LIFE08 ENV/EE/000358

Guidelines and user manuals for monitoring the environment through the status of the soil microbiome

Table of contest 1. Introduction

1.1. Background 1.2. General methodical approach and the application workflow 1.3. Output

2. Methodical approaches 2.1. Sample collection and pre-analysis handling 2.2. Indicator species determination 2.3. Guidelines for primer design and selection for qPCR 2.4. qPCR guidelines 3. Determination of the score of anthropogenic pressure (Pscore) 4. Assessment of the environment according to the monitoring results 5. Appendices Appendix I Manual 1. Collection of soil samples for metageneomic analysis of

microbiome diversity. Appendix II Manual 2. Storage of soil samples over a longer period. Appendix III Manual 3. Preparation of soil samples for DNA purification. Appendix IV Manual 4. Purification of total DNA from soil samples Appendix V Table 1. Primer sets for the BIOTAGENE method 1. Introduction 1.1. Background Current guidelines and user manuals for BIOTAGENE method are a result of a LIFE+ Project LIFE08 ENV/EE/000258 “Elaboration of novel metageneomic method for environmental monitoring” carried out at Tallinn University of Technology Centre for Biology of Integrated Systems (CBIS) between January 2010 and July 2012. The project has been a further development of the research activities carried out at CBIS since 2007, dealing with the application of metageneomic approaches upon environmental monitoring. The aim of the activities under the current project was to elaborate a generally applicable cost-effective methodical approach usable in environmental screening to evaluate the degree of anthropogenic pressure based on metageneomic analysis of the corresponding changes in the community of soil microorganisms. The starting point in the BIOTAGENE method development has

1

LIFE08 ENV/EE/000358 been the general approach of identification and quantification of the members of the soil microbiome by means of high through put highly parallel 454 pyrosequncing allowing to collect corresponding information for thousands of the community members at a time. It is quite clear that although this kind of an approach provides the most detailed and informative data achievable, it cannot be feasible in everyday environmental monitoring, due to high costs and labor intensity. Guide by the mentioned concerns a practical methodical real-time PCR based approach for identification and quantification of indicator/marker species in the soil microbiome permitting assessment of the environment has been elaborated and verified on a set of real environmental samples gathered from 409 locations over the period of the project span. The method’s out put is a score of anthropogenic pressure (from 0 to 1 on the scale) upon given environment derived from mathematical modeling of the metagenomic data collected and the RT-PCR method development. In the current version the scores are calculated based on the RT-PCR results provided by the defined minimal set of 16 indicator species, each of which carries its share in environment assessment. 1.2. General methodical approach and the application workflow The current version of the BIOTAGENE method developed serves as a first proof of principle for the applicability of the results of the soil microbiome metagenomic research performed at the Centre for Biology of Integrated Systems (CBIS), Tallinn University of Technology (TUT), over a period more than half a decade, for environmental monitoring. The BIOTAGENE method can be described as a package of diverse activities, methods and approaches, originating from miscellaneous fields of biology-connected disciplines allowing to describe the environmental status based upon the soil microbiome. For the development of the BIOTAGENE methodology expertise and academic knowledge from the fields of soil science, ecology, microbiology, mycology, molecular biology, biostatistics, bioinformatics and biotechnology has been utilized resulting in an interdisciplinary approach for the assessment of surrounding environments. The assessment of environment according to the BIOTAGENE method is carried out according to the presence, absence or relative representation of the indicator species. The last have been identified as a result of analyzing soil probes collected from 409 sampling sites in countries surrounding the Baltic Sea (Estonia, Latvia, Lithuania, Poland Germany, Sweden and Finland) characterized as varying in the level of anthropogenic pressure. For all the collected soil samples metagenomic analysis by characterization of the soil microbiome according to specific regions of the 16S ribosomal RNA (for Bacteria and Archaea) was carried out by means of 454 high throughput pyrosequencing. The resulting sequencing data was used in pattern analysis. The representation patterns of the species in the samples served as bases for selecting the indicator species and the corresponding DNA sequences were used for the specific primer design. The designed primers were used as an input for developing the qPCR protocols serving as a backbone for data generation in the developed prototype method. The general workflow chart of the method (Fig.1) assists in understanding the approach and helps planning the sequence of activities to be carried out. The workflow can be divided into three major parts. The first of them deals with sample collection, handling and archiving. Detailed descriptions of the assisting actions are

2

LIFE08 ENV/EE/000358 given in more detail in the accompanying manuals. Manual 1 (Collection of soil samples for metageneomic analysis of microbiome diversity) gives guidelines for fieldwork and its preparatory activities. While Manual 2 (Storage of soil samples over a longer period) deals with the issues and requirements of sample archiving. The second set of sub-activities involves preparatory actions for and laboratory work involving molecular biological methods to be sequentially applied upon the collected samples. In detail the guidelines and protocols are given in Manual 3 (Preparation of soil samples for DNA purification), Manual 4 (Purification of total DNA from soil samples) and in the current document (qPCR guidelines). The third set of activities named on the chart as “Determination of the Pscore” and “Monitoring results” involves analysis of the data produced by the workflow and formulation of the assessment of the environment based upon it. The guidelines for these activities will be given in the final parts of the given user manual. One should keep in mind, while using this manual and the accompanying protocols, that we are dealing with a prototype and that we provide the guidelines, which have been working for us. The manuals are meant for any interested parties to be adapted to their own conditions, technical capabilities and aims. On the other hand while redesigning the details of protocols one should keep in mind that all the steps in the workflow are interconnected and one should try to avoid principal changes on any step of the workflow as not to influence outcome. 1.3. Output Based upon qPCR results the value of the score of anthropogenic pressure (Pscore) upon the given environment is calculated. The scale of the score spans from 1 (the least anthropogenic pressure) to 0 (the highest anthropogenic pressure). The calibration of the scale is based on the 5 step ecosystem’s metadata connected gradation in use at the University of Tartu Frontiers in Biodiversity Research (FIBIR) Centre of Excellence. To give the understanding of the biological meaning of the Pscore we hereby give a descriptive list (Table 2) of environments corresponding to the scores.

3

LIFE08 ENV/EE/000358 Table 2. FIBIR grades

BIOTAGENE score of anthropogenic pressure

(Pscore) intervals

Ecosystems characteristic to the intervals

5 0.8 – 1 Primeval forest, non managed growing forest, coastal meadows with low mowing or grazing pressure, etc.

4 0.66 – 0.8 Natural grasslands with intensive mowing or grazing pressure, managed forests subjected to thinning, suburban forest parks, other recreation areas with natural vegetation, etc.

3 0,41 - 0,65 Cultivated pastures, fallow land, intensively used recreational areas, city parks etc.

2 0.16 – 0.4 Agricultural fields, etc. 1 0 – 0.15 Mining spoil tips, areas submitted to intense

landscaping, city lawns in high air pollution and intensive treading areas, etc

The scores are a measure of anthropogenic pressure compared to untouched nature. The scores in themselves describe the status of the ecosystem only at the moment of sample collection. For monitoring purposes the scores have to be compared between samples taken from the same collection area over intervals of time, as to evaluate the deterioration of the status or the remediation of the environment, for example after recultivation of mining areas, etc. Based on the Pscore calculated the environmental assessment can be carried out. 2. Methodical approaches 2.1. Sample collection and pre-analysis handling The fieldwork for sample collection starts with the planning phase and preparatory activities. The first step is to collect information about the sample collection area and get hold of as much preliminary metadata as possible. In that sense different Internet services, best known of which is Google Earth, are of great help. Also one has to go through the supplies needed for field work and see that all the needed appliances are in good order and in sufficient amounts. It is suggested to think the sample colletion procedure through as thoroughly as possible and accordingly prepare sufficient amounts of sample collection containers, labeled accordingly. Also sufficient documentation should be prepared and all the possible changes in the plans during the fieldwork due to possible insufficient preliminary information should be thought through. The details of the sample collection and general guidelines for post collection sample handling are given in Manual 1 and Manual 2, which are suggested to be worked through properly before taking any action, including the planning phase. The work in the lab starts the very moment the sample the samples are passed through the doors of the premises. One has to take care that the soil in the samples will dry in a shortest time possible and will stay the way during the whole storage period. That is of paramount importance as the lack of water in the samples is the factor inhibiting the bacterial reproduction and biological activities, which otherwise might cause significant changes in samples’ DNA profile compared to the conditions in the field the moment the samples were collected. The lack of water traces in the sample could

4

LIFE08 ENV/EE/000358 be seen as a factor fixing the status of the microbiome to the moment of collection. It is expected to be taken care of by the dry silica gel already present in the sample collection containers. But it should be kept in mind that weather conditions are never perfect and the same and attention should be paid to the humidity conditions in the containers. One should follow up the status of the samples during the subsequent to fieldwork days and add extra silica gel to the sample collection containers until one can be sure enough the humidity challenge in the samples has been taken care of. We do not give detailed guidelines concerning the sample archive documentation setup as it should conform to the general routines of every specific working environment, but would like to emphasize here that it is of utter importance to take time and think it through even before starting the field work, as to avoid mix-up of the samples when they start accumulating to avoid piling up during the later stages of research activities. One should take special care to keep the samples linked with the collected before, during and after the fieldwork metadata and other documentation, which usually is of vital importance when interpreting the results during the environment assessment. The sample preparation for DNA purification step can be observed as an intermediate step between the pre-analysis and analysis steps in the workflow as the samples can be kept archived for extended periods even after being packed with the homogenization beads into homogenization tubes. A detailed protocol of hands on activities of preparation of samples for homogenization is given in Manual 3 including the guidelines of precautions to be taken during the procedure as to minimize the threats of introducing artifacts into the samples during the handling steps. The last step of preparatory activities before the actual analysis is the purification of DNA from soil. A sufficiently detailed protocol for the procedure is provided in Manual 4. 2.2. Indicator species determination For indicator species determination several multiparametric statistical methods were implemented upon the metagenomic data generated by 454 sequencing. The principal component analysis (PCA) was the best to identified the differences between the samples collected from areas with varying levels of anthropogenic pressure applied. The method together with the principle coordinates analysis (PCoA) enabled demonstration of well defined microorganism communities in different biotopes. The PCA performed took into account about 60 000 dimensions provided by the dataset, the number corresponding to the amount of OTUs identified throughout all the samples studied. The results of PCA formed the basis for selection and modeling of site-specific indicator taxons. For these purposes modeling by means of glmnet was performed. For glmnet two pools of samples were selected. The ones with the 2nd PC (principle component) value between -0,02 and -0,04 (corresponding to the pristine environments) and affected environmental samples with PC value >0,02. The model resulted with the selection of 134 OTUs with presumed diagnostic value for the determination of environmental disturbance. Of these 134 a minimal set of 16 OTUs was defined carrying the biggest share of specificity information in defining the level of anthropogenic pressure upon the environments.

5

LIFE08 ENV/EE/000358 2.3. Guidelines for primer design and selection for qPCR Primer design is a central objective for making the BIOTAGENE methodology operational for assessment of environment. All the method is built around the presumption that it is possible to identify indicator species of microorganisms, which has proven to be correct. The indicator species or operational taxonomic units (OTUs) are identifiable through the differences in their ribosomal DNA’s variable regions. The exploitation of the high throughput 454 sequencing approach generated enough DNA data (up to 5000 sequences per sample) to pinpoint, through the multiple component and pattern analyses the species allowing to differentiate between environments defined by the level of anthropogenic impact. Based on the list of indicator species their available in the Gene Bank ribosomal genomic sequences served as an input for the design of primer sets. The primers were designed using the developed in CBIS proprietary primer design algorithm and verified by means of the Primer3 and Primer Express software packages. While designing a set of multiple primer pairs to be used in parallel in one qPCR run on one PCR plate the general precautions for such procedures are taken. The primer pairs admitted for the final set and usage in practice must meet the basic requirements like: the primers’ specificity must be high, the melting temperatures of all primers must be as close as possible, the amplicon lengths of the PCR products must be of a comparable size, primer dimere formationshould be avoided. According to these basic demands while choosing the primer set sequences the entire available ribosomal genomic regions were used as a target. In the current BIOTAGENE version the aim was to design primer sets where the forward and the reverse primers as well as TaqMan probes all add to the specificity of the amplification reaction. Such an approach allows implementing the tests on different methodical platforms. Using all the three primers in one reaction is resulting in the highest specificity using the TaqMan approach. At the same time using the forward and reverse primers alone gives adds an option to use the SYBR Green I method, significantly decreasing the overall costs, but the same time prone to not separate between the specific and unspecific amplicons. On the other hand the primer pairs with high specificity allow an option also to use the method when one is lacking high price equipment like RT-PCR machines and instead visualize the amplication products by regular gel electrophoresis. It should be stated here that yet the method of choice is the exploitation of TaqMan probes producing the results most straight forward for interpretation while the SYBR Green I method and visualization by electrophoresis add subjectivity and thus ambiguities to the assessment of the environment although lowering significantly the costs of the undertaking. The list of primer sets evaluated for the current prototype version of the Biotagene method are given in Table 1. 2.4. qPCR guidelines The details of the methodical setup of the qPCR step of the workflow depend from the equipment available and the laboratory routines in use. Here we give a description of the mentioned part of the workflow in use at the CBIS and some practical hints helping to streamline lab-work and lower the running costs. The current version of BIOTAGENE method has been developed using StepOnePlus™ Real-Time PCR System. For TaqMan probe reaction we used the TaqMan® Universal PCR Master Mix while adjusting the reaction volumes to 20 µl and following the guidelines given in the manual. The melting temperatures were adjusted by using the temperature gradient function available on the StepOnePlus

6

LIFE08 ENV/EE/000358 system. The primer sets were also evaluated for the usability while exploiting the SYBR Green I technology. In our experience a significant cost decrease in using the SYBR Green I method could be achieved while instead of the commercially available corresponding master-mix one uses an in-house compiled master-mix. Beside cost effectiveness this kind of approach adds flexibility in modifying conditions to improve reaction efficiency and specificity. Also the option of using the Taq polymerase of one’s choice is introduced. At CBIS we have taken advantage of using a high concentration (25 U/µl) Taq polymerase and the example of setting up SYBR Green one reaction based on in-hous made master-mix is compiled accordingly. The list of chemicals needed is as follows: MgCl2 100 mM stock solution dNTP 10 mM stock solution 200 µM final concentration Taq polymerase 25 U/µl 0.1125 U/µl final concentration 10x standard reaction buffer with MgCl2 (final conc. 3,5 mM) 10X reaction buffer without MgCl2 SYBR Green I gel stain (http://products.invitrogen.com/ivgn/product/S7563) provided in 10,000x concentrate. Dilute this stock first to 100x in 10 mM Tris, pH 7.6 (i.e. 200 times). Use at 0.5 x 6-Carboxy-X-rhodamine is supplied as powder. Dissolve in dimethylformamide to 6 mM (dissolve 10 mg in original vial with 3.1 ml DMF). Dilute this stock to a working solution of 60 µM in DMF. Use at a final conc. of 1.87 µM (1 ng/µl). As to assist and simplify mixing together a sufficient amount of master-mix for the desired amount of reactions we have constructed an Excel based support tool as demonstrated on Fig.2. On the given snapshot guidelines of making enough master- mix for 96 reactions at different MgCl2 concentrations is displayed. In the orange cells up left one can change the reaction number and the volume. The number for 100 reactions warranties that due to possible pipeting discrepancies enough master-mix is made for 96 reactions. The lowest line of cells display the volume of master-mix to be introduced to a feeder plate well as to use an eight channel pipet when transferring the mix to the reaction plate. The PCRs are set up the way that 10 µl of master-mix is mixed in the reaction with 2 µl of primers and 8 µl of template resulting in 20 µl reactions. CBIS is ready to share the master-mix calculator Excel file upon request. It has to be pointed out here that while setting up the in-house master-mix approach one has to optimize and verify its compatibility with the equipment available and the Taq polymerase and reaction buffer used.

7

LIFE08 ENV/EE/000358

3. Determination of the score of anthropogenic pressure (Pscore) Resulting the qPCR procedures one gets 16 Ct values (y1,…y16) for every sample measured. From these values the sample’s score of anthropogenic pressure (Pscore) is calculated. As a first step in the calculations one has to estimate xi (the proportion of the given indicator species i in the given sample) in correspondence with the following formula,

where coefficient c is the sum of relative abundances of all the 16 selected indicator species in the perused by metageneomic studies dataset. In the given version* of the BIOTAGENE method the value of c=0.02 in all the cases; yi is the Ct value of the given indicator species in the given sample where i=1,...,16; j=1,…, 16. The constant 1.6 is the average amplification efficiency value characteristic for the 16 primer sets used at the CBIS facilities at the current reaction conditions. Every user should estimate that value for his own conditions. *in the next version of the method it will be substituted with the sum of relative abundances of all the indicatorspecies in the given sample by intrducing a primer set corresponding to the amplification of all the bacterial 16S genomic DNA independent of the species specificity allowing to calculate a specific c value for every sample based on qPCR procedures.

xi = c 1

1.6−yj

j =1

n

∑1.6−yi

8

LIFE08 ENV/EE/000358 Based on the xi values calculated, the next step is to determine the g value (the unscaled value of the score of anthropogenic pressure (Pscore)) according to the formula where αi is the “purity” coefficient for the given (i=1….16) indicator species allocate by the glmnet model. The corresponding values for every indicator are given in Table 3. The final scaling of the score of anthropogenic pressure (Pscore) is carried out according to the formula or alternatively expressed as follows

Pscore=1/(1+e-g) The resulting scaled values of Pscore for the samples measured should fall into the interval between 0 and 1. As to get the touch of the meaning of the Pscore assigned to a specific sample please refer to Table 2 and section 1.3 of the current document. Table 3. Indicator # GLMnet

“purity” coefficient αi

Characteristic of environment

disturbed/undisturbed INDICATOR 1 -213,41 disturbed INDICATOR 2 -148,33 disturbed INDICATOR 3 -143,41 disturbed INDICATOR 4 -135.89 disturbed INDICATOR 5 -125,31 disturbed INDICATOR 6 -117.32 disturbed INDICATOR 7 -115,89 disturbed INDICATOR 8 -107,77 disturbed INDICATOR 9 39,81 undisturbed INDICATOR 10 42,98 undisturbed INDICATOR 11 45,8 undisturbed INDICATOR 12 46,52 undisturbed INDICATOR 13 74,54 undisturbed INDICATOR 14 98,78 undisturbed INDICATOR 15 106,17 undisturbed INDICATOR 16 390,05 undisturbed Interested parties are welcome to download an Excel based Pscore calculator from the project’s website http://moonfish.ttu.ee/~biotagene/LIFE_eng/Home.html

9

LIFE08 ENV/EE/000358 4. Assessment of the environment according to the monitoring results The BIOTAGENE method allows to assess the status of the environment by measuring the anthropogenic pressure applied upon it. Correspondingly the baseline for the method development had to be defined, which in our case was chosen to be the untouched environment of the primeval forest. The samples collected from the Järvselja forest protection area in Estonia served as the example of untouched nature. The mentioned forest has been under protection as a nature reserve since 1924. When the reserve was established it was considered in those days that the forest had stayed untouched prior to the date for at leas an other 100 years. The other extreme in our sample set is represented by samples from oil shale mining spoil tips in eastern Estonia representing the situation with extreme pressure of human activities upon ecosystem. In principle all the other 400+ sample collection areas from the countries around the Baltic Sea can be characterized as falling between these two extremes. The method has been developed as a first attempt to introduce an objective approach for environmental monitoring not depending so much as the current approaches upon the qualification of the monitoring personnel and their subjective prior experience. At the same time the bases of the method are not so much different from the classical naturalist approaches of determination and counting of species in the environment, since in principle the metagenomic approach of exploiting molecular biological methodology of the BIOTAGENE method performs the same tasks only that the species determination and counting procedure results are generated independent of the observer’s subjective prior expertise. The developed scale for the Pscore works is in general in accordance with the environment assessment scale in use at the University of Tartu Frontiers in Biodiversity Research (FIBIR) Centre of Excellence (see Table 2). As an example of discrepancy between the two approaches is a case of comparing a reindeer pen with the surrounding tundra in the Skallovaara area in northern Finland. The reindeer pen got 1 according to the FIBIR scale and the surrounding tundra got 4. The calculated corresponding Pscore-s gave average of 0.79 for the pen and 0.86 for the tundra while single samples scored between 0.61 and 0.97 in the first case and 0.79 and 0.96 in the second one. Correspondingly the BIOTAGENE method classified both sample sets as ones from ecosystems with limited anthropogenic pressure although the reindeer pen gave an impression of a very disturbed environment. In this context we see the value of the Pscore as a significant objective tool in environment assessment assisting the observer with an extra parameter of the ecosystem’s microbiome status. The BIOTAGENE method yet being in its infancy of usage for assessment of environmental status understandably is not meant to replace the current approaches overnight, but more likely is an objective extra measure while evaluating anthropogenic pressure. The current version of the method represents a developed and verified prototype based on the samples collected from 409 defined sites and its usefulness for universal monitoring has yet to be seen. In the After-Life period the method has to be evaluated on a wider set of samples from even more varying environments and the improvement and optimization of the method has to go hand in hand with the established and classical methodologies, thus providing a thoroughly verified and accepted measure for monitoring the influence of human activities upon the environment we live in.

10

LIFE08 ENV/EE/000358 5. Appendices APPENDIX I

Manual 1

Collection of soil samples for metageneomic analysis of microbiome diversity.

Appliances

• GPS device • Manual soil drill (for 30 cm depth) • Means for soil drill cleaning (water, chlorine containing detergent 10x

solution, cleaning brush, ladle, 2x 5-10 liter buckets) • Rubber gloves • Disposable plastic tablespoons • Sample collection containers (plastic zipper bags 10x15 cm, Minigrip),

labeled beforehand (date, sample collection site coordinates if needed) • Silica gel (dry, preferably containing humidity marker) • In the case of need the cadastre (land property) or field maps. • The soil sample order form if needed (available at

http://pmk.agri.ee/index.php?valik=150&keel=1&template=template2teenused.html)

• Accompanying note for the DNA analysis of the soil samples

• Writing implements (pens, pencils) • Measuring instruments (tapeline and ruler) • Paper napkins

Soil sample collection The sample collection area is selected based on randomness principle inside the borders of a representative ecosystem (field, grassland, meadow, forest, etc.). On the selected sample collection area (30x30 m square) the samples are collected from 9 spots on 10 m distance from each other (look scheme). The samples are collected a straight transect 10 meters apart from each other. Attention should be paid that the soil at different collection spots should be of the same type and having a similar water regime. The samples are collected by drilling to the depth of 10-15 cm. During the sample collection and handling a caution of carrying rubber gloves should be taken as to minimize the chances of contaminating the samples with human genetic material. For every new sample a new pair of rubber gloves should be used. The sample is collected with a manual soil drill prior washed with the detergent and rinsed clean with clean water using the ladle above the bucket containing the cleaning agent.

11

LIFE08 ENV/EE/000358 Before collecting the sample the drill is inserted into the soil in full length next to the sample collection spots, as to clean it from the possible detergent leftovers an as to balance it with the surrounding soil environment. Before taking the sample the drill is cleaned of the attached soil without washing. Next the sample is collected as follows:

• inserted the drill 10-15 cm into soil • turn the inserted drill 90o • pull the drill out of soil • using the disposable plastic spoon empty the soil in drill into the sample

collection container (plastic zipper bags 10x15 cm, Minigrip, containing silica gel, labeled beforehand)

• close the sample collection container (try to keep the amount of air inside the container minimal, as to save space later on)

During the sample collection one should pay attention to avoid stony sites. It can damage the drill. One should also pay attention as to avoid capturing substrates like dry grass, pieces of manure, small stones or fertilizer granules, the contest of which could alter the later analysis results. After moving to the next sample collection spot one should repeat the above-described actions starting with the washing of the soil drill. New rubber gloves and disposable plastic tools are to be used for collecting every new sample. If the soil collected occurs to be too humid fresh silica gel should be added to the sample container (could be also done after returning from sample collection but as soon as possible). If the climate allows samples may be collected the all year round, but not in a rainy weather and the soil should be try enough not to attach to boots hands or the sample collection appliances. During the field works also the sample accompanying not should be fulfilled. Every single sample must be coded and the code should be included in the accompanying note and on the label of the sample collection container (it simplifies sample collection if the coding is carried out beforehand). During the sample collection it is paramount that the following metadata are documented in the accompanying note: location – it is suggested to use GPS coordinates, time of sample collection, weather description, description of vegetation and if present the trees, if possible the description of fauna or the traces of animal activity, if possible photos of landscape in 4 directions and detailed photos of the sample collection spot, the name of the sample collector, date. In addition the ecosystem of the sample collection site should be described, including the climate zone and the biogeographic zone of the sample collection area. Pay attention to the correctness of sample collection and avoid cross contamination between the single probes. NB! No samples should be collected:

• during heavy rain and not before 3-4 hours after the end of rain. Soil should not be too wet and greasy

12

LIFE08 ENV/EE/000358

• from places where manure, compost, lime, fertilizers, potatoes, straw/litter, hay, etc. has been deposited temporarily or for a longer period, unless the analysis of that kind of samples is the aim of the study

• form spots differing significantly from the general sample collection area, like micro hollows, plowing furrows where the soil has been agglomerated or separated due to the successive passes, where layer of soil under the humus horizon has been ploughed up, from spots on the sample collection area where small patches of different soil types occur

• from above the drains, from edges of ditches, waysides, close to the water reservoirs, lakes, rivers, waterholes and places differing significantly from the general background, unless it not the objective.

NB! The accompanying note should be added to the samples. This manual has been developed in the framework of the Life+ program BIOTAGENE project (LIFE08 ENV/EE/000258)

APPENDIX II

Manual 2

Storage of soil samples over a longer period For extended storage the soil samples should be as dry as possible. That is important as in dry environment all the life processes are kept minimal and less changes in the DNA fingerprint of the sample are to be expected. After bringing samples to the lab it is important latest the next day to examine all the samples collected during the fieldwork one by one to ascertain that the soil in samples is dry, the container intact and properly sealed. In the case of a damaged sample container the sample should be transferred into an intact one marked with a corresponding label. If the soil sample occurs insufficiently dry silica gel should be added to the sample container to the amount ensuring the preservation of the sample in dry conditions over extended periods. As mentioned in Manual 1 (Collection of soil samples for metageneomic analysis of microbiome diversity) this activity could be simplified if the silica gel added to sample containers contains the humidity color indicator. In the case the indicator is showing saturation it is important to add silica gel to the sample container. In the case that silica gel used lacks the indicator one should trust one’s own subjective judgment and experience. It is suggested to pack the sample containers into suitable cartoon boxes marked accordingly for convenient archiving. In our case we have found most convenient to use unmarked wine bottle boxes (internal measures 9x9x38 cm) as their sizes fit the sample containers most adequately.

13

LIFE08 ENV/EE/000358 The soil archive should be kept in a dark and dry environment, if possible in a room with a controlled temperature. In our experience no significant alteration in the microbiome characteristics occur in the soil samples stored the way described over a period of least two and a half years.

This manual has been developed in the framework of the Life+ program BIOTAGENE project (LIFE08 ENV/EE/000258)

APPENDIX III

Manual 3

Preparation of soil samples for DNA purification The preparation of soil samples for DNA purification essentially means carrying out the procedure of weighing the required amount of soil sample into Eppendorf 2.0 ml Safe-Lock micro test tubes containing grinding material, which we further refer to as “homogenization tubes”. Alternatively one can use 2.0 ml screw cap v-bottom tubes (it is suggested to use in this case the caps with an attachment loop to avoid the-mix up of the caps during handling) to avoid the possible spillage of the samples during handling. To complete the preparation of homogenization tubes 0.5 g of 0.4-0.6 mm in diameter of ZIRPRO beads should be weighed into every tube. (Saint-Gobain, #ER 120S http://www.zirpro.com/uploadedFiles/SGzirpro/Documents/SGZirPro-ER120-TDS-201204-E.pdf). The weighing procedure must be carried out on clean surfaces, in a clean lab coat and carrying clean powder free rubber/latex gloves, a mask and covering ones hair to minimize the contamination of the samples with human originated genetic material. As an alternative one can use Mo Bio Laboratories Inc. 0.7 mm Garnet Bead Tubes (www.mobio.com; cat# 13123-50) already containing desired grinding material. To start the procedure one should find in the archive the required for the study soil samples and prepare the corresponding amount of 2.0 ml homogenization tubes by labeling them with the sample names or numbers or any convenient codes, as it is usually very unlikely the whole sample label will fit on the tube. To avoid later mix-up of the samples between each other during the downstream steps of the DNA purification and PCR sample preparation it is strongly suggested to create at this stage a conversion table with the corresponding sample labels adjacent to the sample codes on the homogenization tubes.

14

LIFE08 ENV/EE/000358 Before starting the transfer of the weighed samples into the homogenization tubes one should thoroughly verify that the sample label code conversion table and the codes on the tubes correctly correspond to each other. It will avoid any unnecessary confusion and disturbance during the sample weighing activities. While choosing a room or area for sample weighing one should keep in mind that the dry soil samples are prone to great quite some dust and thus cause cross contamination between samples being processed as well as with the ones to be processed in the future. Correspondingly before initiating the activity one should clean thoroughly all the surfaces to be used including the balances. To avoid or minimize the contamination of the whole room it is suggested to perform the sample weighing procedure in the chemical hood or under a local hood above the weighing area. Such a precaution will minimize the possibility of cross contamination, as the soil dust created will be sucked out of the room. To minimize the possible contamination during weighing the samples with DNA originating from humans other than the material from the field (from hair, skin, saliva, etc) it is suggested to carry a clean lab coat, powder-free rubber or latex gloves, a mask covering ones nose and mouth and a cap covering ones hair. In the case the gloves come in contact with the soil from the sample during opening/closing and handling of the sample container one should put on a new pair of cloves prior to starting with the next sample. For sample weighing it is suggested to use digital balances, which display at least tree positions after coma (0.000 g), an instrument with mg-accuracy presumably. Weighing the soil directly into the homogenization tubes might be inconvenient due to the small diameter of the tube’s orifice resulting in spillage of the soil on the balance surface and thus creating threat of cross contamination. It is suggested to use the smallest available disposable weighing boats. 250-300 mg of soil from every sample should be weighed on the disposable weighing boat by using a disposable plastic teaspoon. It might be more convenient to use the tip of the spoon’s handle rather than the spoon itself for transferring the soil. In next step the weighed soil should be carefully transferred into the homogenization tube and the tube closed. The used weighing boat and the spoon used for weighing should be disposed and new clean ones taken for the next sample. In the described way the samples can be prepared in advance and kept for a time being before proceeding with the DNA purification. In the case of a longer period it is suggested to keep all the samples for the planned experiment in a larger intact Minigrip bag and add some silica gel to control the possible humidity levels in the prepared samples.

This manual has been developed in the framework of the Life+ program BIOTAGENE project (LIFE08 ENV/EE/000258)

15

LIFE08 ENV/EE/000358 APPENDIX IV

Manual 4

Purification of total DNA from soil samples The first step starting the DNA purification from the soil samples is to choose the prepared (according to Manual 3: Preparation of soil samples for DNA purification for sequencing) homogenization tubes with desired soil samples. Prior to starting the DNA purification prepare two sets (one for DNA binding and one for the collection and preservation of the purified DNA) of 1.5 or 2 ml safe-lock or screw-cap tubes equivalent to the amount of samples in the experiment by labeling them with the corresponding sample codes. Further on is given a step-by-step protocol for soil DNA purification.

1) Add 800 µl of Lysis buffer to every tube. (In the case of a sediment present in the lysis buffer heat it to 60oC for 10 min prior to usage)

2) Vortex to mix evenly the homogenization beads with the soil in the sample and the lysis buffer

3) Attach the Mo BioVortex Adapter for Vortex-Genie® 2 to a Vortex Genie® 2 Vortex. Insert the homogenization tubes into the adapter (if there are less than 24 tubes in the procedure pay attention to achieve a balanced distribution of tubes in the adapter)

4) To homogenize the samples switch the vortex on for 20 min at max speed 5) After homogenization centrifuge the tubes for 2 min at 104 g 6) Transfer 300 µl of supernatant to the first set of pre-prepared tubes. Save the

leftover for backup 7) Add 20 µl SiMAG/MP-DNA beads to the transferred supernatant. (Before

transferring the beads mix the stock thoroughly by vortexing) 8) Add 300 µl of binding solution and mix on the Vortex 9) Attach the tubes to the Mo BioVortex Adapters for Vortex-Genie® 2 and mix

for 5 min at max speed 10) Insert the tubes into the magnetic stand and allow the bead separation for 1-2

min 11) Aspirate carefully as much of the liquid from the tubes as possible using a

pipette leaving the magnetic beads behind 12) Remove the tubes with beads from the stand and add 500 µl of salt wash

solution to every tube. Mix 13) Insert the tubes into the magnetic stand and repeat the actions from step 10)

to12) twice, resulting in three washes of the beads with the salt wash solution. Special attention should be paid during the last aspiration of the salt solution to get rid of the solution as completely as possible.

14) Take tubes out of the magnetic stand and add 500 µl of ethanol wash solution to the tubes. Mix

15) Insert the tubes into the magnetic stand and allow the bead separation for 1-2 min

16

LIFE08 ENV/EE/000358

16) Aspirate the ethanol wash solution by leaving the beads behind. 17) Repeat the steps from 14) to 16) 18) After removing the final ethanol wash solution leave the open tubes with

beads to dry for ~5 min at room temperature until the ethanol has evaporated 19) Add 100 µl of elution buffer to the tubes and pay attention that all the beads

end up in the solution. 20) Incubate the beads in the elution buffer for minimum 1-2 min. No need to

exceed 5 min. 21) Remix the beads with the elution buffer and insert the tubes into the magnetic

stand for 1-2 min 22) Transfer the elution buffer containing the DNA to the second set of pre-

prepared tubes. 23) Dispose of the tubes with the leftover of beads and store the tubes with the

purified DNA for further use at -20oC. Solutions Lysis buffer for 96 samples (85 ml): Chemical Stock

concentration Volume to add Final

concentration Tris-HCl (pH 8.0) 1M 8.5 ml 100 mM EDTA (pH (8.0) 0.5M 17 ml 100 mM NaCl 5M 17 ml 1M SDS 100% 1.7 ml 2% Rnase A 100 mg/ml 85 µl 100µg/ml H2O (MilliQ) up to 85 ml Binding solution for 96 samples (40 ml) Chemical Stock

concentration Amount to add Final

concentration PEG-8000 100% 8.0 g 20% NaCl 5M 32 ml 4M H2O (MilliQ) up to 40 ml Salt wash solution for 3x96 samples (150 ml) Chemical Amount to add GITC 70.75 g H2O (MilliQ) up to 150 ml Ethanol wash solution for 2x96 samples (106 ml) Chemical Stock Volume to add Final

17

LIFE08 ENV/EE/000358

concentration concentration Ethanol 96% 77,3 ml 70% H2O (MilliQ) 28.7 ml Elution buffer for 96 samples (11 ml) Chemical Stock

concentration Volume to add Final

concentration Tris-EDTA (TE) 100x

1.0M Tris Base and 0.1M EDTA

0.11 ml 1x

H2O (MilliQ) 10.89 ml Chemicals and appliances: Vortex Genie® 2 Vortex Mo BioVortex Adapters for Vortex-Genie® 2 cat# 13000-V1-24 SiMAG/MP-DNA beads Magnetic stands (choose the desired model corresponding to your needs by following the given links): Promega, Life Technologies, Millipore

This manual has been developed in the framework of the Life+ program BIOTAGENE project (LIFE08 ENV/EE/000258)

APPENDIX V Tabel1. Primer sets for the BIOTAGENE method

OLIGO start len tm gc% oligo seq Sequence name LEFT PRIMER

523 20 59.96 50 GTTCGGATTTACTGGGCGTA gi|2329870|emb|Z95709.1| Bacterial species 16S rRNA gene (clone 11-25); INDICATOR 1

RIGHT PRIMER

769 20 60.03 50 CGGGGTATCTAATCCCGTTT

HYB OLIGO

618 20 60.01 60 GTGCTAGAGTGCAGAAGGGG

LEFT PRIMER

1013 20 59.88 50 TACAGGTGGTGCATGGTTGT gi|311335259|gb|HQ327138.1| Arthrobacter sp. TP-Snow-C29 16S ribosomal RNA gene, partial sequence INDICATOR 2

RIGHT PRIMER

1255 20 60.07 55 TGGGATTAGCTCCACCTCAC

HYB OLIGO

1036 20 60.05 55 CAGCTCGTGTCGTGAGATGT

LEFT PRIMER

263 20 59.96 50 TAATGGCCTACCAAGGCAAC gi|192806377|emb|FM176885.1| Uncultured Acidobacteriaceae bacterium partial 16S rRNA gene, clone CL6-7.L265 INDICATOR 3

RIGHT PRIMER

426 20 60.01 45 CCGAAAATCTTCATCCTCCA

HYB 283 20 60.18 55 GATCAGTATCCGGCCTGAGA

18

LIFE08 ENV/EE/000358

OLIGO LEFT PRIMER

138 20 59.93 50 TGGGATAACAGTCCGAAAGG gi|110754887|gb|DQ829574.1| Uncultured Chloroflexi bacterium clone DOK_NOFERT_clone663 16S ribosomal RNA gene, partial sequence INDICATOR 4

RIGHT PRIMER

347 20 60.11 60 CCACCCGTAGGTGTATGGAC

HYB OLIGO

167 20 60.08 45 ACCGCATGTGGTTATTGGAT

LEFT PRIMER

483 20 60.1 55 TCCAGACGGTACCTCCAAAG gi|309241479|emb|FN659097.1| Uncultured bacterium partial 16S rRNA gene, clone t0_12L41 INDICATOR 5

RIGHT PRIMER

664 20 60 55 GCCTCAAGTCCTGCAGTTTC

HYB OLIGO

617 20 60.02 50 CGTACGGCTCAACCGTATTT

LEFT PRIMER

489 20 59.96 50 GTTCGGAATTACTGGGCGTA gi|307940623|gb|HQ114170.1| Uncultured bacterium clone V201-155 16S ribosomal RNA gene, partial sequence INDICATOR 6

RIGHT PRIMER

661 20 59.97 50 CCACTGGTGTTCTTCCGAAT

HYB OLIGO

556 20 60.24 50 CAACTCCGGAACTGCCTTTA

LEFT PRIMER

878 20 59.99 50 GCAAGGCTGAAACTCAAAGG gi|134021453|gb|EF020029.1| Uncultured bacterium clone Elev_16S_1424 16S ribosomal RNA gene, partial sequence INDICATOR 7

RIGHT PRIMER

1116 20 59.97 45 ATGATGGCAACACAGGACAA

HYB OLIGO

1048 20 60.05 55 CAGCTCGTGTCGTGAGATGT

LEFT PRIMER

992 20 60.02 60 GCTAGACAACGGAGGACAGC gi|134021165|gb|EF019741.1| Uncultured bacterium clone Elev_16S_915 16S ribosomal RNA gene, partial sequence INDICATOR 8

RIGHT PRIMER

1153 20 59.93 50 GAGTGCCCACCTGAAATGAT

HYB OLIGO

1070 20 60.05 55 CAGCTCGTGTCGTGAGATGT

LEFT PRIMER

290 20 59.83 60 CTGAGATACGGCCCAGACTC gi|146429810|gb|EF220626.1| Uncultured alpha proteobacterium clone FI-1M_G07 16S gene, partial sequence INDICATOR 9

RIGHT PRIMER

515 20 59.96 50 TACGCCCAGTAATTCCGAAC

HYB OLIGO

383 20 60 50 AGGCCTTCGGGTTGTAAAGT

LEFT PRIMER

155 20 60.27 50 GATAAGCCCTTACGGGGAAA gi|254933897|gb|GQ342579.1| Bradyrhizobium sp. RI270 16S ribosomal RNA gene, partial sequence INDICATOR 10

RIGHT PRIMER

389 20 59.96 55 ACCCTAGGGCCTTCATCACT

HYB OLIGO

233 20 60.28 55 ACCAAGGCGACGATCAGTAG

LEFT PRIMER

117 20 59.95 55 CTGCCCTGTGGTAGGGAATA gi|110754526|gb|DQ829213.1| Uncultured proteobacterium clone DOK_NOFERT_clone239 16S

RIGHT PRIMER

312 20 59.83 60 GAGTCTGGGCCGTATCTCAG

19

LIFE08 ENV/EE/000358

HYB OLIGO

165 20 59.92 50 TGAGTCCTTCGGGAGAAAGA ribosomal RNA gene, partial sequence INDICATOR 11

LEFT PRIMER

406 20 59.78 50 CGGGGAAGATAATGACGGTA gi|148249196|gb|EF605874.1| Unidentified bacterium clone 17_L1_BULK_SP6 16S ribosomal RNA gene, partial sequence INDICATOR 12

RIGHT PRIMER

622 20 59.91 55 ACTCGCAGTTCCACTCACCT

HYB OLIGO

516 20 60.03 55 CACGTAGGCGGCTTCTTAAG

LEFT PRIMER

1007 20 60.05 55 CAGCTCGTGTCGTGAGATGT gi|134021722|gb|EF020298.1| Uncultured Acetobacteraceae bacterium clone Elev_16S_1845 16S ribosomal RNA gene, partial sequence INDICATOR 13

RIGHT PRIMER

1177 20 60 55 ATGACGTGTGAAGCCCTACC

HYB OLIGO

1136 20 60.59 50 TCAAGTCCTCATGGCCCTTA

LEFT PRIMER

77 20 59.73 60 GGCAGACGGGAGAGTAACAC gi|110754277|gb|DQ828964.1| Uncultured proteobacterium clone DOK_CONFYM_clone756 16S ribosomal RNA gene, partial sequence INDICATOR 14

RIGHT PRIMER

248 20 60.28 55 CTACTGATCGTCGCCTTGGT

HYB OLIGO

119 20 60.2 50 GGAACAACCCAGGGAAACTT

LEFT PRIMER

78 20 59.97 50 TGCTAGATTGATGGCGAGTG gi|311335124|gb|HQ318603.1| Uncultured soil bacterium clone DLQAMB9C100 16S ribosomal RNA gene, partial sequence INDICATOR 15

RIGHT PRIMER

304 20 59.95 60 GCTGATCGTCCTCTCAGACC

HYB OLIGO

165 20 59.98 55 ATACCGCATACGACCTGAGG

LEFT PRIMER

783 20 60 50 ACGCCCTAAACGATGTCAAC gi|298397684|gb|HM112378.1| Uncultured beta proteobacterium clone SHOB681 16S ribosomal RNA gene, partial sequence INDICATOR 16

RIGHT PRIMER

978 20 59.99 55 AGTGGCATGTCAAGGGTAGG

HYB OLIGO

928 20 60.43 45 GGATTAATTCGATGCAACGC

This manual has been developed in the framework of the Life+ program BIOTAGENE project (LIFE08 ENV/EE/000258)

20