henipavirus pathogenesis in human respiratory epithelial cells olivier escaffre1, viktoriya

Henipavirus Pathogenesis in Human Respiratory Epithelial Cells 1

2

Olivier Escaffre1, Viktoriya Borisevich1, J. Russ Carmical3, Deborah Prusak3, Joseph Prescott4, 3

Heinz Feldmann4, Barry Rockx1,2# 4

Departments of Pathology 1, Microbiology & Immunology 2, and Biochemistry & Molecular 5

Biology 3 University of Texas Medical Branch, Galveston, TX, USA 6

Laboratory of Virology 4, Division of Intramural Research, NIAID, NIH 7

Rocky Mountain Laboratories, Hamilton, MT, USA 8

9

Running title: Henipavirus infection of respiratory epithelium 10

Abstract: 250 words 11

Text: 6064 words 12

13

Corresponding author: [email protected] 14

15

Copyright © 2013, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.02576-12 JVI Accepts, published online ahead of print on 9 January 2013

on April 12, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

ABSTRACT 16

Hendra virus (HeV) and Nipah virus (NiV) are deadly zoonotic viruses for which no vaccines or 17

therapeutics are licensed for human use. Henipavirus infection causes severe respiratory illness 18

and encephalitis. Although the exact route of transmission in human is unknown, 19

epidemiological studies and in vivo studies suggest the respiratory tract is important for virus 20

replication. However, the target cells in the respiratory tract are unknown as well as the 21

mechanisms by which henipaviruses can cause disease. 22

Here we characterize henipavirus pathogenesis using primary cells derived from the human 23

respiratory tract. The growth kinetics of NiV-Malaysia, NiV-Bangladesh and HeV was 24

determined in Bronchial/Tracheal Epithelial Cells (NHBE) and Small Airway Epithelial Cells 25

(SAEC). In addition, host responses to infection were assessed by gene expression analysis and 26

immunoassays. 27

Viruses replicated efficiently in both cell types and induced large syncytia. The host response to 28

henipavirus infection in NHBE and SAEC highlighted a difference in the inflammatory response 29

between HeV and NiV strains as well as intrinsic differences in the ability to mount an 30

inflammatory response between NHBE and SAEC. These responses were highest during HeV 31

infection in SAEC as characterized by the levels of key cytokines (IL-6, IL-8, IL-1α, MCP-1, CSFs) 32

responsible for immune cell recruitment. Finally, we identified virus strain-dependant variability 33

in type I interferon antagonism in NHBE/SAEC where NiV-Malaysia counteracted this pathway 34

more efficiently than NiV-Bangladesh or HeV. These results provide crucial new information in 35

the understanding of henipavirus pathogenesis in the human respiratory tract at an early stage 36

of infection. 37


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

INTRODUCTION 38

Nipah (NiV) and Hendra virus (HeV) are emerging zoonotic pathogens of the family 39

Paramyxoviridae and are classified in the genus Henipavirus (14). NiV and HeV both cause 40

severe and often fatal respiratory disease and/or encephalitis in animals and humans. HeV was 41

first isolated during an outbreak of respiratory and neurologic disease in horses and humans in 42

Australia in 1994 (41, 42, 56, 68). To date, a total of 5 outbreaks of HeV involving human cases 43

have been reported in Australia and 7 human cases with a case fatality rate of 57% have been 44

identified (54). The first human cases of NiV infection were identified during an outbreak of 45

severe febrile encephalitis in Malaysia and Singapore in 1998-1999 (8, 16). Several other 46

outbreaks have occurred thereafter in Bangladesh and India almost yearly since 2001 (19, 22, 47

54), with the last outbreak reported in Bangladesh in 2012 (2). NiV strains from Malaysia (M) 48

and Bangladesh (B) are genetically distinct based on phylogenic analyses using amino acid 49

sequences (30, 54). To date NiV is responsible for over 500 human cases with mortality rates 50

ranging from 40% (in Malaysia) (7) to 100% (in Bangladesh/India) (2, 34, 54). The natural host of 51

henipaviruses are fruit bat (Pteropus species) (9, 18, 73) and transmission of these viruses from 52

bats to humans may be direct or via an intermediate host like horses or pigs for HeV and NiV 53

transmission, respectively (1, 9, 41, 44, 47, 48, 58, 59). Interestingly, respiratory symptoms such 54

as cough and difficulty breathing were reported in about 70% of NiV-B and less than 30% of 55

NiV-M-infected patients (31). In addition, in recent outbreaks, a high incidence of person-to-56

person transmission has been reported in Bangladesh/India (17, 19, 23) as opposed to the 57

outbreaks of NiV in Malaysia and HeV in Australia, suggesting differences in host-virus 58

interactions between genetically distinct henipaviruses. 59


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

The main target cells during late stage of henipavirus infection in humans are endothelial cells 60

of blood vessels resulting in vasculitis, vasculitis-induced thrombosis and vascular micro 61

infarction in the central nervous system (CNS) but also in other organs such as lung, spleen and 62

kidney (11, 70, 71). The infection also reaches the CNS parenchymal cells, which altogether play 63

an important role in the pathogenicity of henipaviruses (11, 21). 64

Although the exact route of infection in humans is unknown, previous studies in several 65

laboratory animal models reported an efficient infection through intranasal challenge (6, 32, 52, 66

53, 67), suggesting the respiratory tract is one of the first targets of virus replication. In 67

addition, both NiV and HeV have been isolated from oropharyngeal/respiratory secretions in 68

humans and in animals (10, 40, 64) which emphasize the importance of the respiratory tract in 69

virus replication and potential transmission. In hamsters, NiV infection of the respiratory tract is 70

initiated in the trachea and progresses down the respiratory tract, infecting the bronchial 71

epithelium, and finally causing severe hemorrhagic pneumonia, including the characteristic 72

syncytium formation in the pulmonary endothelium. In contrast, HeV infection is initiated 73

primarily in the small airways of the lungs and not in the trachea or bronchi (53). In humans, 74

henipavirus infection is characterized by influenza like illness, which can progress to pneumonia 75

(7, 16, 46, 59, 60) or acute respiratory distress syndrome (ARDS) as characterized in some cases 76

of NiV-B infection (22). Interestingly, while limited data is available on the histopathology of the 77

lungs of henipavirus cases, changes in the respiratory tract of NiV-M infected patients include 78

hemorrhage, necrosis and inflammation in the epithelium of the small airways but not in the 79

bronchi (71), similar to observations in hamsters (53), and non-human primates (52). Finally, 80

lesions and inflammation were reported in the small airways of HeV infected patients (59, 60, 81


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

70) and no information is available about the histopathological changes in the respiratory tract 82

of NiV-B-infected patients. The specific sites of henipavirus infection in the human respiratory 83

tract are still unknown as well as the mechanism by which these viruses can cause disease. 84

We hypothesize that the human immune response to henipavirus infection at an early step of 85

infection can determine the clinical outcome, explain how the virus can disseminate throughout 86

the host and affect person-to-person transmission. To gain further insight into the early steps of 87

infection, here we report the first characterization of NiV and HeV infection of the human 88

respiratory tract using primary human epithelial cells derived from the bronchi 89

(Bronchial/Tracheal Epithelial Cells, NHBE) and the small airways (Small Airway Epithelial Cells, 90

SAEC). Our results showed that replication kinetics of genetically distinct NiV and HeV strains 91

are efficient in both cell types and result in a differential innate immune response depending on 92

the virus strain and the cell origin. Finally, we demonstrate a virus strain dependent variability 93

in type I IFN signaling that seems independent of the origin of cells from the human respiratory 94

tract. 95


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

MATERIAL AND METHODS 96

97

Viruses and Cells. NiV-Malaysia (NiV-M), NiV-Bangladesh (NiV-B) and HeV were kindly 98

provided by the Special Pathogens Branch (Centers for Disease Control and Prevention, GA, 99

USA). The viruses were propagated on Vero cells (CCL-81; ATCC) in Dulbecco’s modified Eagle’s 100

medium with 400mM L-Glutamine, 4500mg/L of Glucose and Sodium pyruvate (Thermo-101

Scientific, Logan, USA) and supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 102

0.1 mg streptomycin (Sigma-Aldrich, St Louis, USA) at 37°c, 5% CO2. Cells were seeded in 96-103

well plates for virus titration. 104

105

Normal Human Bronchial/Tracheal Epithelial Cells (NHBE) derived from the bronchiale 106

tube and Normal Small Airway Epithelial Cells (SAEC) derived from the distal airspace were 107

obtained with the Clonetics Bronchial/Tracheal Epithelial Cell system and the Clonetics Normal 108

Human Small Airway Epithelial cell system (Clonetics, San Diego, USA), respectively. Monolayers 109

of non-differentiated NHBE and SAEC cells were cultured in 150cm2 flask for 8 days (37°c, 5% 110

CO2) with a Bronchial Epithelial Cell Basal Medium supplied with growth factors BEGM BulletKit 111

and with a Small Airway Epithelial Cell Basal Medium supplied with growth factors SAGM 112

BulletKit, respectively. All NHBE and SAEC cell infections were performed at a multiplicity of 113

infection (MOI) of 5 for 1h to ensure synchronous infection. Cells were then rinsed three times 114

with 1x PBS and appropriate medium was added. NHBE and SAEC cells were seeded in 6-well 115

plates at 1x106 cells/well (each condition performed in triplicate) the day prior to infection for 116

the experiments of virus replication, gene expression and of cytokine/chemokine 117


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

quantification. NHBE and SAEC cells were seeded in 12-well plates at 3.5x105 cells/well (each 118

condition performed in triplicate) the day prior to infection for the quantification of Stat1 and 119

pStat1 by western blot. 120

Viruses were titrated on Vero cells in 96-well plates using ten-fold virus dilutions in 121

triplicate. Virus titer was expressed as median Tissue Culture Infective Dose (TCID50/ml) using 122

Reed & Muench method (50). All work with live viruses was performed in the Galveston 123

National Laboratory Level 4 (BSL-4) at the University of Texas Medical Branch, TX, USA. 124

Gene Expression Analysis. Total cellular RNA from NHBE and SAEC was extracted at 24h 125

post infection (pi) in triplicate using TRIzol Reagent (Invitrogen, Carlsbad, USA), following the 126

manufacturer’s recommendations. RNA was quantified using a NanoDrop ND-1000 (NanoDrop 127

Technologies, Wilmington, USA) and RNA integrity assessed by visualization of 18S and 28S RNA 128

bands using an Agilent BioAnalyzer 2100 (Agilent Technologies, Santa Clara, USA). Total RNA 129

extracted from the samples was processed using the RNA labeling protocol described by 130

Ambion (MessageAmp aRNA Kit Instruction Manual) and hybridized to Affymetrix Gene Chips 131

(HGU133 Plus 2.0 arrays, total genome). Data quality was assessed by applying the quality 132

matrix generated by the Affymetrix GeneChip Command Console (AGCC) software. The 133

resulting data were analyzed with Partek Genomics Suite (Partek, St Louis, USA). Principal 134

component analysis as a quality assurance measure was performed. The raw data were 135

normalized through robust multichip averaging upon import to Partek Genomics Suite. An 136

analysis of variance was carried out and a false discovery rate (FDR) applied to reduce the 137

occurrence of false positives. The data set was filtered for a p-value of 0.05 and a cut-off>2.00, 138

resulting in the final list of differentially expressed genes. Ingenuity Pathway Analysis (IPA) 139


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

software and iReport (Ingenuity systems, Redwood City, USA) were then used to analyze and 140

interpret data. The analysis of the most significant biological functional groups and canonical 141

pathways affected per condition were performed using an uncorrected p-value calculation 142

method (right-tailed Fisher Exact Method, p-value <0.05 or –log(p-value) >1.3). A ratio (r) 143

accounting for the number of overlapping genes from a particular pathway was also introduced 144

to help in the analyses of filtered data. 145

Real Time SYBR Green QPCR Assay Design. Real-time QPCR assays were designed from the 146

coding sequence (CDS) of the gene of interest (NCBI) and exon-exon junctions mapped via BLAT 147

(25). Whenever possible, at least one of the two PCR primers was designed to transcend an 148

exon-intron junction in order to reduce the impact of potential genomic DNA amplification in 149

the surveyed RNA samples. Primers were designed with Primer Express™ 2.0 (Applied 150

Biosystems, Foster City, USA) using default settings (Primer Tm = 58oC-60oC, GC content = 30-151

80%, Amplicon Length = 90-150 nucleotides). Primers were synthesized (IDT, San Jose, USA) 152

and reconstituted to a final concentration of 100μM (master stock) prior to dilution to a 153

working stock of 6μM. Primer sequences used for quantifying the gene expression levels are as 154

follows: Stat1 forward (for): GAAAGTATTACTCCAGGCCAAAGG, Stat1 reverse (rev): 155

TGTAAACATGTCACTCTTCTGTGTTCA, CCL5 for: TCTACACCAGTGGCAAGTGCTC, CCL5 rev: 156

CCCGAACCCATTTCTTCTCTG, CXCL10 for: CTTTCTGACTCTAAGTGGCATTCAAG, CXCL10 rev: 157

TGGATTAACAGGTTGATTACTAATGCTG, CXCL11 for: CCTTGGCTGTGATATTGTGTGC, CXCL11 rev: 158

GAGGCTTTCTCAATATCTGCCAC, IFIT1 for: CTGGGTATGCGATCTCTGCC, IFIT1 rev: 159

TTAAGCGGACAGCCTGCC, IFNB1 for: GCAGTTCCAGAAGGAGGACG, IFNB1 rev: 160

TCCAGCCAGTGCTAGATGAATC, IL-8 for: CAGCCTTCCTGATTTCTGCAG, IL-8 rev: 161


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

AGGTTTGGAGTATGTCTTTATGCACTG, ISG15 for: ATCTTTGCCAGTACAGGAGCTTG, ISG15 rev: 162

GACACCTGGAATTCGTTGCC, MX-1 for: GGAGGAGATCTTTCAGCACCTG, MX-1 rev: 163

GCCGTACGTCTGGAGCATG, ephrin-B2 for: TCCAGAACTAGAAGCTGGTACAAATG, ephrin-B2 rev: 164

GAATGTCCGGCGCTGTTG, ephrin-B3 for: GTCTGAAATGCCCATGGAAAGA and ephrin-B3 rev: 165

GAGGTTGCATTGCTGGTGG. Reverse transcription was performed on 1μg of total RNA 166

(previously assayed via Affymetrix GeneChip) with random primers, utilizing TaqMan reverse 167

transcription reagents (Applied Biosystems, Foster City, USA) as recommended by the 168

manufacturer. Although the mass of input RNA should not be utilized for normalization 169

purposes, amounts of input RNA to be assayed should be equivalent. The reverse transcription 170

reaction was used as template for the subsequent PCR, consisting of FastStart Universal SYBR 171

Green PCR Master Mix (ROX) (Roche, Indianapolis, USA), 1μl template cDNA and assay primers 172

(300nM final concentration) in a total reaction volume of 25 μl. Thermal cycling was carried out 173

with an ABI prism 7500 sequence detection system (Life Technologies, Carlsbad, USA) under 174

factory defaults (50oC, 2 min; 95oC, 10 min; and 40 cycles at 95oC, 15 S; 60oC, 1 min). Threshold 175

cycle numbers (Ct) were defined as fluorescence values, generated by SYBR green binding to 176

double-stranded PCR products, exceeding baseline. Relative transcript levels were quantified as 177

a comparison of measured Ct values for each reaction to a designated control via the ΔΔCt 178

method (29). In order to normalize for template input, 18S rRNA (endogenous control) 179

transcript levels were measured for each sample and utilized in these calculations. A student T-180

test was applied to 18S rRNA CT values to rule out any change in expression of the endogenous 181

control due to treatment. Fold change values were calculated as a log2 ratio of the ΔΔCt 182

averages of the biological replicates. 183


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Milliplex Analysis. Cytokine/chemokine concentrations in the supernatant of 184

henipavirus- infected NHBE and SAEC cells were determined using a Milliplex Human Cytokine 185

PREMIXED 28 Plex Immunoassay Kit (Millipore, Billerica, USA). Prior analysis, samples were 186

inactivated on dry ice by gamma-radiation (5 Mrad). The assay was performed according to the 187

manufacturer’s instructions. The Human Cytokine Standards were prepared using the NHBE and 188

SAEC medium. The concentration of 28 cytokines (Epidermal Growth Factor (EGF), Granulocyte-189

Colony Stimulating Factor (G-CSF), Granulocyte Macrophage-Colony Stimulating Factor (GM-190

CSF), interferon (IFN)-α2, IFNγ, Interleukin (IL)-1α, IL-1ß, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, 191

IL-12(p40), IL-12(p70), IL-13, IL-15, IL-17A, chemokine ligand 3-like 1 (CCL3L1 or MIP-1α), 192

chemokine ligand 4 (CCL4 or MIP-1ß), chemokine ligand 10 (IP-10 or CXCL10), chemokine ligand 193

11 (CCL11 or Eotaxin), chemokine ligand 13 (CCL13 or MCP-1), Tumor Necrosis Factor (TNF-α), 194

Lymphotoxin alpha (TNFß) and Vascular Endothelial Growth Factor A (VEGF)) were quantified. 195

Western Blot Experiments. To characterize the levels of IFN antagonism in henipavirus-196

infected NHBE and SAEC cells, 1000IU/ml IFNß was added for 1h to stimulate cells at 12, 18 and 197

24h post infection. The cell lysates were then harvested and the expression of signal transducer 198

and activator of transcription 1 (Stat1) and phosphorylated (p)-Stat1 were quantified by 199

western blot. Samples were inactivated by lysing in 2X SDS lysing Buffer (0.5 M Tris-HCl at pH 200

6.8; 20% glycerol; 10% (w/v) SDS; 0.1% (w/v) bromophenol blue and 2-Mercaptoethanol at 201

5.0% final concentration) and heating for 5 min at 100°c. Proteins were runned on SDS-PAGE, 202

transferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, USA) and blocked in a 203

Superblock buffer (Thermo-Scientific, Logan, USA) before immunodetection. A rabbit polyclonal 204

IgG was used for Stat1 p84/p91 detection (Santa Cruz Biotechnology, Santa Cruz, USA) and for 205


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

p-Stat1(Y701) p84/p91 detection (Cell Signaling Technology, Danvers, USA). A sheep polyclonal 206

antibody to rabbit IgG conjugated to HRP was used as secondary antibody for Stat1 and p-Stat1 207

detection. Beta-actin was used as loading control and was detected using a mouse monoclonal 208

antibody directly conjugated to HRP (abcam, Cambridge, USA). Stat1 and p-Stat1 expression 209

were quantified with Quantity One Software during henipavirus infection at 12, 18 and 24 hpi 210

(experiment performed in triplicate). The Stat1 and p-Stat1 intensities were corrected by 211

dividing by the actin intensity. The ratio pStat1/Stat1 was then generated using the p-Stat1 and 212

Stat1 corrected intensities. 213

Statistical analyses. Comparison of virus replication levels, gene expression fold changes 214

by QPCR assay, concentrations of cytokine/chemokine and of ratios pStat1/Stat1 were 215

subjected to a repeated measure one-way ANOVA test in which the virus strain used (or control 216

versus virus) was the independent variable. When the ANOVAs revealed a significant main 217

effect, a post-hoc test such as Bonferroni’s multiple comparison test was used to determine 218

whether treatment means were significantly different from one another. Comparison of NiV-M 219

or NiV-B or HeV replication levels in cells untreated/treated by IFN was performed using the 220

Paired T test. All data are presented in figures as means ± SD (* p< 0.05, ** p< 0.01, *** p< 221

0.001, **** p< 0.0001). 222

223

224

225

226

227


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

RESULTS 228

229

Primary human epithelial cells derived from the bronchi and the small airway are highly 230

susceptible to henipavirus infection. Epithelial cells derived from the bronchi (NHBE) and the 231

small airways (SAEC) of the human respiratory tract were investigated as potential initial sites of 232

henipavirus replication. Both cell types expressed the henipavirus receptors ephrin-B2 and –B3, 233

suggesting they are permissive for infection. Gene expression of ephrin-B2 in SAEC was 2-fold 234

higher compared to NHBE. In contrast, ephrin-B3 gene expression in NHBE was 5-fold higher 235

than in SAEC. Upon infection, both NHBE and SAEC cells were highly permissive to NiV-M, NiV-B 236

and HeV replication. Using a MOI of 5 to synchronize infection, the first cytopathic effect (CPE), 237

characterized by syncytia formation, in NHBE and SAEC-infected cells was observed as early as 238

12 to 18h post infection (pi), independent of the virus strain. NiV-infected cells showed 239

extensive syncytia formation compared to HeV-infected cells at 24h pi (Figure 1A, 1B). NHBE 240

and SAEC cultures infected with any of the henipavirus strains showed complete CPE by 48h pi. 241

HeV and NiV replication was able to reach a high titer (greater than 106.5 TCID50/ml) in both 242

NHBE and SAEC cells at 32h pi. No significant differences between replication of the two NiV 243

strains and HeV were observed in NHBE cells at any time point up to 48h pi (figure 1C). In 244

contrast, in SAEC cells, HeV replicated significantly faster up to 18h pi (105.2TCID50/ml) 245

compared to NiV-M and NiV-B (103.9 and 103.8 TCID50/ml, respectively; p<0.05). 246

Study of gene expression in henipavirus-infected NHBE and SAEC cells. Characterization of the 247

global henipavirus-host interactions in SAEC and NHBE cells were performed by microarray 248

analysis at 24h pi, a time point at which virus titers were identical for all three viruses (Figure C 249


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

and D) and differential expression of host immune response-related genes, such as IL-6, MX-1 250

and CXCL10, was highest based on preliminary data performed by real-time QRT-PCR assays 251

(data not shown). A global analysis of the data by microarray showed that NiV-M induced a 252

larger number of differentially expressed genes (n) in NHBE and SAEC cells (n=2540 and 2223, 253

respectively) compared to NiV-B (n=1817 and 1836, respectively) or HeV (n=2075 and 1642, 254

respectively, Figure 2A). More than half of those differentially expressed genes in infected NHBE 255

or SAEC cells were common to all 3 virus strains (Figure 2B). 256

To gain more insight into the immune response against henipavirus infection in NHBE and SAEC 257

cells, the most significant functional annotations were determined by Ingenuity Pathway 258

Analysis using all differentially expressed genes per condition (i.e NiV-M or NiV-B or HeV in 259

NHBE or SAEC cells, figure 3A and B). In NHBE cells, the data showed that NiV-M was the only 260

virus that did not affect the expression of genes related to the antimicrobial response, the cell-261

mediated immune response and to the immune cell trafficking. Also, NiV-M infection in NHBE 262

cells affected very few genes from the inflammatory response compared to NiV-B or HeV 263

(figure 3A) but triggered twice more differentially expressed genes in the infectious disease 264

group compared to NiV-B infection. In SAEC cells, NiV-M and NiV-B infection triggered a similar 265

number of differentially expressed genes related to the inflammatory response, the infectious 266

disease, the cell-mediated immune response and to the immune cell trafficking but did not 267

modify the expression of genes related to the antimicrobial response (Figure 3B). Finally, HeV 268

infection triggered at least three times more differentially expressed genes related to the 269

inflammatory response than NiV-M or NiV-B infection. 270


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

The most significant immune response-related canonical pathways were then determined using 271

all differentially expressed genes. In NHBE cells, the IFN signaling pathway and the role of 272

Pattern Recognition Receptors (PRR) pathway, that included Toll-like receptors signaling and 273

RIG-I-like receptors signaling, were in the top ten list of the total canonical pathways affected 274

by HeV (Figure 3C) as with the IL-6 and IFN signaling pathway in SAEC cells (figure 3D). None of 275

these pathways in NHBE or SAEC cells were reported in such a high rank or could even be 276

considered (p>0.05) using NiV-M or NiV-B (figure 3C and D). Surprisingly, no immune response-277

related canonical pathways were observed in the top ten list of the total canonical pathways 278

affected by NiV infection in NHBE and SAEC cells with the exception of B cell receptor signaling 279

in NiV-B-infected NHBE cells. In addition, the p-values associated to IL-6 and 8 signaling during 280

NiV-B infection in NHBE cells were more significant than in HeV or NiV-M infection (Figure 3C). 281

The p-values associated to IL-6 and 8 signaling were significant in NiV-M infection but not 282

during NiV-B infection in SAEC cells (Figure 3D). Finally, an analysis of the differentially 283

expressed genes that were unique to NiV-M or NiV-B infection (Figure 2B) did not show any 284

immune response-related canonical pathway in both NHBE and SAEC cells (p>0.05). However, 285

using HeV, the role of PRR, the IFN signaling and the role of RIG-I-like receptors in antiviral 286

innate immunity pathway had significant p-values in NHBE cells so as the IFN signaling, the IL-6, 287

the GM-CSF, the role of PRR in recognition of viruses and the IL-17 pathway in SAEC cells. 288

Overall, the fold changes for the most upregulated immune response-related genes were 289

higher in SAEC compared to NHBE cells using the same virus and in HeV- than in NiV-infected 290

cells (Table 1). It included chemokines (CCL5, CXCL10 and CXCL11), interleukins (IL-8, IL-24A), 291

interferon-induced proteins (IFIT1, IFIT3, MX-1, IFI6, IFI27, IFI44L) and interferon beta 1 (IFNB1). 292


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

The relative quantification of a subset of these upregulated genes in infected NHBE and SAEC 293

cells (CCL5, CXCL10, CXCL11, IFIT1, IL-8, ISG15, MX-1, Stat1 and IFNB1) were confirmed by real-294

time QPCR assays (Figure 4) which confirmed the fold change observed with the microarray 295

data (Table 1). 296

Cytokine/chemokine production by henipavirus-infected NHBE and SAEC cells. The amount of 297

a subset of cytokines and chemokines produced by henipavirus-infected NHBE and SAEC cells 298

was determined to confirm the gene expression results (Figure 5). Among a panel of 28 human 299

cytokines/chemokines tested, only 6 cytokines including G-CSF, GM-CSF, IL-1α, IL-6, IL-8 and 300

VEGF plus 3 chemokines such as CXCL10, MCP-1 and Eotaxin were detected in the supernatant 301

of NHBE or SAEC cells at 24h pi. Surprisingly, genes for G-CSF and MCP-1 were not significantly 302

expressed in the microarray analysis while their protein expression levels in the supernatant of 303

infected NHBE or SAEC cells were elevated at least 2-fold compared to non-infected NHBE or 304

SAEC cells. This was also true for GM-CSF in NHBE cells and for IL-1α in SAEC cells. Finally, the 305

quantity of IL-6, IL-8, VEGF, CXCL10 and Eotaxin detected in the supernatant of infected cells 306

were concomitant with their respective gene expression fold change. 307

With exception of VEGF, all cytokines/chemokines were secreted at consistently higher 308

concentrations in the supernatants of SAEC cells than in the supernatants of NHBE cells when 309

the same virus was used. Surprisingly, no significant difference could be noticed between NiV-310

M and NiV-B infection in the supernatant of infected NHBE or SAEC cells as to the amount of 311

cytokines/chemokines, with the exception of G-CSF and GM-CSF in NHBE cells (p<0.05). IL-1α 312

and CXCL10 were significantly higher in the supernatant of HeV- compared to NiV-M- or NiV-B-313

infected SAEC cells (p<0.001). This difference was also noticed in the supernatant of NHBE cells 314


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

with CXCL10 (p<0.001). Conversely, the level of MCP-1 was the only selected chemokine that 315

was in lower concentration in the supernatant of HeV-infected SAEC cells than in the 316

supernatant of NiV-infected SAEC cells. 317

Type I interferon pretreatment of epithelial cells derived from the bronchi and the small 318

airway can limit henipavirus replication. Since NiV and HeV have been shown to counteract the 319

innate immune response and particularly the type I interferon (IFN) response, the effect of IFN 320

treatment on virus replication in NHBE and SAEC cells was assessed (figure 6A and B). Cells 321

were treated with 1000UI/ml IFNß for 24h prior infection. IFN treatment of NHBE cells resulted 322

in complete inhibition of NiV-M and NiV-B replication while low levels of HeV replication were 323

observed at 32h pi (103.7, 103.5 and 104.8 TCID50/ml for NiV-M, NiV-B and HeV, respectively, 324

P>0.05). The mean virus titer of HeV, NiV-M and NiV-B at 32h pi was decreased by 2-3 log 325

(p>0.05), in NHBE cells pretreated with IFN. IFN treatment of SAEC cells delayed both NiV-M 326

and HeV replication up to 32h while NiV-B replication was observed as early as 24h pi (103.4, 327

104.7 and 103.6 TCID50/ml for NiV-M, NiV-B and HeV, respectively; P<0.001). The mean virus titer 328

of NiV-M, NiV-B or HeV at 32h pi was decreased 1-2 log (p<0.05), in IFN treated SAEC cells. 329

Characterization of the interferon immune response in henipavirus-infected NHBE and SAEC 330

cells. Based on the microarray results, the interferon signaling was one of the most significant 331

canonical pathways affected by HeV but not with NiV infection in both NHBE and SAEC cells at 332

24hpi. The ability of HeV and NiV strains to antagonize the interferon signaling was thus 333

assessed in time by quantifying the amount of phosphorylated (p)-Stat1. The levels of ß-actin 334

and Stat1 during henipavirus infection in NHBE or SAEC cells did not significantly change 335

compared their respective levels in non-infected cells at 12, 18 and 24h pi (data not shown). 336


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

However, henipavirus infection of NHBE and SAEC cells resulted in a significant reduction in 337

pStat1 induction following a 1hr treatment with 1000UI/ml IFNß as compared to non-infected 338

controls (Figure 7A and B). No significant difference in pStat1 induction between the 3 virus 339

strains was observed at 12hpi. Interestingly, activation of pStat1 was completely blocked by NiV-340

M as early as 18hpi (ratio pStat1/Stat1 of 0) but not by NiV-B or HeV (p<0.001). The quantity of 341

pStat1 in NiV-B or HeV-infected cells (ratio pStat1/Stat1 of 1.0 and 1.1 in NHBE cells, 342

respectively; ratio pStat1/Stat1 of 0.8 and 0.9 in SAEC cells, respectively) was however at that 343

time reduced by about 2 compared to p-Stat1 in non-infected NHBE or SAEC cells (ratio 344

pStat1/Stat1 of 1.9 and 2.1, respectively; p<0.001). Finally, no pStat1 could be detected in any of 345

the henipavirus-infected cells at 24h pi (ratio p-Stat1/Stat1 of 0) while the ratio in non-infected 346

NHBE or SAEC cells was equal to 1.2 and 1.0, respectively (p<0.001). 347

348

349

350

351

352

353

354

355

356

357


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

DISCUSSION 358

Hendra and Nipah viruses are newly emerging zoonotic viruses that can cause severe 359

respiratory illness and encephalitis in humans. Despite intensive studies, little is known about 360

the early stages of henipavirus infection in the human respiratory tract. Here we report the 361

establishment and characterization of NiV and HeV infection in human respiratory 362

epitheliumusing undifferentiated primary epithelial cell monolayers derived from bronchi and 363

small airways to study the role of the host responses in pathogenesis. 364

The epithelial cells derived from the bronchi (NHBE) and the small airways (SAEC) of the human 365

respiratory tract were highly susceptible to NiV and HeV infection as characterized by high peak 366

titers and characteristic syncytia formation as early as 12h pi. Although HeV initially replicated 367

faster than NiV-M and NiV-B in the small airways, all virus strains reached a similar peak of 368

replication as early as 32h pi in both cell types, making them likely targets for virus infection 369

during natural infection. The efficient replication of HeV in bronchi derived epithelial cells was 370

surprising as we previously observed that HeV antigen could not be detected in the epithelium 371

of trachea and bronchi of infected hamsters, suggesting limited replication in these cells (53). 372

One explanation is that this observation is species specific. Another key difference is the fact 373

that we used undifferentiated epithelial cells in the current study. The conditions present in 374

tissue culture result in a de-differentiation and subsequent loss of beating cilia which may affect 375

virus entry and replication by an unidentified mechanism. Studies into the role of epithelial 376

differentiation in virus susceptibility and host responses are ongoing. Both NHBE and SAEC cell 377

types have previously been used as in vitro models to study a variety of respiratory viruses 378

including other members of the Paramyxoviridae family such as measles virus and respiratory 379


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

syncytial virus (38, 63). Overall, these data suggest that human epithelial cells derived from the 380

bronchi and the small airways are highly relevant to study henipavirus replication in the 381

respiratory epithelium.. 382

The global analysis of host gene expression revealed two major characteristics. First, henipavirus 383

infection of SAEC resulted in higher fold changes in host gene expression compared to NHBE 384

cells, suggesting that epithelial cells derived from different areas of the human respiratory tract 385

respond differentially to henipavirus infection. This result is in line with the observations that 386

NiV infection in humans cases, as well as in hamsters, resulted in inflammation of the small 387

airways but not the bronchi (53, 71). Secondly, infection of NHBE and SAEC with NiV-M, NiV-B 388

and HeV resulted in differences in induction of host immune response between these 389

genetically distinct henipavirus strains. Overall, host responses were higher in HeV infected 390

cells, compared to both NiV strains. Specifically, NiV-M infection in NHBE cells resulted in 391

differential expression of very few number of genes related to the inflammatory response, 392

compared to NiV-B or HeV. This is in agreement with the observation that no inflammation 393

occurred in the epithelium of bronchi in NiV-M-infected patients (71) and suggests that 394

inflammation may occur in the bronchi of NiV-B or HeV infected patients even though no 395

histopathological changes have been reported so far in this area. Our data clearly showed that 396

key inflammatory mediators, including IL-6, IL-8, CXCL10, MCP-1 and CCL5, were highly 397

upregulated in SAEC but not in NHBE cells infected with henipavirus. Interestingly, HeV induced 398

higher levels of these cytokines and chemokines compared to both NiV strains with the 399

exception of MCP-1. IL-6, which is released by epithelial cells and macrophages in the 400

respiratory tract, promotes pulmonary inflammation, and high levels in bronchoalveolar lavage 401


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

fluid or in serum are correlated with severity and mortality of Acute Respiratory Distress 402

Syndrome (ARDS) (20, 28) and with severe disease including respiratory insufficiency in 403

pandemic H1N1 influenza-infected patient (5, 43), respectively. In addition, inhibition of IL-6 404

reduces lung injury in mice with acute kidney injury by reducing the levels of IL-8 and neutrophil 405

influx in the lung (26). In line with the previous statement, IL-8 has also been shown to control 406

neutrophil-mediated inflammation during rhinovirus infection (65), to contribute in the 407

pathogenesis of ARDS (24, 36, 51, 66) and was recently reported at elevated levels in serum of 408

H5N1-infected patient especially in those who succumbed to the infection due to respiratory 409

insufficiency (13). Therefore, our data suggest that IL-6 and IL-8 play important roles in 410

inflammation of the small airways due to an increased neutrophil influx in the small airways, as 411

observed in NiV-M infected dogs (69) and in HeV infected swine (27), compared to the bronchi. 412

Chemokines such as CXCL10 and MCP-1 are macrophage chemo-attractants and, along with 413

CCL5, recruit circulating leukocytes to the inflamed tissue. Overexpression of CXCL-10 has 414

previously been reported in the lung of NiV-M and HeV infected hamsters and correlated with 415

the influx of inflammatory cells (35, 53). Its gene expression level in the lung of HeV infected 416

hamsters was also higher than in NiV infected hamsters (53), corroborating our observations in 417

infected NHBE and SAEC cells. Even though it has been described that MCP-1 can be released 418

from bronchial epithelium and contributes to the inflammatory pathology of bronchial asthma 419

(62), in the current study, MCP-1 was expressed in infected SAEC cells only. Similarly, CCL5 gene 420

expression was also mainly observed in infected SAEC cells, especially during HeV infection, 421

which suggest altogether an important role of macrophage and circulating leukocyte 422

recruitment in the small airways leading to a larger inflammatory response compared to the 423


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

bronchi. These results are in agreement with histopathological changes observed in the lung of 424

2 HeV-infected patients showing either an acute pulmonary syndrome with intra-alveolar 425

macrophages and other inflammatory cells in the small airways (70) or focal necrotizing 426

alveolitis with an influx of macrophages as well (60). This is also in line with the high levels of 427

the inflammatory cytokine IL-1α and granulocytes stimulating factor (G-CSF and GM-CSF) 428

secreted in the supernatant of infected SAEC cells and again mostly during HeV infection. 429

In addition to uncovering the role of several key regulators of inflammation, microarray data 430

also revealed differential gene expression in the signaling pathway of pattern recognition 431

receptor (PRR) activation in NiV-B and HeV infected cells but not with NiV-M. The RIG-I-like 432

receptor pathway was activated during HeV infection suggesting that type I interferon was 433

expressed in infected cells. This was confirmed by the increased IFN-β gene expression in all 434

infected cells, mainly in SAEC cells and especially during HeV-infection which was in line with 435

the activation of the IFNα/ß signaling pathway in HeV infected cells. Consequently, higher levels 436

of interferon-induced gene expression such as IFIT1, IFIT3, MX-1, ISG-15 and IFIT35 were 437

observed in HeV- than in NiV-infected cells. Surprisingly, the high expression of CXCL-10 in HeV 438

infected cells was independent of interferon gamma induction and could be the result of a 439

direct viral activation of steps in the interferon pathway (3, 39, 57). Interestingly, while NiV and 440

HeV infection resulted in complete inhibition of Stat1 activation at 24h pi, NiV-M was more 441

efficient at blocking Stat1 activation at earlier time points compared to NiV-B and HeV. This 442

result is in line with the differences of NiV-M replication levels in untreated cellular models and 443

pretreated by IFN type I, which were higher than HeV, suggesting a more important role of IFN 444

response blocking to satisfy NiV-M replication. Since growth kinetics for all three viruses were 445


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

similar, it is likely that the viral proteins P, V and W, that can each inhibit phosphorylation of 446

Stat1 (4, 12, 15, 45, 55, 61) differentially affect the IFN pathway dependent on the virus strain. 447

This differential induction of the IFN response may in turn affect virulence through an unknown 448

mechanism as suggested for a recently discovered henipavirus, Cedar virus (33) as well as for 449

influenza viruses. The non structural NS1 protein of influenza virus is the main viral IFN 450

antagonist and NS1 proteins of more virulent strains were recently reported as having a higher 451

interferon type I signaling inhibitory activity in vitro as well as contributing to a more persistent 452

infection in the upper and lower respiratory tract of ferrets (37). In outbreaks, the NiV-M strain 453

has been less virulent compared to the NiV-B strain despite an increased ability to block 454

interferon type I signaling in vitro. In various animal models, such as hamsters, ferrets and 455

African green monkeys, HeV has consistently been more virulent compared to NiV-M and NiV-B 456

despite being more sensitive to IFN (unpublished data). Interestingly, a NiV-M strain lacking 457

either the C or V protein did not cause any clinical signs in hamster which was possibly due to a 458

reduced replication ability as observed in vitro (74). These results suggest that viral proteins 459

with IFN antagonist functions can influence the virulence although the exact role of interferon 460

antagonism in the pathogenesis of henipaviruses remains unclear. 461

462

Finally, the high level of secreted VEGF, as observed in the supernatant of infected NHBE cells, 463

may play a role in airway remodeling, a phenomenon previously observed during rhinovirus-464

associated asthma exacerbations (49). The monolayer NHBE cells used in this study define a 465

simplified model but if relevant in vivo, the VEGF overexpression might affect the subjacent 466

endothelial cells and lead to vascular leakage and increased permeability (72). This is part of 467


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

ongoing studies using a more complex in vitro model including both epithelial and endothelial 468

cells. To our knowledge, there is no study reporting a role of VEGF during henipavirus infection 469

or a remodeling of the respiratory tract in infected animals and in human cases. Its function in 470

the respiratory tract, and particularly in the bronchi, in facilitating henipavirus dissemination 471

into the vascular system is still unknown and requires further investigations. 472

In conclusion, our data show that henipaviruses are able to efficiently replicate in epithelial 473

cells derived from the bronchi and the small airways of the human respiratory tract. Infection of 474

these cells results in a higher inflammatory response in SAEC compared to NHBE cells, 475

especially during HeV infection including key inflammatory mediators; IL-6, 8, IL-1α, MCP-1, G-476

CSF, GM-CSF and CXCL10. Finally, we demonstrate a virus strain dependent variability in type I 477

IFN signaling. This study demonstrates that primary human epithelial cells derived from the 478

bronchi and the small airways serves as an important site of HeV and NiV replication suggesting 479

that both viruses have the potential for human-to-human transmission through aerosols. We 480

believe that these models allow for more detailed studies of the pathogenesis of respiratory 481

disease caused by HeV and NiV infection in humans. These data provide several target genes 482

and pathways that potentially play roles in henipavirus pathogenesis which will be valuable as 483

candidates for future studies of the mechanism of henipavirus pathogenesis and as potential 484

targets for treatment. 485

486

ACKNOWLEDGEMENTS 487


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

The study was funded by the University of Texas Medical Branch startup funds and by the 488

Intramural Research Program, NIAID, NIH. We also thank the Philippe Foundation for financial 489

support to OE. We thank Alisha Prather for critical review of the manuscript. 490

REFERENCES 491

492

1. Ali, R., A. W. Mounts, U. D. Parashar, M. Sahani, M. S. Lye, M. M. Isa, K. Balathevan, M. T. Arif, 493 and T. G. Ksiazek. 2001. Nipah virus among military personnel involved in pig culling during an 494 outbreak of encephalitis in Malaysia, 1998-1999. Emerging infectious diseases 7:759-761. 495

2. Anonymous. 2012. Nipah virus, fatal-Bangladesh: (Faridpur). ProMED-mail 2012. February 4, 496 2012, archive no. 20110204.0402. 497

3. Asensio, V. C., J. Maier, R. Milner, K. Boztug, C. Kincaid, M. Moulard, C. Phillipson, K. Lindsley, 498 T. Krucker, H. S. Fox, and I. L. Campbell. 2001. Interferon-independent, human 499 immunodeficiency virus type 1 gp120-mediated induction of CXCL10/IP-10 gene expression by 500 astrocytes in vivo and in vitro. Journal of virology 75:7067-7077. 501

4. Basler, C. F. 2012. Nipah and Hendra Virus Interactions with the Innate Immune System. Current 502 topics in microbiology and immunology. 503

5. Bermejo-Martin, J. F., R. Ortiz de Lejarazu, T. Pumarola, J. Rello, R. Almansa, P. Ramirez, I. 504 Martin-Loeches, D. Varillas, M. C. Gallegos, C. Seron, D. Micheloud, J. M. Gomez, A. Tenorio-505 Abreu, M. J. Ramos, M. L. Molina, S. Huidobro, E. Sanchez, M. Gordon, V. Fernandez, A. Del 506 Castillo, M. A. Marcos, B. Villanueva, C. J. Lopez, M. Rodriguez-Dominguez, J. C. Galan, R. 507 Canton, A. Lietor, S. Rojo, J. M. Eiros, C. Hinojosa, I. Gonzalez, N. Torner, D. Banner, A. Leon, P. 508 Cuesta, T. Rowe, and D. J. Kelvin. 2009. Th1 and Th17 hypercytokinemia as early host response 509 signature in severe pandemic influenza. Crit Care 13:R201. 510

6. Bossart, K. N., B. Rockx, F. Feldmann, D. Brining, D. Scott, R. Lacasse, J. B. Geisbert, Y. R. Feng, 511 Y. P. Chan, A. C. Hickey, C. C. Broder, H. Feldmann, and T. W. Geisbert. 2012. A hendra virus g 512 glycoprotein subunit vaccine protects african green monkeys from nipah virus challenge. Science 513 translational medicine 4:146ra107. 514

7. Chong, H. T., S. R. Kunjapan, T. Thayaparan, J. Tong, V. Petharunam, M. R. Jusoh, and C. T. Tan. 515 2002. Nipah encephalitis outbreak in Malaysia, clinical features in patients from Seremban. The 516 Canadian journal of neurological sciences. Le journal canadien des sciences neurologiques 517 29:83-87. 518

8. Chua, K. B., W. J. Bellini, P. A. Rota, B. H. Harcourt, A. Tamin, S. K. Lam, T. G. Ksiazek, P. E. 519 Rollin, S. R. Zaki, W. Shieh, C. S. Goldsmith, D. J. Gubler, J. T. Roehrig, B. Eaton, A. R. Gould, J. 520 Olson, H. Field, P. Daniels, A. E. Ling, C. J. Peters, L. J. Anderson, and B. W. Mahy. 2000. Nipah 521 virus: a recently emergent deadly paramyxovirus. Science 288:1432-1435. 522

9. Chua, K. B., C. L. Koh, P. S. Hooi, K. F. Wee, J. H. Khong, B. H. Chua, Y. P. Chan, M. E. Lim, and S. 523 K. Lam. 2002. Isolation of Nipah virus from Malaysian Island flying-foxes. Microbes and infection 524 / Institut Pasteur 4:145-151. 525

10. Chua, K. B., S. K. Lam, K. J. Goh, P. S. Hooi, T. G. Ksiazek, A. Kamarulzaman, J. Olson, and C. T. 526 Tan. 2001. The presence of Nipah virus in respiratory secretions and urine of patients during an 527 outbreak of Nipah virus encephalitis in Malaysia. The Journal of infection 42:40-43. 528


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

11. Chua, K. B., S. K. Lam, C. T. Tan, P. S. Hooi, K. J. Goh, N. K. Chew, K. S. Tan, A. Kamarulzaman, 529 and K. T. Wong. 2000. High mortality in Nipah encephalitis is associated with presence of virus 530 in cerebrospinal fluid. Annals of neurology 48:802-805. 531

12. Ciancanelli, M. J., V. A. Volchkova, M. L. Shaw, V. E. Volchkov, and C. F. Basler. 2009. Nipah 532 virus sequesters inactive STAT1 in the nucleus via a P gene-encoded mechanism. Journal of 533 virology 83:7828-7841. 534

13. de Jong, M. D., C. P. Simmons, T. T. Thanh, V. M. Hien, G. J. Smith, T. N. Chau, D. M. Hoang, N. 535 V. Chau, T. H. Khanh, V. C. Dong, P. T. Qui, B. V. Cam, Q. Ha do, Y. Guan, J. S. Peiris, N. T. Chinh, 536 T. T. Hien, and J. Farrar. 2006. Fatal outcome of human influenza A (H5N1) is associated with 537 high viral load and hypercytokinemia. Nature medicine 12:1203-1207. 538

14. Eaton, B. T., C. C. Broder, and L. F. Wang. 2005. Hendra and Nipah viruses: pathogenesis and 539 therapeutics. Current molecular medicine 5:805-816. 540

15. Fontana, J. M., B. Bankamp, and P. A. Rota. 2008. Inhibition of interferon induction and 541 signaling by paramyxoviruses. Immunological reviews 225:46-67. 542

16. Goh, K. J., C. T. Tan, N. K. Chew, P. S. Tan, A. Kamarulzaman, S. A. Sarji, K. T. Wong, B. J. 543 Abdullah, K. B. Chua, and S. K. Lam. 2000. Clinical features of Nipah virus encephalitis among 544 pig farmers in Malaysia. The New England journal of medicine 342:1229-1235. 545

17. Gurley, E. S., J. M. Montgomery, M. J. Hossain, M. Bell, A. K. Azad, M. R. Islam, M. A. Molla, D. 546 S. Carroll, T. G. Ksiazek, P. A. Rota, L. Lowe, J. A. Comer, P. Rollin, M. Czub, A. Grolla, H. 547 Feldmann, S. P. Luby, J. L. Woodward, and R. F. Breiman. 2007. Person-to-person transmission 548 of Nipah virus in a Bangladeshi community. Emerging infectious diseases 13:1031-1037. 549

18. Halpin, K., P. L. Young, H. E. Field, and J. S. Mackenzie. 2000. Isolation of Hendra virus from 550 pteropid bats: a natural reservoir of Hendra virus. The Journal of general virology 81:1927-1932. 551

19. Harit, A. K., R. L. Ichhpujani, S. Gupta, K. S. Gill, S. Lal, N. K. Ganguly, and S. P. Agarwal. 2006. 552 Nipah/Hendra virus outbreak in Siliguri, West Bengal, India in 2001. The Indian journal of 553 medical research 123:553-560. 554

20. Headley, A. S., E. Tolley, and G. U. Meduri. 1997. Infections and the inflammatory response in 555 acute respiratory distress syndrome. Chest 111:1306-1321. 556

21. Hooper, P., S. Zaki, P. Daniels, and D. Middleton. 2001. Comparative pathology of the diseases 557 caused by Hendra and Nipah viruses. Microbes and infection / Institut Pasteur 3:315-322. 558

22. Hossain, M. J., E. S. Gurley, J. M. Montgomery, M. Bell, D. S. Carroll, V. P. Hsu, P. Formenty, A. 559 Croisier, E. Bertherat, M. A. Faiz, A. K. Azad, R. Islam, M. A. Molla, T. G. Ksiazek, P. A. Rota, J. 560 A. Comer, P. E. Rollin, S. P. Luby, and R. F. Breiman. 2008. Clinical presentation of nipah virus 561 infection in Bangladesh. Clinical infectious diseases : an official publication of the Infectious 562 Diseases Society of America 46:977-984. 563

23. Hsu, V. P., M. J. Hossain, U. D. Parashar, M. M. Ali, T. G. Ksiazek, I. Kuzmin, M. Niezgoda, C. 564 Rupprecht, J. Bresee, and R. F. Breiman. 2004. Nipah virus encephalitis reemergence, 565 Bangladesh. Emerging infectious diseases 10:2082-2087. 566

24. Jorens, P. G., J. Van Damme, W. De Backer, L. Bossaert, R. F. De Jongh, A. G. Herman, and M. 567 Rampart. 1992. Interleukin 8 (IL-8) in the bronchoalveolar lavage fluid from patients with the 568 adult respiratory distress syndrome (ARDS) and patients at risk for ARDS. Cytokine 4:592-597. 569

25. Kent, W. J. 2002. BLAT--the BLAST-like alignment tool. Genome research 12:656-664. 570 26. Klein, C. L., T. S. Hoke, W. F. Fang, C. J. Altmann, I. S. Douglas, and S. Faubel. 2008. Interleukin-571

6 mediates lung injury following ischemic acute kidney injury or bilateral nephrectomy. Kidney 572 international 74:901-909. 573

27. Li, M., C. Embury-Hyatt, and H. M. Weingartl. 2010. Experimental inoculation study indicates 574 swine as a potential host for Hendra virus. Veterinary research 41:33. 575


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

28. Lin, W. C., C. F. Lin, C. L. Chen, C. W. Chen, and Y. S. Lin. 2010. Prediction of outcome in patients 576 with acute respiratory distress syndrome by bronchoalveolar lavage inflammatory mediators. 577 Exp Biol Med (Maywood) 235:57-65. 578

29. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time 579 quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 580

30. Lo, M. K., L. Lowe, K. B. Hummel, H. M. Sazzad, E. S. Gurley, M. J. Hossain, S. P. Luby, D. M. 581 Miller, J. A. Comer, P. E. Rollin, W. J. Bellini, and P. A. Rota. 2012. Characterization of Nipah 582 virus from outbreaks in Bangladesh, 2008-2010. Emerging infectious diseases 18:248-255. 583

31. Lo, M. K., and P. A. Rota. 2008. The emergence of Nipah virus, a highly pathogenic 584 paramyxovirus. Journal of clinical virology : the official publication of the Pan American Society 585 for Clinical Virology 43:396-400. 586

32. Maisner, A., J. Neufeld, and H. Weingartl. 2009. Organ- and endotheliotropism of Nipah virus 587 infections in vivo and in vitro. Thrombosis and haemostasis 102:1014-1023. 588

33. Marsh, G. A., C. de Jong, J. A. Barr, M. Tachedjian, C. Smith, D. Middleton, M. Yu, S. Todd, A. J. 589 Foord, V. Haring, J. Payne, R. Robinson, I. Broz, G. Crameri, H. E. Field, and L. F. Wang. 2012. 590 Cedar virus: a novel henipavirus isolated from Australian bats. PLoS pathogens 8:e1002836. 591

34. Marsh, G. A., and L. F. Wang. 2012. Hendra and Nipah viruses: why are they so deadly? Current 592 opinion in virology 2:242-247. 593

35. Mathieu, C., V. Guillaume, A. Sabine, K. C. Ong, K. T. Wong, C. Legras-Lachuer, and B. Horvat. 594 2012. Lethal Nipah virus infection induces rapid overexpression of CXCL10. PloS one 7:e32157. 595

36. McGuire, W. W., R. G. Spragg, A. B. Cohen, and C. G. Cochrane. 1982. Studies on the 596 pathogenesis of the adult respiratory distress syndrome. The Journal of clinical investigation 597 69:543-553. 598

37. Meunier, I., and V. von Messling. 2011. NS1-mediated delay of type I interferon induction 599 contributes to influenza A virulence in ferrets. The Journal of general virology 92:1635-1644. 600

38. Mochizuki, H., M. Todokoro, and H. Arakawa. 2009. RS virus-induced inflammation and the 601 intracellular glutathione redox state in cultured human airway epithelial cells. Inflammation 602 32:252-264. 603

39. Mossman, K. L., P. F. Macgregor, J. J. Rozmus, A. B. Goryachev, A. M. Edwards, and J. R. 604 Smiley. 2001. Herpes simplex virus triggers and then disarms a host antiviral response. Journal 605 of virology 75:750-758. 606

40. Mounts, A. W., H. Kaur, U. D. Parashar, T. G. Ksiazek, D. Cannon, J. T. Arokiasamy, L. J. 607 Anderson, and M. S. Lye. 2001. A cohort study of health care workers to assess nosocomial 608 transmissibility of Nipah virus, Malaysia, 1999. The Journal of infectious diseases 183:810-813. 609

41. Murray, K., P. Selleck, P. Hooper, A. Hyatt, A. Gould, L. Gleeson, H. Westbury, L. Hiley, L. 610 Selvey, B. Rodwell, and et al. 1995. A morbillivirus that caused fatal disease in horses and 611 humans. Science 268:94-97. 612

42. O'Sullivan, J. D., A. M. Allworth, D. L. Paterson, T. M. Snow, R. Boots, L. J. Gleeson, A. R. Gould, 613 A. D. Hyatt, and J. Bradfield. 1997. Fatal encephalitis due to novel paramyxovirus transmitted 614 from horses. Lancet 349:93-95. 615

43. Paquette, S. G., D. Banner, Z. Zhao, Y. Fang, S. S. Huang, A. J. Leomicronn, D. C. Ng, R. Almansa, 616 I. Martin-Loeches, P. Ramirez, L. Socias, A. Loza, J. Blanco, P. Sansonetti, J. Rello, D. Andaluz, B. 617 Shum, S. Rubino, R. O. de Lejarazu, D. Tran, G. Delogu, G. Fadda, S. Krajden, B. B. Rubin, J. F. 618 Bermejo-Martin, A. A. Kelvin, and D. J. Kelvin. 2012. Interleukin-6 is a potential biomarker for 619 severe pandemic H1N1 influenza A infection. PloS one 7:e38214. 620

44. Parashar, U. D., L. M. Sunn, F. Ong, A. W. Mounts, M. T. Arif, T. G. Ksiazek, M. A. Kamaluddin, 621 A. N. Mustafa, H. Kaur, L. M. Ding, G. Othman, H. M. Radzi, P. T. Kitsutani, P. C. Stockton, J. 622 Arokiasamy, H. E. Gary, Jr., and L. J. Anderson. 2000. Case-control study of risk factors for 623


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

human infection with a new zoonotic paramyxovirus, Nipah virus, during a 1998-1999 outbreak 624 of severe encephalitis in Malaysia. The Journal of infectious diseases 181:1755-1759. 625

45. Park, M. S., M. L. Shaw, J. Munoz-Jordan, J. F. Cros, T. Nakaya, N. Bouvier, P. Palese, A. Garcia-626 Sastre, and C. F. Basler. 2003. Newcastle disease virus (NDV)-based assay demonstrates 627 interferon-antagonist activity for the NDV V protein and the Nipah virus V, W, and C proteins. 628 Journal of virology 77:1501-1511. 629

46. Paton, N. I., Y. S. Leo, S. R. Zaki, A. P. Auchus, K. E. Lee, A. E. Ling, S. K. Chew, B. Ang, P. E. 630 Rollin, T. Umapathi, I. Sng, C. C. Lee, E. Lim, and T. G. Ksiazek. 1999. Outbreak of Nipah-virus 631 infection among abattoir workers in Singapore. Lancet 354:1253-1256. 632

47. Playford, E. G., B. McCall, G. Smith, V. Slinko, G. Allen, I. Smith, F. Moore, C. Taylor, Y. H. Kung, 633 and H. Field. 2010. Human Hendra virus encephalitis associated with equine outbreak, Australia, 634 2008. Emerging infectious diseases 16:219-223. 635

48. Premalatha, G. D., M. S. Lye, J. Ariokasamy, U. D. Parashar, R. Rahmat, B. Y. Lee, and T. G. 636 Ksiazek. 2000. Assessment of Nipah virus transmission among pork sellers in Seremban, 637 Malaysia. The Southeast Asian journal of tropical medicine and public health 31:307-309. 638

49. Psarras, S., E. Volonaki, C. L. Skevaki, M. Xatzipsalti, A. Bossios, H. Pratsinis, S. Tsigkos, D. 639 Gourgiotis, A. G. Constantopoulos, A. Papapetropoulos, P. Saxoni-Papageorgiou, and N. G. 640 Papadopoulos. 2006. Vascular endothelial growth factor-mediated induction of angiogenesis by 641 human rhinoviruses. The Journal of allergy and clinical immunology 117:291-297. 642

50. Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty percent endpoints. The 643 American Journal of Hygiene 27:493-497. 644

51. Rinaldo, J. E., and H. Borovetz. 1985. Deterioration of oxygenation and abnormal lung 645 microvascular permeability during resolution of leukopenia in patients with diffuse lung injury. 646 The American review of respiratory disease 131:579-583. 647

52. Rockx, B., K. N. Bossart, F. Feldmann, J. B. Geisbert, A. C. Hickey, D. Brining, J. Callison, D. 648 Safronetz, A. Marzi, L. Kercher, D. Long, C. C. Broder, H. Feldmann, and T. W. Geisbert. 2010. A 649 novel model of lethal Hendra virus infection in African green monkeys and the effectiveness of 650 ribavirin treatment. Journal of virology 84:9831-9839. 651

53. Rockx, B., D. Brining, J. Kramer, J. Callison, H. Ebihara, K. Mansfield, and H. Feldmann. 2011. 652 Clinical outcome of henipavirus infection in hamsters is determined by the route and dose of 653 infection. Journal of virology 85:7658-7671. 654

54. Rockx, B., R. Winegar, and A. N. Freiberg. 2012. Recent progress in henipavirus research: 655 Molecular biology, genetic diversity, animal models. Antiviral research. 656

55. Rodriguez, J. J., J. P. Parisien, and C. M. Horvath. 2002. Nipah virus V protein evades alpha and 657 gamma interferons by preventing STAT1 and STAT2 activation and nuclear accumulation. 658 Journal of virology 76:11476-11483. 659

56. Rogers, R. J., I. C. Douglas, F. C. Baldock, R. J. Glanville, K. T. Seppanen, L. J. Gleeson, P. N. 660 Selleck, and K. J. Dunn. 1996. Investigation of a second focus of equine morbillivirus infection in 661 coastal Queensland. Australian veterinary journal 74:243-244. 662

57. Ruvolo, V., L. Navarro, C. E. Sample, M. David, S. Sung, and S. Swaminathan. 2003. The Epstein-663 Barr virus SM protein induces STAT1 and interferon-stimulated gene expression. Journal of 664 virology 77:3690-3701. 665

58. Sahani, M., U. D. Parashar, R. Ali, P. Das, M. S. Lye, M. M. Isa, M. T. Arif, T. G. Ksiazek, and M. 666 Sivamoorthy. 2001. Nipah virus infection among abattoir workers in Malaysia, 1998-1999. 667 International journal of epidemiology 30:1017-1020. 668

59. Selvey, L., and J. Sheridan. 1995. Outbreak of Severe Respiratory Disease in Humans and Horses 669 Due to a Previously Unrecognized Paramyxovirus. Journal of travel medicine 2:275. 670


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

60. Selvey, L. A., R. M. Wells, J. G. McCormack, A. J. Ansford, K. Murray, R. J. Rogers, P. S. 671 Lavercombe, P. Selleck, and J. W. Sheridan. 1995. Infection of humans and horses by a newly 672 described morbillivirus. The Medical journal of Australia 162:642-645. 673

61. Shaw, M. L., A. Garcia-Sastre, P. Palese, and C. F. Basler. 2004. Nipah virus V and W proteins 674 have a common STAT1-binding domain yet inhibit STAT1 activation from the cytoplasmic and 675 nuclear compartments, respectively. Journal of virology 78:5633-5641. 676

62. Sousa, A. R., S. J. Lane, J. A. Nakhosteen, T. Yoshimura, T. H. Lee, and R. N. Poston. 1994. 677 Increased expression of the monocyte chemoattractant protein-1 in bronchial tissue from 678 asthmatic subjects. American journal of respiratory cell and molecular biology 10:142-147. 679

63. Takeuchi, K., N. Miyajima, N. Nagata, M. Takeda, and M. Tashiro. 2003. Wild-type measles 680 virus induces large syncytium formation in primary human small airway epithelial cells by a 681 SLAM(CD150)-independent mechanism. Virus research 94:11-16. 682

64. Tan, C. T., and K. S. Tan. 2001. Nosocomial transmissibility of Nipah virus. The Journal of 683 infectious diseases 184:1367. 684

65. Teran, L. M., S. L. Johnston, J. M. Schroder, M. K. Church, and S. T. Holgate. 1997. Role of nasal 685 interleukin-8 in neutrophil recruitment and activation in children with virus-induced asthma. 686 American journal of respiratory and critical care medicine 155:1362-1366. 687

66. Weiland, J. E., W. B. Davis, J. F. Holter, J. R. Mohammed, P. M. Dorinsky, and J. E. Gadek. 1986. 688 Lung neutrophils in the adult respiratory distress syndrome. Clinical and pathophysiologic 689 significance. The American review of respiratory disease 133:218-225. 690

67. Weingartl, H. M., Y. Berhane, and M. Czub. 2009. Animal models of henipavirus infection: a 691 review. Vet J 181:211-220. 692

68. Williamson, M. M., and F. J. Torres-Velez. 2010. Henipavirus: a review of laboratory animal 693 pathology. Veterinary pathology 47:871-880. 694

69. Wong, K. T., and K. C. Ong. 2011. Pathology of acute henipavirus infection in humans and 695 animals. Pathology research international 2011:567248. 696

70. Wong, K. T., T. Robertson, B. B. Ong, J. W. Chong, K. C. Yaiw, L. F. Wang, A. J. Ansford, and A. 697 Tannenberg. 2009. Human Hendra virus infection causes acute and relapsing encephalitis. 698 Neuropathology and applied neurobiology 35:296-305. 699

71. Wong, K. T., W. J. Shieh, S. Kumar, K. Norain, W. Abdullah, J. Guarner, C. S. Goldsmith, K. B. 700 Chua, S. K. Lam, C. T. Tan, K. J. Goh, H. T. Chong, R. Jusoh, P. E. Rollin, T. G. Ksiazek, and S. R. 701 Zaki. 2002. Nipah virus infection: pathology and pathogenesis of an emerging paramyxoviral 702 zoonosis. The American journal of pathology 161:2153-2167. 703

72. Yancopoulos, G. D., S. Davis, N. W. Gale, J. S. Rudge, S. J. Wiegand, and J. Holash. 2000. 704 Vascular-specific growth factors and blood vessel formation. Nature 407:242-248. 705

73. Yob, J. M., H. Field, A. M. Rashdi, C. Morrissy, B. van der Heide, P. Rota, A. bin Adzhar, J. 706 White, P. Daniels, A. Jamaluddin, and T. Ksiazek. 2001. Nipah virus infection in bats (order 707 Chiroptera) in peninsular Malaysia. Emerging infectious diseases 7:439-441. 708

74. Yoneda, M., V. Guillaume, H. Sato, K. Fujita, M. C. Georges-Courbot, F. Ikeda, M. Omi, Y. Muto-709 Terao, T. F. Wild, and C. Kai. 2010. The nonstructural proteins of Nipah virus play a key role in 710 pathogenicity in experimentally infected animals. PloS one 5:e12709. 711

712

713

714


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Legends 715

716

Figure 1: Primary human epithelial cells from the respiratory tract are highly permissive to henipavirus 717

infection. Cultures of NHBE (A and C) and SAEC (B and D) cells were infected with NiV-M, NiV-B or HeV 718

as described in the Materials and Methods. Syncytia formation (A and B) observed at at 24h post 719

infection. Scale 10µm. The black arrows show syncytia in infected cells. Kinetics of henipavirus 720

replication in NHBE (C) and SAEC (D) cells. Results are expressed as the average of 3 repetitions, error 721

bars represent the standard deviation. The horizontal dotted line corresponds with the detection limit. * 722

p<0.05, ANOVA, Bonferroni’s multiple comparison test. 723

724

Figure 2: Global gene expression analysis of henipavirus infection in primary epithelial cells from the 725

respiratory tract. (A) Number of differentially expressed genes following NiV-M, NiV-B or HeV infection 726

in NHBE and SAEC cells compared to non-infected NHBE or SAEC cells at 24h post infection. Cut-off > 2, 727

p-value < 0.05 right-tailed Fisher Exact Method. (B) Venn diagrams showing unique and common 728

differentially expressed genes between NiV-M, NiV-B and HeV infected cells in NHBE (left panel) and 729

SAEC cells (right panel). 730

731

Figure 3: Gene expression analysis of henipavirus infection in primary epithelial cells from the 732

respiratory tract. Number of differentially expressed genes in the most significant biological functional 733

groups in NHBE (A) and SAEC (B) cells at 24h post infection (pi). The most significant biological canonical 734

pathways in NHBE (C) and SAEC (D) cells at 24h pi. The horizontal dotted line represents the false 735

discovery rate fixed at 5% (p-value>0.05), with the p-value scale on the left Y axis. The ratio (dotted line) 736

is the number of overlapping genes from a particular pathway (scale on the right Y axis). 737

738

Figure 4: Expression of the most upregulated genes of the immune response and interferon signaling 739

in henipavirus-infected NHBE and SAEC cells. Real time QPCR analysis of the expression of CCL5, 740

CXCL10, CXCL11, IFIT1, IL-8, ISG-15, MX-1, IFNB1 and Stat1 compared to non-infected NHBE or SAEC cells 741

at 24h post infection. Results are expressed as the average of 3 repetitions and bars represent standard 742

deviation. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ANOVA, Bonferonni’s multiple comparison 743

test. 744

745


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Figure 5: Quantification of the principal cytokines/chemokines secreted in the supernatant of NHBE 746

and SAEC cells at 24h pi. Cytokines and chemokines are quantified in infected or non-infected cells as 747

described in Materials and Methods. Results are expressed as the average of 3 repetitions and bars 748

represent standard deviation. * p<0.05, **p<0.01, ***p<0.001, **** p<0.0001, ANOVA, Bonferroni’s 749

multiple comparison test. 750

751

Figure 6: Type I interferon pretreatment of epithelial cells from the bronchi and the small airways can 752

limit henipavirus replication. A and B, kinetic of virus replication in NHBE and SAEC cells untreated (full 753

lines) or pretreated with 1000UI/ml of IFNB1 for 24h prior infection (dotted lines). Results are expressed 754

as the average of 3 repetitions with the standard deviation. The horizontal dotted line corresponds to 755

the detection limit. *, # and ^ correspond to significant differences of virus replication levels between 756

untreated and IFN treated cells using the same strain, using both NiV strains and using HeV, respectively 757

(p<0.05, Paired T test). 758

759

Figure 7: Expression and activation of Stat1 during henipavirus infection in human primary epithelial 760

cells from the respiratory tract. Prior protein harvesting, all cells were treated with 1000IU/ml of IFNB1 761

for 1h (see Materials and Methods). Experiment was performed in triplicate. The Stat1 and 762

phosphorylated Stat1 were detected by western blot and the intensities were corrected using the beta 763

actin loading control. The ratio pStat1/Stat1 in non- and infected cells is plotted in A and B for NHBE 764

and SAEC cells, respectively. * p<0.05, **p<0.01, ***p<0.001, ANOVA, Bonferroni’s multiple comparison 765

test. 766


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Name Gene ID for

Human

Description Fold change NiV-

M

Fold change NiV-

B

Fold change HeV Function

NHBE SAEC NHBE SAEC NHBE SAEC

CXCL11 6373 chemokine (C-X-C motif) ligand 11 27.9 147.6 24.5 114.6 70.4 309.9 Immune response

CTH 1491 cystathionase (cystathionine gamma-lyase) 17.0 3.8 16.1 2.6 15.7 3.8 Immune response

IL13RA2 3598 interleukin 13 receptor, alpha 2 13.7 6.8 18.8 12.2 12.7 10.2 Immune response

TSLP 85480 thymic stromal lymphopoietin 11.3 11.3 13.4 10.1 9.7 12.0 Immune response

ISG15 9636 ISG15 ubiquitin-like modifier 9.1 23.1 8.6 15.3 21.5 27.8 Immune response

ATF3 467 activating transcription factor 3 4.2 4.0 4.3 4.7 5.2 9.4 Immune response

CXCL2 2920 chemokine (C-X-C motif) ligand 2 4.1 - 6.2 - 10.2 4.6 Immune response

CXCL10 3627 chemokine (C-X-C motif) ligand 10 3.8 5.0 3.7 3.8 16.4 39.8 Immune response

BIRC3 330 baculoviral IAP repeat containing 3 3.6 6.8 4.9 11.2 6.0 12.7 Immune response

CCL5 6352 chemokine (C-C motif) ligand 5 2.5 14.1 2.1 7.5 2.2 17.1 Immune response

IL28A 282616 interleukin 28A (interferon, lambda 2) 2.4 - - - - 10.2 Immune response

IFI6 2537 interferon, alpha-inducible protein 6 2.2 5.0 3.9 7.4 20.7 20.3 Immune response

IFI44L 10964 interferon-induced protein 44-like 2.1 - 2.0 - 18.2 10.6 Immune response

IL8 3576 interleukin 8 - - 2.0 4.9 2.4 7.4 Immune response


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Table 1. The top upregulated genes in the immune response and interferon signaling of infected cells 1

OAS2 4939 2'-5'-oligoadenylate synthetase 2, 69/71kDa - 2.2 2.6 2.1 9.7 6.3 Immune response

IL24 11009 interleukin 24 - 4.4 - 10.3 - 3.7 Immune response

IFI27 3429 interferon, alpha-inducible protein 27 - 2.4 2.1 3.5 6.6 9.5 Immune response

ISG20 3669 interferon stimulated exonuclease gene 20kDa - 8.1 2.9 7.3 3.3 8.6 Immune response

CXCL3 2921 chemokine (C-X-C motif) ligand 3 - 2 - - 3.4 11.5 Immune response

IFIT1 3434 interferon-induced protein with tetratricopeptide

repeats 1

19.2 131.4 21.5 95.1 42.5 171.0 Interferon signaling

IFIT3 3437 interferon-induced protein with tetratricopeptide

repeats 3

4.6 17.4 5.1 12.5 11.2 21.7 Interferon signaling

STAT1 6772 signal transducer and activator of transcription 1 -2.5 - - - 4.7 2.0 Interferon signaling

OAS1 4938 2'-5'-oligoadenylate synthetase 1 - - 2.0 - 4.6 3.2 Interferon signaling

MX1 4599 myxovirus (influenza virus) resistance 1,

interferon-inducible protein p78 (mouse)

- - 2.2 - 10.4 7.7 Interferon signaling

IFNB1 3456 interferon, beta 1, fibroblast - 5.3 - 2.7 2.1 18.3 Interferon signaling

IFI35 3430 interferon-induced protein 35 - - - - 2.6 2.6 Interferon signaling

IFITM1 8519 interferon induced transmembrane protein 1 - - - 2.8 6.8 - Interferon signaling


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

henipavirus pathogenesis in human respiratory epithelial cells olivier escaffre1, viktoriya

Documents