A

lIpEaossH©

K

epuHb

Retlp2ta

g

sf

1d

Computational Biology and Chemistry 31 (2007) 124–126

Brief communication

HBV-encoded microRNA candidate and its target

Wei-Bo Jin a,b, Fang-Li Wu a, Dong Kong a, Ai-Guang Guo a,b,∗a College of Life Science, Northwest A&F University, Yangling, Shaanxi 712100, China

b Key Laboratory of Agriculture Molecular Biology in Shaanxi, Yangling, Shaanxi 712100, China

Received 24 October 2006; received in revised form 18 January 2007; accepted 21 January 2007

bstract

MicroRNAs (miRNAs) are a group of short (∼22 nt) noncoding RNAs that specifically regulate cellular gene expression at the post-transcriptionalevel. miRNA precursors (pre-miRNAs), which are imperfect stem loop structures of ∼70 nt, are processed into mature miRNAs by cellular RNasesII. To date, hundreds of miRNAs and their corresponding targets have been reported in kinds of species. Although only a few of these miRNA/targetairs have been functionally verified, some do play important roles in regulating normal development and physiology. Several viruses (e.g. thepstein-Barr virus and human herpesvirus Kaposi’s sarcoma-associated herpesvirus) has been reported to encode miRNAs. Here, we extend thenalysis of miRNA-encoding potential to the Hepatitis B virus (HBV). Using computational approaches, we found that HBV putatively encodesnly one candidate pre-miRNA. We then matched deduced mature miRNA sequence from this pre-miRNA against a database of 3′ untranslated

equences (UTR) from the human genome. Surprisingly, none of cellular transcripts could potentially be targeted by the viral miRNA (vmiRNA)equence. However, one viral mRNA was found to be targeted by the vmiRNA when we searched the target from viral mRNAs. We propose thatBV has evolved to use vmiRNAs as a means to regulate its own gene expression for its benefit.2007 Elsevier Ltd. All rights reserved.

mmisgef

iivfios

eywords: HBV; MicroRNA; Identification; Target

The first miRNA to be discovered was the Caenorhabditislegans heterochronic gene lin-4, which inhibits translation byairing with partially homologous sequences lin-14 in the 3′ntranslated region (UTR) (Lee et al., 1993; Fire et al., 1998;unter and Poethig, 2003). To date, thousands of miRNAs haveeen found in animals, plants and virus (Griffiths-Jones, 2004).

Structurally, microRNAs (miRNAs) are 19–25 nucleotideNAs processed from short stem-loop precursors that can bencoded in genomes of plants, animals and viruses. Accordingo the current understanding, miRNA is firstly transcribed asong primary miRNA, which is processed into 60–70 nt miRNArecursor (pre-miRNA) by nuclear RNase III Drosha (Lee et al.,002, 2003). Then the pre-miRNA is transported from nucleuso cytoplasm by Exportin-5 (Kim, 2004; Zeng and Cullen, 2004)

nd further cleaved into ∼22 nt duplexes (Bartel, 2004).

Although the exact mechanism by which miRNA regulatesene expression is not completely understood, several experi-

∗ Corresponding author at: College of Life Science, Northwest A&F Univer-ity, Yangling, Shaanxi 712100, China. Tel.: +86 29 8702 6171;ax: +86 29 8709 2262.

E-mail address: guoaiguang@yahoo.com.cn (A.-G. Guo).

uo(ep

rps

476-9271/$ – see front matter © 2007 Elsevier Ltd. All rights reserved.oi:10.1016/j.compbiolchem.2007.01.005

ental observations have been made to generalize the rules ofiRNA-target binding. The most important one among them

s the base 2–8 of the 5′ end of the miRNA (named as seedequence) must perfectly complement with the 3′UTR of tar-et mRNA. Other general features like optimum minimum freenergy (MFE) of the miRNA:mRNA complex also benefit theunction of miRNAs.

Recently, researchers are more and more interested in thenteraction of miRNA and virus mRNA. Pfeffer et al. (2004)dentified virus-encoded miRNA sequences in Epstein-Barrirus (EBV) infected cells. They reported that EBV encodesve miRNAs which are capable of regulating the expressionf viral genes involved in latency and modulating the expres-ion of host cell genes. Thus, it seems that EBV has evolved tose the miRNA pathway for its replicative benefit. From thenn, virus-encoded miRNA sequences are reported successivelyGriffiths-Jones, 2004). To query whether this strategy is alsomployed by Hepatitis B virus (HBV) or not, we have analyzedutative miRNA-encoding capacity of HBV.

We wondered if HBV maintains RNA structures thatesemble pre-miRNAs. As a proof-of-principle, we examinedre-miRNA structures in the genome of HBV. The HBV genomeequence was downloaded from NCBI (accession number:

W.-B. Jin et al. / Computational Biology and Chemistry 31 (2007) 124–126 125

F iRNA candidate. (For interpretation of the references to colour in this figure legend,t

Nstss((otamhnaF

Wtfti

Fg

Table 1Sequence and location of miRNA

Virus miRNA #2miRNA sequence CAUGUCCUACUGUUCAAGCCUCLocalization on HBV genome 1850–1871

Potential target location 1886–1907 (4a)

gt(

We asked if HBV-encoded vmiRNA is present in HBV-infected patients. By using blood cells infected with HBV, wefirst isolated, based on size selection, only those RNAs smallerthan 80 nt. The size-selected RNAs were electrophoresed in

ig. 1. Potential hairpin structures on HBV genome. Red ringed sequence is mhe reader is referred to the web version of the article.)

C 00397). The hairpins were predicted as follows: (1) extractequences from HBV genome with the window of 700 nt andhe step of 350 nt; (2) compute secondary structure of theseegments using RNAfold (Hofacker et al., 1994); (3) cut theequences containing hairpin structure from 700 nt fragments;4) select segments whose stems are at least 18 base pairingsincluding the GU wobble pairs) in length, and the free energyf the secondary structure is no more than −15 kcal/mol (thehresholds 18 and −15 are the lowest number of base pairingsnd the highest free energy among all the genuine human pre-iRNAs, respectively); (5) validate whether those fragments are

airpin or not using Mfold (Zuker, 2003). Only two thermody-amically reasonable candidates (#1 and #2) were uncoverednd the secondary structures of each candidate are presented inig. 1.

Then the RP-SVM classifier, which was developed by Jinei-bo et al. to classify real and pseudo-pre-miRNA and is free

o all users (http://geneweb.icpcn.com/rp svm/), was applied tourther distinguish the two candidates, and only #2 was iden-ified as pre-miRNA candidate. As shown in Fig. 2, the #2s in the precore/core gene. Using FS-SVM classifier (http://

ig. 2. Locations for predicted pre-miRNAs candidates (#2) in the HBVenome.

Fw1(ls

(according to Fig. 4) 2549–2570 (4b)3081–3012 (4c)

eneweb.icpcn.com/fs svm/) for predicting functional strand,he corresponding deduced mature virus-encoded miRNAvmiRNA) sequence is presented in Table 1.

ig. 3. RNA enriched for small RNAs (<80 nt) was extracted from blood cellsith mock-infected (lane 1) or HBV-infected (lanes 2 and 3) and was separated in5% polyacrylamide–8 M urea gel and hybridized to vmiRNA#2-specific probetop) or to control 5S rRNA probe (bottom). The strong hybridization signal onane 2 indicated high expression of the vmiRNA in latency cells, and the faintignal on lane 3 showed very low-abundance of vmiRNA in activity cells.

126 W.-B. Jin et al. / Computational Biology and Chemistry 31 (2007) 124–126

F ion ofv

phps

H3Cocn

wwwfsaili“g(ciortsir

rps

A

ts

R

B

F

G

H

H

K

L

L

L

L

L

P

of virusencoded microRNAs. Science 304, 734–736.Zeng, Y., Cullen, B.R., 2004. Structural requirements for pre-microRNA binding

and nuclear export by Exportin 5. Nucl. Acids Res. 32, 4776–4785.Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization

prediction. Nucl. Acids Res., 3406–3415.

ig. 4. Potential region targets in mRNA by miRNA (red ring). (For interpretatersion of the article.)

olyacrylamide gel and transferred to nylon membrane. We thenybridized the membrane with a vmiRNA-specific 32P-labeledrobe and detected a ∼21 nt signal (Fig. 3, lanes 2 and 3) noteen in mock-infected cells (Fig. 3, lane 1).

We wonder whether the putative vmiRNA could be used byBV to modulate host cell gene expression profiles. We searched′UTR database for human genes that could engage in Watson-rick base pairing with nucleotides 2–8, the “seed sequence”f vmiRNA (Lewis et al., 2003, 2005), Surprisingly, none ofellular targets were found, which suggests that vmiRNAs couldot affect the expression pattern of cellular genes.

What is the function of the vmiRNA? In order to knowhether the vmiRNA could modulate its own gene expression,e checked the viral mRNAs that could perfectly complementith the “seed sequence” of vmiRNA, and three genes were

ound. Mfold (Zuker, 2003) was applied to predict the secondarytructures of these three genes of large S protein, polymereasend X protein, respectively, and the target binding site are shownn Fig. 4a–c. The binding sites in Fig. 4a and c were found toocate in the duplex, while the binding site in Fig. 4b locatedn the loop structure. Fig. 4b shows that the binding site in thevariable region” can benefit the interaction with vmiRNA, sug-esting that it is the most believable miRNA-target binding siteLewis et al., 2005), so we suppose that the polymerase geneould potentially be targeted if this vmiRNA were processedn host cell. Why does the vmiRNA suppress the expressionf polymerase gene? We speculated that the polymerase wasepressed by vmiRNA to reduce HBV replication for evadinghe immunity system of its host in latent period. But there aretill many problems, such as when does vmiRNA begin express-ng, and how does vmiRNA stop expressing when HBV needeplicating largely, and so on?

Here, we introduce a concept that the HBV genome couldeasonably encode one candidate pre-miRNA. Studies are inrogress to examine how vmiRNAs might evade the immunityystem of host cell during HBV infection.

the references to colour in this figure legend, the reader is referred to the web

cknowledgement

The authors thank Dr. Ning Gao, Second Affiliated Hospi-al, Xi’an Jiaotong University, for providing necessary RNAamples.

eferences

artel, D.P., 2004. MicroRNAs, genomics, biogenesis, mechanism, and func-tion. Cell 116, 281–297.

ire, A., Xu, S., Montgomery, M.K., et al., 1998. Potent and specific geneticinterference by double-stranded RNA in Caenorhabditis elegans. Nature391, 806–811.

riffiths-Jones, S., 2004. The microRNA registry. Nucl. Acids Res. 32 databaseissue, D109–D111.

ofacker, I.L., Fontana, W., Stadler, P.F., Bonhoeffer, S., Tacker, M., Schus-ter, P., 1994. Fast folding and comparison of RNA secondary structures.Monatshefte f Chemie 125, 167–188.

unter, C., Poethig, S.R., 2003. Missing links, miRNAs and plant development.Curr. Opin. Genet. Dev. 13, 372–378.

im, V.N., 2004. MicroRNA precursors in motion: exportin-5 mediates theirnuclear export. Trends Cell Biol. 14, 156–159.

ee, R.C., Feinbaum, R.L., Ambros, V., 1993. The C. elegans heterochronicgene lin-4 encodes small RNAs with antisense complementarity to lin-14.Cell 75, 843–854.

ee, Y., Jeon, K., Lee, J.T., Kim, S., Kim, V.N., 2002. MicroRNA maturation,stepwise processing and subcellular localization. EMBO J. 21, 4663–4670.

ee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Rad-mark, O., Kim, S., Kim, V.N., 2003. The nuclear RNase III Drosha initiatesmicroRNA processing. Nature 425, 415–419.

ewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., Burge, C.B., 2003.Prediction of mammalian microRNA targets. Cell 115, 787–798.

ewis, B.P., Burge, C.B., Bartel, D.P., 2005. Conserved seed pairing, oftenflanked by adenosines, indicates that thousands of human genes aremicroRNA targets. Cell 120, 15–20.

feffer, S., Zavolan, M., Grasser, F.A., Chien, M., Russo, J.J., Ju, J., John,B., Enright, A.J., Marks, D., Sander, C., Tuschl, T., 2004. Identification