great dane x mexican chihuahua

32
Great Dane x Mexican Chihuahua F1 Big (Great Danes) 3 Big : 1 Small

Upload: carney

Post on 24-Feb-2016

40 views

Category:

Documents


2 download

DESCRIPTION

Great Dane x Mexican Chihuahua. F1 Big (Great Danes). 3 Big : 1 Small. The Genius of Mendel. Highly inbred strains of peas Differed by single character. Round x Wrinkled (WT x mutant) F1 All Round F2 5474 Round 1850 Wrinkled 2.96:1 (3:1) Needs Statistics. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Great Dane x Mexican Chihuahua

Great Dane x Mexican Chihuahua

F1 Big (Great Danes)

3 Big : 1 Small

Page 2: Great Dane x Mexican Chihuahua

The Genius of Mendel

• Highly inbred strains of peas

• Differed by single character

Round x Wrinkled (WT x mutant)

F1 All Round

F2 5474 Round 1850 Wrinkled

2.96:1 (3:1)

Needs Statistics

Page 3: Great Dane x Mexican Chihuahua
Page 4: Great Dane x Mexican Chihuahua

Mapping in Drosophila

Ly Sb br

+ + +

Page 5: Great Dane x Mexican Chihuahua

Lots of variation in people

There must be a genetic component

How do we assign “traits” to genes?

Ultimately want a molecular description

Start with inherited diseases

Page 6: Great Dane x Mexican Chihuahua
Page 7: Great Dane x Mexican Chihuahua

Pedigrees……Mendel’s First Law

Autosomal Dominant Disorder

Page 8: Great Dane x Mexican Chihuahua

Autosomal Recessive

Disease is apparent because of consanguinity (III 5 &6)

Page 9: Great Dane x Mexican Chihuahua
Page 10: Great Dane x Mexican Chihuahua
Page 11: Great Dane x Mexican Chihuahua
Page 12: Great Dane x Mexican Chihuahua
Page 13: Great Dane x Mexican Chihuahua
Page 14: Great Dane x Mexican Chihuahua

Population GeneticsScience of Intraspecific Variation Phenotypic

GENOTYPIC

• Genotypic Variation: Alleles, Polymorphism– Ultimate Source of Variation: Mutation

• Dynamics of Variation during Population History– Changes in Allele Frequencies due to

• Drift

• Selection

– Persistence of Allele Combinations due to Linkage

• Linkage Disequilibrium

Page 15: Great Dane x Mexican Chihuahua

Some Basics 1

GATTACA TGTAATC GATCACA TGTGATC

Allele 1 Allele 2

= GATTACATGTAATC GATCACATGTGATCAllele 1 Allele 2

1. Only refer to one strand, and don’t confuse strands with alleles

2. Context is unimportant (unless we have linkage…next)

Allele 1: T Allele 2: C

AGACAGAAAGGAAAAGAACCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAAGGTGATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAAATACATTGTGAGACAGAAAGGAAAAGAACCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAAGGCGATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAAATACATTGTG

Page 16: Great Dane x Mexican Chihuahua

Some Basics 23. Because mutations are rare events, the vast majority of variation is

BINARY, at the base pair level.

CAAAGGAAAAGAATGCCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAAGGTGATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAAATACATT

CAAAGGAAAAGAATGCCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAAGGCGATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAAATACATT

Allele 1

Allele 2

GAAAGGAAAAGAAGATTTACTTCC[1396bp]GAAGCTCAGAAAGGCGATAATATAAAAAATAT[2502bp]TTGGGAATTTACAGAATAC

Haplotype 3

4. Linkage makes things more complicated but only if you actually care about linkage: Linkage equilibrium/disequilibrium.

GAAAGGAAAAGAAGATTTCCTTCC[1396bp]GAAGCTCAGAAAGGTGATAATATAAAAAATAT[2502bp]TTGGGAATTTACAGAATAC

GAAAGGAAAAGAAGATTTACTTCC[1396bp]GAAGCTCAGAAAGGCGATAATATAAAAAATAT[2502bp]TTGGGAATTTACAAAATAC

2 alleles 2 alleles 2 alleles

Haplotype 2

Haplotype 1

Page 17: Great Dane x Mexican Chihuahua

Some Basics 35. Alleles have frequencies in the population (which sum to 1)

Frequency of Allele 1 (T) = 0.59

Frequency of Allele 2 (C) = 0.41p = 0.59

frequency of major allele

0.35

6. We’ll be talking about diploids, and genotype probabilities (which sum to 1) can be calculated from allele frequencies.(And vice versa; and under certain assumptions)

T,T C,CT,CProb. of having:

0.48 0.17

p2 2pq q2

Page 18: Great Dane x Mexican Chihuahua

What about two different genes?Consider two genes A and B that each have two alleles

A a B b

Allelic frequencies are 0.5

(At the “A” locus A=0.5, a= 0.5)

(At the “B” locus B=0.5 and b=0.5)

For A and a genotype frequencies = p2 +2pq +q2

AA , Aa and aa individuals = 0.25 + 0.5 + 0.25

The same for BB, Bb and bb

How many AA BB individuals are (0.25 x 0.25) aa Bb individuals are (0.25 x 0.50)

Both genes are in “equilibrium”. (Hardy and Weinberg)

Page 19: Great Dane x Mexican Chihuahua

A a

a

A AA Aa

Aa aa

(p + q)2 = p2 +2pq + q2

Hardy Weinberg is the Population Equivalent of the Punnett Square

Page 20: Great Dane x Mexican Chihuahua

Mutation Rate per Generation

How often per generation does this happen?

Average Mutation Rates in Mammals

Point substitution (nuc) 0.5 x 10-8 per base pair

Microdeletion (1-10bp) ~10-9 per base pair

Microinsertion (1-10bp) ~0.5 x 10-9 per base pair

Mobile element ins’n ~10-11

Inversion ?? much rarer

ExceptionsHypermutable sites (CpGs)C->T = 10x avg point rate

Simple Sequence Repeats10-1000x indel rate (some 10-4!)mitochondrial DNA10-100x nuclear point rate

1 generation

Page 21: Great Dane x Mexican Chihuahua

Haploid Human Genome is ~2 x 109 base pairs

Most of the DNA is non-coding

Introns, Intragenic regions, LINES, SINES etc

AT the DNA level, can have tremendous variationath no phenotypic consequenses

Page 22: Great Dane x Mexican Chihuahua

Remember the LacI gene (the repressor)

Nonsense mutations at every codon

Substitute every AA at every position

White means no phenotype

Lesson….most mutations in coding regions are silent

Page 23: Great Dane x Mexican Chihuahua

Drift vs. Selection

• Drift– Change in allele frequencies due to

sampling

• Selection– Change in allele frequencies due to

function

The two forces that determine the fate of alleles in a population

Page 24: Great Dane x Mexican Chihuahua

Genetic Drift

Page 25: Great Dane x Mexican Chihuahua

Gen 0

Gen 19

This is like 107 independent populations

For every bottle: after eggs hatch pick 8 male larvae and 8 female larvae, stick in a new bottle. Repeat for 19 generations.

Page 26: Great Dane x Mexican Chihuahua

Genetic Drift: Size Matters

From Li (1997) Molecular Evolution, Sinauer Press

4 populations

2 at N=25

2 at N=250

Page 27: Great Dane x Mexican Chihuahua

Selection & Fitness

“Absolute Fitness” = “Viability” = # of survivors / total # progeny produced

= P(survival until mean reproductive age)

If Fitness depends on Genotype, then we have (natural) Selection

Page 28: Great Dane x Mexican Chihuahua

Selection vs Drift RecapFrom the perspective of disease severity:Given a particular selection coefficient (picture severity of disease), selection is only effective in a population whose size is large enough to overcome the effect of drift.

From the perspective of population size:Given a particular population size, only alleles that bear a large enough selection coefficient (picture severity of disease) will be strongly selected against.

Page 29: Great Dane x Mexican Chihuahua

A new mutation! (on the "red" chromosome)

Eager geneticist obtains samples from multiple affected individuals

Linkage disequilibrium: the big (and oversimplified) picture

• Small number (maybe one) of ancestral disease-causing mutations

• Isolation of chromosome bearing disease-causing mutation

• "Reasonable" opportunity for recombination during population history

• (Think Finland: 1000 founders 2000 years ago; consistent expansion)

• Few (maybe none) reoccurrences of disease-causing mutation

Page 30: Great Dane x Mexican Chihuahua

LD and time: history at work

Do we care about:

The age of the mutation or the age of the founding population?

Page 31: Great Dane x Mexican Chihuahua

Two common types of DNA variants

Page 32: Great Dane x Mexican Chihuahua

DNA haplotype

• Haplotype = a series of marker alleles on a chromosome (DNA molecule)

• E.g.: DNA sequence, a series of SNPs or microsatellites along a chromosome.