48

Fetlock flexion - hind (P7-P8-P9) CTG M 10 101.40 (92.68-110.12) 11.57 3.86 12.03 -0.02 -1.07

Fetlock extension - hind (P7-P8-P9) CPF F 14 123.69 (119.99-127.4) 6.19 1.72 5.19 0.23 -0.68

Fetlock extension - hind (P7-P8-P9) CPF M 24 123.86 (120.7-127.01) 7.31 1.52 6.03 -1.29 1.38

Fetlock extension - hind (P7-P8-P9) CTR F 22 119.13 (116.58-121.68) 5.62 1.23 4.83 0.02 -1.46

Fetlock extension - hind (P7-P8-P9) CTR M 22 118.60 (115.74-121.45) 6.29 1.37 5.43 0.20 -0.80

Fetlock extension - hind (P7-P8-P9) CTRG F 15 117.12 (112.55-121.69) 7.97 2.13 7.04 -0.12 -0.95

Fetlock extension - hind (P7-P8-P9) CTRG M 13 117.63 (114.06-121.2) 5.68 1.64 5.03 -0.49 -0.84

Fetlock extension - hind (P7-P8-P9) CTG F 17 116.53 (112.94-120.12) 6.78 1.69 6.00 0.28 -1.31

Fetlock extension - hind (P7-P8-P9) CTG M 20 118.07 (114.87-121.27) 6.65 1.53 5.78 -0.15 -0.45

Tarsal flexion (P8-P9-P10) CPF M 21 92.99 (90.21-95.77) 5.97 1.33 6.58 0.21 -0.70

Tarsal flexion (P8-P9-P10) CTR F 22 86.78 (82.89-90.68) 8.58 1.87 10.12 0.14 -0.62

Tarsal flexion (P8-P9-P10) CTR M 20 90.77 (87.44-94.1) 6.93 1.59 7.83 -0.03 -0.89

Tarsal flexion (P8-P9-P10) CTRG F 15 87.59 (83.79-91.38) 6.62 1.77 7.82 -0.85 -0.15

Tarsal flexion (P8-P9-P10) CTRG M 13 88.60 (84.89-92.31) 5.91 1.71 6.94 0.32 -1.12

Tarsal flexion (P8-P9-P10) CTG F 15 81.80 (79.08-84.52) 4.75 1.27 6.01 -0.05 -1.00

Tarsal flexion (P8-P9-P10) CTG M 19 86.11 (82.19-90.02) 7.90 1.86 9.43 -0.43 -0.37

Stride frequency CPF F 17 165.66 (160.28-171.04) 10.16 2.54 6.32 0.45 0.35

Stride frequency CPF M 25 160.86 (156.49-165.23) 10.38 2.12 6.58 0.02 -0.42

Stride frequency CTR F 22 165.94 (162.42-169.45) 7.74 1.69 4.77 0.29 -0.49

Stride frequency CTR M 22 172.76 (167.33-178.18) 11.95 2.61 7.08 -0.06 -0.86

Stride frequency CTRG F 15 159.72 (156.08-163.35) 6.34 1.69 4.11 -0.14 -1.54

Stride frequency CTRG M 10 163.31 (157.6-169.03) 7.58 2.53 4.89 -0.37 -1.49

Stride frequency CTG F 17 130.05 (125.18-134.92) 9.19 2.30 7.28 0.19 -1.36



69



Stride frequency CTG M 20 137.07 (133.28-140.86) 7.90 1.81 5.91 0.02 -0.20

Fetlock front speed CPF F 15 32.31 (29.97-34.64) 4.08 1.09 13.07 0.06 -0.90

Fetlock front speed CPF M 22 32.05 (29.85-34.24) 4.83 1.05 15.44 -0.43 -0.74

Fetlock front speed CTR F 22 39.71 (36.14-43.28) 7.87 1.72 20.28 0.45 -0.83

Fetlock front speed CTR M 22 37.09 (33.34-40.84) 8.27 1.80 22.82 0.55 -0.90

Fetlock front speed CTRG F 15 40.76 (35.72-45.8) 8.79 2.35 22.33 0.05 -1.18

Fetlock front speed CTRG M 12 44.30 (39.09-49.51) 7.84 2.37 18.50 -0.03 -0.23

Fetlock front speed CTG F 14 36.83 (33.1-40.56) 6.22 1.73 17.53 0.61 -0.32

Fetlock front speed CTG M 19 34.24 (31.13-37.35) 6.28 1.48 18.84 0.42 -1.25

Fetlock hind speed CPF F 16 27.33 (24.7-29.95) 4.78 1.23 18.05 0.94 0.92

Fetlock hind speed CPF M 23 27.72 (25.35-30.09) 5.36 1.14 19.78 0.16 -0.78

Fetlock hind speed CTR F 21 31.31 (28.48-34.15) 6.09 1.36 19.91 -0.02 -0.96

Fetlock hind speed CTR M 20 29.03 (26.49-31.57) 5.28 1.21 18.66 0.21 -0.82

Fetlock hind speed CTRG F 13 30.46 (26.75-34.17) 5.89 1.70 20.14 0.20 -1.30

Fetlock hind speed CTRG M 14 33.87 (30.13-37.62) 6.25 1.73 19.15 -0.40 -1.28

Fetlock hind speed CTG F 12 29.98 (26.62-33.34) 5.06 1.53 17.63 0.52 -1.18

Fetlock hind speed CTG M 19 29.07 (26.96-31.19) 4.27 1.01 15.08 -0.12 -0.82

Hock speed CPF F 17 15.64 (13.94-17.33) 3.20 0.80 21.10 0.10 -0.75

Hock speed CPF M 23 14.51 (13.32-15.7) 2.69 0.57 18.94 0.26 -0.60

Hock speed CTR F 20 18.04 (16.8-19.28) 2.58 0.59 14.68 0.08 -0.34

Hock speed CTR M 21 17.95 (16.06-19.84) 4.05 0.91 23.11 0.16 -0.87

Hock speed CTRG F 14 17.86 (15.7-20.01) 3.60 1.00 20.90 0.97 0.03

Hock speed CTRG M 15 19.44 (17.82-21.06) 2.83 0.76 15.07 -0.11 -0.79

Hock speed CTG F 14 16.70 (15.02-18.38) 2.81 0.78 17.46 0.59 -0.98

Hock speed CTG M 19 15.63 (14.44-16.82) 2.40 0.57 15.79 0.51 -0.82

Protraction CPF F 11 20.82 (19.95-21.68) 1.23 0.39 6.18 0.05 -1.39

Protraction CPF M 17 21.41 (20.7-22.11) 1.32 0.33 6.37 0.06 -0.51

Protraction CTR F 13 23.10 (21.8-24.4) 2.07 0.60 9.31 -0.43 -0.88

Protraction CTR M 14 22.55 (21.32-23.78) 2.05 0.57 9.45 0.62 -0.61

Protraction CTRG F 13 21.36 (20.48-22.24) 1.40 0.40 6.83 -0.12 -0.37

Protraction CTRG M 12 22.00 (20.82-23.18) 1.78 0.54 8.44 0.24 -1.43

Protraction CTG F 9 22.29 (20.99-23.59) 1.59 0.56 7.57 0.46 -1.37

Protraction CTG M 15 22.95 (21.94-23.95) 1.75 0.47 7.89 -0.32 -1.06

Retraction CPF F 11 17.35 (15.75-18.96) 2.28 0.72 13.77 -0.26 -1.52

Retraction CPF M 17 16.56 (15.46-17.66) 2.08 0.52 12.92 0.64 -0.64

Retraction CTR F 13 18.11 (16.49-19.73) 2.58 0.74 14.82 0.30 -1.24

Retraction CTR M 14 16.91 (15.38-18.45) 2.56 0.71 15.71 -0.51 -0.55

Retraction CTRG F 13 16.69 (15.19-18.19) 2.39 0.69 14.89 -0.60 -1.30

Retraction CTRG M 12 16.53 (13.98-19.09) 3.85 1.16 24.35 -0.48 -0.61

Retraction CTG F 9 18.51 (17.03-19.99) 1.82 0.64 10.42 -0.11 -1.51




Retraction CTG M 15 18.62 (17.36-19.88) 2.19 0.59 12.18 -0.07 -0.93

Stride length front CPF F 17 68.42 (56.48-80.37) 22.54 5.63 33.95 -0.27 -1.10

Stride length front CPF M 24 63.50 (56.4-70.6) 16.46 3.43 26.48 0.20 -1.16

Stride length front CTR F 22 85.29 (75.35-95.23) 21.91 4.78 26.29 0.22 -1.18

Stride length front CTR M 21 70.62 (60.5-80.74) 21.69 4.85 31.47 0.30 -1.38

Stride length front CTRG F 11 85.08 (72.27-97.89) 18.17 5.74 22.40 -0.17 -1.02

Stride length front CTRG M 15 71.93 (62.95-80.92) 15.67 4.19 22.56 0.16 -1.64

Stride length front CTG F 17 81.75 (73.12-90.38) 16.28 4.07 20.53 -0.19 -0.91

Stride length front CTG M 20 62.19 (55.84-68.53) 13.21 3.03 21.80 0.01 -0.31

Stride length hind CPF F 17 69.48 (57.57-81.4) 22.48 5.62 33.35 -0.40 -1.24

Stride length hind CPF M 24 64.74 (57.85-71.62) 15.96 3.33 25.18 0.03 -1.35

Stride length hind CTR F 22 86.44 (76.9-95.97) 21.00 4.58 24.87 0.21 -1.19

Stride length hind CTR M 21 71.31 (61.24-81.38) 21.58 4.83 31.01 0.37 -1.45

Stride length hind CTRG F 15 79.43 (66.39-92.47) 22.74 6.07 29.64 -0.12 -1.02

Stride length hind CTRG M 15 73.52 (64.24-82.8) 16.18 4.32 22.78 0.19 -1.62

Stride length hind CTG F 17 82.71 (74.78-90.65) 14.97 3.74 18.66 -0.34 -1.27

Stride length hind CTG M 20 63.64 (56.74-70.53) 14.35 3.29 23.14 0.17 -0.80

1 Flexions, extensions, protraction, and retraction in degrees; stride frequency in strides per

minute; speed in cm/s; stride lengths in cm. CPF-Colombian Paso Fino, CTR-Colombian

trocha, CTRG-Colombian trocha and gallop, CTG-Colombian trot and gallop. N, number of

horses; CI, confidence interval; SE, standard error; SD, standard deviation; VC, variation

coefficient; Skew., skewness; Kurt., kurtosis; The positions of the landmarks (P1-P10) are

described in the Figure 3-1.

§ Correlations

Table 3-3 shows the moderate to high (r>+-0.5) significant (P<0.05) correlations found for

the different measurements in the CPH groups. The fetlock flexion for the front and hind

limbs as well as the stride length, were the parameters with most correlations with other

parameters. The stride frequency had the largest positive correlation with fetlock extension

– front (CTRG) and a negative correlation with protraction (CTR).

Table 3-3: The moderate to high significant (P<0.05) correlations between the kinematics

parameters1 measured for each CPH group.

Group2 Parameter 1 Parameter 2 r CTRG Stride frequency Fetlock extension - front 0.521



71


Group2 Parameter 1 Parameter 2 r CTR Stride frequency Protraction -0.598 CTR Elbow flexion Fetlock extension - hind 0.517 CTR Elbow flexion Carpal flexion 0.552 CTRG Elbow flexion Carpal flexion 0.522 CTR Elbow flexion Retraction -0.582 CTRG Fetlock extension - front Protraction 0.597 CTR Fetlock extension - front Retraction 0.594 CTRG Fetlock extension - front Retraction -0.781 CTR Fetlock extension - hind Fetlock flexion - hind 0.526 CTRG Fetlock extension - hind Tarsal flexion 0.553 CTG Fetlock extension - hind Tarsal flexion 0.618 CPF Fetlock flexion - front Fetlock flexion - hind 0.545 CTR Fetlock flexion - front Fetlock flexion - hind 0.500 CTRG Fetlock flexion - front Fetlock flexion - hind 0.633 CTG Fetlock flexion - front Tarsal flexion 0.515 CTR Fetlock flexion - front Carpal flexion 0.537 CTR Fetlock flexion - front Protraction -0.516 CTRG Fetlock flexion - hind Fetlock front speed -0.502 CTRG Fetlock flexion - hind Tarsal flexion 0.535 CTG Fetlock flexion - hind Tarsal flexion 0.534 CTR Fetlock flexion - hind Protraction -0.538 CTR Stride length Fetlock extension - hind -0.771 CTRG Stride length Fetlock extension - hind 0.535 CTR Stride length Fetlock flexion - front -0.550 CPF Stride length Fetlock front speed 0.623 CTR Stride length Fetlock hind speed 0.557 CTG Stride length Tarsal flexion -0.513 CPF Stride length Hock speed 0.751

1 Flexions, extensions, protraction, and retraction in degrees, stride frequency in strides per

minute, speed in cm/s, stride lengths in cm. 2 CPF-Colombian Paso Fino group, CTR-Colombian trocha group, CTRG-Colombian

trocha and gallop group, CTG-Colombian trot and gallop group.


§ Analysis of variance

There were significant differences between the CPH groups or sex for most of the kinematic

parameters analyzed (Table 3-4). The fetlock flexion – front, carpal flexion, and strides

lengths measurements presented sexual dimorphisms in all groups. Significant interactions

effects (P<0.05) between horse groups and sex were found for the stride frequency

parameter for all horse groups.

Table 3-4: Differences among the CPH groups or sex on the kinematic parameters

analyzed.

Parameter1 Horse Group2 Sex Post hoc test4

Kinematics Fetlock flexion - front ** CPF-CTR**, CPF-CTG* Fetlock extension - front * ** CPF-CTG* Carpal flexion *** ** CPF-CTR***, CPF-CTRG***, CPF-CTG*** Elbow flexion *** CPF-CTR***, CPF-CTRG***, CPF-CTG*** Fetlock flexion - hind ** CPF-CTG** Fetlock extension - hind *** CPF-CTR***, CPF-CTRG***, CPF-CTG*** Tarsal flexion *** CPF-CTG***, CTR-CTG* Stride frequency *** CPF-CTG***, CTR-CTRG**, CTR-CTG***, CTRG-CTG***

Fetlock front speed (cm/s3 *** CPF-CTR***, CPF-CTRG***, CPF-CTG*, CTR-CTRG*, CTRG-CTG***

Fetlock hind speed (cm/s) ** CPF-CTRG** Hock speed (cm/s) *** CPF-CTR***, CPF-CTRG***, CTRG-CTG* Stride length front (cm)3 * *** CPF-CTR**, CPF-CTRG* Stride length hind (cm) * *** CPF-CTR* Protraction (degrees) ** CPF-CTR**, CPF-CTG*

1 Flexion and extension in degrees, stride frequency in strides per minute. 2 CPF-Colombian paso fino group, CTR-Colombian trocha group, CTRG-Colombian trocha

and gallop group, CTG-Colombian trot and gallop group. 3 For a non-normally distributed parameter a Kruskal-Wallis test was done. 4 Tukey’s post hoc tests for normally distributed parameter, Dunn’s tests for non-normally

distributed parameters after a significant (P<0.05) Kruskal-Wallis test. These tests were

done between every pair of horse groups.

Level of significance: * P<0.05, ** P<0.01, *** P<0.001.



73

§ Multivariate analysis

The discriminant analyses resumed 94.44% of the variance in the two first axes based on

13 selected parameters (stride frequency, elbow flexion, fetlock flexion front, fetlock flexion

hind, fetlock extension front, fetlock extension hind, carpal flexion, tarsal flexion, protraction,

retraction, fetlock front speed, fetlock hind speed, and hock speed) (n=41, i.e. only the

horses that had all the 13 measurements) (Figure 3-4). The contribution of each parameter

to the first dimension is presented in Figure 3-5. The analysis showed that the Colombian

trot is the most differentiated group in the CPH breed. The parameter with the highest

contribution to the first discriminant function was stride frequency followed by the elbow

flexion. Overall, there were no differences between the CTR and the CTRG groups, except

for stride frequency and fetlock front speed, as seen in the ANOVA analysis.

Figure 3-4: Discriminant analysis for the CPH groups using kinematic parameters14.

14 Each point represents an individual classified in one Colombian paso horse group: CPF-Colombian paso fino group; CTR-Colombian trocha group; CTRG-Colombian trocha and gallop group; CTG-Colombian trot and gallop group. F, front; H, hind; ext, extension; SF, stride frequency. Ellipses show 0.5 (inner) and 0.95 (outer) level of significance for each horse group.


Figure 3-5: Canonical scores and the parameters that were selected for the first dimension of the discriminant analysis of the Colombian paso horse groups15.

In Figure 3-6 the results of the discriminant analysis are presented per gait instead of horse

groups. This analysis resumed 100% of the variance in the two first axes based on the

same parameters selected in the horse groups analysis (Figure 3-4).

Figure 3-6: Discriminant analysis between the Colombian paso gaits using kinematic

parameters16.

15 CPF, Colombian paso fino group; CTR, Colombian trocha group; CTRG, Colombian trocha and gallop group; CTG, Colombian trot and gallop group. F, front; H, hind; ext, extension; SF, stride frequency. 16 Each point represents an individual classified per gait. F, front; H, hind; ext, extension; SF, stride frequency. Ellipses show 0.5 (inner) and 0.95 (outer) level of significance for each gait.



75

3.4.2 Genetic analyses The genetic structure analysis based on microsatellites showed a genetic difference

between CPF group and diagonally gaited groups (CTR, CTRG, and CTG groups) (Figure

3-7). Also, the AMOVA showed a genetic difference of 5.3% (P=0.02) between CPF group

and diagonally gaited groups.

Figure 3-7: Bar plot of genetic structure analysis of the Colombian paso horse groups

based on microsatellite data17.

17 1- Colombian trot and gallop group; 2- Colombian trocha and gallop group; 3- Colombian trocha group; 4- Colombian paso fino group.


The frequency of the mutant DMRT3 A-allele in the whole CPH breed was 0.3 but there

was a significant difference in the genotype distribution among the 4 horse groups (P = 2.2

x10-16; Table 3-5). The mutant A-allele was fixed in the CPF group and the frequency of the

mutation in the sample of the diagonally gaited horses (CTR, CTRG, and CTG group) was

0.04. The homozygous AA genotype was not found in the diagonally gaited horses. Also,

there was a heterozygote excess (P<0.001) in the diagonally gaited horses (CTR, CTRG,

and CTG group). In addition, the number of horses which performed diagonal gaits with

different DMRT3 genotypes that performed a clear or unclear gait footfall pattern is

presented in Table 3-6.

Table 3-5: Genotype frequencies of the DMRT3 mutation in a sample of Colombian paso

horses.

Colombia paso horse group n AA CA CC P Colombian paso fino 42 1.00 0.00 0.00

Colombian trocha 50 0.00 0.02 0.98

Colombian trocha and gallop 27 0.00 0.07 0.93 Colombian trot and gallop 33 0.00 0.15 0.85

Total 152 0.28 0.05 0.67 2.2 x10-16

Table 3-6: Number of diagonally gaited horses with different DMRT3 genotypes that

perform a clear or unclear gait footfall pattern.

Diagonal gaits CA CC P Clear gait Unclear gait Clear gait Unclear gait

Trocha 3 0 5 47 0.002 Colombian trot 3 0 14 7 0.529

3.5 Discussion

3.5.1 Asymmetry The asymmetries identified in some of the kinematic parameters could be explained by a

possible lameness of the limb where the fetlock extension, carpal flexion or tarsal flexion

angle was increased. An angle increase in joint flexion or extension (Figure 3-1) is

associated with less weight bearing, which may be a sign of lameness (Kramer & Keegan,

2014). However, it is uncertain if the asymmetries identified within our study are associated

with pain (lameness) or natural variation. In a recent study (Rhodin et al., 2017), 222 horses



77

were analyzed in training and supposed to be sound by the owners, and still, 73% of them

showed movement asymmetries. To evaluate lameness in our horses, additional

measurements and analyses are required as suggested by previous studies (Keegan,

2007; Ishihara et al., 2009; Pfau, Fiske-Jackson & Rhodin, 2016). In addition, the selection

of the kinematic parameters, based on asymmetries (the variables not affected by

asymmetry were chosen), contributes to the reliability of the data used for the statistical

analyses performed in the current study.

3.5.2 Kinematic parameters of the CPH breed The gaits (paso fino, trocha, and Colombian trot) performed by the CPH are distinctive for

this breed. For all the gaits, there is always at least one limb in stance phase and there is

a high stride frequency and short stride length. The stride frequencies for the paso fino

(2.60-2.85 strides per second) and trocha gait (2.70-2.96 strides per second) are higher

than for similar walking gaits as tölt and foxtrot (2.23-2.36 strides per second) (Barrey,

2013), and comparable to the stride frequency at gallop in racing breeds like the

Thoroughbred (2.27–2.92 strides per second) (Yamanobe, Hiraga & Kubo, 1992; Parsons,

Pfau & Wilson, 2008; Barrey, 2013). On the other hand, the stride length of the CPH gaits

is shorter (0.64 – 0.85 m) than in other walking gaits like tölt and foxtrot (Barrey, 2013).

These characteristics make it difficult to distinguish the CPH gaits by just using just the

human eye, and even more difficult to evaluate the footfall pattern and the kinematic

parameters of the CPH gaits. Therefore, the objective measurements presented in the

current study can be useful for establishing judging parameters and genetic improvement

programs in the CPH breed (Table 3-2).

3.5.3 Kinematic differences between the CPH gaits The gaits of the CPH breed were different based on the kinematics traits and genetic data

(DMRT3 genotypes and microsatellites) analyzed in the current study. By using these

genetic and kinematic parameters, it was possible to clearly distinguish the gaits. Regarding

the kinematic data, most of the gait differences could be explained by the stride frequency

as well as the elbow and fetlock flexions, protraction and retraction measurements. Also, in

the current study we have demonstrated that trocha gait can be considered the same gait

for both CTR and CTRG horse groups. The only difference between CTR and CTRG horse


groups was found for the stride frequency and the fetlock front speed (CTRG is slower),

except for the fact that the CTRG horses are also trained to perform canter in competitions.

The Colombian trot gait is the most differentiated gait among the CPH gaits. It had the

lowest stride frequency, flexion and extensions angles, and the highest protraction and

retraction values. The paso fino and trocha gaits were more corresponding to each other

than to the Colombian trot. The stride frequency of paso fino and trocha gait was similar

and both gaits have a lateral sequence footfall pattern. However, the main difference

between these two gaits is that paso fino is a lateral coupled gait whereas trocha is a

diagonal coupled gait. Moreover, there were significant differences in joint flexions and

extensions (paso fino is higher) between the paso fino and the trocha gait.

3.5.4 Genetic differences in the CPH gaits In addition to the kinematic differences, we observed a genetic differentiation of two groups

based on the microsatellite data of the horses that also were genotyped for the DMRT3

mutation: the CPF group and the diagonally gaited horses (CTR, CTRG and CTG groups)

(Figure 3-7), as previously reported in a study using the microsatellite census data (Novoa

& García, 2016). This genetic structure also corresponded to two DMRT3 groups: horses

with the AA genotype of the DMRT3 mutation (horses performing the paso fino gait) and

horses with CC and CA genotypes (horses performing the trocha and the Colombian trot

gaits). The genetic differences between the CPF group and the other CPH groups likely

reflect the selection process for the last 50 years mainly based on the gaits present in the

CPH.

Furthermore, there were differences in the frequency of the DMRT3 mutant A-allele in the

current study compared to a previous report (Promerová et al., 2014) for the CPF (0.94 vs

1 in the current study), the CTR (0.10 vs 0.01 in the current study), and the CTG (0.14 vs

0.07 in the current study) groups (the CTRG group was not used for the comparison since

there were only 4 horses in the previous study). The differences in the mutant A-allele

frequencies between the two studies could possibly be explained by a different

classification of the horse groups and possibly the relatedness among the horses differ

between the two studies (Promerová et al., 2014).



79

In the current study, the mutant A-allele of the DMRT3 gene was significantly associated

(P=2.2 x10-16) with the horses’ ability to perform the paso fino gait, where it seems like the

AA genotype is required for a horse to perform this gait. In our sample, the mutation was

fixed in the CPF group and it was found in low frequencies in the other horse groups. The

high frequency of the mutation in the CPF group could be explained by a high artificial

selection pressure in the CPF horses, considering that the paso fino horses were separated

from the trocha and trot horses in competitions already in the 1980´s (Fedequinas, personal

communication), and the breeders have been selecting horses with a clear paso fino gait.

On the other hand, it seems to be a selection against the DMRT3 AA genotype in horses

performing the trocha and Colombian trot. The selection of the trocha gait appears favoring

the CC genotype indicating that DMRT3 is likely not the most important gene responsible

for controlling the lateral footfall pattern in this gait. In addition, similar results have been

found in the Mangalarga marchador horse breed in Brazil (Patterson et al., 2015). Although

the CC genotype appears to be the most favorable for the trocha gait, there were a few

horses with the CA genotype. The presence of the A-allele in horses performing the trocha

and Colombian trot gaits could possibly be explained by the fact that all CHP horses share

a common origin (Fedequinas, 2006), and that there has not been enough time since the

gait selection started, for the A-allele to completely disappear from the population of horses

performing the trocha and trot gait. Also, there was a tendency where the CA genotype

partly explains the horses’ ability to perform a clear footfall pattern in the trocha gait

(P=0.002; Table 3-6), however this hypothesis must be further explored.

The ambivalent position of the trocha gait is interesting. Based on the kinematic

measurements, the trocha gait is closer to the paso fino gait than to the trot gait (Figure 3-

6), and the trocha gait is not explained by the DMRT3 mutant A-allele as it is for the paso

fino gait (Table 3-5). Since the trocha gait is classified as a stepping gait, with a lateral

sequence footfall pattern in diagonal couplets (Nicodemus & Clayton, 2003), two options

are proposed to explain the nature of the trocha gait. The first hypothesis is that the trocha

gait is an artificial gait (not inherited but conditioned by training) and could be considered

as a dissociation from trot. The second hypothesis is that the trocha gait is a natural gait

(inherited), and that there are other genes that explain this gait.


According to the first hypothesis, a previous study (Hobbs, Bertram & Clayton, 2016)

showed that “at moderate speeds individual horses use dissociation patterns that allow

them to maintain trunk pitch stability through management of the cranio-caudal location of

the COP” (center of pressure), (Hobbs et al., 2016). Those dissociations may have

mechanical advantages over synchronous contacts in certain circumstances, and as

trotting speed increases, forelimb vertical peak force increases, and dissociations tend

towards hind-first (Hobbs et al., 2016), but no to fore-first dissociations, which is the case

for the trocha gait. In addition, similar results have been found in Icelandic horses when the

speed increases. In that circumstance, the tölt gait tends towards lateral couplets (hind-

first), but tölt with diagonal couplets was rarely presented (Zips et al., 2001). Therefore, it

seems that a gait with diagonal couplets or fore-first pattern (as the trocha gait), is not

completely explained as a dissociation from trot or a deviation from a lateral couplet gait as

the tölt gait is in Icelandic horses.

Regarding the second hypothesis, additional data provided by Fedequinas was analyzed,

consisting of 2919 horses whose parents and grandparents all performed the trocha gait,

all of them parentage tested. The registers showed that 94.75% of those 2919 offspring

had the ability to perform the trocha gait, supporting the idea that the trocha is an inherited

gait. Furthermore, there are other gaits like the foxtrot (Missouri fox trotter) and the marcha

batida (Mangalarga marchador) gaits which have been described with the same footfall

pattern as the trocha gait. However, in contrast to horses performing the trocha gait, the

DMRT3 mutant A-allele is fixed in horses performing foxtrot (100% vs 1% in horses

performing the trocha gait) (Promerová et al., 2014). On the other hand, the DMRT3 C-

allele is fixed in horses performing the marcha batida gait as well as in horses performing

the trocha gait, and a recent study proposed that there are likely other genetic mechanisms

that explain the marcha batida gait (Fonseca et al., 2017). This also support the hypothesis

that the trocha is an inherited gait, and that there are other genes than DMRT3, or other

mutations in the DMRT3 gene, that influences these diagonally stepping gaits in horses.

3.6 Conclusions The gaits within the CPH breed can be classified in different groups, using both kinematic

data (stride frequency, fetlock extension and flexion, tarsal flexion, carpal flexion, fetlock

front and hock speed measurements, and footfall pattern) and genetic data (microsatellite



81

and DMRT3 genotype frequencies). This makes possible to implement genetic

improvement programs and to establish kinematic parameters for each gait. Our data

supports the hypothesis that the selection has produced kinematic differences between the

Colombian paso horse’s gaits, particularly between the Colombian trot and the other gaits

(the paso fino and trocha gait). Also, the DMRT3 mutation seems to explain the horses’

ability to perform the paso fino gait but not the other diagonal coupled gaits (trocha and

Colombian trot). However, there were no microsatellite or DMRT3 genotype differences

between horses performing the trocha and the Colombian trot gait. We propose that trocha

is an inherited gait and its ambivalent position could be explained by other genes than the

DMRT3 gene, or other mutations in this gene, that influences this diagonally stepping gait.

Therefore, it is very likely that other genetic factors are involved in regulating the trocha and

the Colombian trot gaits in CPH horses. Finally, this study may serve as a foundation for

implementing a genetic selection program in the Colombian paso horse and future gene

discovery studies for locomotion pattern in horses.

3.7 Acknowledgments We want to thank the Federación Nacional de Asociaciones Equinas - Fedequinas for

providing the pedigree, kinematic and microsatellite data, and their support during the last

years. Also, we want to thank to Mr. Héctor Barriga for providing the supporting videos. We

want to thank the anonymous reviewers for their constructive and valuable comments.

4. Chapter 3. Conclusions and recommendations

4.1 Conclusions The general objective of this study was “To evaluate whether the Colombian paso horse is

a breed based on genetic and phenotypic evidence.”, and it was accomplished. The

analyses of genetic, phenotypic and phylogenetic data of the CPH, evidenced that a single

CPH breed became two different breeds: the Colombian paso fino horse breed and the

Colombian trocha and trot horse breed. The emergence of these recent breeds has likely

arisen from intensive selection on gait and conformation traits during at least the last 50

years. Therefore, the present study is the first to evidence a breed formation process

tracking back the allelic frequencies’ changes across several generations of the population.

In addition, the first specific objective was “To define the genetic structure of the Colombian

paso horse.”, which was achieved. Our data support the hypothesis that the genetic

substructure of the CPH have been increasing during the last 3 generations/decades which

led to a consolidation of 2 different breeds.

The second specific objective was “To demonstrate Mendelian inheritance and differences

of the Colombian paso horse gaits.” which was succeeded. Our analyses support the

hypothesis that the gaits within the CPH breed can be classified in different groups, using

both kinematic data (stride frequency, fetlock extension and flexion, tarsal flexion, carpal

flexion, fetlock front and hock speed measurements, and footfall pattern) and genetic data

(microsatellite and DMRT3 genotype frequencies). This makes possible to implement


genetic improvement programs and to establish kinematic parameters for each gait. Our

data supports the hypothesis that selection has produced kinematic differences between

the Colombian paso horse’s gaits, particularly between the Colombian trot and the other

gaits (the paso fino and trocha gait). Also, the DMRT3 mutation seems to explain the

horses’ ability to perform the paso fino gait (the mutation is fixed in this group) but not the

other diagonal coupled gaits (trocha and Colombian trot). However, there were no

microsatellite or DMRT3 genotype differences between horses performing the trocha and

the Colombian trot gait. We propose that trocha is an inherited gait and its ambivalent

position could be explained by other genes different than DMRT3, or other mutations in this

gene that could influence this diagonally stepping gait. Therefore, it is very likely that other

genetic factors are involved in regulating the trocha and the Colombian trot gaits in CPH

horses.

The third and last specific objective was “To infer the evolutionary history of the Colombian

paso horse.”, which was partly attained. The evolutionary history in horses is a complex

scenario, where it is possible that domestic horse populations were continuously restocked

by wild mares taken from a wide geographical area, as it has been proposed by several

studies (Jansen et al., 2002; Lira et al., 2010; Librado et al., 2016, 2017), so to infer the

evolutionary history of any horse breed is not so easily to infer. Throughout phylogenetic

analyses, we showed partly the history of the CPH, supporting the uniqueness of these

horses. The high mitochondrial diversity of the CPH is comparable with old well-established

breeds as Thoroughbred, Icelandic horses, Lusitano, Pura Raza Española and others,

which evidence the complexity of several possible breed origins in the CPH, as well as

reflect the evolutionary history of horses which involved a massive incorporation of maternal

lines, possibly through recurrent restocking of wild mares (Librado et al., 2016). The CPH

haplotypes belonged to most of the haplogroups described in horses, particularly Iberian

ones. Also, there were haplotypes which belonged to some Mediterranean horse breeds

(i.e. Italian Maremmano) and Asian, middle east and, at low frequency, to south Europe

horse breeds (i.e. Arabian, Akhal-Teke, Syrian, and Italian horse breeds).

Conclusions 85

The haplotypes CPH20 and CPH21 found in this study do belong to an ancestral

haplogroup from Neolithic and Bronze age period, which was present in few horses of a

couple of breeds (Lopes et al., 2005; Lira et al., 2010). Interestingly, the haplotype CPH20

and CPH21 was found in 12 horses (6%) and are grouped with other ibero-american

haplotypes, confirming the hypothesis which some Iberian ancestral haplotypes persisting

in modern American horse breeds (Lira et al., 2010).

4.2 Recomendations

This study is an opportunity to monitor the breed formation as an ongoing process which

will be followed in additional generations (i.e. 2016-2025). Also, additional genetic and

phenotypic data could support this breed formation process in future studies, i.e. genomic

data, DNA mitochondrial haplotype frequencies, Y chromosome markers, and other

phenotypic traits as reproductive, physiological, and performance parameters, etc. In

particular, it would be interesting to look at differences between CPH breeds on other

important genetic variants in horses as coat color (MC1R), performance (MSTN), and size

(IGF1, NCAPG, and HMGA2) (Petersen et al., 2013b). In addition, those studies could

reveal possible effects of selective sweeps at genomic scale in these breeds, and also

reveal genetic bases of a recent breed formation process: i.e. genes related with

reproductive isolation, the genetic differences in recent breeds could be more related with

non-coding sequences with regulatory gene functions, than coding sequences of genes, as

evidenced between equid species (Librado et al., 2016).

About the gaits, it is recommended to evaluate the CPH gaits with other objective

measurements for the footfall patterns, to explore more widely the variation in the CPH gaits

and to avoid possible misclassifications. Furthermore, additional conformation

measurements can be done in future studies in these horse breeds.

A. Appendix: Colombian paso horse gaits

Digital videos in CD: S1 Video. Colombian Paso Fino horse performing paso fino gait. Reprinted with

permission from Héctor Barriga Torres, original copyright [2018].

S2 Video. Colombian Trocha horse performing trocha gait. Reprinted with permission

from Héctor Barriga Torres, original copyright [2018].

S3 Video. Colombian Trot and gallop horse performing Colombian trot gait. Reprinted

with permission from Héctor Barriga Torres, original copyright [2018]. S4 Video. Colombian Trot and gallop horse performing gallop. Reprinted with

permission from Héctor Barriga Torres, original copyright [2018].

References Achilli A., Olivieri A., Soares P., Lancioni H., Hooshiar Kashani B., Perego U. a, et

al. (2012) Mitochondrial genomes from modern horses reveal the major

haplogroups that underwent domestication. Proceedings of the National

Academy of Sciences of the United States of America 109, 2449–54.

Alfaro M.E. (2003) Bayes or Bootstrap? A Simulation Study Comparing the

Performance of Bayesian Markov Chain Monte Carlo Sampling and

Bootstrapping in Assessing Phylogenetic Confidence. Molecular Biology and

Evolution 20, 255–266.

Alfranca I.S. (2001) El concepto de raza: evolución y realidad. 50, 547–564.

Andersson L.L.S., Larhammar M., Memic F., Wootz H., Schwochow D., Rubin C.-

J., et al. (2012a) Mutations in DMRT3 affect locomotion in horses and spinal

circuit function in mice. Nature 488, 642–6.

Andersson L.S., Larhammar M., Memic F., Wootz H., Schwochow D., Rubin C.-J.,

et al. (2012b) Mutations in DMRT3 affect locomotion in horses and spinal

circuit function in mice. Nature 488, 642–6.

Back W. & Clayton H.M. (2013) Equine Locomotion. Elsevier Health Sciences UK.

Bailey E. & Brooks S.A. (2013) Horse Genetics, 2nd edn. (Ed. S. Hulbert), CABI,

Boston, MA.

Bandelt H.J., Forster P. & Röhl A. (1999) Median-joining networks for inferring

intraspecific phylogenies. Molecular biology and evolution 16, 37–48.

Barrey E. (2013) Gaits and interlimb coordination. In: Equine locomotion, Second.

(Eds W. Back & H.M. Clayton), pp. 85–97. Saunders Elsevier.


Bartolomé E., Milho S. & Prazeres J. (2019) Genealogical and morphological

analysis of Lusitano Purebred horses participating at international Dressage

competitions. Research in Veterinary Science 122, 124–131.

Baum D. & Smith S. (2013) Tree Thinking: An Introduction to Phylogenetic

Biology, 1 st. Roberts and Company Publishers, Greenwood Village, Colo.

Bennett D. (2014) THE ORIGIN OF HORSE BREEDS. Equus, 49–65.

Bennett D. & Hoffmann R.S. (1999) Equus caballus. Mammalian species 628, 1–

14.

Bowling A.T. & Clark R.S. (2009) Blood group and protein polymorphism gene

frequencies for seven breeds of horses in the United States. Animal Blood

Groups and Biochemical Genetics 16, 93–108.

Bowling A.T. & Ruvinsky A. (2000) The Genetics of the Horse, 1st. (Eds A.T.

Bowling & A. Ruvinsky), CABI.

Carter A. & Cox E. (1982) Sheep breeds in New Zealand. Sheep production 1,

11–38.

Chowdhary B. (2013) Defining the equine genome: The nuclear genome and the

mitochondrial genome, 1 st.naran. (Ed. B. Chowdhary), John Wiley & Sons

Inc.

Clayton H.M. & Bradbury J.W. (1995) Temporal characteristics of the fox trot, a

symmetrical equine gait. Applied Animal Behaviour Science 42, 153–159.

Colino-Rabanal V.J., Rodríguez-Díaz R., Blanco-Villegas M.J., Peris S.J. & Lizana

M. (2018) Human and ecological determinants of the spatial structure of local

breed diversity. Scientific Reports 8, 1–10.

Cortés O., Dunner S., Gama L.T., Martínez A.M., Delgado J.V., Ginja C., et al.

(2017) The legacy of Columbus in American horse populations assessed by

microsatellite markers. Journal of Animal Breeding and Genetics 134, 340–

350.

Cothran E.G., Canelon J.L., Luis C., Conant E. & Juras R. (2011) Genetic analysis

of the Venezuelan Criollo horse. funpecrp.com.br Genetics and Molecular

Research Genet. Mol. Res 10, 2394–2403.

Bibliografía 91

Darriba D., Taboada G.L., Doallo R. & Posada D. (2012) jModelTest 2: more

models, new heuristics and parallel computing. Nature methods 9, 772.

Dobzhansky T. (1941) Genetics and the origin of species. Columbia University

Press, Nueva York.

Dovc P., Kavar T., Sölkner H. & Achmann R. (2006) Development of the Lipizzan

horse breed. Reproduction in domestic animals = Zuchthygiene 41, 280–5.

Estoup A. & Cornuet J.M. (1999) Microsatellite evolution: inferences from

population data. In: Microsatellites: Evolution and Applications. (Eds G. D.B.

& S. C.), pp. 49–65. Oxford University press, Oxford.

Excoffier L. & Lischer H. (2010) Arlequin suite ver 3.5: a new series of programs to

perform population genetics analyses under Linux and Windows. Molecular

ecology resources 10, 564–567.

Falconer D.S. & Mackay T.F.C. (1996) Introduction to Quantitative Genetics, 4 th.

Longman, New York.

FAO (1999) The Global Strategy for the Management of Farm Animal Genetic

Resources. ROME.

Farris J.S. (1970) Methods for Computing Wagner Trees. Systematic Biology 19,

83–92.

Fedequinas (2006) El caballo colombiano. Cinco siglos de historia., 1era edn. (Ed.

F. Gómez), Imprelibros S.A., Bogotá, Colombia.

Felsenstein J. (1981) Evolutionary trees from DNA sequences: a maximum

likelihood approach. Journal of molecular evolution.

Finno C.J., Spier S.J. & Valberg S.J. (2009) Equine diseases caused by known

genetic mutations. Veterinary Journal 179, 336–347.

Fitch W.M. (1971) Toward Defining the Course of Evolution: Minimum Change for

a Specific Tree Topology. Systematic Biology 20, 406–416.

Fonseca M.G., Ferraz G.C., Lage J., Pereira G.L. & Curi R.A. (2017) A Genome-

Wide Association Study Reveals Differences in the Genetic Mechanism of

Control of the Two Gait Patterns of the Brazilian Mangalarga Marchador

Breed. Journal of Equine Veterinary Science 53, 64–67.


Forsten A. (1989) Horse diversity through the ages. Biological Reviews 64, 279–

304.

Fox J., Weisberg S., Adler D., Bates D., Baud-Bovy G., Ellison S., et al. (2014)

Companion to Applied Regression. R package version 2.0-20. Available at:

http://CRAN.R-project.org/package=car.

Freeman S. & Herron J. (2007) Evolutionary analysis, 4th. (Ed. G. A), Pearson

Prentice Hall., Upper Saddle River, NJ:

Friendly M. (2007) HE plots for multivariate linear models. Journal of

Computational and Graphical Statistics 16, 421–444.

Friendly M. & Fox J. (2013) Visualizing Generalized Canonical Discriminant and

Canonical Correlation Analysis. R package version 0.6-5. http://CRAN.R-

project.org/package=candisc.

Futuyma D.J. (2013) Evolution, 3rd edn. Sinauer Associates, Incorporated.

Gastwirth J.L., Gel Y.R., Hui W.L.W., Lyubchich V., Miao W. & Noguchi K. (2013)

An R package for biostatistics, public policy, and law. R package version

2.4.1. Available at: http://CRAN.Rproject. org/package=lawstat.

George M. & Ryder O. (1986) Mitochondrial DNA evolution in the genus Equus.

Molecular biology and evolution 3, 535–46.

van de Goor L.H.P., Panneman H. & van Haeringen W. a (2010) A proposal for

standardization in forensic equine DNA typing: allele nomenclature for 17

equine-specific STR loci. Animal genetics 41, 122–7.

Goulding M. (2009) Circuits controlling vertebrate locomotion: moving in a new

direction. Nature reviews. Neuroscience 10, 507–18.

Graur D. & Li W. (1999) Fundamentals of molecular evolution, 2nd edn. (Ed. A.D.

Sinauer), Sinauer Associates, Incorporated.

Griffiths A.J.F. (2002) Modern Genetic Analysis: Integrating Genes and Genomes.

W. H. Freeman.

Groeneveld E., Westhuizen B., Maiwashe A. & Voordewind F. (2009) POPREP : a

generic report for population management. Genetics and Molecular Research

8, 1158–1178.

Bibliografía 93

Guindon S. & Gascuel O. (2003) A Simple, Fast, and Accurate Algorithm to

Estimate Large Phylogenies by Maximum Likelihood. Systematic Biology 52,

696–704.

Guisande C., Vaamonde A. & Barreiro A. (2014) RWizard software. v 1.0.

Available: http://www.ipez.es/RWizard.

Hardy G. (1908) Mendelian Proportions in a Mixed Population. Proceedings of the

Royal Society of Medicine XXVIII, 49–50.

Hedrick P.W. (2011) Genetics of Populations, 4 th. Jones & Bartlett Publishers.

Hendricks B. Lou (2007) International encyclopedia of horse breeds. University of

Oklahoma Press.

Hill E.W., Gu J., Eivers S.S., Fonseca R.G., McGivney B. a, Govindarajan P., et

al. (2010) A sequence polymorphism in MSTN predicts sprinting ability and

racing stamina in thoroughbred horses. PloS one 5, e8645.

Hinkle D.E., Wiersma W. & Jurs S.G. (2003) Applied statistics for the behavioral

sciences.

Hobbs S.J., Bertram J.E.A. & Clayton H.M. (2016) An exploration of the influence

of diagonal dissociation and moderate changes in speed on locomotor

parameters in trotting horses. PeerJ 4, e2190.

Hong C.S., Park B.Y. & Saint-Jeannet J.P. (2007) The function of Dmrt genes in

vertebrate development: It is not just about sex. Developmental Biology 310,

1–9.

Hothorn T., Bretz F., Westfall P., Heiberger R. & Schuetzenmeister A. (2014)

Simultaneous Inference in General Parametric Models. R package version

1.3-3. Available at: http://CRAN.Rproject. org/package=multcomp.

Huson D.H. & Bryant D. (2006) Application of phylogenetic networks in

evolutionary studies. Molecular biology and evolution 23, 254.

Ishida N., Hasegawa T., Takeda K., Sakagami M., Onishi A., Inumaru S., et al.

(1994) Polymorphic sequence in the D-loop region of equine mitochondrial

DNA. Animal genetics 25, 215–21.

Ishihara A., Reed S.M., Rajala-Schultz P.J., Robertson J.T. & Bertone A.L. (2009)


Use of kinetic gait analysis for detection, quantification, and differentiation of

hind limb lameness and spinal ataxia in horses. Journal of the American

Veterinary Medical Association 234, 644–51.

Jäderkvist Fegraeus K., Johansson L., Maenpaa M., Mykkanen A., Andersson

L.S., Velie B.D., et al. (2015) Different DMRT3 genotypes are best adapted

for harness racing and riding in finnhorses. Journal of Heredity 106, 734–740.

Jäderkvist Fegraeus K., Lawrence C., Petäjistö K., Johansson M.K., Wiklund M.,

Olsson C., et al. (2017) Lack of significant associations with early career

performance suggest no link between the DMRT3 “Gait Keeper” mutation and

precocity in Coldblooded trotters. PLoS ONE 12, 1–10.

Jäderkvist K., Andersson L.S., Johansson A.M., Árnason T., Mikko S., Eriksson

S., et al. (2014) The DMRT3 ‘Gait keeper’ mutation affects performance of

Nordic and Standardbred trotters. Journal of Animal Science 92, 4279–4286.

Jansen T., Forster P., Levine M. a, Oelke H., Hurles M., Renfrew C., et al. (2002)

Mitochondrial DNA and the origins of the domestic horse. Proceedings of the

National Academy of Sciences of the United States of America 99, 10905–10.

Jimenez L.M., Mendez S., Dunner S., Cañón J. & Cortés O. (2012) Colombian

Creole horse breeds: Same origin but different diversity. Genetics and

molecular biology 35, 790–6.

Jombart T. & Ahmed I. (2011) adegenet 1.3-1: new tools for the analysis of

genome-wide SNP data. Bioinformatics (Oxford, England) 27, 3070–1.

Jombart T., Devillard S. & Balloux F. (2010) Discriminant analysis of principal

components: a new method for the analysis of genetically structured

populations. BMC Genetics 11, 94.

Jukes T.H. & Cantor C. (1969) Evolution of protein molecules. In: Mammalian

protein metabolism. (Ed. H. Munro), pp. 21–132. Academic Press, New York,

NY.

Kalbfleisch T.S., Rice E.S., DePriest M.S., Walenz B.P., Hestand M.S.,

Vermeesch J.R., et al. (2018) Improved reference genome for the domestic

horse increases assembly contiguity and composition. Communications

Bibliografía 95

Biology 1, 197.

Keegan K.G. (2007) Evidence-Based Lameness Detection and Quantification.

Veterinary Clinics of North America - Equine Practice 23, 403–423.

Kelchner S. a & Thomas M. a (2007) Model use in phylogenetics: nine key

questions. Trends in ecology & evolution 22, 87–94.

Khanshour A., Conant E., Juras R. & Cothran E.G. (2013) Microsatellite analysis

of genetic diversity and population structure of Arabian horse populations.

The Journal of heredity 104, 386–98.

Kimura M. (1980) A simple method for estimating evolutionary rates of base

substitutions through comparative studies of nucleotide sequences. Journal of

Molecular Evolution 16, 111–120.

Köhler-Rollefson I. (1997) Indigenous practices of animal genetic resource

management and their relevance for the conservation of domestic animal

diversity in developing countries. Journal of animal breeding and genetics =

Zeitschrift für Tierzüchtung und Züchtungsbiologie 114, 231–8.

Kramer J. & Keegan K.G. (2014) Kinematics of lameness, Second Edi. Elsevier

Ltd.

Kristjansson T., Bjornsdottir S., Sigurdsson A., Andersson L.S., Lindgren G.,

Helyar S.J., et al. (2014) The effect of the “Gait keeper” mutation in the

DMRT3 gene on gaiting ability in Icelandic horses. Journal of Animal

Breeding and Genetics 131, 415–425.

Lemey P., Salemi M. & Vandamme A. eds (2009) The Phylogenetic Handbook: A

Practical Approach to Phylogenetic Analysis and Hypothesis Testing, 1 st.

Cambridge University Press.

Librado P., Fages A., Gaunitz C., Leonardi M., Wagner S., Khan N., et al. (2016)

The evolutionary origin and genetic makeup of domestic horses. Genetics

204, 423–434.

Librado P., Gamba C., Gaunitz C., Der Sarkissian C., Pruvost M., Albrechtsen A.,

et al. (2017) Ancient genomic changes associated with domestication of the

horse. Science 356, 442–445.


Lio P. & Goldman N. (1998) Models of Molecular Evolution and Phylogeny.

Genome Res. 8, 1233–1244.

Lippold S., Matzke N.J., Reissmann M. & Hofreiter M. (2011) Whole mitochondrial

genome sequencing of domestic horses reveals incorporation of extensive

wild horse diversity during domestication. BMC evolutionary biology 11, 328.

Lira J., Linderholm A., Olaria C., Brandström Durling M., Gilbert M.T.P., Ellegren

H., et al. (2010) Ancient DNA reveals traces of Iberian Neolithic and Bronze

Age lineages in modern Iberian horses. Molecular ecology 19, 64–78.

Lopes M.S., Mendonça D., Cymbron T., Valera M., da Costa-Ferreira J. &

Machado a D.C. (2005) The Lusitano horse maternal lineage based on

mitochondrial D-loop sequence variation. Animal genetics 36, 196–202.

Luis C., Bastos-Silveira C., Cothran E.G., Oom M.D.M.D.M. & Luís C. (2006)

Iberian Origins of New World Horse Breeds. Journal of Heredity 97, 107–113.

McCue M.E., Bannasch D.L., Petersen J.L., Gurr J., Bailey E., Binns M.M., et al.

(2012) A high density SNP array for the domestic horse and extant

Perissodactyla: utility for association mapping, genetic diversity, and

phylogeny studies. PLoS genetics 8, e1002451.

Mendel G. (1866) Versuche über Plflanzenhybriden. Verhandlungen des

naturforschenden Vereines in Brünn 4, 3–47.

Mirol P.M., Peral García P., Vega-Pla J.L. & Dulout F.N. (2002) Phylogenetic

relationships of Argentinean Creole horses and other South American and

Spanish breeds inferred from mitochondrial DNA sequences. Animal genetics

33, 356–63.

Naranjo S.E. (2012) Evaluación citogenética del Caballo Criollo Colombiano.

Thesis dissertation. Universidad Nacional de Colombia. Universidad Naciona

de Colombia - Sede Medellín.

Nicodemus M.C. & Clayton H.M. (2003) Temporal variables of four-beat, stepping

gaits of gaited horses. Applied Animal Behaviour Science 80, 133–142.

Novoa-Bravo M., Jäderkvist K., Rhodin M., Strand E., García L.F. & Lindgren G.

(2018) Selection on the Colombian paso horse’s gaits has produced

Bibliografía 97

kinematic differences partly explained by the DMRT3 gene. PLoS ONE 13,

e0202584.

Novoa-Bravo M.A. (2010) Genetic differences among Colombian zebu cattle

breeds (Bos taurus indicus) by microsatellites and genealogical data. - Effects

of sampling strategies for estimating population genetic parameters in

domestic species. Universidad Nacional de Colombia.

Novoa M.A. & García L.F. (2016) Genetic differences in a Colombian Paso horse

breed by gait selection. Journal of Animal Science 94, 113.

Orlando L., Ginolhac A., Zhang G., Froese D., Albrechtsen A., Stiller M., et al.

(2013) Recalibrating Equus evolution using the genome sequence of an early

Middle Pleistocene horse. Nature 499, 74–8.

Parsons K.J., Pfau T. & Wilson A.M. (2008) High-speed gallop locomotion in the

Thoroughbred racehorse . I . The effect of incline on stride parameters. 935–

944.

Patterson L., Staiger E.A. & Brooks S.A. (2015) DMRT3 is associated with gait

type in Mangalarga Marchador horses, but does not control gait ability.

Animal genetics 46, 213–5.

Petersen J.L., Mickelson J.R., Cleary K.D. & McCue M.E. (2014) The American

Quarter Horse: population structure and relationship to the thoroughbred. The

Journal of heredity 105, 148–62.

Petersen J.L., Mickelson J.R., Cothran E.G., Andersson L.S., Axelsson J., Bailey

E., et al. (2013a) Genetic diversity in the modern horse illustrated from

genome-wide SNP data. PloS one 8, e54997.

Petersen J.L., Mickelson J.R., Rendahl A.K., Valberg S.J., Andersson L.S.,

Axelsson J., et al. (2013b) Genome-wide analysis reveals selection for

important traits in domestic horse breeds. PLoS genetics 9, e1003211.

Pfau T., Fiske-Jackson A. & Rhodin M. (2016) Quantitative assessment of gait

parameters in horses: Useful for aiding clinical decision making? Equine

Veterinary Education 28, 209–215.

Pinto L.F.B., Almeida F.Q. de, Quirino C.R., de Azevedo P.C.N., Cabral G.C.,


Santos E.M., et al. (2008) Evaluation of the sexual dimorphism in Mangalarga

Marchador horses using discriminant analysis. Livestock Science 119, 161–

166.

Posada D. & Crandall K.A. (2001) Intraspecific gene genealogies : trees grafting

into networks. Trends in Ecology & Evolution 16, 37–45.

Pritchard J.K., Stephens M. & Donnelly P. (2000) Inference of population structure

using multilocus genotype data. Genetics 155, 945–959.

Promerová M., Andersson L.S., Juras R., Penedo M.C.T., Reissmann M., Tozaki

T., et al. (2014) Worldwide frequency distribution of the “Gait keeper”

mutation in the DMRT3 gene. Animal genetics 45, 274–82.

R Core team 2016 (2016) R: A language and environment for statistical

computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-

900051-07-0. http:// www.R-project.org., 900051.

Raudsepp T., Kata S.R., Piumi F., Swinburne J., Womack J.E., Skow L.C., et al.

(2002) Conservation of gene order between horse and human X

chromosomes as evidenced through radiation hybrid mapping. Genomics 79,

451–7.

Raymond M. & Rousset F. (1995) GENEPOP (version 1.2): population genetics

software for exact tests and ecumenicism. Journal of heredity 86, 248–249.

Rege J.E.O. (2001) Defining livestock breeds in the context of community-based

management of farm animal genetic resources. In: COMMUNITY-BASED

MANAGEMENT OF ANIMAL GENETIC RESOURCES. FAO, Mbabane,

Swaziland.

Rhodin M., Egenvall A., Andersen P.H. & Pfau T. (2017) Head and pelvic

movement asymmetries at trot in riding horses in training and perceived as

free from lameness by the owner. PLoS ONE 12, 1–16.

Ricard A. (2015) Does heterozygosity at the DMRT3 gene make French trotters

better racers? Genetics, selection, evolution : GSE 47, 10.

Ripley B., Venables B., Bates D., Hornik K. & Ripley M. (2014) Support Functions

and Datasets for Venables and Ripley’s MASS. R package version 7.3-33.

Bibliografía 99

Available at: http://CRAN.R-project.org/package=MASS.

Robilliard J.J., Pfau T. & Wilson A.M. (2007) Gait characterisation and

classification in horses. The Journal of Experimental Biology 210, 187–97.

Rodero A., Delgado J. V & Rodero E. (1992) Primitive Andalusian livestock and

their implications in te discovery of America. 41, 383–400.

Rodero E. & Herrera M. (2000) El concepto de raza. Un enfoque epistemológico.

Archivos De Zootecnia 49, 5–16.

Ronquist F., Teslenko M., van der Mark P., Ayres D.L., Darling A., Höhna S., et al.

(2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model

choice across a large model space. Systematic biology 61, 539–42.

Rousset F. (2008) genepop’007: a complete re-implementation of the genepop

software for Windows and Linux. Molecular ecology resources 8, 103–6.

Schaefer R.J., Schubert M., Bailey E., Bannasch D.L., Barrey E., Bar-Gal G.K., et

al. (2017) Developing a 670k genotyping array to tag ~2M SNPs across 24

horse breeds. BMC genomics 18, 565.

Sole M., Cervantes I., Gutierrez J.P., Gomez M.D. & Valera M. (2014) Estimation

of genetic parameters for morphological and functional traits in a Menorca

horse population. Spanish Journal of Agricultural Research 12, 125–132.

Strucken E.M., Lee S.H., Jang G.W., Porto-Neto L.R. & Gondro C. (2015)

Towards breed formation by island model divergence in Korean cattle. BMC

Evolutionary Biology 15, 284.

Tamura K. & Nei M. (1993) Estimation of the number of nucleotide substitutions in

the control region of mitochondrial DNA in humans and chimpanzees.

Molecular biology and evolution 10, 512–526.

Venables W. & Ripley B. (2002) Modern applied statistics with S, 4 th. Springer.

Vila C., Leonard J. a, Gotherstrom A., Marklund S., Sandberg K., Liden K., et al.

(2001) Widespread origins of domestic horse lineages. Science (New York,

N.Y.) 291, 474–7.

Wade C.M., Giulotto E., Sigurdsson S., Zoli M., Gnerre S., Imsland F., et al.

(2009a) Genome sequence, comparative analysis, and population genetics of


the domestic horse. Science (New York, N.Y.) 326, 865–7.

Wade C.M., Giulotto E., Sigurdsson S., Zoli M., Gnerre S., Imsland F., et al.

(2009b) Genome Sequence, Comparative Analysis, and Population Genetics

of the Domestic Horse. Science 326, 865–867.

Wallner B., Palmieri N., Vogl C., Rigler D., Bozlak E., Druml T., et al. (2017) Y

Chromosome Uncovers the Recent Oriental Origin of Modern Stallions.

Current Biology 27, 2029–2035.e5.

Weir B.S. & Cockerham C.C. (1984) Estimating F-Statistics for the Analysis of

Population Structure. Evolution 38, 1358–1370.

Wilson D.E. & Reeder D.M. eds (2005) Mammal Species of the World: A

Taxonomic and Geographic Reference, Volume 12, 3rd edn. JHU Press.

Xu X. & Arnason U. (1994) The complete mitochondrial DNA sequence of the

horse, Equus caballus: extensive heteroplasmy of the control region. Gene

148, 357–62.

Yamanobe A., Hiraga A. & Kubo K. (1992) Relationships between Stride

Frequency, Stride Length, Step Length and Velocity with Asymmetric Gaits in

the Thoroughbred Horse. Japanese Journal of Equine Science 3, 143–148.

Zechner P., Zohman F., Sölkner J., Bodo I., Habe F., Marti E., et al. (2001)

Morphological description of the Lipizzan horse population. Livestock

Production Science 69, 163–177.

Zips S., Peham C., Scheidl M., Licka T. & Girtler D. (2001) Motion pattern of the

toelt of Icelandic horses at different speeds. Equine veterinary journal.

Supplement 33, 109–111.

genética del caballo colombiano de paso, filogenia

Documents