higher education commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/ana... · web...
TRANSCRIPT
![Page 1: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/1.jpg)
In the name of Allah, the Most Beneficent, the Most Merciful
![Page 2: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/2.jpg)
Role of endophytic bacteria containing carbonic anhydrase in improving the photosynthesis and plant biomass of cereals at
different moisture regimes
By
ANA ASLAM
M.Sc. (Hons.) Soil Science 2005-ag-1704
A thesis submitted in partial fulfilment ofthe requirements for the degree
of
DOCTER OF PHILOSOPHY
In
SOIL SCIENCE
Institute of Soil & Environmental SciencesFaculty of Agriculture
University of Agriculture, Faisalabad, Pakistan 2019
![Page 3: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/3.jpg)
![Page 4: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/4.jpg)
![Page 5: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/5.jpg)
DEDICATED
To
My Beloved Parents, Husbandand
Respected Supervisor
Whose encouragement, spiritual inspiration and sincere prayers
motivated me to achieve my academic goals
![Page 6: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/6.jpg)
ACKNOWLEDGEMENTS All praises and humblest thanks are to Almighty ALLAH, the most Beneficent and the most Merciful, whose blessings flourished my thoughts to finally shape up the cherished fruit of my humble proceedings to this study. I pay my homage to Holly Prophet Hazrat Muhammad (P.B.U.H), the most perfect and exalted among us, who is forever a source of wisdom and knowledge for humanity as a whole.
I feel highly priviledge to express my heartiest gratitude to my honorable supervisor Dr. Zahir Ahmad Zahir, Professor, Institute of Soil & Environmental Sciences, University of Agriculture, Faisalabad, for his dynamic supervision, constant guidance, valuable suggestions, constructive and thoughtful criticism during the study. I am also thankful to Dr. Hafiz Naeem Asghar, Assistant Professor, Institute of Soil & Environmental Sciences Dr. Muhammad Shahid Associate Professor, Department of Chemistry and Biochemistry, University of Agriculture, Faisalabad, for their intellectual suggestion and cooperative guidance.
A deep sense of appreciation is owed to Dr. Muhammad Arshad (Late) (T.I.), (D.N.P), Professor, Institute of Soil & Environmental Sciences, University of Agriculture, Faisalabad, for his cooperative attitude, constructive criticism and valuable suggestion during the research study.
My sincere thanks are extended to Dr. Muhammad Naveed, Assistant professor, Institute of Soil & Environmental Sciences, University of Agriculture, Faisalabad, for his constant help, guidance and valuable discussion.
I feel utmost pleasure in expressing my gratitude to Dr. Peer Schenk, Professor, Dr. Lilia Costa Carvalhais, Plant microbe interaction Laboratory, The University of Queensland, Australia for their supportive attitude and kind guidance during my stay in Australia for opening a new era of research in plant microbe interaction
I am highly thankful to Higher Education Commission, Islamabad, Pakistan (HEC) for providing financial assistance and IRSIP.
Special and particular thanks are extended to my Fellows in the Soil Microbiology and Biochemistry Lab., for their help and cooperation to accomplish this script.
No acknowledgements could ever adequately express my obligations to my beloved Parents for their encouragement, love and support throughout my career. I can only say I am here just due to prayers of family specially my father. I am also grateful to my husband Muhammad Adeel for his supportive and motivative attitude. I can’t ignore my dear brother M. Usman and my sweet sisters Sana and Safina who have always inspired and encouraged me. Their prayers will be always with me for my success.
Cordial thanks to my friend Sakeena tul Ain Haider, and all other well-wishers for their encouragement and consistent support during my studies.
Ana Aslam
![Page 7: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/7.jpg)
![Page 8: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/8.jpg)
Chapter Title Page3.10. Plant analysis 353.10.1. Chemical analysis 353.10.2. Digestion 353.10.3. Nitrogen determination 353.10.4. Phosphorus determination 363.10.5. Potassium determination 363.10.6. Leaf relative water contents (RWC) 363.10.7. Electrolyte leakage 373.10.8 Chlorophyll content 373.10.9. Gaseous exchange parameter 373.10.10 Carbonic anhydrase activity 373.10.11. Proline content 383.10.12. Total protein content 383.10.13. Malondialdehyde content 383.10.14. Catalase in leaves 383.10.15. Glutathione reductase in leaves 393.10.16. Ascorbate peroxidase in leaves 393.10.17. Total phenolics in leaves 393.10.18. Total soluble sugars in leaves 393.10.19 Colonization of plant tissues 403.11. Characterization and identification of selected endophytic
bacteria40
3.11.1. Indole 3-acetic acid production under normal and stressed environment
40
3.11.2. Phosphate solubilization 413.11.2.1. Phosphate solubilization (plate assay) 413.11.2.2 Phosphate solubilization under normal and stressed conditions 413.11.3. Siderophore production 433.11.4. Exopolysaachride (EPS) production 433.11.5. Chitinase activity 433.11.6. Catalase activity 433.11.7. Oxidase activity 433.11.8 Organic acid production 453.11.9 Microbial aggregation ability 453.11.10 Survival under starved condition 453.11.11 Survival of bacterial inocula in soil 453.11.12 Cellulase activity 473.11.13 Xylanase activity 473.11.14 Protease activity 473.11.15 Identification of selected isolate 473.12. Influence of endophytic bacteria on gene expression in
Arabidopsis thaliana under drought stress47
3.12.1. Sample collection and isolation of endophytic bacteria from Arabidopsis
47
3.12.2. Screening of endophytic bacteria for stress tolerance and carbonic anhydrase activity
48
![Page 9: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/9.jpg)
Chapter Title Page3.12.3. Screening of selected bacterial isolates for plant growth
promotion under PEG-induced water deficit stress48
3.12.4. Effect of selected isolates on gene expression in Arabidopsis thaliana under PEG-induced water deficit stress
50
3.12.5. RNA extraction 503.12.6. Preparation of cDNA and primers sequence 503.12.7. Expression profiling through Real Time PCR 513.13. Statistical analysis 51Chapter 4 Results 544.1. Drought tolerance ability of endophytic bacteria 544.1.1. Drought tolerance ability of endophytic bacterial isolates from
wheat54
4.1.2. Drought tolerance enhancing ability of endophytic bacterial isolates of maize
57
4.2. Carbonic anhydrase activity of drought tolerant isolates 574.2.1. Carbonic anhydrase activity of drought tolerant wheat isolates 574.2.2. Carbonic anhydrase activity of drought tolerant maize isolates 574.3. Screening of selected drought tolerant CA containing
endophytic bacteria for plant growth promotion under axenic conditions
61
4.3.1. Screening of wheat isolates for growth promotion 614.3.1.1. Root length 614.3.1.2. Shoot length 614.3.1.3. Root fresh weight 654.3.1.4. Shoot fresh weight 654.3.1.5. Root dry weight 674.3.1.6. Shoot dry weight 674.3.1.7. Chlorophyll contents 694.3.1.8. Carbonic anhydrase activity 694.3.1.9. Photosynthetic rate 714.3.1.10. Transpiration rate 714.3.1.11. Stomatal conductance 734.3.1.12. Substomatal conductance 734.3.1.13. Relationship between photosynthetic rate and CA activity
exhibited by drought tolerant endophytic bacterial isolates75
4.3.2. Screening of maize isolates for growth promotion 754.3.2.1. Root length 754.3.2.2. Shoot length 754.3.2.3. Root fresh weight 804.3.2.4. Shoot fresh weight 804.3.2.5. Root dry weight 824.3.2.6. Shoot dry weight 824.3.2.7. Chlorophyll contents 844.3.2.8. Carbonic anhydrase activity in leaves 844.3.2.9. Photosynthetic rate 864.3.2.10. Transpiration rate 864.3.2.11. Stomatal conductance 88
![Page 10: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/10.jpg)
4.3.2.12. Substomatal conductance 88Chapter Title Page4.3.2.13. Relationship between photosynthetic rate and CA activity
exhibiting by drought tolerant endophytic bacteria90
4.5. Evaluation of selected GUS labeled endophytic bacterial isolates in pot trial
90
4.5.1. Effect of selected Gus labelled endophytic bacterial isolates on wheat
90
4.5.1.1. Plant height 904.5.1.2. Root dry weight 934.5.1.3. Soot dry weight 934.5.1.4. Carbonic anhydrase activity 934.5.1.5. Photosynthetic rate 954.5.1.6. Transpiration rate 954.5.1.7. Stomatal conductance 954.5.1.8. Relative water content (RWC) 974.5.1.9. Electrolyte leakage (EEL) 974.5.1.10. Proline Content 974.5.1.11 Melanaldehyde content 994.5.1.12. Grain yield 994.5.1.13. Colonization of plant tissues 994.5.1.14. Characterization of selected bacterial isolates for IAA
production under normal and stressed conditions101
4.5.1.15. Characterization of selected bacterial isolates for P solubilization under normal and stressed conditions
101
4.5.2. Study the selected Gus labeled endophytic bacterial isolates on maize
104
4.5.2.1. Plant height 1044.5.2.2. Root dry weight 1044.5.2.3. Shoot dry weight 1044.5.2.4. Carbonic anhydrase activity in leaves 1064.5.2.5. Photosynthetic rate 1064.5.2.6. Transpiration rate 1064.5.2.7. Stomatal conductance 1084.5.2.8. Relative water content (RWC) 1084.5.2.9. Electrolyte leakage (EEL) 1084.5.2.10. Proline content 1104.5.2.11. Melanaldehyde content (MDA) 1104.5.2.12. Grain yield 1104.5.2.13. Colonization of plant tissues 1124.5.2.14 Characterization of selected bacterial isolates for IAA
production under normal and stressed conditions112
4.5.2.14 Characterization of selected bacterial isolates for P solubilization under normal and stressed conditions
112
4.6. Evaluation of selected endophytic bacterial isolates in field trials
116
4.6.1. Evaluation of selected endophytic bacterial isolates for wheat 1164.6.1.1. Number of tillers 1164.6.1.2. Carbonic anhydrase activity 116
![Page 11: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/11.jpg)
4.6.1.3. Photosynthetic rate 116Chapter Title Page4.6.1.4. Transpiration rate 1184.6.1.5. Water use efficiency (WUE) 1184.6.1.6. Grain Yield 1184.6.1.7. Catalase contents 1204.6.1.8. Ascorbate peroxidase (APX) contents 1204.6.1.9. Glutathione reductase (GR) contents 1204.6.1.10. Total protein contents 1224.6.1.11. Total soluble sugars 1224.6.1.12. Total phenolic contents 1224.6.1.13. Grain nitrogen (%) 1244.6.1.14. Grain phosphorus (%) 1244.6.1.15. Grain potassium (%) 1244.6.2. Evaluation of selected endophytic bacterial isolates for maize 1264.6.2.1. Number of grains per cob 1264.6.2.2. Carbonic anhydrase activity 1264.6.2.3. Photosynthetic rate 1264.6.2.4. Transpiration rate 1284.6.2.5. Water use efficiency (WUE) 1284.6.2.6. Grain Yield 1284.6.2.7. Catalase contents 1304.6.2.8. Ascorbate peroxidase (APX) contents 1304.6.2.9. Glutathione reductase (GR) contents 1304.6.2.10. Total protein contents 1324.6.2.11. Total soluble sugars 1324.6.2.12. Total phenolic contents 1324.6.2.13. Grain nitrogen (%) 1344.6.2.14. Grain phosphorus (%) 1344.6.2.15. Grain potassium (%) 1344.7. Evaluation of potential endophytic bacterial isolates for gene
expression in Arabidopsis thaliana under PEG-induced water deficit conditions
136
4.7.1. Screening of endophytic bacterial isolates based on drought tolerance ability, CA activity and plant growth promotion
136
4.7.2. Effect of endophytic bacterial isolates on plant growth of Arabidopsis thaliana
136
4.7.2.1. Root length 1364.7.2.2 Number of lateral roots 1364.7.2.3. Root fresh weight 1364.7.2.3. Shoot fresh weight 1394.7.3. Effect of selected isolates on gene expression and
transcriptional response of Arabidopsis thaliana139
4.7.3.1. Expression pattern of dehydration responsive protein (RD22) 1394.7.3.2. Expression pattern of dehydration responsive element
(RD29B)139
4.7.3.3. Expression pattern of late embryogenesis (LEA) 1394.7.3.4. Expression pattern of dehydrin (RAB18) 141
![Page 12: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/12.jpg)
4.7.3.5. Expression of dehydration-response element binding protein 2A (DREB2A)
141
Chapter Title Page4.7.3.6. Expression of defense related gene (PR1.2.) 1414.7.3.7. Expression of WRKY57 transcription factors 1414.7.3.8. Expression of WRKY8 transcription factors 1414.7.3.9. Expression pattern of C2H2–Zinc finger protein (Zat 10) 1434.7.3.10. Expression pattern of dehydrins (COR47) 1434.7.3.11. Expression of ethylene responsive transcription factor 7
(AtERF 7)143
4.7.3.12. Expression pattern of dehydrins (LTI78) 1434.7.3.13. Expression pattern of MYB domain protein 15 (MYB 15) 1454.7.3.14. Expression pattern of abscisic acid dependent dehydrins
(ERD10)145
4.7.3.15. Expression of ethylene responsive factor (ERF 13) 1454.8. Characterization and identification of endophytic bacterial
isolates147
Chapter Discussion 1505.1. Drought tolerance ability of bacterial endophytes 1505.2. Carbonic anhydrase activity of drought tolerant isolates 1515.3. Screening of CA producing drought tolerant endophytic
bacteria for growth promotion in wheat and maize seedlings under PEG-imposed water deficit stress in axenic conditions
151
5.4. Evaluation of selected endophytic bacterial isolates for wheat and maize in pot trials
153
5.5. Interaction between endophytic bacterial population and plant tissues
155
5.6. Evaluation of selected endophytic bacterial isolates in field trial
156
5.7 Influence of drought tolerant CA containing endophytic bacteria on plant growth promotion and gene expression
159
Summary 161Future directions 164References 165
![Page 13: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/13.jpg)
List of TablesTable Title Page3.1. Phyico-chemical characteristics of the soils used for wheat and
maize trials34
3.2. Primer sequence for arabidopsis used in RT-PCR 524.1. Selected drought tolerant endophytic bacterial isolates from
wheat56
4.2. Selected drought tolerant endophytic bacteria isolates from maize
59
4.3. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot length of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
64
4.4. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot fresh weight of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
66
4.5. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot dry weight of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
68
4.6. Effect of drought tolerant CA containing endophytic bacterial isolates on chlorophyll content and CA activity in leaves of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
70
4.7. Effect of drought tolerant CA containing endophytic bacterial isolates on photosynthetic and transpiration rate of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
72
4.8. Effect of drought tolerant CA containing endophytic bacterial isolates on stomatal and substomatal conductance of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
74
4.9. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot length of drought tolerant(H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
79
4.10. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot fresh weight of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
81
4.11. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot dry weight of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG induced water deficit conditions
83
![Page 14: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/14.jpg)
Table Title Page4.12. Effect of drought tolerant CA containing endophytic bacterial
isolates on chlorophyll contents and carbonic activity of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
85
4.13. Effect of drought tolerant CA containing endophytic bacterial isolates on photosynthetic and transpiration rate of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
87
4.14. Effect of drought tolerant CA containing endophytic bacterial isolates on stomatal substomatal conductance of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
89
4.15. Characterization of selected drought tolerant endophytic bacterial isolates
148
![Page 15: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/15.jpg)
List of FiguresFig. Title Page4.1. Principal component analysis of optical density of endophytic
bacteria isolates from wheat at different PEG-6000 induced water deficit stress levels
55
4.2. Principal component analysis of optical density of endophytic bacteria isolates from maize at different PEG-6000 induced water deficit stress levels
58
4.3. Drought tolerant endophytic bacterial isolates from wheat with high carbonic anhydrase activity
60
4.4. Drought tolerant endophytic bacteria isolates from maize with their high carbonic anhydrase activity
60
4.5. Relationship between photosynthetic rate and carbonic anhydrase activity exhibited by drought tolerant endophytic bacterial isolates in wheat cv. Fsd-2008
76
4.6. Relationship between photosynthetic rate and carbonic anhydrase activity exhibited by drought tolerant endophytic bacterial isolates in wheat cv. Uqab-2000
76
4.7. Relationship between photosynthetic rate and carbonic anhydrase activity exhibited by drought tolerant endophytic bacterial isolates in maize hybrid (H1)
91
4.8. Relationship between photosynthetic rate and carbonic anhydrase activity exhibited by drought tolerant endophytic bacterial isolates in maize hybrid (H2)
91
4.9. Effect of drought tolerant CA containing endophytic bacteria on plant height (A), root dry weight (B) and shoot dry weight (C) in both wheat cultivars at different field capacity levels
92
4.10. Effect of drought tolerant CA containing endophytic bacteria on carbonic anhydrase activity (A), photosynthetic rate (B) and transpiration rate (C) in both wheat cultivars at different field capacity levels
94
4.11. Effect of drought tolerant CA containing endophytic bacteria on stomatal conductance (A), relative water content (B) and electrolyte leakage (C) in both wheat cultivars at different field capacity levels
96
4.12. Effect of drought tolerant CA containing endophytic bacteria on proline content (A), melanaldehyde (B) and grain yield (C) in both wheat cultivars at different field capacity levels
98
4.13. Colonization of root (A), shoot (B) and leaf (C) tissues with drought tolerant CA containing endophytic bacteria in both wheat cultivars at different field capacity levels
100
4.14. IAA production of drought tolerant CA containing endophytic bacterial isolates with reference to time
102
4.15. P-solubilization of drought tolerant CA containing endophytic bacterial isolates with reference to time
103
![Page 16: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/16.jpg)
Fig. Title Page4.16. Effect of drought tolerant CA containing endophytic bacteria
on plant height (A), root dry weight (B) and shoot dry weight (C) in both maize hybrids at different field capacity levels
105
4.17. Effect of drought tolerant CA containing endophytic bacteria on carbonic anhydrase activity (A), photosynthetic rate (B) and transpiration rate (C) in both maize hybrids at different field capacity levels
107
4.18. Effect of drought tolerant CA containing endophytic bacteria on stomatal conductance (A), relative water content (B) and electrolyte leakage (C) in both maize hybrids at different field capacity levels
109
4.19. Effect of drought tolerant CA containing endophytic bacteria on proline content (A), melanaldehyde content (B) and grain yield (C) in both maize hybrids at different field capacity levels
111
4.20. Colonization of root (A), shoot (B) and leaf (C) tissues with drought tolerant CA containing endophytic bacteria in both maize hybrids at different field capacity levels
113
4.21. IAA production of drought tolerant CA containing endophytic bacterial isolates with reference to time
114
4.22. P-solubilization of drought tolerant CA containing endophytic bacterial isolates with reference to time
115
4.23. Effect of drought tolerant CA containing endophytic bacteria on number of tillers (A), carbonic anhydrase activity (B) and photosynthetic rate (C)of wheat under water deficit stress
117
4.24. Effect of drought tolerant CA containing endophytic bacteria on transpiration rate (A), water use efficiency (B) and grain yield (C) of wheat under water deficit stress
119
4.25. Effect of drought tolerant CA containing endophytic bacteria on catalase (A), ascorbate peroxidase (B) and glutathione reductase (C) of wheat under water deficit stress
121
4.26 Effect of drought tolerant CA containing endophytic bacteria on total protein (A), total soluble sugars (B) and total phenolic content (C) of wheat under water deficit stress
123
4.27. Effect of drought tolerant CA containing endophytic bacteria on grain nitrogen (A), phosphorus (B) and potassium (C) of wheat under water deficit stress
125
4.28. Effect of drought tolerant CA containing endophytic bacteria on no. of grains per cob (A), carbonic anhydrase activity (B) and photosynthetic rate (C) of maize under water deficit stress
127
4.29 Effect of drought tolerant CA containing endophytic bacteria on transpiration rate (A), water use efficiency (B) and grain yield (C) of maize under water deficit stress
129
4.30 Effect of drought tolerant CA containing endophytic bacteria on catalase (A), ascorbate peroxidase (B) and glutathione reductase (C) content of maize under water deficit stress
131
![Page 17: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/17.jpg)
Fig. Title Page4.31 Effect of drought tolerant CA containing endophytic bacteria
total protein contents (A), total soluble sugars (B) and total phenolic contents (C) of maize under water deficit stress
133
4.32 Effect of drought tolerant CA containing endophytic bacteria on grain nitrogen (A), phosphorus (B) and potassium (C) of maize under water deficit stress
135
4.33. Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on root length (A) number of lateral roots (B), root fresh weight (C) and shoot fresh weight (D) in Arabidopsis thaliana under normal (0%) as well as PEG-mediated water deficit conditions (3%)
138
4.34 Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on stress responsive genes RD22 (A), RD29B (B), LEA (C) and RAB18 (D) in Arabidopsis thaliana under normal (0%) as well as PEG-mediated water deficit conditions (3%)
140
4.35. Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on DREB2A (A) PR1.2 (B) WRKY57 (C) and WRKY 8 (D) in Arabidopsis thaliana under normal (0%) as well as PEG-mediated water deficit conditions (3%)
142
4.36 Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on transcription factors and gene Zat 10 (A), COR47 (B), AtERF7 (C) and LTI78 (D) in Arabidopsis thaliana under normal (0%) as well as PEG- mediated water deficit conditions (3%).
144
4.37 Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on transcription factors and gene MYB15 (A), ERD10 (B), ERF13 (C) in Arabidopsis thaliana under normal (0%) as well as PEG-mediated water deficit conditions (3%)
146
4.38 Identification of selected endophytic bacterial isolates on the basis of 16S rRNA sequence similarities
149
![Page 18: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/18.jpg)
List of PicturesPicture Title Page1 Phosphorus solubilization by endophytic bacterial isolates 422 Exopolysacchride production by endophytic bacterial isolates 443 Catalase production by endophytic bacteria 464 Oxidase production by endophytic bacteria 465 Screening of drought tolerant CA containing endophytic
bacterial isolates for plant growth promotion in Arabidopsis thaliana under axenic conditions
49
6 Effect of drought tolerant CA containing endophytic bacteria on root length under normal conditions
62
7 Effect of drought tolerant CA containing endophytic bacteria on root length under PEG-induced water deficit conditions
62
8 Effect of drought tolerant CA containing endophytic bacterial isolates on shoot length under normal conditions
63
9 Effect of drought tolerant CA containing endophytic bacteria on shoot length under PEG-induced water deficit conditions
63
10 Effect of drought tolerant CA containing endophytic bacteria on root length under normal conditions
77
11 Effect of drought tolerant CA containing endophytic bacteria on root length under water deficit conditions
77
12 Effect of drought tolerant CA containing endophytic bacteria on shoot length under normal conditions
78
13 Effect of drought tolerant CA containing endophytic bacteria on shoot length under PEG-induced water deficit conditions
78
14 Effect of drought tolerant CA containing endophytic bacteria on Arabidopsis thaliana growth under normal conditions
137
15 Effect of drought tolerant CA containing endophytic bacteria on Arabidopsis thaliana growth under PEG-induced water deficit conditions
137
![Page 19: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/19.jpg)
AbstractClimate change is one of the serious threats to food security throughout the world
especially in arid and semi-arid regions, affecting agricultural productivity. Rapid
changes in global climate such as alteration in rain fall pattern and increase in temperature
lead to severe drought stress that limits the crop production by reducing photosynthetic
rate and suppressing plant growth. Endophytic bacteria containing carbonic anhydrase
may improve plant growth and elicit tolerance under water deficit stress by enhancing the
photosynthesis in plants. Carbonic anhydrase (CA) catalyzes the reversible conversion of
atmospheric carbon dioxide into bicarbonate, first substrate of photosynthesis in C3 and
C4 plants. Therefore, present study was conducted to assess the potential of drought
tolerant CA containing endophytic bacteria for improving photosynthesis and plant
biomass of cereals under different moisture regimes. One hundred and fifty bacterial
isolates were isolated form two cereals (wheat and maize) and tested for their ability to
tolerate PEG-induced water deficit conditions. Fifty isolates exhibiting higher drought
tolerance from each crop were further analyzed for CA activity. Ten drought tolerant
isolates with higher CA activity were further assessed for growth promotion in wheat
(C3) and maize (C4) plants. Isolates WR2, WS11 and WL19 showed higher
photosynthetic rate and plant growth in both wheat cultivars; however, increase was more
for Uqab-2000 than Fsd-2008 under PEG- induced water deficit conditions. Moreover,
isolates MR17, MS1 and MG9 gave significant increase in photosynthesis and plant
growth in both maize hybrids, especially for H2 hybrid under PEG-mediated water stress.
Selected isolates from both crops were labeled with Gus and tested for plant growth
promotion as well as colonization efficiency in wheat and maize under water deficit
stress. Inoculation of selected isolates showed significant results for photosynthesis,
growth and colonization efficiency of wheat and maize under well watered (100% FC)
and stressed (70 and 40%) conditions especially for Uqab-2000 and H2. In the same
ways, isolates WR2, WS11 and WL19 gave significant results for growth, physiology and
yield of wheat under field condition where water deficit stress was induced by skipping
irrigation at tillering, flowering and grain filling stage. On the other hand, inoculation
with isolates MR17, MS1 and MG9 improved growth under normal and stressed
conditions which were induced by withholding irrigation at vegetative and reproductive
stage of maize. Selected isolates also proved to be efficient auxin producer and p-
solubilizer under normal and stressed conditions. These isolates were identified as
![Page 20: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/20.jpg)
Bacillus sp. In separate study, it was observed that endophytic bacterial isolates carrying
CA activity AR4 and AR14 (belonged to Microbacterium sp. and Psychrobacter sp.,
respectively) also stimulated the expression of various genes and transcription factors in
Arabidopsis thaliana under normal as well as PEG-induced water deficit conditions.
Therefore, it can be suggested that inoculation of endophytic bacterial isolates (WR2,
WL19 for wheat and MR17, MG9 for maize) is good for enhancing photosynthesis and
plant biomass under water deficit conditions. Moreover, multi-site field experiments for
these isolates are suggested for evaluating the successful performance in field. However,
molecular studies are required to confirm role of bacterially synthesized CA in
photosynthesis.
![Page 21: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/21.jpg)
Chapter I
INTRODUCTION
The current and predicted changes in global climate are major concerns for the
productivity of agriculture sector (Lepetz et al., 2009) and food security (Misra, 2014).
The rapid increase in carbon dioxide (CO2) concentration due to insatiable demand of
burgeoning human population for energy from combustion of fossil is projected to result
in significant changes in climate. These climatic changes lead to increase in temperature
and alteration in rainfall patterns (Solomon et al., 2007) coupled with intensified events of
rain and drought. The global average temperature is expected to exceed from 1.4 - 5.8 ˚C
by the 21st century (year 2100) and would cause pronounced reduction in crop yield.
Furthermore, precipitation is expected to decrease 20% or more by the next century in
arid and semi-arid regions (Misra, 2014). Several uncertainties are also associated with
future climate pattern (Parry et al., 2007; Randall et al., 2007). Some of the climate
change impacts are growing desert area and increase in frequency and severity of floods
and drought.
Drought is one of the major constraints to agricultural productivity throughout the
world, suppressing plant growth and crop productivity. About, 25% of world arable land
is primarily affected by drought stress (Jajarmi, 2009). However, overall effects of
drought are likely to accelerate with increasing climatic changes (Walter et al., 2011) and
growing water crisis. Drought stress accounts for 50% reduction in crop yield (Wood,
2005). The degree of destruction caused by water deficit stress in plants depends on plant
species, genotypes, duration of exposure, severity of stress, age of plant and
developmental stage (Safarnejad, 2004). Drought stress decreases cell division and
expansion, root proliferation, stem elongation, leaf size and disturbs plant nutrient
relationship, thereby impairs water use efficiency and crop productivity (Li et al., 2009).
Leaf area also reduces under drought stress due to lower number of leaves and loss of
turgidity (Farooq et al., 2010). Number of physiological and biochemical changes appear
under drought stress at cellular level including variation in membrane fluidity, loss of
turgidity, variation in osmolyte concentration, protein-lipid and protein to protein
interaction (Chaves et al., 2009). Closure of stomata is the earlier response of plant under
water limited conditions (Schroeder et al., 2001). Stomatal closure due to change in leaf
water status under limited supply of water limits the photosynthesis (Nogueira et al.,
1
![Page 22: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/22.jpg)
2001, Silva et al., 2003). Reduction in photosynthesis is primarily explained by limited
availability of intercellular CO2 that affects photosynthesis at acceptor site (Cornic et al.,
1992) and inhibits the activity of photosynthetic enzyme such as Rubisco (Haupt-Herting
and Fock, 2000) or ATP synthase (Nogues and Baker, 2000). Drought stress also impairs
photosynthetic machinery and its components, thus affects biochemical processes
associated with photosynthesis and reduces agriculture productivity (Dreesen et al.,
2012). Therefore, increasing productivity per drop of water is becoming important for
many regions (Luquet et al., 2005).
Several efforts have been made to lower drought induced yield reduction and
improve crop productivity including production of drought tolerant genotypes (Stikic et
al., 2014). Prerequisite to develop drought resistant plants include phenotypic
improvement to elucidate plant response and adaptability to drought stress, selection of
gene that directly contribute in drought stress and evaluate impact of drought resistance
on crop production and quality of produce but these tasks are very difficult because plant
drought tolerance is complex phenomenon (Chaves et al., 2003). Moreover, lack of
proficient selection process and lower genetic variability for yield component are major
problem for their limited success (Gosal et al., 2009). Approaches including molecular
breeding and genetic improvement have been followed to enhance adaptability against
drought stress but have certain limitations (Ashraf and Akram, 2009). Genetically
modified (GM) plants are also not well adopted in many parts around the globe (Wahid et
al., 2007) owing to various reasons.
Therefore, another eco-friendly alternative approach is required. One of such
feasible aproach could be use of bacteria such as plant growth facilitating bacteria that are
living freely either in soil, rhizolpane, rhizophere or phyllosphere having potential role in
growth enhancement under stressed environment (Bashan and de-Bashan, 2005). Some
beneficial bacterial strains mitigate biotic stress also protect plant against abiotic stresses
where they colonize rhizophere and improve plant growth by maintaining proper soil
moisture, improving soil structure and increasing absorption of plant mineral nutrition
(de-Bashan et al., 2012; Kim et al., 2012). Different species of plant growth facilitating
rhizobacteria such as Pseudomonas, Bacillus, Azospirillum, Acetobacter, Burkholderia
etc., produce various phytohormones expecially auxins, cytokinins, gibberellins and may
attribute to growth improvement and development in stressed conditions compared to
plant gown under normal growth environment (Bashan and de-Bashan, 2005).
2
![Page 23: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/23.jpg)
Inoculation of crop plant with beneficial bacteria leads to formation of extensive
root, root hairs and lateral roots that may increase plant ability to survive under different
stress environments (Hayat et al., 2010). Regardless of these positive impacts, bacterial
products can show variability among the experiments (Montesinos, 2003). Furthermore,
there are certain disadvantage associated with the use of plant growth facilitating bacteria
(PGPB) as they are more receptive to the environmental constraints particularly drought
and soil temperature etc., inconsistent efficacy under field conditions (Labuschagne et al.,
2010) and short persistence in soil environment and rhizosphere.
Possible way to solve this delimma is use of endophytic bacteria under drought
stress, since these bacterial strains colonize the interior of plant that is stable and
protected niche. These bacteria colonize the plant without showing any external infection
or substantive detrimental effect on plant (Schulz and Boyle, 2006). Endophytic bacteria
may enter inside the plant through root hair cell by penetration (Huang, 1986) or with the
help of cell wall degenerating enzymes (Quadt- Hallmann et al., 1997) where they
colonize the intercellular spaces as well as vascular bundle and then systematically
colonize the tissues of plant (Compant et al., 2005). The capability to colonize interior
tissues of host has invented them priceless for agriculture to facilitatecrop productivity.
The role of endophytes in growth facilitation has gained attention as their
inoculation provides effective and consistent improvement in plant productivity
(Morrissey et al., 2004; Shi et al., 2010). Endophytic bacteria are known to contribute
plant growth facilitation by number of mechanisms either through production of various
phytohormones particularly auxin, gibberellins and cytokinins (Madhaiyan et al., 2006),
breakdown of endogenously produced plant ethylene by an enzyme 1-
aminocyclopropane-1-carboxylate (ACC) deaminase (Long et al., 2008; Ryan et al.,
2008), better plant nutrient acquisition (Malinowski et al., 2000), nitrogen fixation (Doty
et al., 2009; Jha and Kumar, 2007), phosphorus solubilization (Vessey, 2003; Kuklinsky-
Sobral et al., 2004; Puente et al., 2009a), siderophore production (Ramesh et al., 2009),
iron chelation or pathogen infection (Compant et al., 2005; Forchetti et al., 2007) through
antifungal (Compant et al., 2005; Zachow et al., 2008) or antibacterial agent and by
inducing systemic resistance (Gomez-Lema Cabanas et al., 2014). These bacteria improve
root length and growth of secondary root, thus enhance plant growth (Amaresan et al.,
2012). Endophytic bacteria significantly enhance shoot biomass compared to non-
inoculated control plant (Montanez et al., 2012). Inoculation with these beneficial
3
![Page 24: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/24.jpg)
bacteria increase the total soluble sugars and starch which in turn could compensate the
drought effects and results in better uptake of water and minerals from the soil (Gagne-
Bourque et al., 2015). Endophytic bacteria also confer drought tolerance by facilitating
the induction of several stress associated genes in leaves of plant (Sherameti et al., 2008).
Inoculation with endophytic bacteria enhance drought tolerance by over expressing the
gene associated with drought stress (LEA-14- and DHN3-like) and also transcription
factor regulating the dehydration responsive element binding gene (DREB2B) under
limited supply of water (Gagne-Bourque et al., 2015). These bacteria also improve the
photosynthetic activity (Chi et al., 2005) seedling emergence and establishment under
unfavorable conditions (Puente et al., 2009b; Forchetti et al., 2010).
Moreover, endophytic bacteria may possess carbonic anhydrase that enhances the
efficiency of carbon fixation. This enzyme is involved in several physiological processes
such as photosynthesis and CO2 transport (Supuran, 2008; 2011). Carbonic anhydrase
(CA) is an enzyme that catalyzes the conversion of carbon dioxide (CO2) into bicarbonate
(HCO3-) (Badger and Price, 1994; Sly and Hu, 1995; Tripp et al., 2001; Hisar et al., 2005)
with high catalytic rate up to 106 s-1 (Raven, 1995). Carbonic anhydrase facilitates the
supply of CO2 to ribulose-1,5-bisphosphate carboxylase (RuBisco) by converting HCO3-
to CO2 in C3 plants and also enhances the supply of HCO3- to phosphoenolpyruvate
carboxylase (PEPC) by converting the CO2 to HCO3 in C4 plants for photosynthesis.
Carbonic anhydrase may also regulate the stomatal conductance by maintaining
equilibrium CO2 and HCO3 (Tiwari et al., 2005). Furthermore, CA required for CO2
regulated stomatal opening and closing can be alternative approach to provide protection
against unfavorable conditions (Wei-Hong et al., 2014). Drought tolerant CA containing
endophytic bacteria improves CA activity, photosynthetic rate and plant biomass under
non-stressed as well as PEG induced water deficit stressed conditions (Aslam et al.,
2018). Therefore, it may be an important subject to stimulate the CO2 assimilation by
artificially regulating the CA expression. Increase in photosynthesis is important for
better crop productivity.
Although, an enormous number of studies reported that endophytic bacteria
facilitate the plant growth but little is known about the use of drought tolerant CA
containing endophytic bacteria for enhancing the plant growth by stimulating the
photosynthesis. Thus, monitoring the role of CA containing endophytic bacteria in
enhancing the photosynthesis and facilitating cereal biomass is novel idea.
4
![Page 25: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/25.jpg)
Wheat (C3 plant) and maize (C4 plant) are major food grain crops in Pakistan and
occupy the large area. They are cultivated on 9180 thousand hectare with annual
production 25,478 thousand hectare and 1,130 thousand hectare with annual production
4695 thousand hectare, respectively (Pakistan Economic Survey, 2014-2015). The
decreased production may be associated with several factor including, environmental
stresses. Keeping in view the above discussion, it can be hypothesized that inoculation
with carbonic anhydrase containing endophytic bacteria may enhance the photosynthesis
and improve the biomass of cereals (wheat C3 and maize C4) under water deficit
conditions.
For this purpose, series of experiments were conducted to pursue the following
objectives:
Isolation and screening of CA containing endophytic bacteria for plant growth
promotion under axenic conditions at different moisture levels
Characterization and identification of selected CA containing endophytic bacteria
Studying the potential of CA containing endophytic bacteria on photosynthesis
and plant growth promotion under pot and field conditions under drought stress
Studying the potential of CA containing endophytic bacteria on gene expression in
Arabidopsis thaliana under normal as well as stressed conditions
5
![Page 26: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/26.jpg)
Chapter II
REVIEW OF LITERATURE
Water scarcity and food security are the biggest challenges under changing
climatic pattern as both are highly vulnerable to future climatic change. Continuous
severity in the process of climate change shows that our planet will soon be hotter and
drier and global food supply may become inadequate to meet the demands of rapidly
expanding world’s population. To provide food for all of the people, it is absolutely
necessary that cost effective and eco-friendly strategies should be used to ameliorate the
problem of drought in dry areas and increase the agricultural productivity within next few
years. Application of endophytic bacteria can be potential means for facilitating growth
and yield under drought stress in sustainable manner. In this review, role of carbonic
anhydrase containing bacterial endophytes for enhancing photosynthesis and plant
biomass in cereals under limited water supply has been discussed. Moreover, effect of
these bacteria on drought responsive genes and transcription factors of Arabidopsis
thaliana has also been reviewed.
2.1. The problem of drought
Drought is one of the devastating threats to food productivity and livelihoods of
more than two billion people who live on drylands which contribute to 41% of world land
surface. It refers to creeping phenomena as it develops slowly and its impacts remain for
longer period of time after initiation of event (Mazhar et al., 2015). Arid and semi-arid
zones around the globe are most prone to drought (Deng et al., 2004). Drought is climatic
condition of an area where moisture supply is below the average value over continuous
period of time (Anjum et al., 2012). Frequency of droughts is common in developed and
developing world but it leaves long run impacts on the economy of developing world
because most of agriculture in this world is rainfed (Anjum et al., 2010). Drought events
may be short and intense as well as these can persist for many years and constitute
significant loss to local economy. Water deficit in soil can be chronic in the regions
facing low water availability or unpredictable due to changing weather conditions during
the plant growth period. The drought stress is expected to increase with growing water
scarcity and climate change (Harb et al., 2010). Climatic factors such as low humidity,
high temperature and wind are associated with drought stress in many territories of the
world and can significantly enhance its severity (Edwards et al., 1997). Continuous
6
![Page 27: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/27.jpg)
decrease in precipitation combined with high evapotranspiration yields agricultural
drought (Mishra and Cherkauer, 2010). Agricultural drought occurs due to lack of
adequate moisture necessary for normal growth and expansionto complete plant life cycle
(Manivannan et al., 2008). Drought stress is not only limited to desert regions but also
dramatic reduction in agriculture productivity occurred in temperate regions due to global
warming (Ciais et al., 2003).
In, Pakistan, around 15 million hectares of cultivated land is suffered by water
deficit stress (Mujtaba and Alam, 2002). Out of 79.6 million hectares area, 88% area
encompasses arid to semiarid climate. According to Anjum et al. (2010) about 9% area
receives rain fall above the 508 mm, whereas 22% receives rain between 254-508 mm
and about 69% area receives rain below the 254 mm. The intensity of drought is more
severe in Baluchistan and Sindh because they lie in hyperarid regions; however, Punjab
and Khyber Pakhtunkhwa (KPK) are also affected by drought stress (Mazhar et al., 2015).
2.2. Drought and its impact on photosynthesis and plant growth
Plants are primarily sessile organisms in agriculture environment and are
constantly exposed to plethora of biotic and abiotic constraints including pathogen, heat,
cold, salinity, floods and drought that severely impair crop productivity throughout the
world. Among the stress inducing abiotic factors, limiyed supply of water is a major
constraint that reduces agricultural crop production in tropical world (Kim et al., 2012). It
causes 50% or more decline in crop yield (Wang et al., 2003). It impairs seed germination
and causes poor strengthening (Harris et al., 2002) due to less water uptake in imbibition
phase during germination and disturbed enzyme activity (Taiz and Zeiger, 2010). It also
decreases leaf size, stems elongation, proliferation of root as well as hampers plant water
relations (Anjum et al., 2011). Limited supply of water reduces plant height and growth
by impairing cell expansion, elongation and mitosis (Kaya et al., 2006; Hussain et al.,
2008). Cell elongation is usually inhibited in drought stress due to disturbance in flow of
water from xylem to elongating cell (Nonami, 1998). Drought stress affects water
relations by decreasing total water, water content and turgor. It also limits the gaseous
exchange and transpiration through stomatal closure. Plant cells lower their water
potential and turgor in response to water stress that enhances concentration of solute in
cytosol and other extracellular matrices, resulting in cell enlargement which leads to
growth inhibition and reproductive impairment (Lisar et al., 2012). Moreover, reactive
oxygen species (ROS) increase dramatically under drought stress and induce oxidative
7
![Page 28: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/28.jpg)
damage (Farooq et al., 2009) to DNA, protein and Lipid (Apel and Hirt, 2004). These
ROS (O2−, H2O2 and OH radicals) can attack membrane lipid and markedly increase their
peroxidation (Mittler, 2002). Loss of membrane stability also reflects lipid peroxidation
induced by ROS. Overproduction of ROS stimulates melonaldehydes content under
drought stress. The increased level of melonaldehyde is signal of oxidative stress (Moller
et al., 2007). The ROS are extremely reactive and impose severe impairment in plant by
enhancing protein degradation, lipid peroxidation and DNA fragmentation which
ultimately causes cell death.
Under drought stress, plants modulate their physiological responses such as
stimulation of stomatal closure by increasing ABA contents, accumulation of
osmoprotectant/compatible solutes and increase in expression of vacuolar pyrophosphates
and aquaporins through osmotic adjustment (Bartels and Sunkat, 2005). Closure of
stomata contributes to less CO2 assimilation. Water stress affects photosynthesis through
stomatal and non-stomatal reductions (Chaves et al., 2003). Stomatal limitation increases
under drought stress along with decrease in photosynthetic parameters (Zlative and
Yordanov, 2004). The decrease in photosynthetic CO2 assimilation is resulted from
stomatal closure that reduces the diffusion of CO2 into leaves and ultimately decreases
intracellular concentration of CO2 (Cornic, 2000). Reduction in leaf mesophyll and
stomatal conductance restricts the diffusion of CO2 at the carboxylation site from air
under mild drought stress (Flexas and Medrano, 2002). Net photosynthetic carbon
assimilation as well as relative water content is reduced in wheat leaves due to stomatal
closure (Dulai et al., 2006). Decrease in photosynthesis has also been observed as severity
of water stress progresses either due to disruption in photosystems (Havaux et al., 1986)
resulted from light which is absorbed more than its reduction capability (Navari-Izzo and
Rascio, 1999), or deterioration of photophosphorylation. It reduces gaseous exchange and
disrupts the photosynthetic pigments leading to reduced growth and plant productivity
(Anjum et al., 2011). Chlorophyll content, relative water content and cell membrane
stability also decrease under drought stress, although, decrease is more pronounced in
drought sensitive compared to tolerant wheat varieties (Almeselmani et al., 2011).
Drought stress also induces substantial reduction in crop yield. Decline in crop
yield occurs probably due to disturbance in gaseous exchange parameters which not only
decreases source and sink size but also hampers phloem loading, transfer of assimilate
and partitioning of dry matter under deficit water conditions (Farooq et al., 2009).
8
![Page 29: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/29.jpg)
Substantial reduction in maize growth and its yield components including cobs, kernel per
cob, 100 kernal weight, grain yield and biological yield occurred under drought stress
(Anjum et al., 2011). Yield reduction in drought stress also occurs due to stomatal closure
in response to reduced water content in soil that decreases the diffusion of CO2 and results
in decline in photosynthesis (Flexas et al., 2004). Stomatal conductance, mesophyll
conductance, transpiration rate, photosynthetic rate, pigment content, relative water
content and dry weight also reduced under drought stress in wheat. Photosynthetic
contents such as chlorophyll b to carotenoid also decrease and lead to yield reduction in
wheat. Furthermore, spike weight, number of grains and grains per spike also decreased
in wheat in water deficit conditions (Allahverdiyev et al., 2015). Drought stress also
influences crop performance such as decreases grain filling period and rate, weight of
grains, grain yield and water use efficiency by affecting all the growth stages but its
severity is more at booting and heading stage compared to anthesis and grain filling stage
in wheat (Nawaz et al., 2013) where more yield reduction at early growth stages may be
due to hampered pollination and seed setting (Farooq et al., 2009) that reduced the grain
count per spike in wheat (Mary et al., 2001). Transport and availability of nutrient also
becomes limited in rhizosphere under water deficit condition that ultimately produces
wilting symptoms in plants. Therefore, plant nutritional status is considered as water
stress indicator (Raza et al., 2012). Drought affects mineral nutrition and metabolism that
reduces the leaf area and alters the partitioning of photassimilates among the different
organs (Lisar et al., 2012).
Stress condition also stimulates and represses genes involved in various functions
(Shinozaki et al., 2003; Yamaguchi-Shinozaki and Shinozaki, 2005). Stress induced genes
have been observed in various plant species such as Arabidopsis and rice (Chinnusamy et
al., 2007; Shinozaki and Yamaguchi-Shinozaki, 2007). Molecular analysis showed that
several droughts induced genes with different functions as well as transcription factors
that regulate the expression of stress related genes are found in rice, arabidopsis and many
other plants (Shinozaki and Yamaguchi-Shinozaki, 2007). Transcription factor
dehydration responsive element binding protein, 2A (DREB2A), is activated under limited
supply of water (Sakuma et al., 2006). Futhermore, expression pattern of genes belonging
to dehydrins (DHNs; Td11, Td16) and transcription factors (DREBS), cell wall
polysaccharides (xylanase inhibitor and endo beta 1.4 glucanase) and cellular metabolism
(ALDH7) was upregulated, however, regulation of ethylene-responsive element binding
9
![Page 30: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/30.jpg)
factor genes (ERF) and actin binding protein were slightly not significantly down
regulated in leaves of Triticum durum under water deficit stress (Melloul et al., 2014).
2.3. Adaptation measures to mitigate the drought stress
Several adaptation measures are practiced throughout the world to alleviate yield
reduction elicited by drought stress coupled with increase in crop productivity. Control of
irrigation models such as furrow, drip, sprinkler, recognition of resistant resource through
development of different screening methods, use of crop residues and rotation of crop are
different agronomic ways to mitigate the drought stress (Nezhadahmadi et al., 2013).
Breeding of drought tolerant plant has also become high priority under changing climatic
condition. Different traditional selection methods, genomic and genetic tools are being
used to induce tolerance to water stress (Fleury et al., 2010). Traditional breeding requires
identification of genetic variability between plant genotypes and introduction of tolerant
lines with suitable agronomic traits. Hence, traditional breeding seems to be valuable
under drought stress but it is a slow strategy and limited due to selection of suitable gene
for the breeding. Moreover, these strategies are labor intensive that requires a lot of
efforts to segregate the desirable traits from the undesirable traits (Nezhadahmadi et al.,
2013). Tolerance to drought is complex trait, however, variety of genes associated with
stress tolerance is reported but still large gaps remain (Price et al., 2002; Wang et al.,
2003; Fleury et al., 2010). Transgenic approaches have also been used for understanding
molecular process associated to drought tolerance. Majority of these approaches are not
successful to obtain drought tolerant crop with high yield because overexpressed
promoters are used for expression of drought tolerant genes instead of tissue specific and
drought regulated promoters (Reguera et al., 2012; Cominelli et al., 2013). However,
approaches with tissue specific and drought inducible promoter may be useful in future to
improve tolerance in crop against drought stress (Cominelli et al., 2013). Moreover, under
changing stressed environment and enormous number of crops with variety of cultivars,
key genes need to be engineered into plant but seems unclear that genetic engineering will
be fast enough to cope the burgeoning demand of food in near future (Timmusk and
Behers, 2012). Studies showed that certain microbial strains enhanced tolerance against
environmental constraints such as nutrient and drought stress (Yang et al., 2009).
Specifically, PGPB and mycorrhizal fungi have ability to modulate plant physiological
responses and promote their survival under unfavorable environmental situations
(Marasco et al., 2012; Milosevic et al., 2012).
10
![Page 31: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/31.jpg)
2.4. Plant growth promoting bacteria under drought stress
Being, relatively simple and cost effective alternative strategy, use of PGPB has
emerged as a promising tool with broad spectrum benefits for improving the plant growth
(Timmusk and Wagner, 1999; Timmusk, 2003; Mayak et al., 2004). Timmusk and
Wagner (1999) firstly reported drought tolerance induced by PGPB. (Timmusk and
Wagner, 1999; Mayak et al., 2004). Plant growth facilitating rhizobacteria (PGPR) and
endophytes exhibit a variety of plant growth facilitating properties that support the plant
growth under limited water supply (Marasco et al., 2013). The root length and biomass in
pepper plants increased up to 40% by the PGPB that mediated larger root system being
responsible for water uptake in dry soil (Marasco et al., 2013). Bacteria having capability
to colonize the plant root and facilitate plant growth have been considered as PGPR
(Kloepper and Schroth, 1978). Rhizospheric bacteria harbor different adaptive traits and
improve plant vigour under both biotic and abiotic stressed environments. The exact
mechanism of drought tolerance by rhizospheric bacteria is speculative but possible ways
include production of phytohormones, production of ACC-deaminase enzyme to reduce
the ethylene level, induced systemic resistance and formation of biofilm (Yang et al.,
2009; Timmusk and Nevo, 2011; Kim et al., 2012). Bacterial priming of wheat enhances
drought tolerance by improving the plant biomass upto 78% and its survival up to five
fold greater under drought stress through production of stress related hormones (Timmusk
et al., 2014). Studies also showed the role of these PGPR in eliciting the drought
resistance in peppers and tomatoes (Mayak et al., 2004). Despite the beneficial effect,
application of these microbes is often hampered under field condition due to inconsistent
performance (Thomashow et al., 1996). Ability of inoculum to colonize root is primary
factor that determines its efficacy for yield enhancement (Weller, 1988). This may lead to
selection of beneficial bacteria that can colonize the root system effectively (Raaijmakers
and Weller, 2001). Endophytic bacteria colonize the internal tissues of plant without
inducing any harm (Schulz and Boyle, 2006). Plant pre-exposed to these microbes or
primed plant can respond more rapidly and efficiently compared to non-primed plants as
they are pre-acclimated to host cell metabolism and can survive under challenging
environment betterly (Sturz and Nowak, 2000).
2.5. Comparison of other plant growth promoting rhizobacteria and endophytic
bacteria
Endophytic bacteria can be differentiated from non-endophytic bacteria due to
11
![Page 32: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/32.jpg)
their unique behavior with the host plant. These bacteria efficiently colonize the tissues
(above and below ground) of host plant and form long term association without causing
harm to host. They develop lifelong associations usually latent or dormant infections
which are distinguished from associations of other transient bacteria that will not sustain
longer. These bacteria are further differentiated from others by regulating the growth of
other nematodes, bacteria and fungi (Hallmann et al., 1997; Bacon and Hinton, 2006).
Endophytic bacteria reside in the interior of plant as it is continuous source of nutrients
and protected niche. Intercellular spaces are very rich source of organic and inorganic
nutrients essential for supporting the growth of complicated mixture of bacterial
endophytes (Bacon and Hinton, 2006). Being inside the protected niche, endophytic
bacteria are less exposed to different biotic stresses and face less competition with other
microbes due to frequent source of plant nutrients (Bacon and Hinton, 2006). These
bacteria are considered better than the rhizospheric and their rhizoplanic counterparts
because they can fix nitrogen directly into their host plant, provide benefit to plant by
nitrogen fixation (Cocking, 2003) and face less competition being sheltered in the plant
interior (Gupta et al., 2012). Bacterial endophytes are better sheltered from high biotic
and abiotic constraints and competitive environment of soil (Sturz et al., 2000). In
comparison to rhizobacteria, these bacteria may be less exposed to the stress inducing
biotic and abiotic factors (Hallmann et al., 1997). Being habituate to their host and
present at rhizosphere initiation and seedling development, these bacterial endophytes
offer twins of advantage, thereby provide ecological benefits compared to other wild type
resident soil microflora that are often associated with failure of seed treatments (Sturz and
Nowak, 2000). Moreover, growth enhancement by bacterial endophytes are more
compared to rhizosphere localized bacteria or bacteria restricted to root surface (Chanway
et al., 2000). Beneficial effects of endophytic bacteria are more than rhizosphere
colonizing bacteria (Pillay and Nowak, 1997). Therefore, colonization efficiency of
endophytic bacteria and survival ability of inoculum both in plant and rhizosphere is
prerequisite for efficient delivery and management of inocula (Compant et al., 2005)
2.6. Endophytic bacteria and their relationship with host plant
Plants harbor an abundant and variety of microflora mostly bacteria and fungi
inside the xylematic vessels which carry out various operation for nutrition of host plant
are called endophytes (Hallmann et al., 1997; Rosenblueth and Martinez-Romero, 2006).
Bacterial endophytes are referred to those bacteria which colonize the interior tissues of
12
![Page 33: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/33.jpg)
plant without showing any sign of infection and causing deleterious effects in host plant
(Holliday, 1989; Schulz and Boyle, 2006). These bacteria are virtually found in every
plant studied, nearly 300,000 species of plant reported to exist in our planet and each of
them is host of one or several bacterial endophytes (Strobel et al., 2004). These bacteria
do not generate impairment to host plant and humans (Di Fiore et al., 1995; Chiarini et
al., 2006; Schmid et al., 2006), on contrary, they promote the growth of plant (Castro-
Sowinski et al., 2007). In contrast to other endosymbionts, they do not make membrane
bound structures/compartments. They are spread all over the plant organs including roots,
shoots, leaves, flowers, fruits, seeds. Their association with the host plant may be obligate
and facultative and they cause no impairment to host plant. Obligate endophytes are
closely bound to host for their survival and growth except for transportation to alternate
plants either vertically or with vectors whereas facultative endophytes can live either
inside the plant or other habitats. Some endophytes are opportunistic (enter occasionally)
and some are passenger endophytes (enter inside the plant accidently). However, a newly
emerged plant bacteria association is competent endophytes. Competent endophytic
bacteria possess genetic machinery necessary for colonizing of endosphere and persist in
it. These bacteria actively enter inside the plant, colonize host plant tissue, regulate plant
physiology and maintain beneficial plant microbe relationship (Hardoim et al., 2008).
Large numbers of endophytic bacteria form symbiotic association but some establish
mutualistic association (Bacon and Hinton, 2006). Plants restrict the growth of
endophytes but endophytes use variety of processes to acclimate to their living
environment (Dudeja et al., 2012). Endophytes produce stable compounds to maintain the
symbiosis that help their survival in new environment (Lee et al., 2004; Das and Varma,
2009). Within the plant, endophytic bacteria do not induce morphological changes as root
nodule and do not cause disease as phytopathogen. Transient intercellular dwellers are
excluded here that can become intracellular, sometime invade xylem tissue and become
problematic to plant. Xylem endophytes are regarded not good for bicontrol because they
are viewed as problematic since infected and weakened vessel become impaired and
hazardous to host plant (McCully, 2001). Soil or rhizospheric bacteria can turn to good
endosphere colonizers if these bacteria have ability to cope with unexpected events of
changing environments from exosphere to endosphere that requires different bacterial
responses in different tissues (Hardoim et al., 2008).
13
![Page 34: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/34.jpg)
2.7. Origin of endophytic bacteria and mode of entry in plants
Bacterial endophytes may originate from seed (Adams and Kloepper, 1996),
rhizosphere soil (Mahafee and Kloepper, 1997), vegetative organs (Dong et al., 1994) and
phylloplane (Beattie and Lindow, 1995). Several observations revealed that rhizosphere is
a primary source for bacterial endophytes (Hallmann et al., 1997; Mahafee and Kloepper,
1997) but other site of transmission can not be ignored. Bacteria can also enter in plant
tissue through lenticels, stomata, site of emergence of lateral root and germinating
radicals (Huang, 1986). Gluconobacter diazotrophicus enters through stomata in
sugarcane (James et al., 2001). Streptomyces galbus facilitates leaf surface colonization
and lateral establishment (Suzuki et al., 2005). Endophytic bacteria mostly originate from
soil and infect host plant by colonizing the cracks made at the site of lateral root junction
and spread fastly into intercellular spaces of root (Chi et al., 2005). Cracks in root are the
major hot spot for the colonization of endophytic bacteria (Sorensen and Sessitsch, 2006).
Colonization by bacteria at secondary root emergence site has also been discussed by
various authors (Reinhold and Hureck, 1998; Mahaffee et al., 1997). After entering inside
the plant tissues, these bacteria remain either confine to specific tissue including root
cortex or colonize consistently by transporting through xylem vessel (Quadt-Hallmann et
al., 1997). These bacteria were observed in xylem vessels of internode, leaf and
substomatal chambers but were not found on stem and leaf surfaces (Compant et al.,
2005). Compant et al. (2011) also reported that bacteria get access into plant tissue from
soil through cracks developed by lateral roots and moved from roots to leaves, then
flower and fruit through vascular system (Hardoim et al., 2008; Compant et al., 2011).
2.8. Colonization by endophytic bacteria
There is variety of ways through which endophytes get enter to the interior of host
plant.
2.8.1. Rhizoplane colonization
Bacterial endophytes attach the rhizoplane (solid root surface) to enter into roots
such as root tip, site of lateral root emergence (Hardoim et al., 2008). A momentous
amount of studies have revealed that attachment to root is key step for the establishment
of endophytic colonization. Attachment of bacteria and their subsequent entry into host
root occurs through apical root including zone of active penetration (root hair and thin
walled surface root layer) as well as zone of passive penetration (basal root where cracks
14
![Page 35: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/35.jpg)
are formed due to lateral root formation). Variety of bacterial components is also involved
in this process. The association of Herbaspirillum seropedicae, diazotrophic endophyte
bacteria, to surfaces of maize roots depends on lipopolysacchrides (LPS) (Balsanelli et
al., 2010). Another study showed that colonization of rice rhizoplane and endosphere by
Gluconacetobacter diazotrophicus required exopolysaccharides (EPS) (Meneses et al.,
2011). Some bacterial strains lost their adhesion capability used bacterial structural
component for colonization (Malfanova et al., 2013). Recently, diazotrophic Azoarcus sp.
BH72, a pilT mutant has been reported to impair its twitching motility, resulting in
defective root colonization (Bohm et al., 2007) while the pilT locus plays important role
in motility of attached bacteria on the surface of plant. Any destruction to pilA as well as
pilT that are essential for the formation of pilus decreased its movement, indicating the
role of these genes in colonization potential of Azoarcus sp. (Bohm et al., 2007).
Similarly, rice endophyte Azoarcus sp. BH72 required type IV pili for the attachment of
root (Dorr et al., 1998). These bacteria increase in numbers after attaching to plant root
through cell divisions and result in formation of microcolonies (Compant et al., 2008).
Bacteria form colonies at these sites (Zachow et al., 2010). Infection of root tissues may
occur through these microcolonies for instance at the junction of lateral roots. These
bacteria produce cellulytic enzymes that can hydrolyze cell wall. Enzymatic activity is
important for the degeneraion of plant cell envelop in this invasion process. Many of the
endophytic bacteria produce these enzymes under in vitro conditions (Reinhold-Hurek et
al., 2006). Bacterial gene endoglucanase is considered essential for colonization of
Burkholderia sp. PsJN and Azoarcus sp. BH72 (Compant et al., 2005; Reinhold-Hurek et
al., 2006). In addition, expression of an enzyme, endoglucanase that hydrolyze the β
(1→4) linkage in cellulose was observed at the entry of Azoarcus sp. (Reinhold-Hurek et
al., 2006). Root colonizing bacteria produce low level of cell wall degrading enzymes that
differentiates these bacterial endophytes from the other bacterial pathogens which
produce deleteriously high level of enzymes (Elbeltagy et al., 2000). Bacterial cell wall
degenerating enzymes are involved in induction of plant defense system as many defense
related protein are present in cell wall of bacteria. Elicitation of plant defense response
reduces the induction of plant pathogens (Iniguez et al., 2005). On the other hand,
endophytes may enter inside the plant root and other tissues without producing cell wall
degrading enzymes possibly through the automatically formed cracks in displaced
epidermal cell or through spaces constituted by soil herbivores. These bacteria enter
inside the plant via cracks at the site of lateral root emergence and last invisible to defense
15
![Page 36: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/36.jpg)
system of plant. This is the case that endophytes may escape from immune system
(Malfanova et al., 2013). After entering the roots, these competent endophytes penetrated
through the casparian strips present in endoderm to transmit systematically to the other
above ground plant parts. Highest bacterial population was observed in root, stem and
leaves, respectively (Lamb et al., 1996).
2.8.2. Endophytic colonization of different plant tissues
When, these competent endophytic bacteria are present inside the host plant, they
react with plant signals for inducing cellular processes that are essential for their entry
into endophytic stage and further translocate to cortex intercellular tissues of roots and
beyond. For this process, generation of endoglucanases (Compant et al., 2005) and
endopolygalacturonidases (Reinhold-Hurek et al., 2006) seem indispensable. Some
bacteria penetrate endodermal cell and colonize the xylem vessels. Once bacteria crossed
the endodermal cell wall either last at the spot of entry (Timmusk et al., 2005) or transfer
deeper intercellular spaces in cortex (Gasser et al., 2011). These endophytes multiply
inside the plants (Zakria et al., 2007) and attain high cell density (e.g. 108 cells g-1 dry
weight root tissue) (Barraquio et al., 1997). Inoculation of rice with Sinorhizobium
meliloti labeled with green florescent protein under gnotobiotic conditions showed that
endophytic population dynamics inside plant is greater (i.e. 9 x 1010 cells cm-3 of root and
leaf tissue) (Chi et al., 2005). It is well explained that population of bacterial endophytes
decreases as the area from root increases and only a few bacteria reach the upper part of
shoot, leaf and reproductive organ, such as flower fruit and seed (Compant et al., 2010;
Furnkranz et al., 2011). Chi et al. (2005) found that dynamic infection process began with
colonization of rhizoplane, then endophytic colonization of roots followed by
transmission into stem, leaves and leaf sheath. It is observed that amount of nutrients in
xylem decreased along the axis of plant. The presence of these bacteria in reproductive
tissues was assured by colonization (Okunishi et al., 2005; Furnkranz et al., 2011) and
through microscopic visualization (Coombs and Franco, 2003; Compant et al., 2011). If
one reproductive cell such as male gametes and egg cell possess microbe, the endosperm
and embryo developed from them may be colonized. These results explain the
translocation of endophytes from plant to seed (Malfanova et al., 2013). So far, infection
of reproductive tissues has been observed only with viruses (Agarwal and Sinclair, 1996).
However, the exact procedure for the translocation of bacteria from vascular bundle to
reproductive organ and latterly to other plant needs to be explored.
16
![Page 37: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/37.jpg)
2.9. Bacterial endophytes and their potential role in growth promotion
Endophytic bacteria can facilitate plant growth and induce resistance to different
environmental stresses (Ryan et al., 2008). Interaction between plant and endophytes has
been reported to elicit integrity, proper functioning and feasibility of agro-ecosystem
(Nagarajkumar et al., 2004). These bacteria stimulate seedling emergence, enhance plant
survival under stressful environmental conditions and improve plant growth and
development (Bent and Chenway, 1998). Mechanism of plant growth facilitation by
endophytic bacteria has been postulated to be similar with plant growth promoting
rhizobacteria (Madhaiyan et al., 2006). Bacterial endophytes elicit growth promotion
either directly i) by producing the 1-aminocyclopropane- 1-carboxylate (ACC)
deaminase, an enzyme that lowers ethylene level in plants, ii) by producing the plant
hormones e.g. auxin (Prasad and Dagar et al., 2014) and cytokinin or indirectly i) by
helping the plant in nutrient acquisition (Sessitsch et al. 2002) such as phosphorus
solubilization, nitrogen fixation (Iniguez et al., 2004; Sevilla et al., 2001 ) and chelation
of iron (Costa and Loper, 1994) ii), by preventing the infection caused by pathogen, iii)
by antibacterial (Hardoim et al., 2015) or antifungal agent, iv) by competing the pathogen
for plant nutrient either though siderophore production or inducing systemic resistance in
plant. Plant provides protective niche for endophytes and these endophytes produce useful
signals and metabolites (Rosenblueth and Martinez- Romero, 2006) that stimulate uptake
of nutrients (Ramos et al., 2011), modify plant growth and biomass (Hardoim et al., 2008)
and induce tolerance against osmotic stress (Sziderics et al., 2007) and other abiotic
factors. Endophytic bacteria have been reported to facilitate growth of tomato plants
where 61% of isolated bacteria enhanced tomato growth and 50 to 64% improved
biomass accumulation (Majeed et al., 2014). Jasim et al. (2014) also found that
Pseudomonas sp. affected the growth of ginger by producing IAA, siderophores and
ACC-deaminase activity. Similarly, improvement in root number and root and shoot
length was observed by the inoculation of endophytic bacterial isolates BETL9, BETL13,
BECL8, BECS1 and BECS7 in tomato and chilli seedlings (Amaresan et al., 2012).
2.9.1. Endophytic bacteria as stimulator of plant nutrients
Plant growth facilitation has been recorded by several bacterial endophytes
(Zachow et al., 2010; Gasser et al., 2011; Malfanova et al., 2011) directly mediated
through nutrient availability. The ability to fix N2 in plant by endophytic bacteria was
demonstrated in many studies. It has been investigated that endophytic diazotrophs help
17
![Page 38: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/38.jpg)
plant in acquiring the 70% of required N2 through BNF (James, 2001). Studies also
showed that Acetobacter diazotrophicus (Gluconoacetobacter diazotrophicus) has ability
to fix 150 kg N ha −1 year −1 and act as main contributor to N in sugarcane
(Muthukumarasamy et al., 2005). It has been anticipated that use of endophytes can
produce 200 kg N ha-1 year-1 in rice (Ladha and Reddy, 1995). This fact was well
explained by isotope analysis (Elbeltagy et al., 2001) and by observing the nitrogenase
genes expression in nitrogen-fixing cells (Egener et al., 1999; Roncato-Maccari et al.,
2003; You et al., 2005). 15N2 incorporation studies showed that inoculation of sugarcane
with G. diazotrophicus Pal5 fixed 0.6% of N through BNF (Sevilla et al., 2001) and this
value was 0.14% for rice plant harboring Herbaspirillum sp. (Elbeltagy et al., 2001).
Secondly, N2 fixation is greatly influenced by nitrogen availability and oxygen
concentration. Nitrogenase expression was suppressed in free air (21%) and improved
under microoxic (having low oygen) conditions i.e. 2% O2 in Herbaspirillum sp. B501
(You et al., 2005) indicating that interior of plant is suitable place for nitrogen fixation.
Endophytic bacteria fixed nitrogen with nitrogen fixing ability have an edge over their
rhizospheric counterparts because they make available fixed nitrogen to host plant.
Secondly, low partial pressure of oxygen is required for activity of nitrogenase, an
oxygen sensitive enzyme, however, endosphere of root makes them more acquiescent for
nitrogen fixation reaction. Bacterial endophytes with nitrogen fixing capacity have been
reported to derive 47% nitrogen from the air and promote plant growth (Gupta et al.,
2012). Moreover, nitrogen starvation also depresses the biosynthesis of IAA. Brandi et al.
(1996) revealed that supernatant obtained from Erwinia herbicola culture showed 10-fold
higher IAA synthesis under nitrogen starved condition. Therefore, diazotrophic bacteria
boost plant growth by stimulating the production of phytohormone production and
supplying nitrogen. It is further supported that both wild type and mutant increased the
sugarcane biomass when nitrogen was not limiting (Sevilla et al., 2001).
Bacterial endophytes present in root zone have capability to increase the
availability of phosphorus to plant. Growth facilitation in plants is also enhanced by
phosphorus solubilizing endophytic bacteria that solubilize the inorganic phosphorus.
Bacteria release organic acids to solubilize phosphate complexes and trnsform them into
orthophosphate that is taken up and utilized by plant (Oteino et al., 2015). These organic
acids with their carboxyl and hydroxyl groups chelate cation bounded phosphate
(Kpomblekou and Tabatabai, 1994). Recently, it has been demonstrated that bacterial
18
![Page 39: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/39.jpg)
endophytes produce gluconic acid, possess phosphate solublizing capabilities
approximately 400-1300 mg L-1 accompanied with beneficial effects on Pea sativum plant
growth under limited soluble phosphate conditions (Oteino et al., 2015). Andrade et al.
(2014) found that out of 40 bacterial endophytes isolated from banana trees, 37.5%
isolates have potential to solubilize inorganic phosphate and highest solubilization
capacity was observed in isolate EB-47 and EB-64.
Moreover, siderophore production by bacteria provides competitive advantage to
colonize the tissues of host plant and omit other microbes from ecological niche (Loaces
et al., 2011). However, role of endophytically produced siderophore in plant colonization
is unknown but plays vital role in induction of ISR (Hardoim et al., 2015). Production of
siderophores can inhibit the growth of plant pathogen, thereby improve plant growth
(Sharma and Johri, 2003). Some bacteria produce catecholate-types while other bacteria
produce hydroxamate-type siderophores (Neilands and Nakamura, 1991). In this process,
produce small molecular compounds which have high affinity for iron and cell captures
the iron charged siderophores. This property has been found in many endophytes isolated
from different plants and acts as antagonist of pathogen (Cho et al., 2007; Li et al., 2009).
It has also been studied that most of hetrotrophic endophytic bacteria produce
siderophores in mature plants; however, less than 10% of bacterial endophytic produce
siderophores in leaves and roots of younger plants (Loaces et al., 2011).
2.9.2. Endohytic bacteria as phytohormone producer
Similar to PGPR, bacterial endophytes stimulate plant growth through generation
of phytohormones (Umamaheswari et al., 2013). The synthesis of phytohormone and their
possible role in plant growth promotion by endophytic bacteria have been stated by
copious researchers (Govindarajan et al., 2008; Long et al., 2008; Malfanova et al., 2011).
Bacterial endophytes produce auxins that stimulates cell division, elongation and
differentiation, thus facilitate the plant growth (Shokri and Emtiazi, 2010). Indole acetic
acid has been reported as physiological active hormone in plants, acts as signaling
molecule; regulates plant development processes including tropic responses, organogensis
and cellular responses including cell division, expansion, differentiation and regulation of
genes (Ryu and Patten, 2008). Beneficial effects of endophytic bacteria in rice plants are
associated with their ability to produce IAA that increases the growth of rice seedling and
development under control environment (Etesami et al., 2014). Capability of endophytic
bacteria isolated from the cashew to produce IAA was also checked by Lins et al. (2014)
19
![Page 40: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/40.jpg)
and found that out of 31 isolates, 17 isolates had the ability to produce IAA in
concentration from 11.79 to 145.85 µg/mL. Indole acetic acid stimulates plant growth by
increasing root length and root growth that is associated with elongation and proliferation
of root hair (Weyens et al., 2009). One of the possibilities is that IAA producing bacteria
colonize the root better compared to other isolates (Kuklinsky-Sobral et al., 2004; Mendes
et al., 2007). Bacteria colonize the plant root by forming attachment to root epidermal cell
and basal zone of emerging root hair where root hair is major zone for primary
colonization. Endophytic bacteria produce many other phytohormones such as abscisic
acid (ABA) (Cohen et al., 2008), gibberellins (GB) (Lucangeli and Bottini, 1997;
Malfanova et al., 2011) and cytokinins (Sgroy et al., 2009). Increased level of GA3 in
maize roots was observed with Azospirillum spp., GB-producing endophytic bacteria that
ultimately enhanced plant growth (Lucangeli and Bottini, 1997). Inoculation of plant
Dendrobium officinale with Sphingomonas paucimobilis ZJSH1 enhanced plant growth
such as shoot fresh weight that might be attributed to production of phytohormones
because higher amount of salicyclic acid, IAA, zeatin c-ZR and GA were recorded in the
inoculated plant acting as both plant growth regulator and driver of systemic acquired
resistance (Yang et al., 2014). Zeatin is member of phytohormone known as cytokinins
that promote the cell division and facilitate the growth of lateral bud (Patel et al., 2012).
Production of gibberellins and auxins are typical characteristics of root associated
endophytes (Shi et al., 2010; Khan et al., 2012; Merzaeva and Shirokikh, 2010) . Higher
level of hormones was observed when sugarcane plant roots and shoot were inoculated
with endophytic bacterial isolates compared to uninoculated control plants. These
bacterial isolates produced high level of GA, IAA, ABA and ZR in L-TRP amended
growth medium and improved plant growth under both axenic and glasshouse conditions
in sugar beet (Shi et al., 2010). Endophytes associated with plant having ability to
produce phytohormones can be important biological tool with widespread agriculture
potentials (Ali and Vora, 2014).
2.9.3. Endophytes as modulator of plant ethylene level
Plant also produces phytohormone ethylene on exposure to various constrainsts
which is promising modulator of normal growth and development in plant (Abeles et al.,
1992). To ameliorate the stress caused by high ethylene level, plants select ACC-
deaminase containing bacteria as endophytic bacteria and minimize deleterious effects
caused by ethylene such as reduced root growth (Hardoim et al., 2008). The bacteria have
20
![Page 41: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/41.jpg)
ability to lower the endogenously produced ethylene level by producing the ACC
deaminase that play essential role in optimal functioning of bacteria which not only
facilitate the plant growth but also secure the plant against drought stress (Glick, 2013).
Many endophytic bacteria have been reported which contain ACC-deaminase activity
taking part in lowering the ethylene (Long et al., 2008). The endophytic bacteria
containing high ACC deaminase activity proved to be efficient growth stimulator as they
efficiently block the ethylene production and ameliorate plant stress (Cheng et al., 2007).
Bacteria containing high ACC-deaminase activity take ACC before its oxidation through
ACC oxidase, thus lower ethylene level inside the plant (Glick et al., 1998). This enzyme
cleaves the precursor of plant ethylene ACC into ammonia and α-ketobutyrate (Honma
and Shimomura, 1978).
Different stresses enhance ethylene level known to involve in reduction of root
growth and lateral root emergence (Ivanchenko et al., 2008). Few bacteria use ethylene as
nutrient and lower the ethylene synthesis inside the plant. According to Glick (2005),
bacterially mediated IAA enhance the synthesis of ACC-synthase resulting in enhancing
the regulation of ethylene precursor ACC. Moreover, ACC-deaminase activity was
observed in many plant growth facilitating endophytic Burkholderia (Sun et al., 2009;
Gasser et al., 2011), Herbaspirillum (Rothballer et al., 2008) and Pseudomonas (Long et
al., 2008). Mutational study also confirmed the involvement of ACC-deaminase in plant
growth stimulation where gene coding for ACC-deaminase, acdS gene, was deleted in B.
phytofirmans PsJN and resulted in 32% decrease in root length of canola (Sun et al.,
2009). Another study on cut flower also showed that bacterial endophytes also delayed
the senescence of flowers (Ali et al., 2012). Several other researchers have also
demonstrated the use of bacteria having ACC deaminase activity to protect the biomass of
different plants against drought stress (Arshad et al., 2008; Shakir et al., 2012).
2.9.4. Endophytes as a biocontrol agent of phytopathogen
Pathogenic microbes are serious threat to food productivity and ecosystem
sustainability throughout the world. Several bacteria have been found to form endophytic
association with host plant and prevent disease development. The use of endophytic
bacteria for general and specific biological control purpose is wide spread (Kobayashi and
Palumbo 2000; Sturz et al. 2000) and well established (Berg and Hallmann, 2006;
Scherwinski et al., 2008; Malfanova et al., 2011), however, the exact mechanism for
biocontrol is less elucidated. Biocontrol is based on several mechanisms including
21
![Page 42: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/42.jpg)
antibiosis, induced systemic resistance (ISR) and fight for niches and nutrients (CNN).
Among these, role of ISR was confirmed in plants (Malfanova et al., 2013). Microscopic
observation showed that endophytic bacteria induced phenotypic changes related with
ISR and reduced the disease symptoms at the site where endophytes were present.
Bacterial endophytes colonize the ecological niche similar to plant pathogen thus make
them useful for biocontrol (Berg et al., 2005). Colonization by endophytic bacteria
induces several modifications in cell wall including accumulation of cellulose, pectin and
phenolic compound that leads to generation of barrier at the place of infection caused by
phytopathogen (Benhamou et al., 1998; 2000). Another response of bacterized plant to
attack of phytopathogen is expression of defense associated proteins such as chitinase,
peroxidase and β-1,3-glucanases (Fishal et al., 2010) resulting in decrease of pathogens in
plant. Reduction in disease was also observed in endophytically colonized wheat with B.
subtilis (Liu et al., 2009) and banana plant inoculated with endophytic Burkholderia and
Pseudomonas (Fishal et al., 2010). Melnick et al. (2008) investigated the capability of
Bacilli to colonize and decrease signs of black pod rot in cacao plants induced by
Phytophthora capsici. However, genomic analysis proposed endophytes competition for
iron and colonization but yet it has not been studied in plant.
It has also been investigated that plant-pathogen interaction is greatly influenced
by lipopolysaccharides (LPS) obtained from external cell wall of gram negative bacteria.
Apart from direct effect on plant pathogen, these bacteria also induced systemic
resistance in plant. Lipopolysaccharides have been suggested to be main component
present in cell wall of gram negative bacteria (Van et al., 1998). These LPS producing
endophytic bacteria like Burkholderia cepacia caused protective effect against Nicotianae
tabacum and Phytophthora nicotianae when plants were treated with zoospores of
pathogen. LPS activity acts as elicitor molecule to plant defense response. Enhanced
defensive ability and expression of pathogenesis related protein occur due to inoculation
with lipopolysaccharide producing Burkholderia cepacia against pathogen in Nicotianae
tabacum. Endophytic bacteria released LPS in plant where they interacted with host plant
cell and acted as elicitor molecule (Conventry and Dubery, 2001).
Endophytic bacteria protect the host plant by synthesizing the large amount of
antimicrobial compounds, siderophores and molecules that elicit induced systemic
resistance (Compant et al., 2010). Molecules that play an influential role in biocontrol are
lipopeptides (LPs) (Perez-Garcia et al., 2011). Compound such as fengycins and
22
![Page 43: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/43.jpg)
surfactins have recently been found as elicitors of ISR (Jordan et al., 2009). Biocontrol of
bacterial wilt pathogen in tomato was observed by endophytic bacteria where plant
treated with isolate BC4 hastened the disease incidence compared to control plant
(Nawangsih et al., 2011). Furthermore, it has been established that growth can be
enhanced in plants by the control of pathogenic bacteria under natural condition. The
enhancement in growth may occur due to i) lack of parasitism and disease ii) lack of
susceptibility to abiotic stresses such as drought and salinity and iii) resistance to frost
(Becan and Hinton, 2006). Therefore, biocontrol is being considered a supplemental or
alternative way to minimize the use of agrochemicals (Welbaum et al., 2004).
2.9.5. Endophytic bacteria as producer of secondary metabolites
Endophytes produce secondary metabolites involved in competition, signaling and
defense mechanisms as well as in regulation and establishment of symbiosis (Schulz and
Boyle, 2005). Endophytes act as chemical synthesizer inside the plant (Owen and
Hundley, 2004). Actually, these metabolites are biologically important compounds and
act as antioxidant, antibacterial, antifungal, antiviral, immunosuppressive, nematicidal
and insectidal agents (Tan and Zou, 2001; Strobel et al., 2004; Gunatilaka. 2006; Verma
et al., 2009; Brader et al., 2014). Kaaria et al. (2012) found that endophytic bacteria
isolated from Kenyan plants produced secondary metabolites that possessed the
antimicrobial activities against human pathogen specially Bacillus substilus. Besides
producing the secondary metabolites, these bacterial endophytes also affect the plant
metabolism. Bacterial endophytes may also modulate the synthesis of plant metabolites
(Brader et al., 2014).
Metabolic signature (alteration in metabolic profiling of plant inoculated with
same strain in repeated trials) showed that modulation of metabolites production which
were vital for colonization and activation of pathways associated with plant defense. A
metabolic signature of grapewine plant inoculated with Enterobacter ludwigii EnVs6
showed the decrease in concentration of esculin, catechin, astringin, pallidol, arbutin,
ampelopsin, D- isohopeaphenol and quadrangularin and increase in vanillic acid (Lopez-
Fernandez, 2015). Inoculation of strawberry plant with the Methylobacterium strain
influenced the synthesis of flavor compounds i.e. furanones in host plant
(Koutsompogeras et al., 2007). Endophytic bacteria with methanol dehydrogenase
transcripts were found in vascular tissue of receptacles and in achenes cell of strawberry
where gene of furanone biosynthesis was expressed (Nasopoulou et al., 2014). Bacterial
23
![Page 44: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/44.jpg)
endophytes, Candida- tus Burkholderia kirkii protected the host plant against various
pathogen/harbivores by producing metabolites. It has also been observed that genome of
C. Burkholderia kirkii contain gene involved in several metabolites production especially
analogues of C7N aminocyclitols family (Brader et al., 2014). Many members have also
been demonstrated to possess insecticidal and antifungal activity in this family.
2.10. Role of endophytic bacteria in growth stimulation under drought stress
Bacterial endophytes secure the plant growth from the devastating effect of
drought. It has been observed that drought tolerant endophytic bacteria, actinobacteria,
Streptomyces olivaceus DE10, Streptomyces geysiriensis DE27 and Streptomyces
coelicolor DE07 tolerate the drought stress from 0.05 to -0.73 MPa and enhance plant
growth in wheat under stressed environment due to production of phytohormones
(Yandigeri et al., 2012). Bacterial endophytes also minimized the adverse effect of
drought by affecting physiological responses and growth in maize including increase root
and shoot biomass, chlorophyll content, leaf area, photochemical efficiency of PSII and
photosynthesis. Endophytic bacteria Enterobacter sp. FD17 and Burkholderia
phytofirmans strain PsJN also reduced the damage caused by H2O2 compared to control
plants due to production of defense related enzyme superoxide dismutase, peroxidase,
catalase or phenolic compounds that mitigate the oxidative stress caused by drought
(Naveed et al., 2014a). Another study also revealed that bacterial endophytes B.
phytofirmans strain PsJN increased the chlorophyll content, CO2 assimilation rate and
water use efficiency in wheat compared to non-inoculated control plant under drought
stress (Naveed et al., 2014a). Endophytic bacteria B. phytofirmans PsJN remained active
in potato plant and induce variety of genes and pathways showing high metabolic activity
in the plant. However, activity of selected strain is greatly affected under drought stress.
Bacterial strains also sense the stress signals and adjusts its gene pattern accordingly to
cope with drought stress (Sheibani-Tezerji et al., 2015). Inoculation of arabidopsis plant
with Pirifomospora indica enhanced drought tolerance by handling the stress related
genes in the leaves. Drought stress related genes including early response to dehydration1
(ERD1), response to dehydration 29A (RD29A), dehydration-response element binding
protein2A (DREB2A), ANAC072, calcineurin b-like proteiN (CBL)1, phospholipase Dδ,
(PLD), salt-,drought-induced ring finger1 (SDIR1), histone acetyltransferase (HAT) and
cbl-interacting protein kinase3 (CIPK3) were upregulated in Arabidopsis thaliana leaves
colonized with P. indica compared to uninoculated seedling (Sherameti et al., 2008).
24
![Page 45: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/45.jpg)
Overexpression of DREB2A (Sakuma et al., 2006) and ANAC072 (Tran et al., 2004)
improved drought tolerance in Arabidopsis. Gibberellin and absicic acid produced by
endophytic bacteria Azospirillum lipoferum alleviated the drought stress symptoms in
maize.
2.11. Bacterial produced carbonic anhydrase and its role in plant photosynthesis
Endophytic bacteria may possess an enzyme carbonic anhydrase (CA). Bacterial
produced CA enzymes belong to α, β, and δ classes (Capasso and supuran, 2014).
Carbonic anhydrase involves in several physiological processes of life including
respiration, photosynthesis as well as transport of CO2 (Supuran, 2008; 2011). This is key
enzyme in photosynthetic carbon assimilation and any change in its activity directly
influences the photosynthetic CO2 fixation under CO2 limited conditions. It catalyzes the
hydration of CO2 into HCO3 that is physiologically important reaction in all forms of life.
CO2+H2O HCO3- + H+ (Supuran, 2008; 2011)
The relation between plant photosynthesis and CA is widely understood. It plays
important role because uncatalyzed reaction is 104 times slower as compared to CO2 flux
in the photosynthesis (Badger and Price, 1994). Carbonic anhydrase generally converts
CO2 to HCO3- for phosphoenolpyruvate carboxylase (PEPC) in C4 plant during
photosynthesis and converts HCO3- to CO2 and provides CO2 for ribulose-1,5-
bisphosphate carboxylase (Rubsico) reaction during photosynthesis in C3 plants (Wei-
Hong et al., 2014). In C4 plants, CA first converts the CO2 to HCO3 that is fixed by PEPC
to produce the C4 acid. Latterly, these C4 acids are diffused and decarboxylated to
supply CO2 for Rubsico in the bundle sheath cell, consequently Rubisco works close to its
Vmax and represses the photorespiration (Hatch, 1987), indicating the requirement of CA
for C4 plants (Badger & Price, 1994). A study reported that CA activity inhibited in
ethoxyzolamide treated C3 plant caused 80-90% reduction in photosynthesis at low CO2
concentration showing the key role of CA in photosynthesis (Badger and Pfanz, 1995).
The CA also plays important role in stressed conditions (Wei-Hong et al., 2014).
Overexpression of OsCA1 in Arabidopsis enhances the salt tolerance compared to wild
type at seedling stage (Yu et al., 2007). The CA activity increases in the flag leaves
during first period of water stress in drought resistance cultivars but decreases during last
stage of vegetation (Guliyev et al., 2008). Transformants of maize having l0% CA
activity than the wild type showed less CO2 assimilation at ambient pressure of CO2
25
![Page 46: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/46.jpg)
(Caemmerer et al., 2004). Perez-Martin et al. (2014) studied the role of CA enzyme in the
stomatal and mesophyll conductance and found that CA enzyme had little but vital role in
stomatal conductance in 5 year old olive plant under water stress. They also observed that
CA activity was down regulated under water stress and after recovery, it was again
upregulated. Under drought stress, lower CA activity caused reduction in net
photosynthetic rate (PN) in plant. This happens to an extent that it becomes near limiting
for plant photosynthesis. Studer et al. (2014) also suggested that CA appeared to limit the
photosynthesis in C4 plants. Therefore, it would be an interesting subject to increase the
CO2 assimilation in both C3 and C4 plants by regulating the expression of CA activity.
After a complete discussion of endophytic bacteria, their capacity to tolerate the
drought stress and facilitate plant growth under non-stressed as well as stressed
conditions, it can be speculated that endophytic bacteria can be beneficial for growth
enhancement under drought stress. Carbonic anhydrase can improve the photosynthetic
rate and crop productivity. For the reason, present studies were designated to investigate
the efficient drought tolerant CA containing endophytic bacteria for enhancing
photosynthesis and growth of wheat and maize under drought conditions. Moreover,
influence of endophytic bacteria on Arabidopsis thaliana, a model plant, was also studied
under drought conditions in search of finding the possible mechanism of action.
26
![Page 47: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/47.jpg)
Chapter III
MATERIALS AND METHODS
A number of bacterial endophytes were isolated from different plant parts of
wheat and maize crops and tested for their ability to tolerate PEG-6000 induced water
deficit stress. The endophytic bacteria exhibiting high drought tolerance ability were
analyzed for CA activity. These drought tolerant CA containing endophytic bacteria were
screened for plant growth promotion and colonization efficiency in both wheat and maize
under normal and stressed environment in axenic conditions. Endophytic bacterial
isolates having good capability to survive and improve growth of wheat and maize
seedlings under water deficit conditions were further tested in pot and field conditions.
Furthermore, influence of CA containing bacterial endophytes on gene expression of
Arabidopsis thaliana was also studied. Materials and methods used during the
experiments are detailed as under:
3.1. Collection of plant material
Healthy and disease free wheat and maize plants used in this study were randomly
collected during their growing season from five different locations at University of
Agriculture, Faisalabad. The plants of each crop were uprooted, placed in polyethylene
(poly) bags, kept in ice and immediately transferred to laboratory for further processing.
3.2. Isolation and preservation of endophytic bacteria
For the isolation of putative endophytic bacteria, plants from both crops were
washed thoroughly with running tap water to clear away microbes and adhering soil
particles and separated into different parts including root, shoot and leaves. These plant
parts were further cut into 2-3 cm long pieces with the sterilized blade and transferred
aseptically in Petri plates. Grains of two crops were also collected. Plant tissues were
surface-sterilized by dipping them in 70% ethanol for 30 seconds, 3% sodium
hypochlorite (NaClO) for 3 min and rinsed again four to five times with sterilized
distilled water to eliminate the hypochlorite. To confirm the surface sterility, aliquot of
sterile water used in last wash were spread on Petri plates containing Luria Bertani (LB)
and Tryptic Soy Agar (TSA) media, placed in incubator at 28ºC and observed for 3-7
days. The root, shoot, leaf and grain tissues were macerated using sterile pestle and
mortar, serially diluted in 0.85% NaCl solution to improve the disruption of cell wall.
27
![Page 48: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/48.jpg)
Then, 100 µL of tissue extract was poured on two different media (LB, TSA) in triplicate
and placed in incubator at 28º C for 3-7 days to recover bacterial endophytes. After
incubation, individual bacterial colonies were picked on the basis of appearance and
streaked on media and incubated for three days. Eventually, pure cultures of bacterial
endophytes were attained by repeatedly streaking on respective media and then preserved
in glycerol stock at -80 ºC. A total of one hundred and fifty fast growing isolates from
different tissues of both crop plants were selected.
3.3. Drought tolerance ability of endophytic bacteria
One hundred and fifty bacterial isolates from each crop were tested for their
ability to tolerate water deficit stress by using different levels of PEG-6000 in LB media
(Busse and Bottomley, 1989). For this pupose, inoculum of all the isolates either obtained
from wheat or maize was prepared in 100 mL conical flask containing 50 mL sterile LB
broth and left for 3 days in shaking incubator at 28 ºC and 100 rpm. Bacterial cells from
each isolate were harvested by centrifugating the culture at 4000 × g for 15 min and
uniform cell density (0.5 OD i.e. 107- 108 cells mL-1) was maintained in LB media at 600
nm by spectrophotometer. Freshly prepared bacterial cultures (0.5 mL) were inoculated
into test tubes containing 7 mL LB broth media with different osmotic potentials and left
for 3 days at shaking incubator. All the isolates including uninoculated control were
maintained in triplicate at different osmotic potentials. Osmotic potential of -0.31, -0.61, -
1.09, -1.91 and -3.20 MPa was developed by adding different levels of polyethylene
glycol (0, 10, 20, 30 and 40%) in LB broth media measured by Cryoscopic Osmometer
(OSMOMAT-030-D, Gonotec, Germany). Furthermore, osmotic potential was measured
before and after autoclaving the LB broth media. Drought tolerance ability was measured
at 600 nm by spectrophotometer after 3 days and corresponding population was
calculated by dilution plate technique (data not shown; Wollum, 1982). Isolates
exhibiting more absorbance and higher OD were considered more drought tolerant
compared to other isolates.
3.4. Carbonic anhydrase activity of endophytic bacterial isolates
Isolates having better drought tolerance ability from both crops were further tested
for carbonic anhydrase activity by method as described by Achal and Pan (2011) and
Zhang et al. (2011) with some modifications. Bacterial isolates were cultured in 250 mL
flasks having 100 mL LB media and kept at 28 º C for 3 days. Then, these isolates were
28
![Page 49: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/49.jpg)
inoculated in 250 mL flask containing 100 mL CA producing medium and incubated in
mechanical shaker at 150 rpm and 32º C. Cell cultures of bacterial isolates were
centrifuged at 8000 × g for 10 minutes and cell pallets were suspended in 1 mL of Tris-
EDTA (pH 8.0) buffer containing 0.01 mg of RNaseI/mL, and kept at 37 ºC for 1 h.
These bacterial lysates were centrifuged and supernatant was used as CA enzyme
solution.
Carbonic anhydrase activity was measured by colorimetric method. The assay
mixture consisted of 0.8 mL tris buffer solution (pH 7.5, 50 mM), 0.1 mL enzyme
solution and 1 mL substrate solution (p-NPA dissolved in acetonitrile). The released p-
nitrophenol was determined at 400 nm by spectrophotometer using p -nitrophenol.
Distilled water was also used as a blank instead of enzyme solution. One unit enzyme
activity represented the amount of enzyme to produce 1 μmol p-nitrophenol per min.
3.5. Screening of endophytic bacteria for growth promotion of plant and drought
tolerance enhancement in growth pouch assay under controlled conditions
Among the isolates, 10 isolates with good drought tolerance and CA activity from
each crop were tested for plant growth promotion and improvement in drought tolerance
capacity in both wheat and maize, respectively under axenic conditions. Grains of two
wheat varieties viz drought tolerant (Fsd-2008, Faisalabad 2008) and drought sensitive
(Uqab-2000, Uqab 2000) were surface-sterilized with 70 % ethanol and 3.5% NaClO for
5 min followed by four to five washings with sterile distilled water. Four pre-germinated
surface-sterilized seeds were dipped in inoculum for 10 minutes and placed in sterile
(autoclaved) growth pouches already containing 10 mL autoclaved nutrient solution at
120º C for 20 minutes. Similarly, surface-sterilized seeds (as described above) of two
maize hybrids tolerant (H1, Monsanto 919) and sensitive (H2, Monsanto 6525) were
dipped in suspensions but in contrast to wheat, three pre-germinated seed of maize were
placed in each growth pouch. Selection of drought tolerant wheat cultivars and maize
hybrids was done on the basis of literature; cultivar or hybrid which showed better grain
yield under drought stress were considered tolerant and other that showed relatively less
yield was selected as sensitive. Inoculum of each isolate was prepared as described in
previous section. Sterilized broth was used for control and 3 repeats were used for each
treatment. Water deficit stress was induced by dissolving various amount of polyethylene
glycol (PEG-6000) into half strength Hoagland solution (-0.04, -1.09 and -1.23 MPa). For
ensuring sterility, nutrient solution containing PEG-6000 was autoclaved at 120º C for 20
29
![Page 50: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/50.jpg)
min. Approximately, 10 mL of nutrient solution containing different concentrations of
PEG-6000 was added into the growth pouches after 5 days of germination to maintain
water deficit stress. Suitable temperature 25±1 ºC was maintained and light and dark
period was adjusted at 10 and 14 h, respectively for wheat. On the other hand, maize
seedlings were placed at 25 ± 2 ºC and light and dark period was adjusted at a 16 h light
and 8 h dark period, repectively. Plants were collected after 21 days in wheat and 24 days
in maize and data related to root length, shoot length, fresh and dry biomass of root, fresh
and dry bimass of shoot, relative water content, relative membrane permeability,
physiological parameters were recorded. Carbonic anhydrase activity was also measured
in plants. Isolates having better drought tolerance and plant growth promotion were
recognized as efficient isolates in wheat and maize.
Three bacterial isolates from wheat (WR2, WS11, and WL19) and maize (MR17,
MS1, and MG9) were further assessed in both pot as well as in field conditions based on
drought tolerance ability and CA activity as well as growth facilitating activity for wheat
and maize sapling sunder limited water conditions.
3.6. GUS labeling of selected growth promoting bacterial isolates
Based on growth facilitation under screening trial, three potential endophytes from
each crop (wheat and maize) were selected and tagged with glucoronidase A (gusA)
marker gene that form stable insertion in variety of bacteria according to protocol as
defined by Wilson et al. (1995). Construct pCAM110 was used as delivery plasmid DNA
in which gusA gene is under the control of promoter (ptac promoter). For this purpose,
wild type isolates (wheat and maize) and E. coli (Delivery plasmid pCAM110) were
grown at 28 ± 1°C in LB medium until the OD reached to 0.6 at λ 600 nm. Endophytic
bacterial cells of each isolate were then pelleted by centrifugated at 3000 × g (10 min),
washed three times with ice cold deionized water and finally resuspended in 100 μL of
0.85% NaCl (saline buffer). Each cell suspension of 100 μL was mixed well and spread
on the respective plates and placed at 28 ± 1°C for overnight. Bacterial colonies that
exhibited the gusA marker gene were cultured on M9 medium [KH2PO4, 3g; NH4Cl, 1g;
NaCl, 0.5g; Na2HPO4.12H2O, 11g; Fe-EDTA solution, 1 mL; MgSO4, 0.24g; trace
elements solution 1 mL (Alef, 1994) containing SAC (succinate, acetate and citrate) each
at 2 g concentration being dissolved in one litre], rectified with 100 μg mL -1 of XGlcA (5-
bromo-4-chloro-3-indolyl-β-D-glucuronide), 100 μg mL-1 of IPTG (isopropyl-β-D-
galactopyranoside and 100 μg mL-1 of spectinomycin (Sigma, St. Louis, Mo.). Then, the
30
![Page 51: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/51.jpg)
bacterial isolates were inspected by using an optical microscope.
3.8. Evaluation of selected GUS labeled endophytic bacterial isolates in pot trial
Pot experiments were excuted in the glass house of Institute of Soil &
Environmental Sciences at University of Agriculture, Faisalabad to study the efficacy of
three bacterial isolates (each for wheat and maize) for growth enhancement and yield
stimulation in wheat and maize under different field capacity levels. Selection of drought
tolerant wheat cultivars and maize hybrids was done as described in section 3.5. Fresh
inoculum of each gus labeled isolates (Wheat: WR2, WS11, and WL19 and Maize:
MR17, MS1, and MG9) was prepared in 250 mL LB broth possessing 100 µg mL -1
spectinomycin and placed at 28 ± 1˚C in mechanical shaker at 100 rpm for 48 hours. Cells
were collected by centrifugated at 4 ˚C and 4000 × g for 15 min and OD of the culture was
measured by using the OD meter and adjusted to 106-8 CFU mL-1 to obtain uniform
population for inoculation by adding the harvested cell in sterilized LB medium. Seeds of
both wheat cultivars (Fsd, Faisalabad-2008; Uqab, Uqaab-2000) and maize hybrids (H1,
Monsanto 919; H2, Monsanto 6525) were soaked in 10% sterilized sugar solution and
inoculated with the mixture of inoculum, peat and clay in ratio of 1:6:2. Control (without
bacterial inoculation) treatment was also maintained by inoculating seeds of both crops
with mixture of sterilized broth culure, clay, peat and sugar solution. After inoculation,
seeds were dried in shade for 6-8 hour and were sown at 5 seeds per pot. Seventy two
pots were aligned in accordance to completely randomized design under factorial setting
filled with 10 kg of air- dried, well ground and sieved soil that was collected from farm of
Institute of Soil & Environmental Sciences and tested for physico-chemical attributes.
Plants were thinned to three plants for wheat and one plant for maize after two weeks of
germination and allowed to establish before the start of water deficit stress such as well
watered (100% field capcity: FC), moderately stressed (70% FC) and severely stressed
(40% FC) plants. In both crops, plants were grown at different water holding capacities
by weight. Plants were irrigated with tap water as per moisture requirement. Two wheat
cultivars were applied with recommended dose of NPK as 120, 90 and 60 kg ha -1, and
maize hybrids were applied with 160-100-60 kg ha-1 using urea, diammonium phosphate
(DAP) and murate of potash (MOP) fertilizers, respectively. Full doses of K and P were
applied as basal but N was applied in 3 equal splits (before sowing, vegetated and
reproductive stage of the crop). All the treatments were replicated with 3 repeates. After
inducing stress, photosynthesis system was measured using CIRAS. Colonization by
31
![Page 52: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/52.jpg)
endophytic bacteria was also checked in different plant parts by dilution plate technique
in both crops. Green leaves were collected from all the treatments to measure carbonic
anhydrase activity, antioxidants, relative water contents (RWC) and electrolyte leakge
(EL). The plants were allowed to grow till maturity, however, growth and yield aatributes
were noted at harvesting.
3.8. Evaluation of selected endophytic bacteria under skipped irrigation system
Potential bacterial isolates were also tested in the field trials at the experimental
site of the Institute of Soil & Environmental Sciences, University of Agriculture,
Faisalabad. Soil samples were analyzed for physico-chemical characteristics (Table 3.1)
before sowing. Wheat (Uqab-2000) and maize (Monsanto 6525) seeds were treated in the
similar pattern as mentioned in pot study. Recommended dose of NPK (120-90-60 kg ha -
1) for wheat and (160-100-60 kg ha-1) maize were applied, respectively, using fertilizers
urea, DAP and MOP, respectively. Nitrogen was supplied in 3 equal splits (1/3 as basal,
1/3 at vegetative and 1/3 at reproductive stage of crop) whereas P and K were applied as
basal dose. Trials were laid down following the randomized complete block design
(RCBD) under factorial arrangements with three replicates. In wheat, irrigaion was done
with water passing through canal and skipped at tillering, flowering and grain filling
stages of crop as per treatment plan whereas control was sustained with recommended
(four) irrigations. In case of maize, drought stress was imposed at vegetative and
reproductive stage whereas a treatment receiving recommended irrigations was also
maintained. Green leaves were collected from all the treatments to measure the carbonic
anhydrase and antioxidants. After inducing stress, photosynthesis system was measured
using CIRAS. The plants were allowed to grow till maturity, however, growth and yield
attributes were noted at harvesting. Morevover, grains of both crops were analyzed for
nutrient contents (NPK).
3.9. Physico-chemical properties of soil
Soil used in pot and field experiment of both crops was analyzed according to
protocols given below.
3.9.1. Textural analysis
Soil texture was exmined using method defined by Moodie et al. (1959). For this
purpose, 40 g soil was taken into plastic bottles (600 mL) and 40 mL of dispersing agent
(2% sodium hexametaphosphate) was incorporated and left for overnight. After that, soil
32
![Page 53: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/53.jpg)
suspension was mixed with mechanical stirrer and gentally transferred into 1 L
cylinder. Then, brought to volume using deionized water and stirred the suspension with
plunger. The readings were recorded with Bouyoucos hydrometer. Textural class was
assigned using the USDA textural class calculator (USDA, 2011).
3.9.2. Saturation percentage (SP)
For the determination of soil saturated paste, air-dried soil (200 g) was slowly
saturated using distilled water and weighed in a tared china dish. After that, paste was
dried in an oven at 105 ˚C and re-weighed. Saturation percentage (SP) was obtained by
putting values in the following formula (Method 27a, U.S. Salinity Lab. Staff, 1954).
SP(%)=Weight of saturated soil−Weight of oven dried soilWeight of ovendried soil
×100
3.9.3. pH of the saturated soil paste (pHs)
pH of soil saturated paste was examined after preparing paste using pH meter
(Kent Eil 7015, England) according to Method 21a, U.S. Salinity Lab. Staff (1954).
3.9.4. Electrical conductivity of soil extract (ECe)
Water from saturated paste was obtained using vacuum pump through ceramic
filter. Electrical conductivity (EC) of the saturated paste extract was measured by
conductivity meter (Jenway Conductivity Meter Model 4070) following Method 3a and
4b, U.S. Salinity Lab. Staff, 1954.
3.9.5. Organic matter content
Soil organic matter was quantified as per method given by Moodie et al. (1959).
One gram (1g) soil was well blended with 10 mL of IN potassium dichromate (K2Cr2O7)
solution and then 20 mL of concentrated sulphuric acid (H2SO4) was added in 500 mL
flask, agitated and left for 30 min. After that, about 150 mL of distilled water and 25 mL
of 0.5 N FeSO4 (ferrous sulphate) were added. Then, titrated against 0.1 N solution of
KMnO4 till end point. Blank (without soil) was also prepared using same procedure.
3.9.6. Total nitrogen
Soil total nitrogen was measured following the Gunning and Hibbard’s method
using conc. H2SO4 where ammonia was collected into 4% boric acid during distillation
with Kjeldhal’s apparatus. Then, receiver flask was titrated with 0.01 N solution of H2SO4
(Jackson, 1962).
33
![Page 54: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/54.jpg)
Table 3.1. Phyico-chemical characteristics of the soils used for wheat and maize trials
Characteristics Unit Value
Pots Field
(Wheat)
Field
(Maize)
Textural Class Sandy clay loam Sandy clay loam Sandy clay loam
Saturation percentage % 35 38 37
pHs -- 7.2 7.9 7.4
ECe dS m-1 2.15 2.20 2.19
Organic matter % 0.87 0.77 0.74
Total nitrogen % 0.03 0.05 0.05
Available phosphorus (P) mg kg-1 6.8 7.9 7.4
Extractable potassium mg kg-1 120 115 113
34
![Page 55: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/55.jpg)
3.9.7. Available phosphorus
Extract of five gram (5 g) air-dried soil was taken using 100 mL 0.5 M sodium
bicarbonate solution (pH 8.5) and filtered with Whatman No. 42 filter paper. Afterwards,
filtrate was taken in 250 mL conical flask. Five milliliter (5 mL) of filtrate was mixed
with 5 mL of color developing reagent (ascorbic acid) and volume (100 mL) was brought
with distilled water. Absorbance was measured at 880 nm wavelength using
spectrophotometer (ANA-720W, Tokyo Photo-electric Company Limited, Japan) while P
concentration was calculated from caliberation curve (Watanabe and Olsen, 1965).
3.9.8. Extractable potassium
Soil extraction was done with 1 N ammonium acetate (pH 7.0) and K was
determined with Jenway PFP-7 flame photometer (England). However, K concentration
was calculated by using caliberation curve (Method 1la, Salinity Lab. staff, 1954).
3.10. Plant analysis
3.10.1. Chemical analysis
Grain samples were ground and wet digested to measure nutrient (N, K and P)
contents as follow.
3.10.2. Digestion
Dried and ground sample (0.1g) was transferred quantitavely in 25 mL conical
flask. Two millimeter of concentrated H2SO4 was added and allowed to stand at room
temperature for overnight. Then, 1 mL of 35% hydrogen peroxide (H2O2) was poured in
flask and kept at 350 ˚C for 20 min on hot plate. Afterwards, flasks were removed, 1 mL
H2O2 was slowly poured and were kept on hot plate for 20 min. This procedure was
carried out until the digestate became colourless. Then, filtered this colourless material
and diluted with distilled water in volumetric flask (50 mL), brought to volume and
preserved for macronutrients estimation (Wolf, 1982).
3.10.3. Nitrogen determination
Nitrogen estimation was done by placing 5 mL of digested solution in digestion
tube on Kjeldhal distillation apparatus. Briefly, 10 mL of NaOH (40%) poured in tube
and started the distillation. After that, distillate was collected in 100 mL receiver flask
containing H3BO3 and stopped the distillation when volume was reached to 50 mL. Then,
35
![Page 56: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/56.jpg)
removed the receiver flask from apparatus and allowed to cool for few min. At the end,
distillate was treated against 0.01 N standardized H2SO4 till pink color end point.
3.10.4. Phosphorus determination
Five milliliter of sample aliquot was added in Barton’s reagent (10 mL) and
volume was brought to 50 mL using distilled water. These samples were allowed to stand
for 30 min and measured the absorbance on ANA-720W spectrophotometer (Tokyo
Photo-electric Company Limited, Japan) at 410 nm wavelength. Actual P concentration
was calculated by plotting standard curve.
a). Barton reagent
The Barton reagent was processed by mixing the Reagent A and B following the
Ashraf et al. (1992).
Solution A
This solution was made by mixing 25 g ammonium molybdate in distill water
(400 mL).
Solution B
For this, 1.25 g of ammonium metavenadate was added in 300 mL of boiling
water and about 250 mL concentrated HNO3 was added after cooling. Both solutions (A
and B) were well mixed in volumetric flask and brought to 1L with distilled water.
3.10.5. Potassium determination
For K content, fed the sample aliquote to Jenway PFP-7 flame photometer
(England) and its content was measured using a standard curve developed by different
known cocenctation of potash.
3.10.6. Leaf relative water contents (RWC)
The relative leaf water content (RWC) was calculated with the following formula
suggested by Teulat et al., (2003).
RWC= (Fresh weight−Dry weight )(Fully turgid weight−Dry weight)
Three leaf samples were collected early in the morning (8:00 to 10:00 a.m) from
each treatment to determine the relative water content. Fully turgid weight was attained
by placing them at 4 ºC for 24 h and dry weight was noted after oven dried.
36
![Page 57: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/57.jpg)
3.10.7. Electrolyte leakage
Freshly cut leaf discs were rinsed with deionized water and transferred into test
tube having 5 mL deionized water. Then, tubes were placed on shaker for 4 h at room
temperature. The electrolyte leakage, electrical conductivity was measured with
conductivity meter (Jenway Conductivity Meter Model 4070, England). Then, tubes were
placed in autoclave at 121 ºC and 15 psi for 20 min. After cooling these tubes, electrical
conductivity was recorded and leakage of ions from leaves was calculated following the
formula (Jambunathan, 2010).
%EL= EC before autoclavingEC after autoclaving
× 100
3.10.8. Chlorophyll content
Chlorophyll content in leaves was recorded with the help of SPAD-502 meter
(Konica-Minolta, Japan). Measurements were taken at three points of each leaf. Three
readings were averaged to provide single reading. Readings were taken from all the
repeats of each treatment.
3.10.9. Gaseous exchange parameters
Gases exchange parameters of flag leaves were recorded using portable
photosynthesis systems CIRAS-3, during 9:00 to 12:00 a.m in both pot and field
experiments of wheat and maize at photosynthetic photon flux density of 1200-1400 μmol
m-2 s-1. Fully expanded flag leaf was used to measure CO2 assimilation rate (A), stomatal
conductance (gs), substomatal CO2 conductance (Ci), transpiration rate (E), and water use
efficiency (WUE). Readings were noted from all the repeatsof each treatment.
3.10.10. Carbonic anhydrase activity
The CA activity was measured according to method defined by Dwivedi and
Randhawa (1974). Briefly, leaf samples obtained from wheat and maize were chpped into
small fragments and 200 mg samples were dipped in cystein hydrochloride solution and
incubated for 20 min at 4˚C. After that, leaf samples were blotted and transferred to test
tube containing phosphate buffer (pH 6.8) followed by alkaline bicarbonate and
bromothymol indicator. These test tubes were incubated at 5˚C for 20 min and titrated
against HCl using methyl red as indicator. Results are expressed as mol (CO2) kg−1 (F.M.)
s−1.
37
![Page 58: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/58.jpg)
3.10.11. Proline content
For the quantification of proline contents, 1 g of leaf tissues was ground with
sulphosalycylic acid (3%) and clarified with filter paper (Whatman No.2). Filtrate was
blended with glacial acetic acid and acid ninhydrin and heated for 1 h in water bath at 100
ºC. After 1 h of heating, reaction was allowed to stopp on an ice bath. Then, extract was
taken with toluene and its absorbance was recorded on spectrophotometer at about 520
nm wavelength. Afterwards, proline content (µg g-1) was calculated using caliberation
curve (Bates et al., 1973).
3.10.12. Total protein content
Protein content in leaves of both crops was measured as method defined by
Bardford (1976). For total protein contents, 200 µL extract of fresh leaves was transferred
into test tube and mixed with 1800 µL deionized water. Then, added 2 mL Bardford
reagent and placed for 10-20 min at room temperature. After that, absorbance was
computed by ANA-720W spectrophotometer, made by Tokyo Photo-electric Company
Limited, Japan, at 595 nm wavelength. Protein content (µg g-1 fresh weight) in leaves was
determined from caliberation curve derived form BSA (bovine serum albumin).
3.10.13. Malondialdehyde content
The lipid peroxidation/ malondialdehyde (MDA) was checked by calculating the
quantity of MDA produced through the reaction of thiobarbituric acid (TBA) as
mentioned by Jambunathan (2010). The reaction mixture (2.5 mL), containing 0.5 mL
leaf extract, 0.5% thiobarbituric acid (TBA) and 20% trichloroacetic acid (TCA), was
heated in fume hood for 30 min at 95 ºC and quickly allowed to cool on ice bath. After
that, absorbance was recorded on 532 and 600 nm. Then, MDA contents (µg g-1 fresh
weight) were figured out by measuring difference in absorbances (A532-A600) following
equation as described by Beer and Lambert’s.
3.10.14. Catalase in leaves
Catalase activity was performed by measuring the disintegration of H2O2 at 240
nm. The reaction mixture consisted of 2 mL extract which was diluted 200 times using 50
mM solution of potassium phosphate buffer having pH 7.0 and 1 mL 10 mM H2O2.
Decline in absorbance was observed due to H2O2 extinction at 240 nm. The activity was
described as mM H2O2 min-1 mg-1 protein (Cakmak and Marschner, 1992) at 25 ± 2 °C.
38
![Page 59: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/59.jpg)
3.10.15. Glutathione reductase in leaves
Leaves of both plants grown under normal as well as drought condtions were
homogenized in 50 mM potassium phosphate buffer having pH 7.8 along with 2 mM
EDTA. Then, homogenate was centrifuged and supernatant was used for assay. Three
millimeter of reaction mixture contained 30 µL of sample extract, 0.75 mM 5, 5´-dithiobis
2-nitrobenzoic acid (DTNB), 1 mM oxidized glutathione (GSSG) and 0.1 mM
Nicotinamide adenine dinucleotide phosphate NADPH. Glutathione reductase was
determined by measuring rise in absorbance due to reduction of DTNB to TNB. The
activity of GR was described in µM TNB min-1 mg-1 protein (Smith et al., 1988) at 25 ± 2
°C.
3.10.16. Ascorbate peroxidase in leaves
Ascorbate peroxidase (APX) activity was figured out by subjecting the samples to
spectrophotometer at 290 nm wavelength (Nakano and Asada, 1981). The reaction
mixture consisted of 20 µL plant extract, 660 µL H2O2, 660 µL 50 mM potassium
phosphate buffer having pH 7.0, and 0.5 mM 660 µL ascorbic acid solution. However,
H2O2 was poured at the end to initate the reaction because the reaction wasstarted after the
addition of H2O2. Decline in absorbance was measured for three min. The enzyme activity
APX (mM Ascorbate min-1 mg-1 protein) was described at 25 ± 2 °C.
3.10.17. Total phenolics in leaves
Total phenolics were estimated calorimetrically using the method defined by
Singleton et al. (1999). The reaction mixture (2 mL) was prepared by transferring 20 µL
sample extract, 1580 µL distilled water, 300 µL 1 N Na2CO3 and 100 µL 0.25 N Folin
ciocalteu’s reagent and left in dark for h at room temperature. In Folin-Ciocalteau’s
reagent, phenol reacts with phosphomolybdic acid and formed a blue coloured
complex.Then; absorbance of above stated reaction mixture was measured on
spectrophotometer at 760 nm Total phenolics were expressed in µg g-1.
3.10.18. Total soluble sugars in leaves
To measure the total soluble sugars, anthrone colorimetric method was used as
described by Sadasivam and Manickam, (1992). For this, 200 µL of sample was obtained
from leaf extract and mixed with 1800 µL deionized water followed by 8 mL anthrone
reagent. This solution was heated in hot water for 8 min and afterwards cooled on ice
bath. The absorbance was recorded at 630 nm on spectrophotometer. Amount of soluble
39
![Page 60: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/60.jpg)
sugars was determined from caliberation curve developed by glucose solutions (Hedge
and Hofreiter, 1962) and expressed in terms of µg g-1.
3.10.19. Colonization of plant tissues
Colonization by endophytic bacteria in root, shoot and leaves were studied by
using method described by Naveed et al. (2014a). For isolation of endophytic bacteria, 3
g of root, 5 g of shoot and leaves from each treatment were surface-sterilized and
macerated in 15 mL saline buffer (0.85% NaCl) solution with autoclaved mortar and
pestle. Suspension was mixed well on rotary shaker for 1 min and then allowed to settle
down at room temperature. Afterwards, serial dilutions were made upto 10 -4 in case of
root and 10-3 in case of shoot and leaves and spread on LB media plates having 100 g mL-
1 spectinomycin, 100 g mL-1 XGlcA, and 100 g mL-1 IPTG as mentioned by Afzal et al.
(2012). Plates were placed at 28 ± 1˚C in an incubator for 48 h and transferred to 4˚C for
three days and measured the blue colonies with colony counter.
3.11. Characterization and identification of selected endophytic bacteria
Selected drought tolerant and growth promoting carbonic anhydrase containing
endophytic bacterial isolates were studied for particular plant growth facilitating
charcteristics. Their PGP activities were studied using the standard protocol as discussed
below:
3.11.1. Indole 3-acetic acid production under normal and stressed environment
To determine the quantity of IAA (indole 3-acetic acid, an auxin) produced by
endophytic bacterial isolates with L-TRP and without L-TRP under non-stressed and
water-deficit stressed conditions, a spectrophotometric technique was followed using
procedure demonstrated by Sarwar et al. (1992). For this, fresh cultures of selected
isolates were prepared in conical flasks having LB media and placed at 28 ± 1 °C in
mechanical shaker (100 rpm) for 72 h. After incubation, broth culture of isolate was
centrifuged at 4 °C for 15 min and 4000 × g, and uniform OD 0.5 was developed in
sterilized distilled water. Then, 20 mL sterilized LB broth was shifted in 100 mL conical
flasks followed by 5 mL of 5% filter-sterilized (0.2 µm membrane filter) L-TRP solution
to achieve the 1 g L-1 solution concentration. For drought stress, 15% PEG-6000 was
added into LB medium coupled with and without substate (L-TRP). Flasks containing LB
broth media were inoculated with 1 mL of inoculum in the presence and absence of
substrate (L-TRP) under normal (non- stressed) and stressed conditions and placed at 28
40
![Page 61: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/61.jpg)
± 1 ºC in mechanical shaker for 2 days at 100 rpm. Uninoculated control was also
maintained for comparison. Then, culture was filtered using filter paper. Afterwards, 2
mL of freshly prepared Salkowski reagent as colour developing reagent (CDR) was
mixed with 3 mL of culture filterate. After adding CDR, tubes were allowed to stand for
30 min at room temperature. Standard IAA solutions were prepared and colour was
induced using salkowski reagent. The reading was recorded on spectrophotometer using
absorbance of 535 nm and IAA concentration was attained from caliberation curve.
3.11.2 Phosphate solubilization
3.11.2.1 Phosphate solubilization (plate assay)
Bacterial strains isolated from both wheat and maize were studied for their
phosphate (inorganic phosphate) solubilization capacity by growing them on NBRI-PBB
(National Botanical Research Institute Phosphate Bromophenol Blue) medium (Mehta
and Nautiyal, 2001). Loopful quantity of each actively growing bacterial strain cultures
(0.5 OD) were poured at four different sites of Petri plates. All the selected endophytic
bacteria were inoculated on three Petri plates and placed in an incubator for 7 days at 28 ±
1 ºC. After 7 day, isolates showing halo zone around their colonies were able to solubilize
the inorganic phosphate and proved to be efficient P solubilizers.
3.11.2.2. Phosphate solubilization under normal and stressed condition
Endophytic bacteria were also tested for quantification of P solubilization ability
under normal (non-stressed) as well as PEG-6000 induced stressed conditions. For this
purpose, fresh cultures of selected isolates were prepared in flasks having LB media and
placed at 28 ± 1°C in orbital shaker (100 rpm) for 72 h. After incubation, broth culture
was centrifuged using centrifuge machine for 15 min at 4 °C and 4000 × g and uniform
OD 0.5 was maintained in sterilized distilled water. After that, loopful of actively
growing isolates was inoculated in 100 mL conical flasks carrying 50 mL of NBRI-PBB
media both with without 15% PEG-6000 and placed at 30 ± 2 °C on mechanical shaker
for 7 days at 150 rpm. After 7 days incubation, cell culture was centrifuged using
centrifuged machine at 5000 rpm for 10 min to get cell free supernatant of bacterial
isolates. Then, 1 mL of cell free supernatant was blended with 4 mL Reagent B and 20
mL of water and allowed for color development. After 20 min, OD was measured on
spectrophotometer at 882 nm. Blank samples were also run. Soluble P was measured by
following the standard curve of KH2PO4.
41
![Page 62: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/62.jpg)
Picture 1: Phosphorus solubilization by endophytic bacterial isolates
42
![Page 63: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/63.jpg)
3.11.3. Siderophore production
Bacterial culture being assayed for production of siderophore was spotted on Petri
plates having sterilized CAS (chrom azurol S) agar media. Ten microliters of each
inoculum was spot inoculated on plates with 3 repeats and placed at t 28 ± 1 ºC in an
incubator a for 48-72 h. Similarly, control plates were also processed by spot inoculation
of sterilized broth. Positive results for siderophore were observed by formation of orange
yellow zone along the growth (Schwyn and Neilands, 1997).
3.11.4. Exopolysaccharide (EPS) production
Bacterial inoculants were prepared in 10 mL of customized LB medium
inoculated with 100 µL of culture and placed at shaking incubator. After incubation at 28
± 1 ºC and 100 rpm for 72h, they were adjusted to OD 0.5, loopful of grown cultures was
plated at different locations on Petri plates carrying RCV-glucose media proposed by
Ashraf et al. 2004 and incubated for 48 h at 28 ± 2oC. At the end of incubation, colonies
which had mycoid growth were examined by visual appearance. Mucoidy growth showed
that isolates were considered positive for exopolysaccharides (EPS) production.
3.11.5. Chitinase activity
The potential of these bacteria for chitolytic activity was assayed by growing them
on colloidal chitin LB agar medium (Chernin et al., 1998). For this, loopful of culture of
each isolate, adjusted to 0.5 OD, was poured on four sites of chitin agar Petri plates and
kept for 96 h in an incubator at 28 ± 1 ºC . Plates were observed for zone of clearance
around the inoculated area. Colonies showing the large halo zone around them were
considered as potent chitinase producer.
3.11.6. Catalase activity
Catalase activity in selected bacterial isolates was determined using method
demonstrated by MacFaddin (1980). For this, loopful quantity of bacterial culture to be
tested was poured on slide (microscopic glass slide), afterthat, a drop of H2O2 (35%) was
placed on the bacterial culture with the help of dropper. Bubbles production, on reaction
of H2O2 (35%) addition, was a signal of existence of catalase activity in selected
endophytic bacteria (Diane Hartman, Baylor University, Waco, TX).
3.11.7. Oxidase activity
Isolates to be tested for oxidase activity were grown in LB agar plates at 28 ± 1 ºC
43
![Page 64: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/64.jpg)
Picture 2: Exopolysaachride production by endophytic bacterial isolates
44
![Page 65: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/65.jpg)
for 24 h. After incubation, a portion of overnight grown colony with inoculation loop was
picked and mashed on filter papers treated with Kovacs reagent (soaked in 1% reagent
and dried). Filter paper was observed for colour change to purple. Change in colour, in a
period of 90 s, from blue to purple was considered positive for oxidase (Steel, 1961).
3.11.8. Organic acid production
Bacterial isolates were tested for the production of oraganic acid as described by
Vincent (1970). For this, freshly prepared bacterial culture was streaked on LB agar
plates possessing blue dye (0.025%) and incubated at 28 ± 1 ºC for 72. At the end of
incubation, media color change to yellow was considered positive for organic acid.
3.11.9. Microbial aggregation ability
The ability of bacteria to aggregate was assessed according to method
demonstrated by Madi and Henis (1989) with certain modifications. The selected isolates
were cultured separately in LB medium at 28ºC for 24 h. The freshly grown cultures were
poured into test tubes and left at room temperature for 20 min. Aggregates were settled
down at the bottom of test tubes and free bacterial cells were present in suspension.
Afterthat, turbidity (cloudiness) of aliquot was recorded (OD1) at 540 nm by
spectrophotometer. Then, vortexed the cell suspensions for 1 min and measured the
turbidity (OD2). The percent aggregate of isolates was expressed as
% aggregation=OD 2−OD 1OD 2
× 100
3.11.10. Survival under starved condition
Ability of isolates to survive under starved conditions was assayed following Tal
and Okon (1985) with few modifications. Briefly, after three days incubation at 100 g and
28 ± 1 ºC, selected bacterial cells were collected by centrifugating at 4000 × g using
centrifuge machine and then suspended in LB broth medium without carbon source
(Trypton). Inoculated culture was again incubated for 13 days at 100 × g and 28 ± 1 ºC
in orbital shaking incubator. Bacterial population (CFU mL-1) was counted with the help
of colony counter using the serial dilution method.
3.11.11. Survival of bacterial inocula in soil
Survival of inoculants was studied using protocol of Fallik and okon (1996) with
some modifications. Ten gram of previously sterilized soil was inoculated with isolates in
45
![Page 66: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/66.jpg)
Picture 3: Catalase production by endophytic bacteria
Picture 4: Oxidase production by endophytic bacteria
46
![Page 67: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/67.jpg)
test tubes and placed at 28 ± 1 ºC for 30 days. After that, (0.9%) saline water was added
in soil and shaken well for 2 h. Viability of endophytic bacteria was determined through
serial dilution method and given as CFU g-1 of soil.
3.11.12. Cellulase activity
Cellulase activity of endophytic bacterial isolates was also determined by
growing the isolates on plates containing 1% carboxymethyl cellulose. After 2 days
incubation, plates were filled with Gram's iodine staining solution. Plates were washed
with NaCl (1 M) to confirm the cellulose degrading ability and to clarify the halo zone
around bacterial colonies (modified from Yin et al., 2010).
3.11.13 Xylanase activity
Ability to isolate to degrade xylan was determined as described by Roy and Habib
(2009). Isolates were spread on plates containing 0.5% xylan and incubated for 2 days.
After incubation, bacterial colonies producing halo zone were considered positive for
xylanase activity.
3.11.14. Protease activity
For confirmation of protease activity, bacterial isolates were streaked on 10%
gelatin containing agar plates. Plates were incubated for 24 h. Halo zone formed around
bacterial colonies was used as indicator of protease activity (Josephine et al., 2012).
3.11.15. Identification of selected isolates
Sequencing of bacterial isolates (WS7, WS11, WL19, MR17, MS1, MG9, AR4
and AR14) was performed by Macrogen Inc. (Korea). These isolates were identified by
16S r RNA gene sequencing. For phylogenetic tree, the partial sequences of nucleotides
of these isolates were analyzed for sequence smililarity using Basic Local Alignment
Search Tool (BLAST) program on National Center for Biotechnology Information
(NCBI) site and identified on the basis of closest homology. Then, aligned the sequences
using ClustalW alignment and subjected to phylogeny analysis using MEGA 5 software.
3.12. Influence of endophytic bacteria on gene expression in Arabidopsis thaliana
under drought stress
3.12.1. Sample collection and isolation of endophytic bacteria from arabidopsis
Healthy plant samples were collected from already cultivated Arabidopsis plants
47
![Page 68: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/68.jpg)
in three different soils in the controlled environment of growth chamber of Plant Microbe
Interaction Laboratory, The University of Queensland, Australia. Plant samples were
obtained and cleaned with running tap water. Roots and leaves were separated, surface
sterilized with ethanol and 1 % NaClO for 3 min and afterwards, washed four to five
times with sterile distill water. To check the sterilization efficacy, aliquots from last
washing was poured on LB medium containing Petri plates. These samples were
pulverized in pestle and mortar. Different dilutions were made and spread on plates and
then preserved as described in earlier section (3.2)
3.12.2. Screening of endophytic bacteria for stress tolerance and carbonic anhydrase
activity
All the isolates were screened for the sensitivity of isolates against polyethylene
glycol (PEG-6000). Media (LB broth) with different concentration of PEG were prepared
and inoculated with overnight grown culture. The cultures were placed for 24 h at shaking
incubator at 180 rpm and 28 ˚C and growth was calculated by reading absorbance at 600
nm. All the drought tolerant endophytic bacteria were also screened for carbonic
anhydrase activity as described in earlier section (3.4.).
3.12.3. Screening of selected bacterial isolates for plant growth promotion under
PEG induced water deficit stress
Ten drought tolerant endophytic isolates having higher carbonic anhydrase were
further screened under gnotobiotic conditions to improve Arabidopsis thaliana biomass
under normal and PEG indued water deficit stress conditions in pouch trial. Seed of
arabidopsis ecotype Columbia were sterilized by dipping in ethanol (70%) for 5 min and
50% bleach for 2 min followed by 5 times rinsing with sterile distilled water. Afterthat
seeds were spread on Petri plates having half strength Murashige and Skoog (MS) media
and then placed for 2 days at 4˚C for scarification. After scarification, those Petri plates
were transferred to growth room and kept at 22°C for 10 h of light and 14 h dark for 2
weeks. Inoculum of each isolate was prepared as explained in previous section (3.3).
Sterilized broth was used for control and 3 repeats were used for each treatment. Root of
arabidposis plants were dipped in respective inocula and placed in growth pouch already
containing sterile half strength Hoagland solution. After two weeks, plants were exposed
to water deficit stress induced by various amount of PEG-6000 (polyethylene glycol) i.e,
0, 3 and 5% into half strength Hoagland solution. Then, 10 mL of PEG-6000 solution was
48
![Page 69: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/69.jpg)
Picture 5: Screening of drought tolerant CA containing endophytic bacterial isolates for plant growth promotion in Arabidopsis thaliana under axenic conditions
49
AR14Control
![Page 70: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/70.jpg)
added into the growth pouch. Suitable temperature (22º C) was maintained and light and
dark period was adjusted at 10 and 14 h, respectively, in growth chamber. Plants were
harvested after one week exposure to drought stress and data related to root and shoot
length, root fresh and dry biomass, shoot fresh and dry weight were recorded
3.12.4. Effect of selected isolates on gene expression in Arabidopsis thaliana under
PEG induced water deficit stress
Arabidopsis seeds (ecotype Columbia) were collected from Plant Microbe
Interaction Laboratory, The University of Queensland, Australia. Seeds were surface-
sterilized, placed on MS media plates as described in section 3.12.3 and scarified for 2
days at 4˚C. Then, plates were placed vertically for 2 weeks in growth room at 10 h light
and 14 h dark. Two isolates (AR1 and AR14) were used. Inoculum of selected isolate was
prepared as explained in earlier section (3.3). Sterilized broth was used for control and 3
repeats were used for each treatment with two technical repeats. After 2 weeks, roots of
arabidposis plants were dipped in respective inocula and spread in Petri plates containing
half strength MS medium without sucrose with 0 and 3 % PEG-6000 for 10 days. Plant
samples were harvested and number of lateral roots, root length, and root and plant fresh
biomass were measured.
3.12.5 RNA extraction
For RNA extraction, arabidopsis leaves were cut and immediately placed in liquid
nitrogen. Leaf samples from both PEG induced water defcit stressed and non-stressed
plants were mashed in liquid nitrogen. However, total RNA from leaf tissues was
obtained using SV Total RNA Isolation System (Promega, Madison, USA) following the
instruction given by manufacturer. The integrity and quality of RNA as well as lack of
genomic DNA was confirmed with agarose gel electrophoresis and using NanoDrop
2000D (NanoDrop Technologies,Wilmington, DE, USA).
3.12.6. Preparation of cDNA and primers sequence
First strand of complementary DNA was synthesized from all the treatments using
kit namely Invitrogen, USA, SuperScript III Reverse Transcriptase kit according to the
instruction described by manufacturer and stored at -20˚C. Most of primer sequences used
in this study was synthesized using Primer express 3 software whereas some primers were
collected from Plant Microbe Interaction Laboratory, The University of Queensland. The
sequences of primers which were used for RT-PCR (real time polymerase chain reaction)
50
![Page 71: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/71.jpg)
are given in the table (3.2.).
3.12.7. Expression profiling through Real Time PCR
Transcripts levels of arabidopsis gene were determined with RT PCR on sequence
detection system, ABI Prism 7900 (Applied Biosystems), with SYBR Green PCR Master
Mix following the instructions defined by manufacturer i.e. 1µL primer, 5 µL SYBR
Green PCR and 4 µL cDNA. Two biological repeats for all the treatments were prepared.
Actin, internal reference gene, was used for measureing the relative transcript level in
analysis. The level of these internal reference genes did not change during the PEG
induced water deficit stress. Specificity of RT PCR was assured by the presence of single
peak of amplified products in melting curve during analysis of RT PCR and single band
on agarose gel. PCR efficiency of arabidopsis primer pairs was investigated using
programme LinReg as described by Ramakers et al. (2003). Moreover, relative
quantification of each treatment was determined following the method described by Pfaffl
(2001). Relative mRNA value in the given sample was determined using the mean of two
values against reference gene. For gene expression; ratio is expressed in relative
expression level compared with actin internal standard.
3.13. Statistical analysis
Various statistical tools were followed to interpret the data (Steel et al., 1997) and
Duncan’s Multiple Range Tests was used for comparing means (Duncan, 1955).
51
![Page 72: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/72.jpg)
52
Table 3.2. Primer sequences for arabidopsis used in RT-PCR
Gene Category Primer Name 5’-3’ Designed by
Actin rt_ActinUni_Frt_ Actin 2_Rrt_ Actin 7_Rrt_ Actin 8_R
AGTGGTCGTACAACCGGTATTGTGATGGCATGGAGGAAGAGAGAAACGAGGAAGAGCATTCCCCTCGTAGAGGATAGCATGTGGAACTGAGAA
Bob
AtERF7(AP2/EREBP-type Transporter related to ABA)
At-ERF7_FAt-ERF7_R
CTTCTCCATGAGGAAAGGGAGAGTCTATACCTCGGCTCCTTCACAG
This work
Late embryogenesis abundant protein (LEA) At-LEA-FAt-LEA-R
GCACCGTTGGAGAAACACATCTTGCTCCAGTACCAGCAGAGAC
This work
Putative DRE- binding protein (DREB2A) At_DERB2A_FAt_DERB2A_R
GGAGTGGAGCCGATGTATTGTCCTCGCTCAGCCAATGCTTATC
This work
At_ERF13_FAt_ERF13_R
CAGTTAACGTCGGAGCAGAAGAGGATCCACCGTGAAATCCAACTC
This work
WRKY At-WRKY8_FAt-WRKY8_R
GAAGTTGTCGGTGATGGTTGTGGATGATGATCGGCCTCACTTG
This work
At-WRKY57_FAt-WRKY57_R
CCCTCAGCTACCTCAAGTTCAAGGAGCCTTCTTCTTCTCCTTCACTG
This work
RAB 18 ABA responsive gene At-RAB18-FAt-RAB18_R
AGCTCTAGCTCGGAGGATGATGCATGATGACCTGGCAACTTCTC
This work
At_LTI78_FAt_LTI78_R
GAATCGCCACATTCTGTTGAAGACAGTGGAGCCAAGTGATTGTG
This work
PR1 At_PR-1_FAt_PR-1_R
GTGGCGTGACTCGGTTCGTGTAATTCCCCGGAGGAT
This work
Gene Category Primer Name 5’-3’ Designed by
MYB 15 (MYB domain protein 15) DNA binding and transcription factor
MYB_FMYB_R
CCTGATTGTGTTTCCAAGAAGATTGCCAGCCACTTCTAGGTCATTCG
Nasser
RD22 (Responsive to dehydration) RD22_FRD22_F
ATTGTGCGACGTCTTTGGAGTTGCGTTCTTCTTAGCCACCTC
Lilia
799 Putative cold acclimation protein (dehydrin 10)
ERD10799 and 799 Homolog
AGCTCTTCTTCCTCTTCGAGTGATGCCACTGTTTTCACATGATCTCCTTC
Peer
Cor 47Similar to cold-regulated protein cor47
rt_COR47_Brt_COR47_A
CCACTAGTCCTTTCTTATCTTCCTCTCCCTTCTTCCTCTTCGAGCGATGA
Peer
RD29b(Rreposnive to dessication)
RD29B_FRD29B_R
ATGGAGTCACAGTTGACACGTCCTCTTCTGGGTCTTGCTCGTCATACT
This work
Zat-10 ZAT10_FZAT10_R
GTGTCCAACTCCGAAGGTGCCCATCGAGAATTCAGGGATCG
This work
![Page 73: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/73.jpg)
53
![Page 74: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/74.jpg)
Chapter IV
RESULTS
Increasing water deficit stress and global concerns for production of copious food
to support expanding human population have gained attention among the scientific
community. They are striving hard to explore innovative approaches for meeting the
challenge. In the present study, several culturable endophytic bacteria were obtained from
wheat and maize plants and tested for their ability to tolerate PEG-induced water deficit
stress. Drought tolerant isolates were further characterized for carbonic anhydrase (CA)
activity. Selected endophytic bacterial isolates with higher CA activity were screened for
growth promotion of wheat (C3 plant) and maize (C4 plant) at different water deficit
stress levels under axenic conditions. Efficient isolates (from wheat and maize) were
further evaluated for improving photosynthetic rate and plant biomass of both crops in pot
and field under non-stressed as well as stressed conditions. Moreover, potential of
drought tolerant CA containing endophytic bacteria was also tested for understanding the
gene expression in Arabidopsis thaliana, a model plant, under water deficit stress. Results
are demonstrated in details as under:
4.1. Drought tolerance ability of endophytic bacteria
Endophytic bacteria isolated from different tissues of wheat and maize plants were
analyzed for their drought tolerance ability at -0.31, -0.61, -1.09, -1.91 and -3.20 MPa
with PEG-6000 induced water deficit stress. Results showed that optical density of
endophytic bacterial isolates decreased with increasing the PEG-6000 induced water
deficit stress. However, isolates differed for their gowth and survial ability at different
water deficit levels. The results of wheat and maize isolates are presented separately.
4.1.1. Drought tolerance ability of endophytic bacterial isolates from wheat
Results regarding drought tolerance ability of 150 endophytic bacterial isolates
exposed to PEG induced water deficit stress (-0.31, -0.61, -1.09, -1.91 and -3.20 MPa)
showed that isolates differed for their cability to tolerate PEG-mediated water deficit
stress. Principal component analysis of endophytic bacteria based on drought tolerance
ability is shown in figure 4.1. First two principal factors explained maximum variation
(F1=78.99% and F2=10.27%). Plot of scores on first and second factor coordinate
showed that fifty endophytic bacterial isolates which scored high values ranging from
54
![Page 75: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/75.jpg)
-7 -6 -5 -4 -3 -2 -1 0 1 2 3 4 5 6 7-4
-3
-2
-1
0
1
2
3
4
5
6
7(-0.31MPa)
(-0.61MPa)
(-1.09MPa)
(-1.91MPa)
(-3.20MPa)
WR1 WR4WR7WR12
WR15
WR18WR26 WR29
WR32WR35
WR43
WS4 WS5WS9WS16WS18WS20WS24
WS27WS30
WS40WL2
WL7
WL11WL23
WL27
WL28
WL32WL36 WG1
WG3
WG8WG13
WG16WG22WR10
WR17
WR19
WR21WR23
WR33WR44
WS1WS8
WS12
WS14WS19WS21
WS35WS38
WL4
WL12
WL22
WL24
WL29
WL31WL34
WL39
WG6WG9
WG15
WG17
WG23WG25 WR5WR9
WR14
WR22WR27WR31
WR36
WR38
WR41
WR45
WS6
WS10WS13WS25
WS26WS29
WS32
WS33WS36
WS37WL3WL5
WL8 WL14
WL15WL17
WL18WL21
WL25
WL37
WG4
WG7WG11
WG19WL38
WR2
WR3
WR6
WR8WR11
WR13
WR16 WR20
WR24WR25 WR28
WR30 WR34
WR37WR39WR40
WR42WS2 WS3WG10
WS7WS11
WS15WS17
WS22 WS23 WS28WS31
WS34WS39
WL1WL6
WL9 WL10WL13WL16 WL19WL20
WL26WL30
WL33WL35WL40
WG2
WG5WG12
WG14
WG18
WG20WG21 WG24
Biplot (axes F1 and F2: 89.26 %)
F1 (78.99 %)
F2 (1
0.27
%)
Fig. 4.1. Principal component analysis of optical density of endophytic bacteria isolates from wheat at different PEG-6000 induced water deficit stress levels
55
![Page 76: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/76.jpg)
Table 4.1 Selected drought tolerant endophytic bacterial isolates from wheat
Sr.
No.
Isolates Sr.
No.
Isolates Sr.
No
Isolates Sr.
No
Isolates Sr.
No.
Isolates
1 WR2 11 WR28 21 WS11 31 WL9 41 WL40
2 WR3 12 WR30 22 WS17 32 WL10 42 WG2
3 WR6 13 WR34 23 WS22 33 WL13 43 WG5
4 WR8 14 WR37 24 WS23 34 WL16 44 WG10
5 WR11 15 WR39 25 WS28 35 WL19 45 WG12
6 WR13 16 WR40 26 WS31 36 WL20 46 WG14
7 WR16 17 WR42 27 WS34 37 WL26 47 WG18
8 WR20 18 WS2 28 WS39 38 WL30 48 WG20
9 WR24 19 WS3 29 WL1 39 WL33 49 WG21
10 WR25 20 WS7 30 WL6 40 WL35 50 WG24
56
![Page 77: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/77.jpg)
0.668 to 4.918 in first factor coordinate were selected as drought tolerant isolates (Table
4.1). However, second factor coordinate did not produce results that were as clear as the
first factor coordinate as it explained less variation. These fifty isolates were used for
further study.
4.1.2. Drought tolerance enhancing ability of endophytic bacterial isolates of maize
Principle component analysis of optical density of 150 endophytic bacterial
isolates from maize at five PEG-induced water deficit stress levels (-0.31, -0.61, -1.09, -
1.91 and -3.20 MPa) is presented in figure 4.2. Results revealed that ability of isolates to
tolerate PEG-induced water deficit stress varied with different stress levels. First principal
factor (F1) explained 79.18% of variation while 9.26% variation was explained by second
principal factor (F2). Maximum score (4.791) was observed with isolate ML30 while
minimum (-2.748) was observed with isolate MS33 in F1 coordinate. Fifty isolates with
maximum score ranging from 0.537 to 4.791 in F1 (shown in Table 4.2) were selected as
drought tolerant isolates.
4.2. Carbonic anhydrase activity of drought tolerant isolates
4.2.1. Carbonic anhydrase activity of drought tolerant wheat isolates
From the endophytic bacterial isolates of wheat, 50 drought tolerant isolates were
further tested for CA activity. All the isolates varied in CA activity. Ten drought tolerant
isolates (WR2, WS7, WS11, WS22, WS23, WL9, WL13, WL16, WL19 and WL20) with
higher CA activity ranging from 13.03 to 20.23 are shown in figure 4.2. Out of these ten,
isolate WL19 showed significantly higher CA activity followed by WS11 and WS23.
Moreover, isolate WR2 also showed better CA activity which was statistically similar
with isolate WS11, WS23 and WL9. Isolates WS22, WL16 and WL20 possessed
statistically similar CA activity. However, isolate WS7 showed lowest CA activity among
the drought tolerant isolates.
4.2.2. Carbonic anhydrase activity of drought tolerant maize isolates
Similar to endophytic bacteria isolated from wheat, 50 drought tolerant isolates
from maize were analyzed for CA activity. All the isolates varied in CA activity. Ten
drought isolates (MR1, MR3, MR17, MS1, MS7, ML5, ML8, ML15, MG2 and MG9)
with higher CA activity ranging from 13.08 to 21.63% are shown in figure 4.3. Among
these 10 isolates, isolate MG9 showed significantly higher compared to all other isolates.
57
![Page 78: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/78.jpg)
-6 -5 -4 -3 -2 -1 0 1 2 3 4 5 6 7-3
-2
-1
0
1
2
3
4
5
6
7 (-0.31 MPa)
(-0.61MPa)
(-1.09MPa)(-1.91MPa)
(-3.20MPa)
MR7
MR10
MR16MR23
MR26MR36
MR30MR32
MR35MR38MR41
MS2MS6
MS8MS10MS12
MS21
MS22MS23
MS27MS28
MS30
MS33
MS35
MS38
MS39ML2
ML6
ML9
ML12
ML14ML16ML24
ML27
ML29ML31ML36
ML39MG8MG10MG16
MG17MG20
MR2MR4
MR5MR9
MR12MR13MR14MR18
MR39
MS4MS14MS18MS26
MS31 MS32
MS34
ML4 ML10ML19
ML22 ML33ML34
ML40
MG1
MG7MG11
MG12
MG14MG23
MR11
MR15MR19MR21MR24MR27
MR28MR31
MR44
MR45MS3
MS5MS15MS16
MS19MS25
ML1
ML7
ML13 ML17ML18ML23
ML25
MG5
MG6MG18
MG22 MR1
MR3
MR6MR8MR17MR20
MR22MR25MR29
MR33MR34MR37
MR40MR42
MR43MS1
MS7MS9
MS11
MS13MS17
MS20MS24
MS29
MS36
MS37MS40
ML3ML5ML8
ML11
ML15
ML20
ML21ML26ML28
ML30ML32ML35
ML37
ML38
MG2
MG3
MG4
MG9
MG13MG15
MG19
MG21MG24
MG25
Biplot (axes F1 and F2: 88.44 %)
F1 (79.18 %)
F2 (9
.26
%)
Fig. 4.2. Principal component analysis of optical density of endophytic bacteria isolates from maize at different PEG-6000 induced water deficit stress levels
58
![Page 79: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/79.jpg)
Table 4.2. Selected drought tolerant endophytic bacteria isolates from maize
Sr.
No.
Isolates Sr.
No.
Isolates Sr.
No
Isolates Sr.
No
Isolates Sr.
No.
Isolates
1 MR1 11 MR34 21 MS17 31 ML11 41 ML38
2 MR3 12 MR37 22 MS20 32 ML15 42 MG2
3 MR6 13 MR40 23 MS24 33 ML20 43 MG3
4 MR8 14 MR42 24 MS29 34 ML21 44 MG4
5 MR17 15 MR43 25 MS36 35 ML26 45 MG9
6 MR20 16 MS1 26 MS37 36 ML28 46 MG13
7 MR22 17 MS7 27 MS40 37 ML30 47 MG19
8 MR25 18 MS9 28 ML3 38 ML32 48 MG21
9 MR29 19 MS11 29 ML5 39 ML35 49 MG22
10 MR33 20 MS13 30 ML8 40 ML37 50 MG25
59
![Page 80: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/80.jpg)
WR2 WS7 WS11 WS22 WS23 WL9 WL13 WL16 WL19 WL200
5
10
15
20
25
bc
f
ab
d
ab
cd
efd
a
de
Endophytic bacterial isolates
CA
activ
ity (µ
mol
/mL)
Fig. 4.3. Drought tolerant endophytic bacterial isolates from wheat with high carbonic anhydrase activity
MR1 MR3 MR17 MS1 MS7 ML5 ML8 ML15 MG2 MG90
5
10
15
20
25
de db bc
g
ef
c
f f
a
Endophytic bacterial isolates
CA
act
ivity
(µm
ol/m
L)
Fig. 4.4. Drought tolerant endophytic bacterial isolates from maize with high carbonic anhydrase activity
60
![Page 81: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/81.jpg)
However, lowest CA activity was recorded with isolate MS7 among the 10 drought
tolerant isolates.
4.3. Screening of selected drought tolerant CA containing endophytic bacteria for
plant growth promotion under axenic conditions
The drought tolerant CA containing endophytic bacteria were further evauated for
plant growth promotion in wheat and maize under gnotobiotic conditions. Two different
studies were conducted on wheat and maize with their respective isolates. The outcomes
of these gnotobiotic studies are given below.
4.3.1 Screening of wheat isolates for growth promotion
4.3.1.1 Root length
Drought stress considerably reduced the root length of non-inoculated plants of
both cultivars (Fsd-2008 and Uqab-2000). Inoculation with drought tolerant CA
containing endophytic bacteria not only alleviated the deleterious effect of water deficit
stress on plant but also significantly improved root length under PEG-induced water
deficit conditions (-1.09 and -1.23 MPa), however, effect was more obvious in Uqab-
2000 (Table 4.3). Under normal conditions (-0.04 MPa), root length was increased up to
43.7, 37.1 and 45.5 % in Fsd-2008 and 48.0, 49.1, 47.4% in Uqab-2000 with isolates
WR2, WS11 and WL19 respectively, compared to their respective uninoculated control
plants. However, minimum increase up to 7.7 and 17.5% was observed in Fsd-2008 and
Uqab-2000 respectively, compared to uninoculated control under normal conditions. At
PEG-imposed water deficit stress (-1.09 MPa), isolates WS11, WR2 and WL19 showed
52.1, 48.5 and 47.8% increase in Fsd-2008 and 57.3, 53.1 and 57.3 % in Uqab-2000
compared to control (un-inoculated plant). Similarly, isolate WL19 showed substantial
increase by 56.7% in Fsd-2008 and 65.0% in Uqab-2000 followed by WR2, WS11 and
WS23 compared to uninoculated control plants in exposure to PEG-induced water deficit
stress (-1.23 MPa). Moreover, minimum increase was observed by 16.9 and 23.5% in
Fsd-2008 and Uqab-2000 respectively, with bacterial inoculation comparison to control at
-1.23 MPa of water deficit stress.
4.3.1.2. Shoot length
Shoot length of wheat significantly improved by the inoculation of drought
tolerant CA containing endophytic bacteria under non-stressed and stressed environments
61
![Page 82: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/82.jpg)
Picture 6: Effect of drought tolerant CA containing endophytic bacteria on root length under normal conditions
Picture 7: Effect of drought tolerant CA containing endophytic bacteria on root length under PEG-induced water deficit conditions
62
Control WL19
Control WR2
![Page 83: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/83.jpg)
Picture 8: Effect of drought tolerant CA containing endophytic bacteria on shoot length under normal conditions
Picture 9: Effect of drought tolerant CA containing endophytic bacteria on shoot length under PEG-induced water deficit conditions
63
Control WL19WR2WS11
Control WL19 WR2WS11
![Page 84: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/84.jpg)
Table 4.3. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot length of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
-0.04 MPa -1.09 MPa -1.23 MPaIsolates Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000Root length (cm)Control 16.7±0.18 17.7±0.34 14.2±0.08 14.3±0.34 11.8±0.29 12.3±0.35WR2 24.0±0.16 26.2±0.29 21.1±0.25 21.9±0.22 18.4±0.35 19.5±0.04WS7 20.4±0.40 22.4±0.30 17.3±0.58 18.1±0.24 14.7±0.39 15.2±0.27WS11 22.9±0.36 26.4±0.29 21.6±0.34 22.5±0.26 17.8±0.34 18.6±0.26WS22 18.0±0.35 20.8±0.02 17.4±0.19 18.4±0.29 15.3±0.24 15.6±0.22WS23 22.1±0.24 24.6±0.34 20.7±0.21 20.4±0.32 18.2±0.33 18.7±0.15WL9 20.5±0.43 24.3±0.24 18.7±0.18 19.8±0.39 15.3±0.26 16.9±0.07WL13 19.6±0.67 22.3±0.15 17.0±0.32 18.1±0.25 13.8±0.71 15.4±0.32WL16 22.6±0.57 21.8±0.69 19.3±0.59 19.9±0.24 17.0±0.19 18.3±0.33WL19 24.3±0.29 26.1±0.34 21.0±0.63 22.5±0.33 18.5±0.32 20.3±0.11WL20 20.1±0.21 22.4±0.27 18.2±0.24 18.9±0.22 14.6±0.21 15.8±0.17Shoot length (cm)Control 23.7±0.47 24.8±0.08 19.9±0.64 20.2±0.54 14.3±0.46 15.5±0.63WR2 30.9±1.16 32.7±0.19 26.3±0.48 26.6±0.64 19.3±0.16 22.6±0.66WS7 27.6±0.66 31.9±0.87 25.0±0.55 24.9±0.54 18.5±0.17 20.7±0.27WS11 29.5±1.06 32.9±0.95 26.5±0.20 27.5±0.80 19.8±0.38 21.8±0.90WS22 25.8±0.31 26.1±0.56 22.6±1.04 23.3±0.51 17.7±0.44 19.3±0.33WS23 28.9±0.34 28.5±0.83 24.4±1.28 26.8±0.09 17.4±0.15 20.1±0.59WL9 26.4±0.98 32.3±0.34 24.7±0.76 26.5±0.35 16.3±0.31 19.8±0.38WL13 28.0±0.52 29.4±0.85 23.4±1.37 25.7±0.60 18.2±0.52 18.5±0.52WL16 27.5±0.82 29.1±0.31 25.5±0.89 24.5±0.70 19.5±0.71 20.2±1.10WL19 30.2±1.08 31.8±0.81 26.0±0.86 26.8±0.22 18.8±0.74 22.5±0.29WL20 25.9±0.95 27.7±0.58 23.5±1.95 24.9±0.52 19.1±0.12 19.4±0.75
Note: Least significant difference (LSD): Root length, 0.98; Shoot length, 1.56Mean are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
64
![Page 85: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/85.jpg)
uninoculated control plants (Table 4.3.). However, increase was more pronounced in
Uqab-2000 than Fsd-2008. Inoculation with isolate WR2 caused significant improvement
of 30.3, 32.1 and 34.9% in Fsd-2008 while 31.8, 31.6 and 45.8% in Uqab-2000 compared
to uninoculated control under normal (-0.04 MPa) and PEG-induced water deficit stress
of -1.09 and -1.23 MPa, respectively. Isolate WS11 improved the shoot length by 24.4,
33.1 and 38.4% in Fsd-2008 and 32.6, 36.1 and 40.6% in Uqab-2000 compared to control
plants under non-stressed as well as stressed conditions, respectively. However, isolate
WS22 showed minimum increase of 13.6 % in Fsd-2008 and 15.3% in Uqab-2000 at -
1.09 MPa of water deficit stress compared to uninoculated control plants. Isolate WL19
also produced significant enhancement in shoot length up to 27.4, 30.6 and 31.4% in Fsd-
2008 while 28.2, 32.6 and 45.1% in Uqab-2000 compared to their respective non-
inoculated control plants at different stress levels.
4.3.1.3. Root fresh weight
The results showed that root fresh weight was substantially decreased in non-
inoculated plants of both cultivars under PEG-induced water deficit conditions (Table
4.4). However, inoculation with drought tolerant CA containing endophytic bacteria
significantly improved root fresh weight under normal (-0.04 MPa) as well as PEG
induced water deficit conditions (-1.23 MPa), particularly in Uqab-2000. Root fresh
weight was improved up to 40.2% in Fsd-2008 and 41.5% in Uqab-2000 by the
inoculation of endophytic bacteria under non-stressed conditions (-0.04 MPa). However,
minimum increase 13.6 and 16.9% was observed in Fsd-2008 and Uqab-2000
respectively, by the inoculation of WS22 compared to uninoculated control plants under
normal conditions. Isolate WL19 and WR2 showed maximum increase by 49.3 and 43.7
in Fsd-2008 and 55.0 and 51.0% in Uqab-2000 compared to uninoculated control plants
under PEG-induced water deficit stress (-1.09 MPa). Similarly, at -1.23 MPa, PEG
induced water deficit stress, isolate WL19 and WR2 caused considerable enhancement in
root fresh biomass with 69.2 and 61.7% increase in Fsd-2008 and 74.2 and 67.3% in
Uqab-2000 followed by WL16 and WS11 compared to uninoculated control plants.
However, isolate WL13 gave minimum increase of 17.9% in Fsd-2008 while isolate
WS22 gave 33.4% increase in Uqab-2000.
4.3.1.4. Shoot fresh weight
Under non-stressed conditions (-0.04 MPa), symbolic increase of 39.8% in shoot
65
![Page 86: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/86.jpg)
Table 4.4. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot fresh weight of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
-0.04 MPa -1.09 MPa -1.23 MPaIsolates Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000Root fresh weight (mg)Control 114.22±2.23 134.67±2.65 98.66±1.71 103.63±2.31 47.67±1.54 54.33±2.92WR2 154.56±1.42 190.67±1.93 141.78±1.11 156.56±2.74 77.11±2.31 90.94±2.82WS7 144.00±1.75 161.78±1.93 127.28±2.39 135.11±2.94 69.11±1.83 81.22±2.59WS11 150.55±1.17 187.67±2.03 134.00±1.93 151.78±1.11 73.06±1.84 84.22±0.22WS22 129.78±2.09 157.56±1.94 116.33±2.17 131.78±2.94 60.72±2.22 72.52±2.43WS23 137.11±1.73 158.33±2.70 125.67±1.67 135.11±1.11 64.44±1.06 79.11±3.89WL9 144.83±1.80 171.78±2.94 128.55±1.06 134.33±2.08 66.11±1.64 78.00±2.89WL13 154.00±2.72 186.22±2.22 119.78±2.89 135.31±2.36 56.22±0.78 73.17±2.32WL16 145.94±1.86 177.33±2.55 134.28±1.69 137.33±1.93 74.89±2.70 87.33±1.92WL19 160.22±1.90 183.89±2.22 147.33±2.21 160.67±2.03 80.67±1.93 94.67±2.34WL20 143.39±1.60 165.66±2.55 129.56±2.22 140.44±2.13 60.89±4.24 71.44±2.22Shoot fresh weight (mg)Control 181.91±3.18 190.44±2.42 109.33±2.89 111.00±3.85 53.44±2.45 58.00±3.33WR2 243.89±2.95 267.22±4.01 155.92±2.14 160.56±4.85 81.67±3.34 90.00±3.66WS7 237.39±4.53 231.66±2.89 140.00±3.34 146.11±2.94 73.78±3.81 78.56±2.28WS11 241.94±2.28 260.56±1.47 147.50±3.82 155.00±3.85 83.33±4.41 88.60±2.75WS22 194.17±3.61 206.11±4.01 125.00±2.41 131.11±3.89 60.44±1.50 72.11±3.88WS23 226.11±2.01 245.00±3.85 148.61±1.65 152.78±4.01 76.11±4.45 84.44±4.45WL9 238.33±4.41 237.00±2.78 137.72±2.51 142.50±2.68 67.89±3.28 74.17±3.01WL13 205.56±2.51 231.67±3.34 128.00±4.34 127.22±1.87 62.78±2.94 69.63±1.73WL16 233.44±3.86 237.22±2.95 151.67±3.01 147.22±2.01 78.11±4.07 86.63±3.32WL19 254.44±4.28 272.78±4.45 160.33±3.67 166.11±4.02 83.33±3.34 92.11±2.95WL20 210.00±2.89 221.67±3.64 135.56±2.94 136.66±2.55 69.44±2.22 78.89±3.10
Note: Least significant difference (LSD): Root fresh weight, 6.34; Shoot fresh weight, 9.26Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
66
![Page 87: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/87.jpg)
fresh weight of Fsd-2008 and 43.2% of Uqab-2000 was recorded with isolate WL19
followed by WR2 and WS11 compared to (uninoculated) control plants (Table 4.4).
However, isolates WL9 and WL16 remained statistically similar for improving the shoot
fresh weight in Fsd-2008 and Uqab-2000 under normal conditions (-0.04 MPa). Shoot
fresh weight also improved by 46.6% in Fsd-2008 and 49.6% in Uqab-2000 with
inoculation of isolate WL19 under PEG-imposed water deficit stress (-1.09 MPa)
compared to uninoculated control plants. In the same way, inoculation significantly
enhanced shoot fresh weight at -1.23 MPa of water deficit stress especially in Uqab-2000.
Shoot fresh weight was also improved by 55.9% in Fsd-2008 plants and 58.8% in Uqab-
2000 plants with isolate WL19 compared to uninoculated control plants under severe
water stress.
4.3.1.5. Root dry weight
Root dry weight of two wheat cultivars (Fsd-2008 and Uqab-2000) significantly
decreased in response to PEG-induced water deficit stress. Inoculation with drought
tolerant CA containing endophytic bacteria significantly enhanced the root dry weight,
especially in Uqab-2000 (Table 4.5). Significant increase of 40.8% in Fsd-2000 and
45.5% in Uqab-2000 with was observed with isolate WL19 under normal conditions (-
0.04 MPa) when compared to their respective uninoculated control plants. However,
isolate WR2, WS11 and WL9 showed statistically similar response in increasing root dry
weight in both genotypes. At PEG-imposed water deficit stress (-1.09 MPa), significant
enhancement of 45.9% in root dry weight was observed in Fsd-2008 and 48.3% in Uqab-
2000 with isolate WL19 followed by WR2, WS23, WS11 compared to control plants.
Inoculation with WL19, WR2 and WS23 showed significant increase up to 49.1, 43.8 and
37.0% in Fsd-2008 while 53.3, 44.9 and 46.6% in Uqab-2000 compared to uninoculated
control plants at PEG-induced water deficit stress (-1.23 MPa). However, minimum
increase of 11.2% was observed with isolate WS22 in both cultivars compared to
uninoculated control at -1.23 MPa of water deficit stress.
4.3.1.6. Shoot dry weight
A momentous enhancement in shoot dry weight was recorded with drought
tolerant CA containing endophytic bacterial inoculation compared to uninoculated control
in both cultivars, especially in Uqab-2000 (Table 4.5). Isolate WL19 showed significantly
higher shoot dry weight which was 32.7 and 38.0% in Fsd-2008 and Uqab-2000, 32.4%
67
![Page 88: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/88.jpg)
Table 4.5. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot dry weight of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
Isolates-0.04 MPa -1.09 MPa -1.23 MPa
Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000Root dry weight (mg)Control 16.33±0.34 17.73±0.18 11.90±0.23 13.37±0.38 8.85±0.15 9.50±0.21WR2 20.70±0.67 24.13±0.47 16.07±0.58 18.96±0.54 12.73±0.29 13.77±0.38WS7 19.53±0.42 20.90±0.52 14.55±0.39 16.73±0.72 11.80±0.61 13.27±0.03WS11 21.00±0.50 23.10±0.46 15.82±0.61 18.20±0.42 10.98±0.54 11.67±0.32WS22 18.86±0.57 19.50±0.40 15.10±0.25 19.57±0.33 9.84±0.37 10.57±0.27WS23 20.73±0.44 23.40±0.20 16.01±0.57 17.03±0.38 12.13±0.32 13.93±0.34WL9 19.45±0.43 22.47±0.37 14.80±0.64 16.50±0.12 11.23±0.03 12.73±0.27WL13 18.38±0.46 19.90±0.47 13.60±0.25 15.27±0.77 10.23±0.23 11.50±0.50WL16 21.14±0.50 21.77±0.23 16.06±0.61 17.27±0.43 12.27±0.09 12.57±0.23WL19 23.00±0.58 25.80±0.47 17.37±0.57 19.83±0.62 13.20±0.40 14.57±0.52WL20 20.23±0.39 23.13±0.58 15.67±0.44 18.43±0.29 11.70±0.51 13.10±0.61Shoot dry weight (mg)Control 23.60±0.46 25.74±0.48 17.37±0.45 16.83±0.46 12.67±0.33 12.90±0.26WR2 30.00±0.58 34.13±0.30 23.00±0.29 24.00±0.58 17.50±0.12 18.45±0.51WS7 26.50±0.29 30.00±0.24 21.20±0.47 22.03±0.55 14.53±0.23 15.00±0.46WS11 28.87±0.57 32.90±0.08 23.67±0.20 23.63±0.37 17.89±0.34 18.17±0.33WS22 25.27±0.32 28.37±0.17 19.80±0.36 20.97±0.55 14.77±0.62 16.66±0.12WS23 27.80±0.42 30.80±0.34 22.37±0.32 20.83±0.64 13.41±0.45 15.81±0.40WL9 28.63±0.20 31.50±0.41 21.77±0.49 22.00±0.29 16.33±0.38 17.97±0.58WL13 26.57±0.59 30.83±0.36 20.69±0.16 19.40±0.46 13.33±0.33 13.69±0.16WL16 28.63±0.41 32.43±0.35 23.12±0.65 23.23±0.39 17.67±0.67 18.40±0.31WL19 31.33±0.33 35.53±0.38 24.17±0.44 24.67±0.44 18.40±0.31 19.17±0.33WL20 25.80±0.42 29.33±0.54 20.00±0.58 20.27±0.37 14.37±0.18 16.07±0.43
Note: Least significant difference (LSD): Root dry weight, 1.23; Shoot dry weight, 1.82 Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
68
![Page 89: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/89.jpg)
in Fsd-2008 and 46.5, 40.4 and 42.6% in Uqab-2000 inoculated with isolate WL19,
WS11 and WR2 compared to uninoculated control plants at -1.09 MPa of water deficit
stress. Inoculation with isolate WL19 significantly enhance shoot dry weight by 45.2% in
Fsd-2008 and 48.6% in Uqab-2000 compared to uninoculated control plants followed by
WR2, WS11 and WL16 at -1.23 MPa.
4.3.1.7. Chlorophyll contents
The results ravealed that PEG-induced water deficit conditions caused
considerable reduction in chlorophyll contents in uninoculated plants, especially in Uqab-
2000 (Table 4.6). Inoculation with drought tolerant CA containing endophytic bacterial
isolates significantly improved the chlorophyll contents compared to uninoculated control
plants, under normal (-0.04 MPa) as well as PEG-induced water deficit stress (- 1.09, -
1.23 MPa) in both cultivars, however, effect of endophytic bacterial inoculation was
much prominent in Uqab-2000. Chlorophyll contents were enhanced by 32.0 and 39.1%
in Fsd-2008 and Uqab-2000, respectively, with isolate WL19 followed by WS23, WR2
and WS7 compared to uninoculated control plants under normal conditions (-0.04 MPa).
At -1.09 MPa, isolate WS22 showed minimum increase in both cultivars. However,
isolate WL19 significantly improved chlorophyll contents in Uqab-2000 by 48.5 % while
43.0% in Fsd-2008 compared to their respective control plants. At -1.23 MPa, inoculation
with isolate WS11, WL19 and WR2 caused significant enhancement of 54.9, 52.6 and
52.1% in Fsd-2008 and 54.0, 55.6 and 52.9% in Uqab-2000 when compared with their
respective control. Moreover, isolate WL9 showed 57.2% increase in Uqab-2000 and
45.9% in Fsd-2008 compared to control plants under stressed conditions (-1.23 MPa).
4.3.1.8 Carbonic anhydrase activity in leaves
Bacterial endophytes and PEG-induced water deficit stress had strong effect on
CA activity. Carbonic anhydrase activity was significantly decreased in non-inoculated
plants under PEG-mediated water deficit conditions, particularly in Uqab-2000 (Table
4.6). Inoculation with drought tolerant CA containing endophytic bacterial isolates
(WL19, WR2 and WS11) significantly increased CA activity under non stressed
conditions (-0.04) in both cultivars compared to uninoculated control. Moreover, under
PEG-induced water deficit stress (-1.09 MPa), inoculation with isolate WL19 followed by
WS23, WR2, WS11 significantly enhanced CA activity, especially in Uqab-2000.
However, less increase in CA activity was detected with isolate WS22 in both
69
![Page 90: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/90.jpg)
Table 4.6. Effect of drought tolerant CA containing endophytic bacterial isolates on chlorophyll content and CA activity in leaves of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
-0.04 MPa -1.09 MPa -1.23 MPaIsolates Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000Chlorophyll content (SPAD Value)Control 35.6±0.33 31.9±0.47 27.2±0.61 24.9±0.58 21.1±0.38 18.5±0.49WR2 45.6±0.15 43.2±0.53 38.2±0.15 36.4±0.64 32.1±0.09 28.3±0.76WS7 42.1±0.28 39.3±0.26 36.0±0.09 33.7±0.15 29.9±0.55 26.8±0.72WS11 46.2±0.14 42.7±0.24 38.0±0.58 34.5±0.83 32.7±0.09 28.5±0.72WS22 42.5±0.17 38.7±0.12 35.3±0.29 32.3±0.38 28.3±0.63 23.9±0.55WS23 46.4±0.07 43.6±0.15 37.8±0.52 33.2±0.55 31.4±0.06 27.4±0.61WL9 42.0±0.15 37.7±0.15 35.5±0.03 32.1±0.37 30.8±0.64 29.1±0.85WL13 39.8±0.07 38.8±0.03 36.2±0.18 32.9±1.03 28.8±0.61 25.5±0.67WL16 43.7±0.27 40.3±0.19 37.3±0.26 34.0±0.69 30.4±0.23 27.7±0.35WL19 47.0±0.07 44.4±0.33 38.9±0.09 37.0±0.50 32.2±0.53 28.8±0.83WL20 43.4±0.45 40.8±0.37 35.5±0.61 34.2±0.25 29.7±0.55 27.4±0.29CA activity in leaves (mol CO2 Kg-1 leaf FM s-1)Control 1.259±0.05 1.027±0.04 0.810±0.04 0.760±0.04 0.574±0.04 0.501±0.03WR2 1.762±0.04 1.496±0.03 1.177±0.06 1.127±0.06 0.839±0.03 0.799±0.07WS7 1.448±0.02 1.149±0.04 1.114±0.05 1.012±0.05 0.791±0.02 0.608±0.05WS11 1.694±0.07 1.461±0.04 1.198±0.03 1.148±0.04 0.808±0.06 0.825±0.05WS22 1.268±0.05 1.139±0.07 0.902±0.05 0.859±0.04 0.616±0.03 0.566±0.04WS23 1.450±0.06 1.251±0.06 1.221±0.02 1.171±0.04 0.765±0.04 0.761±0.04WL9 1.505±0.05 1.273±0.04 0.976±0.06 0.956±0.06 0.687±0.03 0.637±0.06WL13 1.449±0.03 1.183±0.03 1.086±0.04 0.903±0.05 0.713±0.04 0.680±0.03WL16 1.310±0.04 1.247±0.03 1.118±0.05 1.048±0.06 0.815±0.07 0.581±0.06WL19 1.865±0.03 1.549±0.06 1.254±0.03 1.204±0.04 0.890±0.06 0.843±0.08WL20 1.308±0.06 1.152±0.02 0.982±0.01 0.872±0.05 0.756±0.04 0.754±0.03
Note: Least significant difference (LSD): Chlorophyll content, 1.29; CA activity, 0.133Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
70
![Page 91: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/91.jpg)
when compared to their respective uninoculated control. Similarly, isolate WL19 and
WR2 showed significant increase in CA activity up to 68.2 and 59.5% in Uqab-2000 and
55.0 and 46.1% in Fsd-2008 compared to non-inoculated control plants in exposure to
water deficit stress (-1.23 MPa). However, isolate WS23 and WL20 remained statistically
similar in improving the CA activity in both cultivars.
4.3.1.9. Photosynthetic rate
Water deficit stress caused significant reduction in net CO2 assimilation rate of
non-inoculated plants of both wheat cultivars. Inoculation with drought tolerant CA
containing endophytic bacteria enhanced the photosynthetic rate in the leaves of non-
stressed and stressed plants, however, increase was more pronounced in Uqab-2000
(Table 4.7). Isolate WL19 improved photosynthetic rate in Uqab-2000 leaves by 39.4%
and 33.6 % in Fsd-2008 when compared to their respective (non-inoculated) control
under non-stressed conditions (-0.04 MPa). In the same way, isolate WL19 caused 40.0
and 44.2% increase in photosynthetic rate of Fsd-2008 and Uqab-2000 compared to their
uninoculated control plants at -1.09 MPa of water deficit stress. However, isolates WL13
and WL16 showed similar response for improving the photosynthetic rate in both
cultivars compared to control plants. Moreover, significant increase of 43.7% in Fsd-2008
and 47.2% in Uqab-2000 in photosynthetic rate was observed when exposed to water
stress (-1.23 MPa) compared to their respective non-inoculated plants, however, less
increase was observed with isolate WS22 followed by WL13 and WL20 in both cultivars.
4.3.1.10. Transpiration rate
Inoculation of drought tolerant CA containing endophytic bacterial isolates WL19,
WS11 and WR2 increased the transpiration rate in both cultivars, especially in Uqab-
2000 under normal conditions (Table 4.7). Isolate WL19 showed significantly higher
transpiration rate of 23.3% in Fsd-2008 and 28.1% in Uqab-2000 compared to
uninoculated control plants under normal conditions (-0.04 MPa). Transpiration rate was
also increased by 28.3, 30.9 and 31.9% in Fsd-2008 with inoculation of isolates WL19,
WR2 and WS11 and by 37.7, 37.7, 37.1% in Uqab-2000 compared to uninoculated
control plants at -1.09 MPa. Similarly, inoculation with isolate WL19 significantly
improved transpiration rate under PEG induced severe water deficit stress (-1.23 MPa) by
38.3% in Fsd-2008 and 44.5% in Uqab-2000 compared to inoculated control plants
followed by WR2, WS11 and WS23. However, effect of isolate WS22 remained
71
![Page 92: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/92.jpg)
Table 4.7. Effect of drought tolerant CA containing endophytic bacterial isolates on photosynthetic and transpiration rate of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
-0.04 MPa -1.09 MPa -1.23 MPaIsolates Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000Photosynthetic rate (μmol CO2 m-2 s-1)Control 9.5±0.10 7.6±0.18 7.0±0.18 5.2±0.15 4.8±0.15 3.6±0.15WR2 12.0±0.17 10.3±0.12 9.0±0.09 7.1±0.06 6.5±0.15 5.0±0.06WS7 10.9±0.12 9.0±0.06 8.5±0.15 6.1±0.13 5.4±0.09 3.7±0.18WS11 12.3±0.10 10.0±0.12 9.4±0.09 6.9±0.09 6.4±0.13 4.8±0.03WS22 11.7±0.09 8.8±0.06 8.9±0.03 6.2±0.17 5.0±0.10 3.6±0.17WS23 11.9±0.07 10.0±0.09 9.1±0.17 7.1±0.15 6.3±0.15 4.9±0.09WL9 10.7±0.17 9.5±0.15 8.1±0.06 6.9±0.06 5.8±0.17 4.3±0.07WL13 11.4±0.19 9.2±0.17 8.6±0.07 6.4±0.13 5.5±0.07 4.1±0.18WL16 11.6±0.15 9.5±0.07 8.8±0.10 6.5±0.07 5.8±0.15 4.1±0.12WL19 12.7±0.09 10.6±0.10 9.8±0.12 7.5±0.12 6.9±0.06 5.3±0.15WL20 11.0±0.18 8.8±0.15 8.1±0.19 6.0±0.15 5.3±0.17 4.0±0.09Transpiration rate (mmol H2O m
-2 s-1)Control 2.18±0.04 2.13±0.02 1.94±0.03 1.83±0.03 1.46±0.02 1.48±0.03WR2 2.60±0.03 2.72±0.01 2.54±0.02 2.52±0.02 2.02±0.02 2.08±0.01WS7 2.49±0.01 2.49±0.02 2.46±0.03 2.45±0.03 1.92±0.01 1.95±0.02WS11 2.67±0.02 2.70±0.02 2.56±0.05 2.51±0.03 2.00±0.03 2.03±0.02WS22 2.28±0.03 2.26±0.01 2.05 ±0.03 1.96±0.04 1.56±0.02 1.57±0.02WS23 2.60±0.01 2.66±0.03 2.50±0.06 2.44±0.03 1.95±0.03 2.10±0.03WL9 2.43±0.05 2.45±0.01 2.31±0.03 2.36±0.02 1.93±0.01 2.04±0.01WL13 2.54±0.02 2.67±0.04 2.47±0.02 2.33±0.01 1.92±0.02 1.90±0.02WL16 2.63±0.03 2.72±0.02 2.35±0.01 2.42±0.03 1.87±0.02 1.96±0.03WL19 2.69±0.01 2.73±0.01 2.49±0.05 2.52±0.02 2.02±0.01 2.14±0.04WL20 2.47±0.02 2.52±0.02 2.38±0.04 2.30±0.04 1.97±0.02 1.95±0.02
Note: Least significant difference (LSD): Photosynthetic rate, 0.37; Transpiration rate, 0.07Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤0.0.05
72
![Page 93: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/93.jpg)
statistically similar in both cultivars under severe water deficit stress (-1.23 MPa).
4.3.1.11. Stomatal conductance
Results regarding stomatal conductance of two wheat cultivars showed that
stomatal conductance significantly decreased under PEG-induced water deficit stress.
Inoculation with drought tolerant CA containing endophytic bacteria significantly
enhanced the stomatal conductance, especially in Uqab-2000 (Table 4.8). Stomatal
conductance was enhanced by 33.3% in Fsd-2008 and Uqab-2000 with the inoculation of
isolate WL19 under normal conditions (-0.04 MPa) when compared to their respective
uninoculated control plants. However, isolate WL13 followed by WL20 and WS22
showed minimum improvement in stomatal conductance of both cultivars. At PEG-
imposed water stress (-1.09 MPa), significant improvement upto 37.5% in Fsd-2008 and
40.0% in Uqab-2000 in stomatal conductance was detected with inoculation of bacterial
isolates compared to control plants. However, isolate WL19 remained statistically similar
with WR2 in both cultivars at -1.09 MPa of water deficit stress imposed by PEG.
Seedling inoculated with WL19, WR2 and WS23 showed significant increase up to
40.0% in Fsd-2008 and 66.6% in Uqab-2000 compared to uninoculated control plants
under severe water deficit stress (-1.23 MPa). However, minimum increase was observed
with isolate WS22 in both cultivars compared to uninoculated control at -1.23 MPa of
water stress.
4.3.1.12. Substomatal conductance
Contrary to stomatal conductance, substomatal conductace raised with growing
level of PEG-6000 induced water deficit stress. Inoculation of isolates (WL19, WS11 and
WR2) significantly decreased substomatal conductance under normal and stressed
conditions, especially in in Uqab-2000 (Table 4.8). Maximum reduction of 25.4% in Fsd-
2008 and 29.7% in Uqab-2000 was observed by the inoculation of isolate WL19
compared to control plants under normal conditions (-0.04 MPa). However, isolates
WS11 and WR2 remained statistically similar for decreasing the substomatal conductance
in both cultivars. At PEG-induced water stress (-1.09 MPa), isolates WL19 and WR2
showed significant increase of 38.4 and 41.5% in Uqab-2000 followed by 29.6 and 32.8%
in Fsd-2008 compared to their respective controls. Similarly, substomatal conductance
was enhanced by 41.7 and 49.0% in Fsd-2008 and Uqab-2000 respectively, compared to
uninoculated control plants on exposure to PEG-induced water deficit stress (-1.23 MPa).
73
![Page 94: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/94.jpg)
Table 4.8. Effect of drought tolerant CA containing endophytic bacterial isolates on stomatal and substomatal conductance of drought tolerant (Fsd-2008) and sensitive (Uqab-2000) wheat cultivars under normal and PEG-induced water deficit conditions
-0.04 MPa -1.09 MPa -1.23 MPaIsolates Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000 Fsd-2008 Uqab-2000Stomatal Conductance (mol H2O m
-2 s-1)Control 0.12±0.002 0.09±0.001 0.08±0.002 0.05±0.002 0.05±0.002 0.03±0.002WR2 0.14±0.003 0.12±0.002 0.11±0.004 0.07±0.003 0.07±0.001 0.05±0.001WS7 0.13±0.001 0.09±0.002 0.09±0.001 0.06±0.001 0.05±0.003 0.03±0.001WS11 0.14±0.002 0.11±0.004 0.09±0.003 0.07±0.001 0.07±0.002 0.05±0.001WS22 0.13±0.001 0.10±0.002 0.09±0.001 0.06±0.004 0.06±0.001 0.04±0.002WS23 0.14±0.001 0.11±0.003 0.10±0.002 0.07±0.000 0.07±0.002 0.05±0.002WL9 0.13±0.002 0.10±0.003 0.09±0.002 0.07±0.001 0.06±0.001 0.04±0.001WL13 0.13±0.003 0.09±0.004 0.09±0.001 0.06±0.004 0.05±0.001 0.04±0.002WL16 0.14±0.002 0.10±0.001 0.09±0.002 0.07±0.003 0.06±0.003 0.05±0.003WL19 0.16±0.002 0.12±0.004 0.11±0.004 0.07±0.002 0.07±0.002 0.05±0.003WL20 0.13±0.001 0.09±0.002 0.09±0.003 0.06±0.001 0.06±0.003 0.04±0.002Substomatal conductance (µmol mol-1)Control 240±3.97 235±4.09 280±5.04 276±4.49 335±2.89 328±4.34WR2 183±2.65 174±5.26 197±4.41 183±2.67 199±4.59 189±2.65WS7 202±4.41 180±2.83 205±3.18 204±2.41 238±4.06 214±2.91WS11 181±4.06 175±2.13 198±5.57 179±4.36 206±4.10 186±4.59WS22 210±5.49 192±3.05 225±2.89 205±3.93 237±3.61 214±2.97WS23 206±3.85 179±2.18 211±2.85 184±4.34 240±3.93 198±3.34WL9 215±4.73 199±4.49 228±3.48 220±5.24 245±6.07 242±2.03WL13 197±3.93 190±4.96 224±4.81 191±2.67 246±5.57 236±5.18WL16 207±1.79 181±6.44 207±5.70 188±2.91 241±3.48 207±3.85WL19 179±2.03 165±3.81 188±4.41 169±5.21 192±5.24 172±2.00WL20 198±2.34 182±1.52 203±2.41 190±3.06 223±4.17 200±4.34
Note: Least significant difference (LSD): Stomatal conductance, 0.006; Substomatal conductance, 11.13Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
74
![Page 95: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/95.jpg)
4.3.1.13. Relationship between photosynthetic rate and CA activity exhibited by
drought tolerant endophytic bacterial isolates
Relationship between photosynthetic rate and CA activity in bacteria under
normal as well as PEG-induced water deficit conditions (-1.09 and -1.23MPa) is shown in
figure 4.5 and 4.6 Inoculation of isolates (WL19, WR2, WS11 and WS23) exhibiting
highest CA activity gave considerable increase in photosynthetic rate in both cultivars,
especially in Uqab-2000 on exposure to water stress imposed by PEG. Photosynthetic rate
improved substantially with increasing CA activity and relationship was more
pronounced under water deficit stress Any change in CA activity exhibited by bacteria
significantly affected the photosynthetic rate in both cultivars. Moreover, correlation
analysis showed that photosynthetic rate and CA activity were positively correlated under
normal and stressed condition. However, correlation was more positive under PEG-
induced water deficit conditions. In case of cultivars, correlation was more significant in
drought sensitive cultivars (Uqab-2000) compared to tolerant cultivar (Fsd-2008) at
probability of p ≤ 0.05.
4.3.2. Screening of maize isolates for growth promotion
4.3.2.1. Root length
In the presence of PEG-induced water deficit stress, root length reduced
significantly in the seedling of maize susceptible hybrid (H2) in comparison with tolerant
(H1) hybrid (Table 4.9). However, inoculation of drought tolerant CA containing
endophytic bacterial isolates caused significant increase in root length under non-stresses
(-0.04) and PEG-induced water deficit stress (-1.09 and -1.23 MPa) inboth hybrids. Root
length for H2 increased by 41.3% and for H1 by 37.1% with the inoculation of isolate
MG9 compared to non-inoculated control plants under non-stressed conditions.
Comparable enhancement in root length of both hybrids was also observed with isolate
MG9 followed by MR17 and MS1 at PEG-induced water deficit stress (-1.09 MPa),
however, effect was slightly greater (50.3%) for H2 than for H1 (46.1%). Root length also
increased by 70.0 and 84.5% for H1and H2 hybrids respectively, with the inoculation of
isolate MG9 compared to uninoculated control plants under PEG-induced water deficit
stress (-1.23 MPa).
4.3.2.2. Shoot length
The results revealed that inoculation of drought tolerant CA containing endophytic
75
![Page 96: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/96.jpg)
10 12 14 16 18 20 220
2
4
6
8
10
12
14
R² = 0.737843012109168
R² = 0.707025417529565
R² = 0.680798158984398
D0=-0.04 MPa Linear (D0=-0.04 MPa) D1=-1.09 MPaLinear (D1=-1.09 MPa) Linear (D1=-1.09 MPa) D2=-1.23 MPa
Carbonic anhydrase activity (µmol/mL)
Phot
osyn
theti
c rat
e (μ
mol
CO2
m-2
s-1)
Fig. 4.5. Relationship between photosynthetic rate and carbonic anhydrase activity exhibited by drought tolerant endophytic bacterial isolates in wheat cv.
Fsd-2008
10 12 14 16 18 20 220
2
4
6
8
10
12
R² = 0.797094952015257
R² = 0.743704869825054
R² = 0.738762049340802
D0=-0.04 MPa Linear (D0=-0.04 MPa) D1=-1.09 MPaLinear (D1=-1.09 MPa) Linear (D1=-1.09 MPa) D2=-1.23 MPa
Carbonic anhydrase activity (µmol/mL)
Phot
osyn
theti
c rat
e (μ
mol
CO2
m-2
s-1)
`
Fig. 4.6. Relationship between photosynthetic rate and carbonic anhydrase activity exhibited by drought tolerant endophytic bacterial isolates in wheat cv.
Uqab-2000
76
![Page 97: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/97.jpg)
Picture 10: Effect of drought tolerant CA containing endophytic bacteria on root length under normal conditions
Picture 11: Effect of drought tolerant CA containing endophytic bacteria on root length under water deficit conditions
77
MG9Control
Control MG9
![Page 98: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/98.jpg)
Picture 12: Effect of drought tolerant CA containing endophytic bacteria on shoot length under normal conditions
Picture 13: Effect of drought tolerant CA containing endophytic bacteria on shoot length under PEG-induced water deficit conditions
78
Control
Control
MG9
MG9
![Page 99: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/99.jpg)
Table 4.9. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot length of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
-0.04 MPa -1.09 MPa -1.23 MPaIsolates H1 H2 H1 H2 H1 H2Root length (cm)Control 22.6±0.43 20.3±0.44 19.3±0.44 16.3±0.67 13.7±0.38 11.0±0.53MR1 25.9±0.52 23.4±0.46 23.2±0.33 19.9±0.49 18.0±0.58 16.0±0.23MR3 27.7±0.39 25.3±0.52 25.3±0.52 21.0±0.58 18.9±0.72 15.2±0.62MR17 30.3±0.49 29.7±0.49 27.8±0.37 24.7±0.77 23.9±0.57 19.9±0.31MS1 29.7±0.58 28.7±0.33 27.2±0.44 24.0±0.58 23.3±0.52 19.3±0.44MS7 26.3±0.54 24.2±0.62 19.9±0.35 17.8±0.60 14.0±0.56 11.7±0.52ML5 29.7±0.27 27.7±0.17 25.8±0.57 21.0±0.58 19.7±0.41 15.6±0.30ML8 29.0±0.47 25.0±0.51 25.6±0.37 23.3±0.52 21.7±0.33 17.7±0.33ML15 28.3±0.54 26.0±0.74 23.8±0.44 20.3±0.60 16.7±0.44 13.3±0.67MG2 24.2±0.36 23.7±0.44 24.2±0.33 21.7±0.17 18.0±0.17 13.0±0.49MG9 31.0±0.33 28.7±0.62 28.2±0.67 24.5±0.50 23.3±0.67 20.3±0.44Shoot length(cm)Control 34.1±0.73 29.1±0.61 27.4±0.76 23.6±0.70 21.2±0.45 16.5±0.47MR1 39.6±1.32 33.3±1.07 33.1±0.94 30.3±0.46 28.7±0.96 24.0±0.82MR3 42.9±0.97 34.4±1.19 36.3±1.50 27.9±1.21 26.7±0.40 21.8±0.38MR17 44.0±0.27 40.7±0.43 38.8±0.50 34.0±0.65 31.1±0.89 25.3±0.59MS1 42.7±0.86 39.4±0.54 37.5±0.92 32.5±0.74 30.0±1.35 24.5±0.28MS7 38.6±0.69 33.5±0.36 28.7±0.31 26.5±0.58 22.3±0.56 18.2±0.58ML5 40.7±1.49 36.3±0.57 33.4±1.57 26.8±0.39 28.9±0.74 22.9±0.64ML8 44.0±0.93 38.6±0.62 37.7±0.72 31.5±0.98 30.9±0.44 24.3±0.77ML15 40.9±0.69 35.4±0.48 35.8±0.61 28.5±1.19 26.8±0.33 21.1±1.18MG2 37.7±0.73 32.6±0.97 29.2±0.32 29.2±0.46 22.4±0.27 19.8±0.33MG9 44.6±0.78 41.5±1.35 38.9±0.43 34.8±1.06 31.9±1.29 25.8±0.97
Note: Least significant difference (LSD): Root length, 1.43; Shoot length, 2.29Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
79
![Page 100: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/100.jpg)
normal (non-stressed) and PEG-mediated water deficit environment (Table 4.9). Growth
enhancement in shoot length of H2 was greater compared to H1 hybrid by the inoculation
of endophytic bacterial isolates. Inoculation of isolate MG9 significantly enhanced the
shoot length varying about 42.6% in H2 and 30.7% in H1 compared to their uninoculated
control plants under normal conditions (-0.04 MPa). Inoculation of isolate MS7 also
increased the shoot length under normal conditions; however, increase over control plants
was smaller compared to other isolates. At PEG-induced water deficit stress (-1.09 MPa),
H2 hybrid treated with isolates MG9 and MR17 showed 47.4 and 44.0% increase while
H1 showed 41.9 and 41.6% compared with uninoculated control plants. In addition, shoot
length increased by 50.4 and 56.3% with the inoculation of isolate MG9 followed by
MR17, MS1 and ML8 in both hybrid compared to their respective control at -1.23 MPa.
4.3.2.3. Root fresh weight
Root fresh weight of maize decreased substantially with rising PEG-6000 induced
water deficit stress, however, inoculation of drought tolerant CA containing endophytic
bacterial isolate MG9, MR17, MS1 and ML8 enhanced the root fresh weight under non-
stresses as well as stressed conditions, especially in drought sensitive hybrid H2 (Table
4.10). Maximum root fresh weight (48.4%) was detected with isolate MG9 in H2 while
43.9 % in H1 compared to uninoculated control plants in the absence of PEG (-0.04
MPa). However, minimum increase was detected with isolate ML15 in both hybrids
under normal conditions (-0.04 MPa). Isolate MG9 followed by MR17, MS1 also showed
significant increase in both hybrids in response to water deficit conditions (-1.09 MPa).
Comparable increase (84.0%) in root fresh weight was recorded with isolate MG9 in H2
and 71.9% in H1 hybrid after PEG-treatment (-1.23 MPa). However, isolate MS7 showed
minimum increase in both H2 and H1 hybrid compared to respective uninoculated control
plant at -1.23 MPa mediated with PEG.
4.3.2.4. Shoot fresh weight
Momentous enhancement in shoot fresh biomasst was found in inoculated plants
of maize hybrids (H1 and H2), indicating the beneficial effect of drought tolerant CA
containing endophytic bacteria on shoot fresh weight in contrast to non-inoculated control
plants. However, effect of inoculation on enhancement of shoot fresh weight was more
pronounced in H2 hybrid compared to uninoculated control plants under normal as well
as stressed conditions (Table 4.10). Isolate MS7 showed minimum increase over the
80
![Page 101: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/101.jpg)
-0.04 MPa -1.09 MPa -1.23 MPaIsolates H1 H2 H1 H2 H1 H2Root fresh weight (g)Control 1.320±0.02 0.923±0.01 0.837±0.03 0.700±0.03 0.570±0.03 0.433±0.01MR1 1.780±0.03 1.267±0.02 1.167±0.02 1.027±0.01 0.867±0.02 0.697±0.01MR3 1.623±0.02 1.173±0.02 1.073±0.02 0.910±0.02 0.773±0.02 0.603±0.02MS17 1.893±0.02 1.367±0.01 1.267±0.01 1.117±0.02 0.967±0.01 0.750±0.03MS1 1.803±0.01 1.320±0.04 1.220±0.02 1.070±0.03 0.920±0.03 0.717±0.02MS7 1.627±0.02 1.193±0.02 1.093±0.02 0.943±0.02 0.673±0.02 0.490±0.01ML5 1.783±0.02 1.150±0.03 1.157±0.03 0.890±0.02 0.857±0.01 0.587±0.02ML8 1.673±0.01 1.257±0.02 1.150±0.02 1.007±0.02 0.750±0.02 0.680±0.02ML15 1.577±0.03 1.097±0.01 0.997±0.01 0.827±0.03 0.697±0.01 0.660±0.03MG2 1.677±0.02 1.074±0.03 1.110±0.01 0.847±0.01 0.674±0.02 0.513±0.01MG9 1.900±0.03 1.370±0.03 1.270±0.03 1.120±0.03 0.980±0.03 0.797±0.02Shoot fresh weight (g)Control 1.870±0.01 1.520±0.02 1.400±0.02 1.063±0.01 0.780±0.02 0.608±0.02MR1 2.210±0.01 1.997±0.02 1.817±0.02 1.470±0.03 1.067±0.01 0.880±0.01MR3 2.113±0.02 1.953±0.03 1.790±0.01 1.407±0.01 1.030±0.02 0.750±0.01MS17 2.370±0.02 2.067±0.02 1.973±0.03 1.627±0.01 1.197±0.03 0.997±0.02MS1 2.340±0.03 2.023±0.01 1.857±0.01 1.540±0.03 1.113±0.02 0.880±0.03MS7 1.953±0.02 1.633±0.02 1.523±0.02 1.250±0.02 0.837±0.03 0.643±0.02ML5 2.207±0.02 1.883±0.02 1.737±0.02 1.440±0.01 0.993±0.01 0.853±0.02ML8 2.307±0.01 2.070±0.01 1.833±0.03 1.380±0.02 1.127±0.02 0.883±0.03ML15 2.237±0.03 1.920±0.02 1.780±0.01 1.440±0.03 0.967±0.02 0.833±0.02MG2 2.117±0.01 1.813±0.03 1.593±0.02 1.267±0.01 0.910±0.03 0.737±0.02MG9 2.487±0.03 2.147±0.02 1.993±0.02 1.673±0.02 1.233±0.01 1.030±0.01
Table 4.10. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot fresh weight of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
Note: Least significant difference (LSD): Root length, 0.064; Shoot length, 0.060Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
81
![Page 102: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/102.jpg)
uninoculated control compared to other isolates in both hybrids. Out of 10 isolates, isolate
MG9 improved the shoot fresh weight by 32.9% in H1 and 41.2% in H2 compared to
uninoculated control under normal conditions (-0.04 MPa). In the same way, isolate MG9
showed 57.4 and 69.4% increase in H2 followed by 42.3 and 58.0% in H1 at -1.09 and -
1.23 MPa of PEG-induced water deficit stress, respectively in comparison with control.
However, isolate MS1 and ML8 remained statistically at par for improving the shoot
fresh weight in both hybrids at PEG-6000 induced water deficit stress (-1.23 MPa).
Moreover, minimum increase over control plants was recorded with isolate MS7 in both
hybrids under severe water deficit stress conditions (-1.23 MPa).
4.3.2.5. Root dry weight
The data explained in table 4.11 demonstrated that inoculation of isolates (MG9,
MR17, MS1 and ML8) significantly enhanced root dry weight of both sensitive and
tolerant hybrids under non-stressed (-0.04 MPa) as well as water deficit conditions (-1.09
and -1.23 MPa). Inoculation of drought tolerant CA containing endophytic bacterial
isolates MG9 and MR17 remained statistically similar for improving the root dry weight
in both hybrids with 39.2% in H1 and 42.3% in H2 compared to respective control plants
at -0.04 MPa. However, isolates MR1 and MS7 showed minimum increase under normal
conditions in H1 and H2 hybrids. Isolate MG9 showed 46.1% increase for H1 and 54.5%
for H2 in the presence of PEG-mediated water deficit stress (-1.09 MPa) compared to
uninoculated control plants. In the same way, at -1.23 MPa of PEG-6000 induced water
deficit stress, inoculation significantly enhanced root dry weight in both hybrids
especially in H2. Root dry weight was improved by 68.9 % in H1 plants and 73.9 % in
H2 plants by the inoculation of isolates MR17 and MG9 compared to uninoculated
control plants. However, smaller increase up to 6.5 and 6.7% was observed in both
hybrids with isolate MS7 compared to respective control plants on exposure to severe
water deficit stress (-1.23 MPa).
4.3.2.6. Shoot dry weight
Water deficit caused noticeable reduction in shoot dry weight of non-inoculated
maize seedlings of both hybrids, especially in H2 hybrid. Contrarily, shoot dry weight
was significantly increased with the inoculation of drought tolerant CA containing
endophytic bacterial isolates under PEG-induced water deficit stress (Table 4.11).
Inoculation of MG9, MR17, MS1 and ML8 enhanced shoot dry weight and improved the
82
![Page 103: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/103.jpg)
Table 4.11. Effect of drought tolerant CA containing endophytic bacterial isolates on root and shoot dry weight of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG induced water deficit conditions
Isolates-0.04 MPa -1.09 MPa -1.23 MPa
H1 H2 H1 H2 H1 H2Root dry weight (g)Control 0.158±0.01 0.111±0.00 0.117±0.01 0.077±0.00 0.074±0.00 0.046±0.00MR1 0.185±0.00 0.128±0.00 0.144±0.00 0.098±0.01 0.099±0.00 0.059±0.00MR3 0.202±0.01 0.126±0.01 0.150±0.00 0.091±0.00 0.102±0.01 0.061±0.01MR17 0.219±0.00 0.158±0.00 0.171±0.01 0.115±0.00 0.125±0.00 0.079±0.00MS1 0.214±0.00 0.152±0.00 0.161±0.00 0.110±0.00 0.121±0.00 0.073±0.00MS7 0.179±0.00 0.131±0.00 0.125±0.00 0.084±0.00 0.079±0.00 0.049±0.00ML5 0.203±0.01 0.136±0.00 0.153±0.00 0.096±0.00 0.099±0.01 0.054±0.00ML8 0.211±0.00 0.147±0.01 0.172±0.00 0.117±0.00 0.118±0.00 0.064±0.00ML15 0.188±0.00 0.136±0.00 0.147±0.00 0.083±0.00 0.090±0.00 0.065±0.01MG2 0.194±0.01 0.125±0.00 0.153±0.00 0.096±0.00 0.090±0.00 0.054±0.00MG9 0.220±0.00 0.156±0.00 0.171±0.01 0.119±0.01 0.125±0.01 0.080±0.00Shoot dry weight (g)Control 0.123±0.00 0.095±0.00 0.082±0.00 0.068±0.00 0.057±0.00 0.044±0.01MR1 0.135±0.00 0.107±0.00 0.092±0.00 0.079±0.01 0.069±0.01 0.050±0.00MR3 0.147±0.01 0.114±0.00 0.089±0.00 0.085±0.00 0.074±0.00 0.053±0.00MR17 0.161±0.00 0.128±0.01 0.110±0.01 0.094±0.00 0.081±0.00 0.065±0.00MS1 0.155±0.01 0.125±0.00 0.108±0.00 0.088±0.01 0.078±0.00 0.063±0.01MS7 0.141±0.00 0.105±0.00 0.089±0.00 0.073±0.00 0.060±0.00 0.047±0.00ML5 0.141±0.00 0.114±0.00 0.094±0.00 0.085±0.00 0.078±0.01 0.053±0.00ML8 0.155±0.01 0.125±0.00 0.105±0.01 0.085±0.00 0.080±0.00 0.064±0.01ML15 0.132±0.00 0.116±0.01 0.103±0.00 0.073±0.00 0.066±0.00 0.054±0.00MG2 0.143±0.01 0.103±0.01 0.105±0.00 0.081±0.01 0.067±0.01 0.050±0.00MG9 0.158±0.00 0.130±0.00 0.113±0.00 0.096±0.00 0.082±0.00 0.066±0.01
Note: Least significant difference (LSD): Root dry weight, 0.009; Shoot dry weight, 0.008Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
83
![Page 104: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/104.jpg)
plant health under non-stressed as well as stressed conditions, although improvement in
shoot dry weight was greater for H2 than H1 hybrid. Significant increase by 36.8, 41.1
and 50.0% was observed in H2 followed by 28.4, 37.8 and 43.8% in H1 hybrid with
isolate MG9 at different PEG-induced water deficit stress levels compared to their
respective non inoculated plants. However, inoculation of isolate MS7 gave significant
increase under normal conditions (-0.04 MPa) but showed non-significant differences
with uninoculated control plants under PEG-mediated water deficit conditions (-1.09 and
-1.23 MPa) in both HI and H2 hybrids of maize.
4.3.2.7. Chlorophyll contents
Data regarding chlorophyll content showed that inoculation with drought tolerant
CA containing endophytic bacterial isolates significantly enhanced the chlorophyll
contents in both hybrids, especially in H2 under normal and stressed conditions (Table
4.12). Inoculation with isolates MG9 followed by MR17 and MS1 significantly increased
chlorophyll contents by 28.8% in H1 and 32.2% in H2 compared to respective control
under non stressed conditions (-0.04). Under PEG-induced water deficit stress (-1.09
MPa), inoculation with isolate MG9 significantly enhanced chlorophyll contents by
39.5% in H2 hybrid. However, minimum increase in chlorophyll content was detected
with isolate MS7 in both hybrids when compared to their (uninoculated) control.
Similarly, isolate MG9 and MR17 showed significant increase in chlorophyll content up
to 47.8 and 44.9% in H2 and that of 40.9 and 39.0 % in H1 compared to non-inoculated
plants at PEG-induced water deficit stress (-1.23 MPa). However, isolate MR3 and ML15
remained statistically similar for improving the chlorophyll contents in both hybrids.
4.3.2.7. Carbonic anhydrase activity
Under PEG-induced water deficit stress, CA activity reduced significantly in the
seedling of maize susceptible (H2) hybrid in comparison with tolerant (H1) hybrid (Table
4.12) However, inoculation of drought tolerant CA containing endophytic bacterial
isolates caused significant enhancement in CA activity of both hybrids under non-stressed
(-0.04) as well as PEG- induced water deficit stress (-1.09 and -1.23 MPa). Under normal
conditions, CA activity for H2 increased by 26.6% and for H1 by 24.0% with the
inoculation of isolate MG9 followed by MR17 and MS1 compared to non-inoculated
plants. Comparable increase in CA activity was also observed with isolate MG9 followed
by MR17 and MS1 for both hybrids, however, effect was slightly greater
84
![Page 105: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/105.jpg)
Table 4.12. Effect of drought tolerant CA containing endophytic bacterial isolates on chlorophyll contents and carbonic activity of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
-0.04MPa -1.09 MPa -1.23 MPaIsolates H1 H2 H1 H2 H1 H2Chlorophyll content (SPAD Value)Control 40.2±0.31 35.3±0.82 32.6±0.23 29.6±0.55 26.1±0.46 23.8±0.53MR1 48.6±0.54 45.9±0.07 41.4±0.39 39.9±0.08 32.9±0.29 28.3±0.33MR3 47.8±0.74 43.0±0.26 39.6±0.35 39.0±0.03 31.7±0.33 31.5±0.06MR17 49.0±0.87 46.2±0.12 43.9±0.51 41.1±0.15 36.3±0.18 34.5±0.29MS1 50.1±0.06 46.1±0.03 42.1±0.12 40.8±0.17 34.8±0.43 34.7±0.05MS7 44.2±0.32 39.9±0.66 38.2±0.34 35.1±0.53 29.5±0.24 26.0±0.13ML5 49.3±0.23 45.7±0.10 39.6±0.50 39.8±0.26 30.5±0.90 32.7±0.12ML8 49.7±0.31 46.9±0.06 42.2±0.34 40.5±0.06 35.6±0.15 33.5±0.31ML15 47.9±0.14 44.7±0.24 41.7±0.07 38.9±0.08 33.3±0.43 33.2±0.20MG2 47.5±0.43 42.0±0.80 39.6±0.50 35.8±0.15 32.8±0.13 28.0±0.38MG9 51.8±0.30 46.7±0.08 43.9±0.33 41.3±0.12 36.8±0.11 35.2±0.15CA activity (mol CO2 Kg-1 leaf FM s-1)Control 2.309±0.04 2.007±0.05 1.700±0.05 1.630±0.04 1.327±0.05 1.121±0.03MR1 2.442±0.06 2.249±0.02 2.064±0.04 2.060±0.02 1.715±0.04 1.335±0.04MR3 2.370±0.04 2.215±0.05 1.870±0.05 1.851±0.06 1.608±0.05 1.328±0.02MR17 2.762±0.04 2.461±0.03 2.148±0.04 2.171±0.02 1.768±0.04 1.609±0.06MS1 2.694±0.03 2.496±0.03 2.171±0.03 2.154±0.07 1.789±0.04 1.578±0.03MS7 2.375±0.04 2.112±0.06 1.792±0.04 1.842±0.05 1.533±0.02 1.253±0.03ML5 2.505±0.06 2.239±0.02 2.067±0.06 2.058±0.05 1.635±0.06 1.526±0.07ML8 2.649±0.08 2.373±0.06 2.171±0.04 2.161±0.02 1.729±0.03 1.585±0.04ML15 2.543±0.06 2.151±0.03 1.936±0.02 1.916±0.06 1.511±0.03 1.357±0.03MG2 2.450±0.07 2.257±0.05 2.127±0.06 1.889±0.03 1.577±0.01 1.383±0.04MG9 2.86±50.04 2.542±0.07 2.214±0.04 2.217±0.03 1.873±0.04 1.666±0.05
Note: Least significant difference (LSD): Chlorophyll content,1.08; CA activity, 0.13Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
85
![Page 106: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/106.jpg)
(36.0%) for H2 than for H1 (30.2%) at -1.09 MPa of PEG-induced water deficit stress.
Similarly, in the presence of PEG-mediated water deficit stress of -1.23 MPa, about 41.1
and 48.6% increase was observed in H1 and H2 hybrids respectively, with the inoculation
of isolate MG9 compared to non-inoculated control plants. Moreover, smaller increase of
11.8 and 15.5% was observed with isolate MS7 in H2 and H1 hybrids, respectively, after
PEG-induced stress of -1.23 MPa.
4.3.2.9. Photosynthetic rate
Photosynthetic rate differed significantly between hybrids and reduced more for
sensitive (H2) than tolerant (H1) hybrid under non-stressed and stressed conditions (Table
4.13). However, inoculation with drought tolerant CA containing bacterial isolates
significantly enhanced the photosynthetic rate of both hybrids in the presence as well as
absence of PEG. Increase in photosynthetic rate was greater for H2 than H1 hybrid when
compared to their non-inoculated control plants. Inoculation with isolate MG9 followed
by MR17 and MS1 improved photosynthetic rate by 28.1 and 30. 3% for H1 while 33.6
and 37.8% for H2 compared to their respective control plants under non-stressed (-0.04
MPa) and stressed conditions (-1.09 MPa), respectively. However, inoculation of MR1,
ML5 and ML8 did not give any significant difference for improving the photosynthetic
rate in both hybrids after PEG-imposed water deficit stress of -1.09 MPa. Smaller
increase in photosynthetic rate was observed with isolate MG2 followed by ML5 and
MR1compared to their respective control plants under PEG-induced water deficit stress (-
1.23 MPa). Isolate MS7 did not show any significant effect for improving the
photosynthesis under severe water deficit stress (-1.23 MPa).
4.3.2.10. Transpiration rate
Under normal conditions (-0.04 MPa), significant increase of 26.2% in
transpiration rate for drought tolerant (H1) hybrid and 27.6% for sensitive (H2) hybrid
was recorded with the inoculation of drought tolerant CA containing endophytic bacterial
isolates MR17 followed by MG9 and MS1 compared to their non-inoculated control
plants (Table 4.13). However, inoculation of isolate MS7 did not cause significant
differences for improving transpiration rate of both hybrids under normal conditions (-
0.04 MPa). Under PEG-imposed water deficit stress (-1.09 MPa), inoculation of bacterial
isolates significantly enhanced the transpiration rate by 32.7% in H1 and 33.0 % in H2
compared to uninoculated control plants. Similarly, inoculation significantly enhanced
86
![Page 107: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/107.jpg)
Table 4.13. Effect of drought tolerant CA containing endophytic bacterial isolates on photosynthetic and transpiration rate of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
-0.04 MPa -1.09 MPa -1.23 MPaIsolates H1 H2 H1 H2 H1 H2Photosynthetic rate (μmol CO2 m
-2 s-1)Control 12.8±0.17 11.0±0.12 9.9±0.18 8.2±0.22 7.2±0.22 5.8±0.15MR1 14.8±0.10 13.9±0.07 11.7±0.07 9.9±0.08 8.5±0.06 6.7±0.12MR3 15.4±0.18 13.3±0.15 10.9±0.18 9.0±0.03 8.6±0.12 6.3±0.05MR17 16.0±0.07 14.2±0.12 12.6±0.21 11.1±0.15 9.0±0.18 7.9±0.10MS1 16.1±0.06 14.1±0.03 12.1±0.12 10.8±0.17 8.9±0.06 7.5±0.11MS7 14.5±0.09 12.9±0.16 10.5±0.13 9.1±0.13 7.7±0.09 6.0±0.13ML5 15.3±0.23 13.7±0.10 10.9±0.18 9.8±0.26 8.9±0.15 6.8±0.03ML8 16.0±0.14 14.9±0.06 12.2±0.34 10.5±0.06 8.6±0.15 7.7±0.05ML15 14.9±0.14 13.7±0.24 11.7±0.07 9.9±0.08 8.5±0.14 6.2±0.20MG2 15.8±0.11 13.7±0.15 11.3±0.18 9.2±0.20 8.0±0.13 6.5±0.06MG9 16.4±0.05 14.7±0.08 12.9±0.33 11.3±0.12 9.6±0.11 8.2±0.15Transpiration rate (mmol H2O m
-2 s-1)Control 3.69±0.07 3.54±0.06 2.75±0.04 2.54±0.07 2.05±0.07 1.85±0.05MR1 3.98±0.06 3.87±0.08 3.08±0.02 2.80±0.06 2.71±0.04 2.47±0.04MR3 3.91±0.04 3.82±0.06 3.04±0.08 2.84±0.07 2.79±0.02 2.55±0.08MR17 4.66±0.08 4.52±0.05 3.46±0.03 3.43±0.29 2.87±0.04 2.46±0.04MS1 4.54±0.03 4.39±0.08 3.48±0.03 3.38±0.09 2.89±0.02 2.66±0.04MS7 3.89±0.02 3.78±0.02 2.98±0.09 3.08±0.05 2.57±0.09 1.98±0.06ML5 4.38±0.07 4.32±0.04 3.38±0.03 2.74±0.03 2.70±0.03 2.62±0.04ML8 4.44±0.06 4.42±0.04 3.44±0.08 3.10±0.01 2.89±0.02 2.58±0.06ML15 3.88±0.07 3.81±0.07 3.08±0.02 2.80±0.06 2.57±0.09 2.12±0.03MG2 3.91±0.03 4.32±0.02 3.02±0.07 2.77±0.02 2.70±0.04 1.95±0.04MG9 4.59±0.05 4.49±0.04 3.65±0.04 3.38±0.05 3.04±0.08 2.76±0.05
Note: Least significant difference (LSD): Photosynthetic rate, 0.07; Transpiration rate, 0.18Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
87
![Page 108: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/108.jpg)
transpiration rate in both hybrids, especially in H2 under severe water deficit stress (-1.23
MPa). Transpiration rate was improved in H2 plants by 49.1% and that of 48.2% in H1
plants with isolate MG9 compared to uninoculated control plants under PEG-induced
water deficit stress (-1.23 MPa). However, isolates MR1 and MR3 remained statistically
similar for improving the transpiration rate in H1 and H2 hybrids under severe water
deficit conditions.
4.3.2.11. Stomatal conductance
On exposure to PEG-mediated water deficit stress, stomatal conductance of maize
seedlings significantly decreased in non-inoculated plants. However, inoculation of
drought tolerant CA containing endophytic bacterial isolates improved stomatal
conductance under normal (-0.04 MPa) as well as PEG-induced water deficit stress
conditions (-1.09 MPa) in both maize hybrids i.e. drought tolerant (H1) and sensitive (H2)
compared to uninoculated plants (Table 4.14) especially in H2 than H1. Inoculation of
isolate MG9 showed considerable improvement of 33.3% in H1 and 36.3% in H2
compared uninoculated control under normal conditions (-0.04 MPa). Isolate MR17
improved the stomatal conductance in both hybrids compared to uninoculated control
plants under PEG-induced water deficit stress (-1.09 MPa), which was similar to isolates
MG9 and MS1. However, isolate MG2 showed minimum increase of 22.2 % in H1 and
14.2 % in H2 at -1.09 MPa compared to uninoculated control plants. Under severe water
deficit conditions (-1.23 MPa), isolate MG9 gave pronounced enhancement in stomatal
conductance i.e. 57.1% in H1 and 60.0% in H2 compared to control plants.
4.3.2.12. Substomatal conductance
Substomatal conductance showed inverse relationship with the inoculation of
drought tolerant CA containing bacterial isolates for drought tolerant (H1) and sensitive
(H2) hybrids under non-stressed as well as stressed conditions (Table 4.14). Inoculation
with drought tolerant CA containing bacterial isolates significantly reduced the
substomatal conductance in both hybrids. Decrease in substomatal conductance was
greater for H2 than H1 hybrid when compared with their respective uninoculated control
plants under normal conditions (-0.04 MPa) as well as stressed conditions (-1.09 and -
1.23 MPa). Inoculation with isolate MG9, MR17 and MS1 significantly reduced
substomatal conductance under PEG-induced water stress (-1.09 MPa). At greater level of
PEG-mediated water deficit stress (-1.23 MPa), isolate MS7 showed minimum reduction
88
![Page 109: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/109.jpg)
-0.04 MPa -1.09 MPa -1.23 MPaIsolates H1 H2 H1 H2 H1 H2Stomatal conductance (mol H2O m
-2 s-1)Control 0.15±0.002 0.11±0.005 0.09±0.006 0.07±0.005 0.07±0.004 0.05±0.004MR1 0.16±0.003 0.15±0.003 0.11±0.007 0.09±0.003 0.10±0.004 0.06±0.003MR3 0.16±0.005 0.13±0.003 0.11±0.002 0.08±0.004 0.09±0.002 0.06±0.002MR17 0.18±0.006 0.15±0.002 0.13±0.003 0.10±0.004 0.09±0.004 0.08±0.006MS1 0.18±0.003 0.14±0.003 0.13±0.004 0.10±0.003 0.10±0.004 0.08±0.002MS7 0.16±0.004 0.13±0.005 0.11±0.003 0.09±0.005 0.08±0.003 0.06±0.005ML5 0.17±0.002 0.13±0.003 0.12±0.005 0.09±0.006 0.09±0.003 0.07±0.003ML8 0.17±0.004 0.15±0.004 0.12±0.005 0.08±0.004 0.09±0.006 0.07±0.006ML15 0.16±0.002 0.13±0.004 0.11±0.002 0.09±0.003 0.08±0.005 0.07±0.003MG2 0.16±0.005 0.12±0.002 0.11±0.004 0.08±0.005 0.08±0.003 0.07±0.002MG9 0.20±0.003 0.15±0.002 0.13±0.002 0.10±0.004 0.11±0.003 0.08±0.005Substomatal conductance (µmol mol-1)Control 274±1.23 244±3.04 289±2.04 265±2.10 365±1.78 345±2.89MR1 183±2.21 198±2.13 210±2.15 198±3.20 290±3.89 288±1.32MR3 203±2.10 210±4.05 223±4.01 213±2.13 243±3.20 203±2.45MR17 178±6.03 169±4.67 210±3.06 178±2.07 215±2.94 302±3.20MS1 184±1.78 175±5.32 199±5.29 184±2.89 206±1.78 214±2.02MS7 202±2.40 164±1.80 276±3.05 239±1.07 254±2.89 298±3.04ML5 207±4.08 224±6.03 271±4.44 229±5.02 267±3.45 242±2.45ML8 239±2.87 187±3.20 205±2.33 230±3.33 238±1.23 236±1.32ML15 265±4.32 189±2.90 234±1.59 281±5.23 299±2.89 234±5.23MG2 198±4.32 216±2.89 279±2.07 245±3.68 298±4.13 274±6.32MG9 214±2.21 169±1.78 210±3.30 192±1.50 215±5.09 220±5.00
Table 4.14. Effect of drought tolerant CA containing endophytic bacterial isolates on stomatal substomatal conductance of drought tolerant (H1) and sensitive (H2) maize hybrids under non-stressed and PEG-induced water deficit conditions
Note: Least significant difference (LSD): Stomatal conductance 0.01; Sub stomatal conductance, 8.90Means are given with standard error of three replicates and LSD is statistically significant differences at probability of p ≤ 0.05
89
![Page 110: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/110.jpg)
90
![Page 111: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/111.jpg)
in substomatal conductance in both hybrids, especially in H1. However, inoculation of
isolate MG9 significantly lowered the intracellular CO2 concentration in both hybrids,
especially for H2 maize hybrid compared to control plants on exposure to severe water
deficit stress (-1.23 MPa).
4.3.2.13. Relationship between photosynthetic rate and CA activity exhibiting by
drought tolerant endophytic bacteria
Water deficit stress had strong effect on CA activity and photosynthetic rate of
maize seedlings. Relationship between CA activity in bacteria and photosynthetic rate
was calculated for both drought tolerant (H1) and sensitive hybrids (H2) of maize under
normal (-0.04 MPa) as well as PEG induced water deficit conditions (-1.09, -1.23 MPa)
(Fig 4.7. and 4.8.). Photosynthetic rate was significantly influenced with any change in
CA activity in both hybrids, however, relationship was more pronounced on exposure to
water stress developed by PEG. In case of hybrids, H2 (sensitive) showed more positive
relationship than the H1 (tolerant). Significant increase in photosynthetic rate was
observed with the inoculation of isolate MG9, MR17, MS1 and ML8 having high CA
activity in both maize hybrids at PEG-induced water deficit stress (-1.09 and -1.23MPa).
Moreover, correlation analysis also showed that CA activity was positively correlated
with photosynthetic rate in both (H1and H2) hybrids under non-stressed and stressed
condition. However, correlation was stronger under PEG-induced water deficit stress for
drought sensitive hybrid (H2) than for tolerant (H1) hybrid.
4.5. Evaluation of selected Gus labeled endophytic bacterial isolates in pot trial
Three efficient Gus labeled isolates (WL19, WR2 and WS1 from wheat while
MG9, MR17 and MS1 from maize) showed varied response for improving growth in
wheat and maize crops under drought stress in pot trials. Results are described below.
4.5.1. Effect of selected Gus labelled endophytic bacterial isolates on wheat
4.5.1.1. Plant height
Response of wheat cultivars was monitored in the presence as well as absence of
drought tolerant CA producing endophytic bacterial inoculant under different water
deficit environment (Fig. 4.9A). Under non-stressed conditions (100% FC), Uqab-2000
inoculated with all the three isolates i.e. WS11, WL19 and WR2 showed increased plant
height compared to uninoculated control plants. Wheat cultivar Fsd-2008 also showed
91
![Page 112: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/112.jpg)
10 12 14 16 18 20 22 240
2
4
6
8
10
12
14
16
18
R² = 0.838531764339567
R² = 0.774641803795353
R² = 0.630850239478198
D0=-0.04 MPa Linear (D0=-0.04 MPa) D1=-1.09 MPaLinear (D1=-1.09 MPa) Linear (D1=-1.09 MPa) D2=-1.23 MPa
Carbonic anhydrase actitity (µmol/mL)
Phot
osyn
theti
c rat
e (μ
mol
CO2
m-2
s-1)
Fig. 4.7. Relationship between photosynthetic rate and carbonic anhydrase activity exhibited by drought tolerant endophytic bacterial isolates in maize hybrid
(H1)
10 12 14 16 18 20 22 240
2
4
6
8
10
12
14
16
R² = 0.841650906065255
R² = 0.793622726958695
R² = 0.650181430781647
D0=-0.04 MPa Linear (D0=-0.04 MPa) D1=-1.09 MPaLinear (D1=-1.09 MPa) Linear (D1=-1.09 MPa) D2=-1.23 MPa
Carbonic anhydrase actitity (µmol/mL)
Phot
osyn
theti
c rat
e (μ
mol
CO2
m-2
s-1)
Fig. 4.8. Relationship between photosynthetic rate and carbonic anhydrase activity exhibited by drought tolerant endophytic bacterial isolates in maize hybrid
(H2)
92
![Page 113: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/113.jpg)
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
20
40
60
80
100
hie-g
k-m jk
p op
c-eb
gh ef
nok-m
de
a
ijc-e
nlm
bca
f-hb-d
mkl
Control WR2 WS11 WL19
Field capacity levels
Pla
nt
hei
gh
t (c
m)
A
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
5
10
15
20
fgef
i
gh
lkl
cd a-c
f-h
b-d
ij i
de
a
ij fg
jk ijk
b-dab
ef c-e
ij
h
Control WR2 WS11 WL19
Field capacity levels
Ro
ot
dry
wei
gh
t (
g)
B
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
5
10
15
20
25
fgef
i-kg-i
nl-n
c-eab
fgc-e
k-m j-l
b-d a-cd-f ef
mn
h-j
a-ca
efa-c
high
Control WR2 WS11 WL19
Field capacity levels
Sho
ot
dry
wei
gh
t (g
) C
Fig. 4.9. Effect of drought tolerant CA containing endophytic bacteria on plant height (A), root dry weight (B) and shoot dry weight (C) in both wheat cultivars at different field capacity levels
93
![Page 114: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/114.jpg)
pronounced increase in plant height with endophytic bacterial isolates, though the
increase was slightly smaller than Uqab-2000 at 100% FC. Moreover, plant height was
increased by 18.9 and 24.3% for Fsd-2008 and 24.3 and 27.5% for Uqab-2000 with the
inoculation of isolate WL19 under stressed conditions (70% and 40% FC, respectively)
compared to their respective control plants.
4.5.1.2. Root dry weight
Under water deficit stressed conditions (70 and 40% FC), root dry weight was
significantly decreased in both wheat cultivars (Fsd-2008 and Uqab-2000) (Fig. 4.9B).
However, inoculation of bacterial isolates (WR2, WS11 and WL19) improved the root
dry weight more for Uqab-2000 and Fsd-2008 compared to their respective uninoculated
control plant under non-stressed (100% FC) as well as stressed (70, 40% FC) conditions.
Inoculation of Uqab-2000 with isolate WR2 significantly enhanced the root dry weight by
27.0 and 23.2% for Fsd-2008 under mild stressed conditions (70% FC) compared to
untreated plant. Root dry weight was markedly increased (37.2%) by isolate WL19 for
Uqab-2000 than for Fsd-2008 (31.8%) under severe water deficit conditions (40% FC).
4.5.1.3. Shoot dry weight
Inoculation of wheat cultivars with drought tolerant CA containing endophytic
bacteria helped plant to improve the shoot dry weight under well-waterd condition (100%
FC) and stressed environment in both wheat cultivars (Fsd-2008 and Uqab-2000) (Fig.
4.9C). Improvement in dry weight was observed under non-stressed and mild water
deficit conditions (100%, 70% FC). Inoculation of bacterial isolates WL19 and WR2 also
showed comparable differences for enhancing the shoot dry weight in both Fsd-2008 and
Uqab-2000 under mild water stress condition compared to their respective control.
Moreover, isolate WL19 improved shoot dry weight but did not show significant
difference for Fsd-2008 and Uqab-2000 under severe water stress condition (40% FC).
4.5.1.4. Carbonic anhydrase activity
Carbonic anhydrase activity of plant considerably decreased in both cultivars
under water deficit environements (70 and 40% FC), especially in Uqab-2000 (Fig.
4.10A). Drought tolerant CA containing endophytic bacterial inoculants significantly
enhanced CA activity compared to respective uninoculated control plants, however, effect
of inoculation was more pronounced for Uqab-2000 than Fsd-2008. Under well-watered
condition (100% FC), isolates WL19 showed better CA activity in both wheat cultivars.94
![Page 115: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/115.jpg)
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
0.5
1
1.5
2
2.5
3
3.5
gh hi
jk
lm
b
ef fgg
k k
cdfg
cd
hij
l
abc
def
hi-l
Control WR2 WS11 WL19
Field capacity levels
Ca
rbo
nic
an
hy
dra
se a
ctiv
ity
(m
ol
CO
2 K
g-1
lea
f F
M s
-1)
A
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
5
10
15
20
25
cfg
hij
mn
bc-e ef
gh
jklm
bc-f cd
h
k k
ab
c-e d-f
ikl
Control WR2 WS11 WL19
Field capacity levels
Ph
oto
syn
thet
ic r
ate
(μ
mo
l C
O2
m-2
s-1
)
B
Fsd Uqab Fsd Uqab Fsd Uqab70% 40%
0
1
2
3
4
5
6
7
deef
ghi
lmn
a-cc-e
defg
j-l
mn
cd cdde
h
jkkl
a ab
ef ef
ijkl
Control WR2 WS11 WL19
Field capacity levels
Tra
nsp
ira
tio
n r
ate
(mm
ol
H2
O m
-2 s
-1)
C
Fig. 4.10. Effect of drought tolerant CA containing endophytic bacteria on carbonic anhydrase activity (A), photosynthetic rate (B) and transpiration rate (C) in both wheat cultivars at different field capacity levels
95
![Page 116: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/116.jpg)
Moreover, inoculation of isolate WL19 showed 37.7 and 58.3% increase in Fsd-2008 and
53.3 and 66.6% in Uqab-2000 in comparison with control at mild (70% FC) and severe
(40% FC) water deficit stress.
4.5.1.5. Photosynthetic rate
A significant decrease in photosynthetic rate was observed for Uqab-2000 than
Fsd-2008 under limited water supply (Fig. 4.10B). However, inoculation of drought
tolerant CA containing endophytic bacterial isolates (WL19, WR2 and WS11)
significantly increased leaf photosynthetic rate, especially in Uqab-2000 both in the
presence and absence of water deficit stress (100, 70 and 40% FC). Under normal
condition, Uqab-2000 showed significant increase of 21.8% with the inoculation of
isolate WL19 that was 18.7% for Fsd-2008 compared to uninoculated control plants.
Nevertheless, under severe water deficit stress (40% FC), photosynthetic rate was
increased upto 30.1% with isolate WL19 for Fsd-2008 and 35.2% with isolate WS11 for
Uqab-2000 compared to respective control plants.
4.5.1.6. Transpiration rate
Transpiration rate was increased about 22.9% in Uqab-2000 with isolates WL19
followed by 19.7% increase in Fsd-2008 compared to control under normal growth
conditions (100% FC) (Fig. 4.10C). However, isolates showed variable response for
facilitating the transpiration rate under water deficit environement (70% FC) in both
cultivars. Inoculation with drought tolerant bacterial isolate WL19 gave highest increase
of 42.5% for Uqab-2000 and 32.5% for Fsd-2008 compared to respective control plants,
under severe water stress (40% FC). On the other hand, isolate WR2 showed similar
increase for transpiration rate in both cultivars at 40% FC level.
4.5.1.7. Stomatal conductance
Under water stress conditions (40% FC), stomatal conductance was decreased in
both cultivars, however, effect was more pronounced in Uqab-2000 compared to Fsd-
2008 (Fig. 4.11A). Inoculation of isolate WL19 improved the stomatal conductance in
both cultivars and showed 21% increase when compared to their non-inoculated control
plants under normal growth conditions. Similarly, enhancement in stomatal conductance
was observed with the inoculation of drought tolerant endophytic bacterial inoculant
WL19 compared to control (un-inoculated) plants under water stress conditions 70% FC)
96
![Page 117: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/117.jpg)
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0.40
cf
h i
mno
b
cd de
gh
klm
b b
fg
kln
ab
cdef
jkl
Control WR2 WS11 WL19
Field capacity levels
Sto
ma
tal
con
du
cta
nce
(mo
l H
2O
m-2
s-1
)
A
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
20
40
60
80
100
fhi
jk mn o
abd
gh hi jk kl
cd de efi
m lm
aa
f fgij jk
Control WR2 WS11 WL19
Field capacity levels
Rel
ati
ve
wa
ter
con
ten
t(%
)
B
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
10
20
30
40
50
h-j hef
d
ba
kh-j gh
fg
c c
i-k jkgh
e
cb
k jkhi
ef ef e
Control WR2 WS11 WL19
Field capacity levels
Ele
ctro
lyte
lea
ka
ge
(%)
C
Fig. 4.11. Effect of drought tolerant CA containing endophytic bacteria on stomatal conductance (A), relative water content (B) and electrolyte leakage (C) in both wheat cultivars at different field capacity levels
97
![Page 118: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/118.jpg)
Inoculation of endophytic bacterial isolate WL19 gave significant improvement of 39.1%
for Uqab-2000 and 29.7% for Fsd-2008 compared to uninoculated control plants under
severe water deficit conditions (40% FC).
4.5.1.8. Relative water content (RWC)
Relative water content, indicator of plant water status, decreased more in Uqab-
2000 than Fsd-2008 (Fig. 4.11B) under water deficit conditions. However, inoculation of
drought tolerant CA containing endophytic bacterial inoculants (WR2, WS11 and WL19)
significantly improved RWC in both cultivars under normal (100% FC) and stressed
condition (70, 40% FC) but increase was more in Uqab-2000. In normal growth
conditions, relative water content (RWC) was significantly increased by 18.6% in Uqab-
2000 and 14.8% in Fsd-2008 compared to uninoculated control plants. Inoculation with
isolate WL19 facilated the RWC by15.7 and 24.8 % in Fsd-2008 and by 21.1 and 30.6 %
in Uqab-2000 under severe water stress (40% FC) in comparison with control.
4.5.1.9. Electrolyte leakage (EEL)
In contrast to RWC, electrolyte leakage (EEL) was increased under water deficit
stress conditions (70 and 40% FC) (Fig. 4.11C). Decrease for Uqab-2000 was greater for
Fsd-2008. Inoculation with drought tolerant CA containing endophytic bacterial isolates
reduced the electrolyte leakage in both cultivars. Isolate WL19 showed 17% reduction in
electrolyte leakage under normal (100% FC) and mild stressed conditions (70% FC) in
Uqab-2000. Under severe water stress (40% FC), significant reduction of 32. 7% for Fsd-
2008 was observed and 37.3% for Uqab-2000 compared to control plants.
4.5.1.10. Proline content
Concentration of proline in the leaves of wheat genotypes was comparable for
entire treatments; however, it was more for the plants inoculated with isolate WL19 under
water deficit (70% FC) conditions in comparison with control (Fig. 4.12A). Moreover,
greater accumulation was observed for Fsd-2008 compared to Uqab-2000. Under normal
conditions, isolate WR2, WS1 and WL19 showed variable response for proline
accumulation in both the cultivars. A similar response for proline content was observed
under mild water stress (70% FC). However, inoculation with isolate WL19 significantly
enhanced the proline content by 20.1% in Fsd-2008 and 25.2 % in Uqab-2000 compared
to uninoculated control plants under sever water stress (40% FC).
98
![Page 119: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/119.jpg)
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
1.0
3.0
5.0
7.0
9.0
11.0
13.0
15.0
mnp
h
k
c
e
lm no
f
j
b
d
lop
g
j
b
d
kno
f
i
a
c
Control WR2 WS11 WL19
Field capacity levels
Pro
lin
e co
nte
nt
(µm
ol
g-1
)
A
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
3
6
9
12
15
18
21
24
lm jk
g f
b
a
mn m
h g
d
b
m kli h
cb
nlm
ijgh
ed
Control WR2 WS11 WL19
Field capacity levels
Mel
an
ald
ehy
de
con
ten
t
(μm
ol.
g-1
fw
)
B
Fsd Uqab Fsd Uqab Fsd Uqab100% 70% 40%
0
3
6
9
12
15
18
21
24
fg
ij h-jkl
no
bcde ef
ghjk
mn
de de cd
hikl
n
a
bde
fg
ijlm
Control WR2 WS11 WL19
Field capacity levels
G
rain
yie
ld (
g p
ot-
1)
C
Fig. 4.12. Effect of drought tolerant CA containing endophytic bacteria on proline content (A), melanaldehyde (B) and grain yield (C) in both wheat cultivars at different field capacity levels
99
![Page 120: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/120.jpg)
4.5.1.11. Melanaldehyde content
Melanaldehyde (MDA) content was increased as intensity of water deficit stress
increased; however, increase was more in Uqab-2000 compared to Fsd-2008 (Fig. 4.12B).
Inoculation of isolate WS11 showed slight decrease in MDA contents of both cultivars
under normal conditions compared to isolates WL19 and WR2. However, isolates
exhibited different response for lowering the MDA content under mild stress conditions
(70% FC). Under sever water deficit conditions, isolate WL19 gave considerable
reduction of 30.2 and 34.9% in Fsd-2008 and Uqab-2000, respectively, under severe
water stress (40% FC).
4.5.1.12. Grain yield
Inoculation of endophytic bacterial isolates (WR2, WS11 and WL19) gave
significant increase in grain yield, especially in Uqab-2000 (Fig 4.12C). Isolates WR2
and WL19 facilitated the grain yield compared to uninoculated control plants in both
cultivars under non-stressed (100% FC) and under water deficit (70% FC) stress. Under
severe water deficit stress (40% FC), isolate WL19 showed 32.6 and 34.4% increase in
grain yield in both Fsd-2008 and Uqab-2000, respectively, in comparison with control
plants.
4.5.1.13. Colonization of plant tissues
The results regarding colonization of different tissues of both wheat cultivars
(Fsd-2008 and Uqab-2000) with Gus labelled drought tolerant CA containing endophytic
bacterial isolates are shown in figure 4.13. The isolates i.e. WR2, WS11 and WL19
efficiently colonized the root, shoot and leaf tissues of both cultivars however,
colonization was slightly greater for Fsd-2008 than Uqab-2000. Colonization of tissues by
isolates decreased under mild (70% FC) and severe (40% FC) stress compared to normal
growth conditions (100% FC). In case of root, higher CFU of isolate WR2 was observed
for Fsd-2008 than Uqab-2000 followed by WL19 and WS11 under normal (100% FC) as
well as water deficit conditions (70 and 40% FC). Inoculation of isolate WR2 and WL19
efficiently colonized the shoot tissues than WS11, though, their number decreased as
intensity of water deficit stress increased in both the cultivars. On the other hand, less
CFU was recorded in shoot tissues of Fsd-2008 and Uqab-2000 compared to root tissues.
100
![Page 121: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/121.jpg)
100% 70% 40% 100% 70% 40%Fsd-2008 Uqab-2000
0E+00
1E+05
2E+05
3E+05
4E+05
5E+05
6E+05
7E+05 WR2 WS11 WL19
Root tissues
CF
U/g
fre
sh b
iom
ass
A
100% 70% 40% 100% 70% 40%Fsd-2008 Uqab-2000
0E+00
1E+03
2E+03
3E+03
4E+03
5E+03
6E+03
7E+03
8E+03 WR2 WS11 WG9
Shoot tissues
CF
U/g
fre
sh b
iom
ass
B
100% 70% 40% 100% 70% 40%Fsd-2008 Uqab-2000
0E+00
1E+03
2E+03 WR2 WS11 WL19
Leaf tissues
CF
U/g
fre
sh b
iom
ass
C
Fig. 4.13. Colonization of root (A), shoot (B) and leaf (C) tissues with drought tolerant CA containing endophytic bacteria in both wheat cultivars at different field capacity levels
101
![Page 122: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/122.jpg)
Minimum viable cell number was found with inoculants in leaf tissues of both cultivars
compared to root and shoot tissues. However, among the isolates, isolate WL19
efficiently colonized the leaf tissue of Fsd-2008 than Uqab-2000 under non-stressed
(100% FC) and under water deficit (70 and 40% FC) conditions.
4.5.1.14. Characterization of selected bacterial isolates for IAA production under
normal and stressed conditions
Selected drought tolerant CA containing endophytic bacterial isolates (WR2,
WS11, and WL19) were also characterized for IAA production under normal and PEG-
induced water deficit conditions both in the presence as well as in absence of the L-
tryptophan (L-TRP) with reference to time (1-6 days) (Fig. 4.14). Results showed that
PEG-induced water deficit conditions significantly reduced IAA synthesis, especially in
the absence of substate (L-TRP). Moreover, isolates WR2, WS11and WL19 enhanced the
IAA synthesis under normal conditions, though; increase was higher with L-TRP under
non-stressed and PEG-induced water deficit conditions. However, among the isolates,
highest 1AA production was observed with isolate WL19 in the presence of substrate (L-
TRP) followed by L-TRP+ PEG, without L-TRP and PEG at day 3 and showed slight
decrease in IAA at day 6. Isolate WS11 also showed maximum IAA production at day 3
with L-TRP while IAA substantially decreased at day 5 and 6. However, minimum
accumulation was observed with isolate WR2 and WS11 at day 3 under PEG-induced
water deficit conditions.
4.5.1.15. Characterization of selected bacterial isolates for P solubilization under
normal and stressed conditions
Results showed that P- solubilization was increased with increasing time and
maximum P solubilization was observed at day 7. Selected isolates (WR2, WS11, and
WL19) efficiently enhanced P solubilization under normal (no-stresses) and PEG-6000
induced water deficit stress conditions (Fig. 4.15). Interestingly, greater P-solubilization
was observed under PEG-6000 induced water deficit stress with isolates. Among the
isolates, isolate WR2 gave maximum P solubilization followed by isolate WL19 and
WS11 under PEG-6000 induced water deficit stress than the normal conditions at day 7.
102
![Page 123: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/123.jpg)
WL19
1 2 3 4 5 60
10
20
30
40
50
60
70
80 Growth in L-TRP Growth without L-TRP PEG+L-TRP
PEG+without L-TRP
Days
IAA
pro
duct
ion
(μg
mL
-1)
WS11
1 2 3 4 5 60
5
10
15
20
25
30
35
40
Growth in L-TRP Growth without L-TRP PEG+L-TRPPEG+without L-TRP
Days
IAA
pro
duct
ion
(μg
mL
-1)
WR2
1 2 3 4 5 60
10
20
30
40
50
60
Growth in L-TRP Growth without L-TRP PEG+L-TRP
PEG+without L-TRP
Days
IAA
pro
duct
ion
(μg
mL
-1)
Fig. 4.14. IAA production of drought tolerant CA containing endophytic bacterial isolates with reference to time
103
![Page 124: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/124.jpg)
1 2 3 4 5 6 70
20
40
60
80
100
NBRIPNBRIP+PEG
Days
Tri
calc
ium
pho
spha
te so
lubi
lizat
ion
(µg/
ml) WL19
1 2 3 4 5 6 70
20
40
60
80
100
NBRIPNBRIP+PEG
Days
Tri
calc
ium
pho
spha
te so
lubi
lizat
ion
(µg/
ml) WS11
1 2 3 4 5 6 70
20
40
60
80
100
NBRIPNBRIP+PEG
Days
Tri
calc
ium
pho
spha
te so
lubi
lizat
ion
(µg/
ml) WR2
Fig. 4.15. P-solubilization of drought tolerant CA containing endophytic bacterial isolates with reference to time
104
![Page 125: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/125.jpg)
4.5.2. Study the selected Gus labeled endophytic bacterial isolates on maize
4.5.2.1. Plant height
In response to water deficit stress (40%), plant height of maize hybrids viz
tolerant (H1) and sensitive (H2) was significantly improved by the inoculation of drought
tolerant CA containing endophytic bacterial isolates compared to uninoculated control
plants (Fig. 4.16A). However, increase was more pronounced in H2 than H1 hybrid.
Inoculation with isolate MG9 significantly improved plant height by 14.8 and 18.5% in
H1 and H2 respectively, compared to respective control under well-watered conditions
(100%FC), though response was statistically similar in both (H1, H2) hybrids. Under
water deficit (70 and 40% FC) conditions, isolate MG9 showed 17.2 and 20.3% increase
for H1 and 20.5 and 25.8 % for H2, respectively, compared to respective control.
4.5.2.2. Root dry weight
A substantial reduction in root dry weight of both non inoculated plants of both
drought tolerant (H1) and sensitive (H2) hybrid of maize was observed under limited
water supply (Fig. 4.16B). Inoculation of drought tolerant CA containing endophytic
bacterial inoculants enhanced root dry weight in both hybrids, however, increase was
more for sensitive than for tolerant hybrid. In H2 hybrid, significant increase of 25.0, 27.3
and 34.4% was observed with isolate MG9 and that of 17.9, 25.8 and 30.7% in H1,
respectively, compared to corresponding control under non-stressed (100% FC) and under
water deficit conditions (70 and 40% FC).
4.5.2.3. Shoot dry weight
Shoot dry biomass of maize hybrids (H1 and H2) was increased both in the
presence as well as absence of drought tolerant CA producing endophytic bacterial
inoculants under different water deficit environment (Fig. 4.16C). Under normal growth
conditions (100% FC), plant of both hybrids inoculated with isolate MG9 showed similar
response for improving shoot dry weight. However, H2 plant also showed momentous
increase in shoot dry biomass in the presence of endophytic bacterial isolates (MR17,
MS1 and MG9) and increase was slightly greater than H1 at 70% FC. Moreover, 18.8
and 30.3% increase in shoot dry weight was observed for H1 and H2, respectively, with
isolate MR17 compared to their control plants under stressed condition (40% FC).
105
![Page 126: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/126.jpg)
H1 H2 H1 H2 H1 H2100% 70% 40%
40
60
80
100
120
140
160
180
efhi ij
kl
no
bcd de
gh
l m
bcd
e-g fg
k
n
a abcd de
jkkl
Control MR17 MS1 MG9
Field capacity levels
Pla
nt
hei
gh
t (c
m) A
H1 H2 H1 H2 H1 H2100% 70% 40%
0
5
10
15
20
25
30
35
cdgh
ij
o o
b cd-f
hij-l
n
bcd
fg e-g
mn l-n
a bc
de
jk k-m
Control MR17 MS1 MG9
Field capacity levels
Ro
ot
dry
wei
gh
t (
g)
B
H1 H2 H1 H2 H1 H2100% 70% 40%
40
60
80
100
120
effg
ghij
lm
abc cd
ef
jk jk
ab bc
d-f efh
k
a abbc
de
hijk
Control MR17 MS1 MG9
Field capacity levels
Sh
oo
t d
ry w
eig
ht
(g) C
Fig. 4.16. Effect of drought tolerant CA containing endophytic bacteria on plant height (A), root dry weight (B) and shoot dry weight (C) in both maize hybrids at different field capacity levels
106
![Page 127: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/127.jpg)
4.5.2.4. Carbonic anhydrase activity
Inoculation with drought tolerant CA containing endophytic bacterial inoculants
stimulated CA activity in the leaf of maize hybrids both in the presence and absence of
stressed conditions (Fig. 4.17A). Significant increase in CA activity was observed with
isolate MG9, however, isolate MR17 and MG9 showed varied response in both hybrids
under normal conditions (100/%FC). Inoculation of isolate MG9 caused 18.4%
improvement in H1 and 24.1% in H2 compared to control plants under mild water deficit
conditions (70% FC) compared to control plants. Similar to this, isolate MG9 also gave
highest CA activity under severe water deficit conditions (40% FC) in both hybrids
compared to control.
4.5.2.5. Photosynthetic rate
Isolates showing higher CA activity in leaves of maize hybrids, also caused
marked increase in photosynthetic rate compared to uninoculated control plants under
normal as well as stressed conditions (Fig 4.17B). Isolate (MR17, MS1, and MG9)
showed variable response for both hybrids compared to control plants under normal
growth conditions (100% FC). However, inoculation of H2 with isolate MG9
significantly increased the photosynthetic rate by 22.9 and 30.2% and by 19.1 and 28.9%
for H1under mild and severe stressed conditions (70 and 40% FC), respectively,
compared to control plant.
4.5.2.6. Transpiration rate
Drought tolerant CA containing endophytic bacterial isolates also facilitated the
transpiration under non-stressed (100%FC) and stressed (70%, 40% FC) conditions in
drought tolerant (H1) and drought sensitive (H2) maize hybrid in a pot conditions. Under
normal plant growth (100% FC) and mild stressed conditions (70% FC), isolates MR17
showed minimum increase whereas isolate MG9 gave maximum in both hybrids (H1 and
H2) compared to respective control plants. However, increase was greater for H2
compared to H1 hybrid (Fig. 4.17C). Under severe water deficit conditions (40% FC),
isolate MG9 increased the transpiration rate by 22.2 % for H2 and 26.4% for H1
compared to control plants.
107
![Page 128: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/128.jpg)
H1 H2 H1 H2 H1 H2100% 70% 40%
0
1.5
3
4.5
6
gh hi
jkl m
bfg fg g
ijl
cd ef cd
hk k
abc de f
h ij
Control MR17 MS1 MG9
Field capacity levels
Ca
rbo
nic
an
hy
dra
se a
ctiv
ity
(m
ol
CO
2 k
g-1
lea
f f
.w s
-1)
A
H1 H2 H1 H2 H1 H2100% 70% 40%
0
5
10
15
20
25
30
f-hh-j
j-ll-n
pqq
abd-g
g-i g-i
m-oop
b-e a-ce-g
i-k
o no
ab-d c-f e-g
k-mm-o
Control MR17 MS1 MG9
Field capacity levels
Ph
oto
syn
thet
ic r
ate
(μ
mo
l C
O2
m-2
s-1
)
B
H1 H2 H1 H2 H1 H2100% 70% 40%
0
2
4
6
8
e fgi
j
mo
bcd
ghi
kl lm
d cdfg h
kn
a abef gh
jk-m
Control MR17 MS1 MG9
Field capacity levels
Tra
nspi
rati
on r
ate
mm
ol H
2O m
-2 s
-1)
C
Fig. 4.17. Effect of drought tolerant CA containing endophytic bacteria on carbonic anhydrase activity (A), photosynthetic rate (B) and transpiration rate (C) in both maize hybrids at different field capacity levels
3.5.2.7. Stomatal conductance108
![Page 129: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/129.jpg)
The results regarding stomatal conductance showed that inoculation with drought
tolerant CA containing endophytic bacterial inoculants MR17, MS1 and MG9 facilitated
the stomatal conductance under non-stressed and stressed conditions (Fig. 4.18A).
However, increase was more for H2 compared to H1 hybrids. Under normal conditions
(100% FC), stomatal conductance enhanced by 18.5 and 31.2% in H1 and H2,
respectively, in comparison with non-inoculated control plants. At mild water stress (70%
FC), isolates also showed comparable differences but response varied among isolates in
both hybrids. However, under severe water stress conditions (40% FC), inoculation with
isolate MG9 showed 25.7% increase in H2 that was smaller than that in H1 (20.9%) in
comparison with control plants.
3.5.2.8. Relative water content (RWC)
Response of maize hybrids was monitored for RWC in the presence of drought
tolerant CA producing endophytic bacterial inoculant under different moisture regimes
(Fig. 4.18B). Under normal conditions (100% FC), H2 planta inoculated with isolate
MG9 had increased RWC by 28.6% and while 19.9% H1 compared to control
(uninoculated) plants. However, H2 plants also showed momentous increase in RWC in
the presence of endophytic bacterial isolates, though increase was slightly smaller than
that H1 plants in mild water stress (70% FC). Moreover, RWC was increased by 66.6%
for H2 and 38.8% for H1 with the inoculation of isolate MG9 under stressed condition
(40% FC) compared to their respective uninoculated plants.
4.5.2.9. Electrolyte leakage (EEL)
In response to mild and severe water deficit conditions (70 and 40% FC),
electrolyte leakage significantly enhanced in both maize hybrids (Fig. 4.18C). However,
inoculation with bacterial isolates (MR17, MS1 and MG9) reduced the electrolyte
leakage, more for H2 compared to H1 hybrid under non-stressed and stressed conditions.
Moreover, isolate MR17 significantly decreased the electrolyte production by 19.6%,
which was greater than H1 under mild stressed conditions (70% FC) compared to
untreated plant. Electrolyte leakage was markedly decreased (30.0%) by isolate MG9 for
H2 hybrid than for H1 hybrid (27.9%) under severe water deficit conditions (40% FC).
109
![Page 130: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/130.jpg)
H1 H2 H1 H2 H1 H2100% 70% 40%
0.00
0.20
0.40
0.60
cdf f
gjk
l
bc de
fgh
ij
b bc
f
hikl
ab
cde
gh-j
Control MR17 MS1 MG9
Field capacity levels
Sto
ma
tal
con
du
cta
nce
(m
ol
H2
O m
-2 s
-1) A
H1 H2 H1 H2 H1 H2100% 70% 40%
0
20
40
60
80
cd
g g
h-jk
l
bcd de
gh
ij
b
ef efg g
j
a
c cdf
ghi
Control MR17 MS1 MG9
Field capacity levels
Rel
ativ
e w
ater
con
tent
(%)
B
H1 H2 H1 H2 H1 H2100% 70% 40%
0
10
20
30
40
50
60
mnjk
f-h
cdb
a
nolm
i-kg-i
d
b
o
j-l h-jef
cb
om k-m
fg f-hde
Control MR17 MS1 MG9
Field capacity levels
Ele
ctro
lyte
lea
ka
ge
(%
)
C
Fig. 4.18. Effect of drought tolerant CA containing endophytic bacteria on stomatal conductance (A), relative water content (B) and electrolyte leakage (C) in both maize hybrids at different field capacity levels
110
![Page 131: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/131.jpg)
4.5.2.10. Proline content
Inoculation of both maize hybrids with drought tolerant CA containing endophytic
bacterial isolates did not reveal any considerable difference in proline content under
normal (100% FC) growth conditions, however, isolates helped plants to improve the
proline content under stressed (70 and 40% FC) conditions (Fig 4.19A). Isolate MG9
enhanced proline content in both hybrids under mild stress (70% FC) compared to other
isolates. Nevertheless, pronounced increase in proline accumulation was observed with
isolates MR17, MS1 and MG9 under severe water deficit conditions (40% FC) especially
in H2 than non-inoculated control plants.
4.5.2.11. Melanaldehyde (MDA) content
Content of MDA, indicator of lipid peroxidation, was increased with increasing
water deficit stress in both hybrids (Fig. 4.19B). Inoculation of isolates reduced MDA
content, however, reduction was marked for H2 compared to H1. Under normal
conditions (100% FC), isolate MS1 showed 15.0 and 22.6% reduction in MDA content of
H1 and H2, respectively, compared to control plants. Comparable differences for MDA
content was observed under mild water stress (70% FC) with bacterial inoculation.
However, inoculation of isolate MG9 significantly reduced MDA content by 19.6% in H1
and 23.9 % in H2 compared to uninoculated control plants under severe water stress (40%
FC).
4.5.2.12. Grain yield
Grain yield was substantially increased in the presence of drought tolerant CA
producing endophytic bacterial inoculant under non-stressed as well as stressed
conditions (Fig. 4.19C). Under normal conditions (100% FC), inoculation showed
different response for improving grain yield in both hybrids. However, H2 showed
significant increase (19.8%) in grain yield in the presence of endophytic bacterial isolates,
though increase was slightly greater than H1 at 70% FC. Grain yield was also increased
by 21.5 % for H2 and 38.0% for H1 compared to their respective non-inoculated plants
under non-stressed (100% FC) as well as stressed (70 and 40% FC) conditions.
Inoculation of maize hybrid H2 with isolate H1 with isolate MG9 under stressed
condition (40% FC) compared to respective control.
111
![Page 132: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/132.jpg)
H1 H2 H1 H2 H1 H2100% 70% 40%
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
ijk
fh
ce
i
k
f-h gh
b
cd
ijjk
degh
b
de
ik
defg
a
c
Control MR17 MS1 MG9
Field capacity levels
Pro
lin
e co
nte
nt
(µm
ol
g-1
)
A
H1 H2 H1 H2 H1 H2100% 70% 40%
0
20
40
60
80
mnjk
ghe
d
a
nkl
efhi
efd
o no
ijgh
el
b
om lm
jkfg
de
Control MR17 MS1 MG9
Field capacity levels
Mel
an
ald
ehy
de
con
ten
t
(µ
mo
l g
-1)
b
B
H1 H2 H1 H2 H1 H2100% 70% 40%
0
20
40
60
80
100
cd
efg
hij
l
bc
e
gh
j
a
d
fg g
k
a
c
ef
ghij
Control MR17 MS1 MG9
Field capacity levels
G
rain
yie
ld (g
pot
-1)
C
Fig. 4.19. Effect of drought tolerant CA containing endophytic bacteria on proline content (A), melanaldehyde content (B) and grain yield (C) in both maize hybrids at different field capacity levels
112
![Page 133: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/133.jpg)
4.5.2.13. Colonization of plant tissues
The data present in figure. 4.20 showed that colonization efficiency of Gus
labelled drought tolerant CA containing endophytic bacterial isolates (MR17, MS1, MG9)
decreased from root to leaf tissues in both maize hybrids under non-stressed as well as
stressed conditions, although, colonization was slightly greater for drought tolerant hybrid
(H1) than sensitive (H1). Furthermore, colonization efficiency by isolates decreased with
increasing stress i.e. mild (70% FC) and severe (40% FC) water stress compared to
normal growth condition (100% FC). Maximum CFU was detected in root tissues with
isolate MR17 and MG9 for H1 than H2 under non-stressed as well as stressed conditions.
Isolate MR17 efficiently colonized the shoot tissue followed by MS1 and MG9 in H1
under different water regimes (100, 70 and 40% FC). On the other hand, all the three
isolates showed similar response for colonizing the shoot tissues except for MG9 which
showed highest CFU at 40% FC. Smaller CFU of isolates was found in leaf tissues of
both hybrids. Among the isolates, isolate MG9 efficiently colonized the leaf tissue of H1
than H2 at 100, 70 and 40% FC.
4.5.2.14. Characterization of selected bacterial isolates for IAA production under
normal and stressed conditions
The results regarding IAA production by drought tolerant CA containing
endophytic bacterial isolates (MR17, MS1 and MG9) showed that IAA production
increased with increasing time in the presence of L-TRP under non-stressed as well as
PEG-6000 induced water deficit stress (Fig. 4.21). Maximum IAA synthesis was
observed at day 3. All the isolates (MR17, MS1and MG9) enhanced the IAA synthesis
under normal growth conditions and PEG-6000 induced water deficit stress with L-TRP.
Highest 1AA production was observed with isolate MG9 in the presence of substrate (L-
TRP) followed by L-TRP+ PEG, without PEG and PEG at day 3. Isolate MS1also
showed maximum IAA production at day 3 in the presence of substrate (L-TRP).
4.5.1.15. Characterization of selected bacterial isolates for P solubilization under
normal and stressed conditions
Drought tolerant CA containing endophytic bacterial isolates interestingly
enhanced P-solubilization under PEG-induced water deficit stress (Fig. 4.22). Isolates
MG9 and MR17 showed higher P- solubilization under stressed conditions than non-
stressed conditions at day 6 and 7, indicating the ability of isolates to solubilize P under
113
![Page 134: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/134.jpg)
100% 70% 40% 100% 70% 40%H1 H2
0E+00
1E+05
2E+05
3E+05
4E+05
5E+05
6E+05
7E+05
8E+05
9E+05 MR17 MS1 MG9
Root tissues
CF
U/g
fre
sh b
iom
ass
A
100% 70% 40% 100% 70% 40%H1 H2
0E+00
1E+03
2E+03
3E+03
4E+03
5E+03
6E+03
7E+03
8E+03 MR17 MS1 MG9
Shoot tissues
CF
U/g
fre
sh b
iom
ass
B
100% 70% 40% 100% 70% 40%H1 H2
0E+00
1E+03
2E+03
MR17 MS1 MG9
Leaf tissues
CF
U/g
fres
h bi
omas
s
C
Fig. 4.20. Colonization of root (A), shoot (B) and leaf (C) tissues with drought tolerant CA containing endophytic bacteria in both maize hybrids at different field capacity levels
114
![Page 135: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/135.jpg)
MR17
1 2 3 4 5 60
10
20
30
40
50
60
70Growth in L-TRP Growth without L-TRP PEG+L-TRP
PEG+without L-TRP
Days
IAA
pro
du
ctio
n (
μg
mL
-1)
MS1
1 2 3 4 5 60
5
10
15
20
25
30
35Growth in L-TRP Growth without L-TRP PEG+L-TRPPEG+without L-TRP
Days
IAA
pro
duc
tio
n (
μg
mL
-1)
MG9
1 2 3 4 5 60
5
10
15
20
25
30
35
40Growth in L-TRP Growth without L-TRP PEG+L-TRPPEG+without L-TRP
Days
IAA
pro
duc
tion
(μg
mL
-1)
Fig. 4.21. IAA production of drought tolerant CA containing endophytic bacterial isolates with reference to time
115
![Page 136: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/136.jpg)
1 2 3 4 5 6 70
20
40
60
80
100
NBRIPNBRIP+PEG
Days
Tri
calc
ium
pho
spha
te s
olub
iliz
atio
n (µ
g/m
l)
MR17
1 2 3 4 5 6 70
20
40
60
80
100
NBRIPNBRIP+PEG
Days
Tri
calc
ium
pho
spha
te so
lubi
lizat
ion
(µg/
ml)
MS1
1 2 3 4 5 6 70
20
40
60
80
100
NBRIP
NBRIP+PEG
Days
Tri
calc
ium
pho
spha
te so
lubi
lizat
ion
(µg/
ml)
MG9
Fig. 4.22. P-solubilization of drought tolerant CA containing endophytic bacterial isolates with reference to time
116
![Page 137: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/137.jpg)
4.6. Evaluation of selected endophytic bacterial isolates in field trial
Selected drought tolerant CA containing endophytic bacterial isolates (WR2,
WS11 and WL19 for wheat while MR17, MS1 and MG9 for maize) showed different
response for improving wheat (Uqab-2000) and maize (H2) growth under field condition.
Results are described as below.
4.6.1. Evaluation of selected endophytic bacterial isolates for wheat
4.6.1.1. Number of tillers
Inoculation of drought tolerant CA containing endophytic bacterial isolates (WR2,
WS11 and WL19) significantly improved number of tillers compared to uninoculated
control, under normal growth conditions and where water deficit stress was imposed by
holding irrigation at different development stages viz tillering, flowering and grain filling
(Fig. 4.23A). Withdrawal of irrigation at tillering significantly reduced the number of
tillers; however, isolate WL19 showed considerable increase (14.3%) in number of tillers
at tillering. On the other hand, isolate WR2 and WS11 performed better where water
deficit stress was imposed at flowering by holding irrigation. Moreover, isolate WL19
showed 13% increase in comparison with control (un-inoculated) plant under stressed
conditions where irrigation was hold on grain filling.
4.6.1.2. Carbonic anhydrase activity
Carbonic anhydrase activity in the leaves significantly enhanced with isolate
WL19 under non-stressed and stressed conditions where irrigation was hold on either
tillering, flowering or during grain filling phase (Fig. 4.23B). A considerable increase of
26.6 and 32.7% was observed with isolate WL19 where water deficit conditions were
imposed by cut-off irrigations at tillering or grain filling. However, isolate WS11 showed
pronounced enhancement in CA activity compared to uninoculated plants, where water
stress was induced at flowering.
4.6.1.3. Photosynthetic rate
Under field conditions, photosynthetic rate was markedly influenced when cutoff
the irrigation either at tillering or grain filling phase (Fig. 4.23C). Inoculation with
endophytic bacterial isolates caused considerable increase in photosynthetic rate where
wheat plants were normally irrigated or stressed conditions were induced at various
development stages of wheat crop. However, WL19 inoculated plant showed pronounced
117
![Page 138: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/138.jpg)
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling200
270
340
410
480
e
j
gf
ab
i
decdc
hi
d d
a
gh
e
bc
Control WR2 WS11 WL19
Nu
mb
er o
f ti
ller
s (m
-2) A
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling0
1
2
3
4
5
6
c
ghi
k
b
ef ef
j
b
fg
cd
ij
a
cd de
hi
Control WR2 WS11 WL19
CA
aci
tiv
ty
(mo
l C
O2
Kg
-1 l
eaf
FM
s-1
)
B
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling0
5
10
15
20
25
c
hg
j
b
gef
i
b
g
cd
i
a
fde
h
Control WR2 WS11 WL19
Pho
tosy
nthe
tic
rate
(μm
ol C
O2
m-2
s-1
)
C
Fig.4.23. Effect of drought tolerant CA containing endophytic bacteria on number of tillers (A), carbonic anhydrase activity (B) and photosynthetic rate (C) of wheat under water deficit stress
118
![Page 139: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/139.jpg)
increase in photosynthetic rate.
4.6.1.4. Transpiration rate
A considerable decline in transpiration rate was detected when water deficit stress
was applied by holding the irrigation at grain filling phase in comparison with unstressed
and stressed plants (withdrawal of irrigation at tillering or flowering) (Fig 4.24A).
However, inoculation of isolate WL19 improved the transpiration rate by 14.9% when
irrigation was cutoff at flowering and by 17.2% when water deficit stress was induced by
holding the irrigation at grain filling. Inoculation of isolates caused pronounced increase
in transpiration rate when stress was imposed by withdrawing the irrigation at tillering
compared to control plants.
4.6.1.5. Water use efficiency (WUE)
Reduced irrigation either at tillering, flowering or during grain filling phase
lowered the WUE with respect to plants raised under non-stressed growth conditions (Fig.
4.24B). However, minimum value of WUE was observed where irrigation was
withdrawal at tillering or cutoff at grain filling. Inoculation with drought tolerant
endophytic bacterial isolates did not show any significance difference for facilitating the
WUE under non-stressed and stressed conditions.
4.6.1.6. Grain yield
Grain yield declined significantly under stressed conditions when water deficit
stress was simulated at different development phases of wheat by withholding the
irrigation (Fig. 4.24C). However, inoculation with drought tolerant CA containing
endophytic bacterial isolates improved the grain yield under non-stressed as well as
stressed conditions (Skipping irrigation at tillering, flowering or grain filling). Under
normal condition, isolate WL19 showed significant increase in comparison with
uninoculated control plants. Moreover, isolate WL19 and WS11 also caused significant
improvement in grain yield where water deficit conditions were induced by withholding
irrigation at tillering or flowering compared to uninoculated control plants. However,
isolate WL19 showed 30% increase in comparison with control when cutoff irrigation at
grain filling.
119
![Page 140: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/140.jpg)
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling3
5
7
9
f
cde
i
e
bc
h
d
b b
g
d
ab
f
Control WR2 WS11 WL19
Tra
nsp
ira
tio
n r
ate
(mm
ol
H2
O m
-2 s
-1)
A
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling1.00
2.00
3.00
4.00
b
g
d
fg
a
e-g
c
ef
b
fg
c
e-g
a
e
cd
e
Control WR2 WS11 WL19
Wat
er u
se e
ffic
ienc
y (A
/E) B
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling0
1
2
3
4
5
c-e
hi f-ii
b
e-hde
e-g
bc
c-ebc
g-i
a
de
b-d
ef
Control WR2 WS11 WL19
Gra
in Y
ield
(M
g h
a-1
) C
Fig. 4.24. Effect of drought tolerant CA containing endophytic bacteria on transpiration rate (A), water use efficiency (B) and grain yield (C) of wheat under water deficit stress
120
![Page 141: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/141.jpg)
4.6.1.7. Catalase contents
A significant increase in catalase content was detected when water deficit stress
was induced by holding the irrigation at tillering stage or grain filling compared to
unstressed and stressed plants (irrigation skipped at flowering) (Fig 4.25A). However,
inoculation of isolate WL19 decreased the catalase when irrigation skipped at tillering
and when stress was induced by holding the irrigation during grain filling. Moreover,
inoculation of isolate WL19 also gave significant decrease in catalase content when
irrigation was stopped at flowering compared to uninoculated control plants.
4.6.1.8. Ascorbate peroxidase (APX) contents
Reduced irrigation either at tillering, flowering or during grain filling phases
increased the amount of ascorbate peroxidase with respect to plants raised under non-
stressed conditions (Fig 4.25B). Inoculation with endophytic bacterial isolates
significantly reduced ascorbate peroxidase compared to uninoculated control when plant
grown under normal growth conditions as well as stressed conditions. All the three
isolates (WR2, WS11 and WL19) reduced the ascorbate peroxidase content where
irrigation skipped at development phases (tillering or grain filling). However, significant
decrease in ascorbate peroxidase content was observed with isolate WL19 by reduced
irrigation at flowering stage compered to uninoculated control plants.
4.6.1.9. Glutathione reductase (GR) contents
Glutathione reductase contents were significantly increased under stressed
environment when water deficit stress was inuced at various phases viz tillering,
flowering or grain filling by withholding the irrigation (Fig. 4.25C). However, inoculation
with drought tolerant CA containing endophytic bacterial isolates reduced the glutathione
reductase content under stressed conditions (skipping irrigation either at tillering,
flowering or during grain filling with respect to uninoculated controls). Under normal
condition, inoculation did not give any significant decrease compared to uninoculated
control plants. However, inoculation of isolates WL19 and WS11 caused significant
reduction in glutathione reductase where water deficit conditions were induced by
withholding irrigation at tillering and flowering stage compared to uninoculated control
plants. However, isolate WS11showed significant decrease in comparison with control
when reduced the irrigation at grain filling.
121
![Page 142: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/142.jpg)
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling20
40
60
80
100
120
140
160
f
d
gh
a
fg
e
hi
bc
j
e
ij
ab
h
e
j
cd
Control WR2 WS11 WL19C
ata
lase
(µM
H2
O2
min
-1 m
g-1
pro
tein
)
A
Norm
al ...
Skip
ped
...
Skip
ped
...
Skip
ped
a...100
200
300
400
500
600
f
bc
a
g
c
d
b
h
cd
b
gh
c
e
b
Control WR2 WS11 WL19
Asc
orb
ate
Per
ox
ida
se(µ
M a
sco
rba
te m
in-1
mg
-1 p
rote
in) B
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling20
40
60
80
100
h
a
g
bc
hi
b
i
cd
h
f
h
f
hi
de
j
ef
Control WR2 WS11 WL19
Glu
thio
ne r
educ
tase
(µM
TN
B m
in-1
mg
-1 p
rote
in) C
Fig. 4.25. Effect of drought tolerant CA containing endophytic bacteria on catalase (A), ascorbate peroxidase (B) and glutathione reductase (C) of wheat under water deficit stress
122
![Page 143: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/143.jpg)
4.6.1.10. Total protein contents
Inoculation of drought tolerant CA containing endophytic bacterial isolates (WR2,
WS11 and WL19) significantly improved total protein contents compared to uninoculated
control, where water deficit stress was imposed by holding the irrigation at various
development stages (Fig. 4.26A). Withdrawal of irrigation at tillering or grain filling,
significantly reduced the total protein, however, inoculation of isolates (WR2, WS11 and
WL19) showed marked increase in total protein contents. On the other hand, isolate WR2
and WS11 performed better where water deficit stress was imposed at flowering by
skipping irrigation. Isolates depicted the pronounced increase incomparison to
uninoculated control plant under normal conditions
4.6.1.11. Total soluble sugars
Drought tolerant CA containing endophytic bacterial isolates improved total
soluble sugars in contrast to uninoculated control, where water deficit stress was imposed
by holding the irrigation at various development phases of wheat (Fig. 4.26B).
Withdrawal of irrigation at tillering or grain filling significantly reduced the total soluble
sugars, however, inoculation of isolates showed significant increase in total soluble
sugars. Under normal conditions and water deficit stress condition during flowering,
isolates also showed considerable increase compared to uninoculated control plant.
4.6.1.12. Total phenolic contents
Data regarding total phenolics showed that phenolic contents increased under
stressed conditions (holding the irrigation at tillering or grain filling) but inoculation of
drought tolerant CA containing endophytic bacterial isolates (WR2, WS11 and WL19)
significantly reduced total phenolics compared to uninoculated control, where water
deficit stress was imposed by holding the irrigation at tillering, flowering and grain filling
(Fig. 4.26C). Minimum phenolic contents were observed where plants were grown under
normal growth conditions and stress was imposed at flowering. Inoculation of isolate
WL19 caused marked decrease in phenolic contents where holding the irrigation during
tillering, flowering or grain filling.
123
![Page 144: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/144.jpg)
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling20
40
60
80
100
d
i
e
h
c
gh
b
f
a
f
b
g
b
h
d
f
Control WR2 WS11 WL19
To
tal
pro
tein
(u
g g
-1)
A
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling0
1
2
3
4
5
b
h
e
i
ab
ee
h
a
f
c
g
a
e
d
g
Control WR2 WS11 WL19
To
tal
solu
ble
su
ga
rs
(u
g g
-1)
B
Normal irrigation Skipped at tillering Skipped at flowering Skipped at grain filling100
150
200
250
300
350
400
g
c
a
d
hi
e
c
g
ij
ef
b
fg
j
g
d
h
Control WR2 WS11 WL19
To
tal
ph
en
oli
cs
(ug
g-1
)
C
Fig. 4.26. Effect of drought tolerant CA containing endophytic bacteria on total protein (A), total soluble sugars (B) and total phenolic content (C) of wheat under water deficit stress
124
![Page 145: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/145.jpg)
4.6.1.13. Grain nitrogen (%)
A significant reduction in nitrogen content was recorded when water deficit stress
was applied by holding the irrigation at tillering or grain filling in comparison with
unstressed and stressed plants (irrigation skipped at flowering) (Fig 4.27A). However,
inoculation of isolates WR2 and WL19 improved the grain nitrogen when cutoff the
irrigation during tillering or grain filling. Inoculation of isolate WL19 gave significant
increase in grain nitrogen where watering was stopped at grain filling compared to
uninoculated control plants.
4.6.1.14. Grain phosphorus (%)
Reduced irrigation during various developmental stages lowered grain phosphorus
with respect to plants raised under non-stressed growth conditions (Fig. 4.27B). However,
inoculation with drought tolerant CA containing endophytic bacterial isolates improved
grain phosphorus compared to control plants under normal as well as reduced irrigation at
different developmental phases. Moreover, inoculation of isolates performed statistically
similar for increasing the grain phosphorus when holding the irrigation during grain
filling.
4.6.1.15. Grain potassium (%)
Grain potassium decreased significantly when water deficit stress was mediated
during tillering, flowering or grain filling phases of wheat by withholding the irrigation
(Fig. 4.27C). However, inoculation with drought tolerant CA containing endophytic
bacterial isolates improved the grain potassium content under stressed conditions
(skipping irrigation at different developmental stages). Under normal condition,
inoculation of isolates WS11 and WL19 showed marked increase in grain potassium in
comparion to respective uninoculated control plants. In the same way, isolate WR2,
WS11 and WL19 also caused significant increase in grain potassium where water deficit
conditions were induced by holding the irrigation during tillering or grain filling in
comparison with uninoculated control plants. Isolate WL19 also showed significant
increase in grain potassium content in contrast to respective non-inoculated control plant
where cutoff the irrigation at flowering.
125
![Page 146: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/146.jpg)
Nor
mal
i...
Skip
ped at..
.
Skip
ped a...
Skip
ped at .
..0.5
1
1.5
2
2.5
c
hi
fg
i
b
g
cd
gh
b
e de
fg
a
ef
bc
fg
Control WR2 WS11 WL19
Gra
in n
itro
gen
(%
)
A
Nor
mal
i...
Skip
ped
a...
Skip
ped
a...
Skip
ped
at ...
0.1
0.2
0.3
0.4
0.5
0.6
0.7
d
hi i
k
b
efg
j
c
fg fg
j
a
f f
j
Control WR2 WS11 WL19
Gra
in P
ho
sph
oru
s (%
)
B
Norm
al...
Skip
ped...
Skip
ped.
..
Skip
ped ...0.1
0.15
0.2
0.25
0.3
0.35
b-d
hi
fg
i
b
gh
c-e
gh
a
gh
d-f
hi
a
e-g
bc
g
Control WR2 WS11 WL19
Gra
in p
ota
ssiu
m (
%)
C
Fig. 4.27. Effect of drought tolerant CA containing endophytic bacteria on grain nitrogen (A), phosphorus (B) and potassium (C) of wheat under water deficit stress
126
![Page 147: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/147.jpg)
4.6.2. Evaluation of selected endophytic bacterial isolates for maize
4.6.2.1. Number of grains per cob
A marked enhancement in the number (No.) of grains was observed by the
inoculation of drought tolerant CA containing endophytic bacterial isolates (MR17, MS1
and MG9) compared to uninoculated control plants in the presence of water deficit stress
condition which was imposed by holding irrigation at vegetative stage (Fig. 4.28A).
Inoculation with isolate MG9 improved the grain per cob by 27.2% when cutoff the
irrigation at vegetative stage and by 26.8% when stressed conditions were induced by
holding the irrigation at reproductive stage compared to respective uninoculated control
plants. Inoculation of isolate MG9 gave marked increase in grains also where plants were
normally irrigated compared to non-inoculated control plants.
4.6.2.2. Carbonic anhydrase activity
Inoculation improved the CA activity under non-stressed and stressed conditions
(skipped irrigation at vegetative stage or reproductive stage) in comaprison with
respective controls (Fig. 4.28B). However, overall marked reduction in CA activity was
observed when irrigation skipped at reproductive stage. Under normal condition, all the
endophytic bacterial isolates showed marked increase in comparison with respective
uninoculated control plants. In the same way, all the isolates also showed marked increase
in CA activity under stressed conditions. Isolate MG9 caused significant improvement
(25.1%) in CA activity where water deficit conditions were induced by withholding
irrigation at vegetative and 34.2% at reproductive stage compared to non-inoculated
control plants.
4.6.2.3. Photosynthetic rate
Water deficit conditions had strong effect on CA activity and photosynthesis.
Photosynthetic rate decreased under water deficit conditions (where holding the irrigation
at vegetative stage or reproductive stage). Nevertheless, inoculation with isolate MG9
significantly enhanced photosynthetic rate under non-stressed as well as stressed
conditions where irrigation was skipped at vegetative or reproductive stage (Fig. 4.28C).
A considerable increase of 23.7% was observed with isolate MG9 where water deficit
conditions were imposed by holding irrigation at reproductive stage. On the other hand,
all the isolates showed significant increase in
127
![Page 148: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/148.jpg)
Normal irrigation Skipped at vegetative stage
Skipped at reproductive stage
100
200
300
400
500
c-ef-h
j
c cd
ef
c
c-eij
a
b
c-e
Control MR17 MS1 MG9
( N
um
ber o
f g
ra
ins
per c
ob
)
A
Normal irrigation Skipped at vegetative stage
Skipped at reproductive stage
0
2
4
6
8
ce
h
b
d
ef
b
d
g
a
c
f
Control MR17 MS1 MG9
Ca
rb
on
ic a
nh
yd
ra
se a
cit
ivty
(mo
l C
O2
kg
-1 l
ea
f fw
s-1
)
B
Normal irrigation Skipped at vegetative stage Skipped at reproductive stage
0
5
10
15
20
25
30
35
40
c-e
gh
k
b
ef
j
bcc-e
j
a
d-e
g-i
Control MR17 MS1 MG9
Ph
oto
syn
thet
ic r
ate
(μm
ol
CO
2 m
-2 s
-1)
C
Fig. 4.28. Effect of drought tolerant CA containing endophytic bacteria on no. of grains per cob (A), carbonic anhydrase activity (B) and photosynthetic rate (C) of maize under water deficit stress
128
![Page 149: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/149.jpg)
photosynthesis in comparison with respective uninoculated control plants, where
withdrawaing the irrigation at vegetative stage. Under normal condition, isolates MG9
and MR17 showed significant increase in comparison with respective uninoculated
control plants.
4.6.2.4. Transpiration rate
Inoculation with drought tolerant CA containing endophytic bacterial isolates
significantly improved transpiration rate compared to uninoculated control, where water
deficit stress was imposed by holding the irrigation during vegetative or reproductive
stage (Fig. 4.29A). Irrigation withdrawal at reproductive stage significantly reduced the
transpiration rate; however, isolate MS1 and MG9 showed pronounced increase in
transpiration rate. Under normal conditions and water deficit stress condition during
vegetative stage, all the endophytic bacterial isolates showed considerable enhancement
in transpiration rate compared to control (uninoculated) plant.
4.6.2.5. Water use efficiency (WUE)
Water stress at vegetative or reproductive stage significantly reduced the water
used efficiency as shown in figure 4.29B. Inoculation of drought tolerant CA containing
endophytic bacterial isolates did not show any statistically significant difference for
facilitating the WUE under non-stressed as well as stressed conditions where water deficit
stress was imposed by cutoff the irrigation during vegetative or reproductive stage.
However, inoculation of isolate MG9 showed maximum increase in WUE under normal
condition with respect to non-inoculated control plant.
4.6.2.6. Grain yield
Grain yield was considerably decreased under skipped irrigation at vegetative and
reproductive stage (Fig. 4.29C). However, inoculation with drought tolerant CA
containing endophytic bacterial isolates (MR17, MS1and MG9) improved the grain yield
under non-stressed and stressed conditions (vegetative and reproductive stage). Under
normal condition, isolate MG9 showed significant increase in comparison with respective
uninoculated control plants. Similarly, isolate MG9 caused significant enhancement
(32.6%) in grain yield where water deficit conditions were induced by holding irrigation
at reproductive stage compared to uninoculated control plants. All the isolates did not
show any significant differences where irrigation was withhold at vegetative stage
although they did increase the grain yield with respect to their non-inoculated control.
129
![Page 150: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/150.jpg)
Normal irrigation Skipped at vegetative stage Skipped at reproductive stage
0
2
4
6
8
10
12
c-fgh
l
ab
ce
k
abc
j
a
c-f
g-i
Control MR17 MS1 MG9
Tra
nsp
ira
tio
n r
ate
(mm
ol
H2
O m
-2 s
-1)
A
Normal irrigation Skipped at vegetative stage
Skipped at reproductive stage
2
3
4
5
bc-e
ef
abb-d
de
b bc
g
abc
e-g
Control MR17 MS1 MG9
Wa
ter
use
eff
icie
ncy
(A
/E)
B
Normal irrigation Skipped at vegetative stage Skipped at reproductive stage0
3
6
9
13
c
e
g
ab
c
e
bc
f
a
c
e
Control MR17 MS1 MG9
( Gra
in y
ield
( to
ns h
a-1)
C
Fig. 4.29. Effect of drought tolerant CA containing endophytic bacteria on transpiration rate (A), water use efficiency (B) and grain yield (C) of maize under water deficit stress
130
![Page 151: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/151.jpg)
4.6.2.7. Catalase contents
A marked decrease in catalase was observed by the inoculation of drought tolerant
CA containing endophytic bacterial isolates (MR17, MS1and MG9) in the presence of
water deficit stress conditions which were imposed by holding the irrigation at both
developmental stages (vegetative or reproductive) compared to unstressed (Fig. 4.30A).
Inoculation with isolate MG9 resulted in decrease in amount of catalase when holding the
irrigation at vegetative stage and when water stressed conditions were induced by cutoff
the irrigation at reproductive stage in comparison with respective uninoculated control
plants. Inoculation with isolates did not give significant decrease where plants were
normally irrigated compared to uninoculated control plants.
4.6.2.8. Ascorbate peroxidase (APX) contents
Change in ascorbate peroxidase content was detected under water deficit
conditions by skipping irrigation at vegetative stage and reproductive stage (Fig. 4.30B).
However, marked increase in ascorbate peroxidase was observed when irrigation skipped
at reproductive stage. Inoculation with drought tolerant CA containing endophytic
bacterial isolates reduced the ascorbate peroxidase under non-stressed and stressed
conditions (skipping irrigation at vegetative and reproductive stage). Under normal
condition, isolate MS1 did not show significant decrease compared to respective
uninoculated control plants. However, isolate MS1 and MG9 caused significant reduction
in ascorbate peroxidase content where water deficit conditions were induced by
withholding irrigation at vegetative and at reproductive stage compared to uninoculated
control plants.
4.6.2.9. Glutathione reductase (GR) contents
Water deficit conditions had strong effect on glutathione reductase. Glutathione
reductase increased under water deficit conditions where irrigation was withhold at
vegetative or reproductive stage. However, glutathione reductase was significantly
reduced with isolate MG9 under non-stressed and stressed conditions where irrigation
was skipped at vegetative or reproductive stage (Fig. 4.30C). A considerable decrease in
GR content was recorded with isolate MR17 and MG9 where water deficit conditions
were imposed by holding irrigation at reproductive stage.
131
![Page 152: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/152.jpg)
Normal irrigation Skipped at vegetative stage
Skipped at reproductive stage
50
100
150
de
c
a
de
d
c
de
d
b
e
d
c
Control MR17 MS1 MG9
Ca
tala
se
(µ
M H
2O
2 m
in-1
mg
--1
pro
tein
)
A
Normal irrigation Skipped at vegetative stage
Skipped at reproductive stage
20
40
60
80
100
120
e
bc
a
f
d
b
ef
d
c
f
d
c
Control MR17 MS1 MG9
Asc
orb
ate
pero
xid
ase
(µ
M a
sco
rb
ate
min
-1 m
g-1
pro
tein
)
B
Normal irrigation Skipped at vegetative stage
Skipped at reproductive stage
30.00
60.00
90.00
120.00
e
c
a
ef
dc
ef
d
b
f
d
c
Control MR17 MS1 MG9
Glu
tath
ion
e r
ed
ucta
se
(µ
M T
NB
min
-1 m
g-1
pro
tein
)
C
Fig. 4.30. Effect of drought tolerant CA containing endophytic bacteria on catalase (A), ascorbate peroxidase (B) and glutathione reductase (C) content of maize under water deficit stress
132
![Page 153: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/153.jpg)
4.6.2.10. Total protein contents
Inoculation with drought tolerant CA containing endophytic bacterial isolates
significantly improved total protein contents compared to uninoculated control under
normal as well as water deficit stress generated by withholding irrigation at vegetative or
reproductive stage (Fig. 4.31A). Irrigation withdrawal at reproductive stage, significantly
reduced the total protein, however, isolate MG9 showed significant increase in total
protein. Under non-stressed and water deficit stress conditions during vegetative stage
isolate MG9 showed considerable increase in comparison with uninoculated control plant.
Moreover, isolates MR17 and MS1 also performed better where plants were normally
irrigated and water deficit stress conditions imposed by holding irrigation at vegetative
stage in comparison with respective control plants.
4.6.2.11. Total soluble sugars
Inoculation caused significant difference in total soluble sugars under water deficit
conditions where water deficit stress was induced by withholding irrigation at
developmental stages (vegetative, reproductive) (Fig. 4.31B). Water deficit conditions at
vegetative and reproductive phases enhanced the total soluble sugars with respect to
plants raised under non-stressed conditions. However, inoculation with isolates also
enhanced total soluble sugars under stressed conditions by withholding irrigation at
vegetative as well as reproductive stage.
4.6.2.12 Total phenolic contents
Total phenolics were considerably increased under skipped irrigation at
developmental stages (vegetative and reproductive) (Fig. 4.31C). However, inoculation
with drought tolerant CA containing endophytic bacterial isolates (MR17, MS1or MG9)
decreased the total phenolics under non-stressed as well as stressed conditions (vegetative
or reproductive phases).Under normal condition, isolates did not show significant
decrease compared to respective control (uninoculated) plants. Contrarily, isolate MG9
caused significant reduction in total phenolics where water deficit conditions were
induced by withholding irrigation at reproductive stage compared to uninoculated control
plants. Moreover, all the isolates performed statistically similar where irrigation was
withhold at vegetative stage although isolate did decrease the total phenolics compared to
uninoculated control.
133
![Page 154: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/154.jpg)
Normal irrigation Skipped at vegetative stage Skipped at reproductive stage
0
20
40
60
80
d
g
j
c
f
i
b
e
i
a
e
h
Control MR17 MS1 MG9
To
tal
Pro
tein
(u
g g
-1) A
Normal irrigation Skipped at vegetative stage
Skipped at reproductive stage
0.00
0.50
1.00
1.50
2.00
2.50
h
fg
d
gh
ef
b
g
dec
g
d
a
Control MR17 MS1 MG9
To
tal
So
lub
le s
ug
ars
(u
g g
-1)
B
Normal irrigation Skipped at vegetative stage Skipped at reproductive stage
30
50
70
90
110
130
150
e
bc
a
e
d
b
e
d
b
e
d d
Control MR17 MS1 MG9
To
tal
ph
eno
lics
(u
g g
-1)
C
Fig. 4.31. Effect of drought tolerant CA containing endophytic bacteria total protein contents (A), total soluble sugars (B) and total phenolic contents (C) of maize under water deficit stress
134
![Page 155: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/155.jpg)
4.6.2.13. Grain nitrogen (%)
Statstically significant increase in grain nitrogen was recorded by the inoculation
of drought tolerant CA containing endophytic bacterial isolates (MR17, MS1 and MG9)
in the presence of water deficit stress conditions which was imposed by holding the
irrigation during vegetative or reproductive stage compared to unstressed conditions (Fig
4.32A). Inoculation of isolate MS1 improved the grain nitrogen by 19.3% when holding
the irrigation at vegetative stage and by 15.4% when stressed conditions were induced by
reducing irrigation at reproductive stage compared to respective uninoculated control
plants. Inoculation of isolates also gave marked increase in grain nitrogen where plants
were normally irrigated compared to uninoculated control plants.
4.6.2.14. Grain phosphorus (%)
Change in phosphorus content was observed under water deficit conditions by
skipping irrigation at vegetative stage and reproductive stage (Fig. 4.32B). However,
marked reduction in phosphorus content was observed when irrigation cutoff at
reproductive stage. Inoculation of drought tolerant CA containing endophytic bacterial
isolates improved the phosphorus content under non-stressed as well as stressed
conditions (skipping irrigation during vegetative or reproductive phases). Under normal
condition, isolates MG9 and MS1 showed significant increase compared to their
respective control (uninoculated) plants. Similarly, isolate MG9 also caused significant
improvement (12.2%) in grain phosphorus where water deficit conditions were induced
by withholding irrigation at vegetative and 16.5% at reproductive stage incomparison
with uninoculated control plants.
4.6.2.15. Grain potassium (%)
Water deficit conditions caused considerable reduction in grain potassium
concentration. Grain potassium content decreased with water deficit conditions. However,
inoculation with drought tolerant CA producing bacterial isolates improved its value but
remained statistically at par with non-inoculated control plants in improving the grain
potassium content under normal as well as stressed conditions where holding irrigation at
developmental stages (vegetative or reproductive) (Fig.4.32C). A considerable increase
was observed with isolate MG9 where water deficit conditions were imposed by holding
irrigation at reproductive stage.
135
![Page 156: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/156.jpg)
Norm
al ir
riga
tion
Skip
ped
at v
eget
ativ
e stag
e
Skip
ped
at re
prod
uctive
sta
ge
1
1.5
2
2.5
3
3.5
d
h hi
c
g cd
b
ef-g
a
eff-g
Control MR17 MS1 MG9
Gra
in n
itro
gen
(%
)
A
Norm
al ir
rigat
ion
Skip
ped
at v
eget
ativ
e stag
e
Skip
ped
at re
prod
uctiv
e stag
e
0
0.2
0.4
0.6
0.8
cf
i
bde
g
b
e
h
a
cd
g
Control MR17 MS1 MG9
Gra
in p
ho
sph
oru
s(%
)
B
Normal irrigation Skipped at vegetative stage
Skipped at reproductive stage
0.5
1
1.5
2
bc
ef
h
a
de
g
ab
e
g
a
cd
fg
Control MR17 MS1 MG9
Gra
in p
ota
ssiu
m(%
)
C
Fig. 4.32. Effect of drought tolerant CA containing endophytic bacteria on grain nitrogen (A), phosphorus (B) and potassium (C) of maize under water deficit stress
136
![Page 157: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/157.jpg)
4.7. Evaluation of potential endophytic bacterial isolates for gene expression in
Arabidopsis thaliana under PEG-induced water deficit conditions
4.7.1. Screening of endophytic bacterial isolates based on drought tolerance ability,
CA activity and plant growth promotion
One hundred and fifty morphotypes of endophytic bacteria were isolated from
Arabidopsis thaliana and screened for PEG-induced water deficit stress as well as CA
activity at Plant Microbe Interaction Laboratory, The University of Queensland,
Australia. Ten drought tolerant and CA containing endophytic bacterial isolates were
screened for plant growth promotion (data are not shown here). Two drought tolerant CA
producing plant growth facilitating isolates were selected for plant growth promotion and
gene expression study.
4.7.2. Effect of endophytic bacterial isolates on plant growth of Arabidopsis thaliana
4.7.2.1. Root length
Under PEG-induced water deficit conditions, root growth of Arabidopsis thaliana
was decreased significantly compared to uninoculated control plants (Fig. 4.33A).
However, inoculation with drought tolerant CA containing endophytic bacterial isolates
(AR4 and AR14) improved the root length under normal (0% PEG) as well as stressed
conditions (3% PEG). Significant increase of 30.7% was observed with isolate AR4 under
PEG-mediated stress conditions compared to uninoculated control plants.
4.7.2.2. Number of lateral roots
Number of lateral roots was significantly higher in plant inoculated with AR4 and
AR14 than the non-inoculated control plants under normal (0%) as well as PEG induced
water deficit conditions (3%) (Fig. 4.33B). A positive effect on no. of laterals roots (30.6
and 58.2%) were observed in plants inoculated with isolate AR14 compared to non-
inoculated plants under normal as well as stressed conditions.
4.7.2.3. Root fresh weight
Inoculation with drought tolerant CA containing endophytic bacterial isolates
improved the root fresh weight under normal (0% PEG) as well as stressed conditions
(3% PEG) (Fig. 4.33C). Inoculated plants showed 24.9 and 36.9% increase over control
plants under normal conditions. Under PEG-induced water deficit conditions, root fresh
weight was considerably increased in inoculated plants compared to uninoculated control
137
![Page 158: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/158.jpg)
Picture 14: Effect of drought tolerant CA containing endophytic bacteria on Arabidopsis thaliana growth under normal conditions
Picture 15: Effect of drought tolerant CA containing endophytic bacteria on Arabidopsis thaliana growth under PEG-induced water deficit conditions
138
Control AR14
Control AR4
![Page 159: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/159.jpg)
Control AR4 AR140
1
2
3
4
5
6
7
8
90% PEG 3% PEG
Endophytic bacteria
Root
length
(cm)
A
Control AR4 AR140
1
2
3
4
5
6
7
8
9
100% PEG 3% PEG
Endophytic bacteria
Root f
resh w
eight (
mg)
C
Control AR4 AR140
5
10
15
20
250% PEG 3% PEG
Endophytic bacteria
Numb
er of l
ateral
roots
B
Control AR4 AR140
5
10
15
20
25
30
0% PEG 3% PEG
Endophytic bacteria
Shoo
t fresh
weigh
t (mg)
D
Fig. 4.33. Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on root length (A) number of lateral roots (B), root fresh weight (C) and shoot fresh weight (D) in Arabidopsis thaliana under normal (0%) as well as PEG-mediated water deficit conditions (3%)
139
![Page 160: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/160.jpg)
plants. Root fresh weight was increased by 75.7% in arabidopsis plants treated with AR14
on exposure to PEG-6000 induced water deficit stress.
4.7.2.4. Shoot fresh weight
Shoot fresh weight of Arbaidopsis thaliana decreased significantly under stressed
environment (Fig. 4.33D). However, inoculation of drought tolerant CA containing
endophytic bacterial isolates (AR4, AR14) facilitated the shoot fresh weight compared to
non-inoculated control plants under non-stressed as well as stressed conditions. Plants
inoculated with isolate AR14 showed significant increase in shoot fresh weight under
PEG-induced water deficit stress compared to non-inoculated plants.
4.7.3. Effect of selected isolates on gene expression and transcriptional response of
Arabidopsis thaliana
4.7.3.1. Expression pattern of dehydration responsive protein (RD22)
To explore whether difference in drought tolerance could be due to RD 22,
expression of gene encoding RD22 was followed. Results showed that inoculation of
isolates (AR4 and AR14) modified the expression of RD22 under PEG-mediated water
deficit stress (Fig. 4.34 A). The expression level of RD22 was downregulated in plant
inoculated with isolates AR4 and AR14 under water stress (3% PEG) in comparison with
control.
4.7.3.2. Expression pattern of dehydration responsive element (RD29B)
The result regarding drought tolerance induced by RD29B showed that expression
of RD29B was enhanced by plant inoculated with isolates AR4 and AR14 compared to
control (uninoculated) plants under non-stressed (0%) as well as PEG-mediated water
stress (3%) (Fig.4. 34B). Overexpression of RD29B was detected with the inoculation of
AR4 compared to non-inoculated control after PEG treatment.
4.7.3.3. Expression pattern of late embryogenesis (LEA)
Overexpression of LEA protein was observed in both inoculated and non-
inoculated plant under PEG-imposed water deficit stress (Fig. 4.34C). The results of RT-
PCR analysis clearly showed increased expression of LEA in plant treated with AR4 and
AR14 compared to non-inoculated plants.
140
![Page 161: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/161.jpg)
Control AR4 AR140
2
4
60% PEG 3% PEG
Endophytic bacteria
Relat
ive fol
d chan
geRD22 A
Control AR4 AR140
400
800
1200
1600
20000% PEG 3% PEG
Endophytic bacteria
Relativ
e fold c
hange
LEA C
Control AR4 AR140
2
4
6
8 0% PEG 3% PEG
Endophytic bacteria
Relativ
e fold c
hange
RD29B B
Control AR4 AR140
20
40
60 0% PEG 3% PEG
Endophytic bacteria
Relativ
e fold c
hange
RAB18 D
Fig. 4.34. Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on stress responsive genes RD22 (A), RD29B (B), LEA (C) and RAB18 (D) in Arabidopsis thaliana under normal (0%) as well as PEG-mediated water deficit conditions (3%)
141
![Page 162: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/162.jpg)
4.7.3.4. Expression pattern of dehydrin (RAB18)
Expression level of representative gene RAB18 was the highest in inoculated plan
compared to uninoculated plants under PEG-mediated water deficit stress (Fig. 4.34D).
Dehydrin RAB18 also differently expressed in inoculated and non-inoculated plants
under normal condition.
4.7.3.5. Expression of dehydration-response element binding protein 2A (DREB2A)
In exposure to PEG induced water deficit conditions, transcripts level of DREB2A
enhanced in both inoculated as well as uninoculated control plants (Fig. 4.35A).
Inoculation with drought tolerant CA containing endophytic bacterial isolates modified
the expression of DREB2A. Increased transcript level was observed in Arabidopsis
thaliana plant inoculated with AR4 and AR14 compared to non-inoculated under PEG-
mediated water deficit condition.
4.7.3.6. Expression of defense related gene (PR1.2.)
Results regarding defense related gene showed that PR1.2. gene differentially
expressed when inoculated with bacterial isolates (AR4 and AR14) under non-stressed
growth conditions (Fig. 4.35B). Under PEG-mediated water deficit stress (3%),
expression level of PR1.2. was also upregulated in plant treated with isolates (AR4 and
AR14), however, effect was smaller under normal conditions.
4.7.3.7. Expression of WRKY57 transcription factors
The analysis of RT-PCR showed that WRKY57 gene was not differentially
expressed in control as well as in plant treated with drought tolerant CA containing
endophytic bacterial isolates (AR4 and AR14) under normal growth conditions as shown
in figure 4.35C. However, expression of drought responsive gene WRKY57 was down
regulated in plant treated with AR4 and AR14 in comparison with uninoculated control
plants under PEG- imposed water stressed conditions.
4.7.3.8. Expression of WRKY8 transcription factors
Under normal growth conditions (0% PEG), constitutive expression of WRKY8
transcription factors were upregulated by the inoculation of drought tolerant CA
producing endophytic bacterial isolates (AR4 and AR14) compared to control
(uninoculated) plants (Fig. 4.35D). In the same way, in exposure to water stressed
142
![Page 163: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/163.jpg)
Control AR4 AR140
50
100
1500% PEG 3% PEG
Endophytic bacteria
Relat
ive fo
ld cha
nge
DREB2A A
Control AR4 AR140
20
40
60
800% PEG 3% PEG
Endophytic bacteria
Relativ
e fold c
hange
WRKY 57 C
Control AR4 AR140
2
4
6
8
10 0% PEG 3% PEG
Endophytic bacteria
Relativ
e fold c
hange
PR1.2 B
Control AR4 AR140
5
10
15
20 0% PEG 3% PEG
Endophytic bacteria
Relativ
e fold c
hange
WRKY 8 D
Fig. 4.35. Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on DREB2A (A) PR1.2 (B) WRKY57 (C) and WRKY 8 (D) in Arabidopsis thaliana under normal (0%) as well as PEG-mediated water deficit conditions (3%)
143
![Page 164: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/164.jpg)
conditions, inoculation of isolates (AR4 and AR14) showed overexpression of WRKY8
in comparison with untreated plants.
4.7.3.9. Expression pattern of C2H2–Zinc finger protein (Zat 10)
Transcripts of Zat 10 were significantly deceased in plant assisted with AR14
compared to uninoculated control plants under normal growth conditions (0% PEG) (Fig.
4.36A). However, Zat 10 transcripts were elevated in leaves of non-inoculated control
plants on exposure to PEG-induced water deficit stress. Moreover, expression of Zat 10
was downregulated in plant inoculated with isolates (AR4 and AR14) and this effect was
more pronounced in plant treated with isolate AR4 under PEG-induced water deficit
stress (3%).
4.7.3.10. Expression pattern of dehydrins (COR47)
The result regarding drought tolerance induced by COR 47 showed that
expression level of COR47 dehydrins was enhanced in plant inoculated with AR4 and
AR14 compared to uninoculated control plants under non-stressed (0%) as well as PEG-
mediated water stress (3%) (Fig. 4.36B.). Overexpression of COR 47 was detected with
the inoculation of AR4 and AR14 compared to uninoculated control under water deficit
stress (3% PEG).
4.7.3.11. Expression of ethylene responsive transcription factor 7(AtERF 7)
The AtERF7 transcripts were accumulated in Arabidopsis thaliana leaves under
PEG- mediated water deficit stress (Fig. 4.36C). The AtERF 7 transcripts were induced
through dehydration in non-inoculated plants under PEG-6000 induced water deficit
stress (3%). Significant reduction in AtERF 7 transcripts was recorded in plant inoculated
with AR4 and AR14 compared to uninoculated control plants under PEG-induced water
deficit stress (3%). Moreover, inoculation with drought tolerant CA containing
endophytic bacterial isolates (AR4 and AR14) also downregulated the expression of
AtERF 7 under normal conditions.
4.7.3.12. Expression pattern of dehydrins (LTI78)
The expression of LT178 exposed to water deficit stress was evaluated by RT-
PCR, in the presence as well as absence of drought tolerant CA producing endophytic
144
![Page 165: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/165.jpg)
bacterial isolates. AR4 and AR14) (Fig. 4.36D). Under normal growth conditions (0%
PEG), constitutive expression of LTI78 dehydrins transcription factors remained similar
145
![Page 166: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/166.jpg)
Control AR4 AR140
2
4
6
8
10
12
14
16 0% PEG 3% PEG
Endophytic bacteria
Relat
ive fol
d chan
ge Zat 10
A
Control AR4 AR14
-20
-15
-10
-5
0
5
10
15
200% PEG 3% PEG
Endophytic bacteria
Relat
ive fol
d chan
ge
AtERF7C
146
![Page 167: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/167.jpg)
Control AR4 AR140
20
40
60 0% PEG 3% PEG
Endophytic bacteria
Relat
ive fol
d chan
ge
COR 47B
Control AR4 AR140
20
40
60
80
100 0% PEG 3% PEG
Endophytic bacteria
Relat
ive fo
ld cha
nge
LTI78D
Fig. 4.36. Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on transcription factors and gene Zat 10 (A), COR47 (B), AtERF7 (C) and LTI78 (D) in Arabidopsis thaliana under normal (0%) as well as PEG- mediated water deficit conditions (3%).
147
![Page 168: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/168.jpg)
for inoculated as well as uninoculated control plants. However, on exposure to water
stressed conditions imposed by PEG (3%), inoculation of AR14 showed overexpression
of LTI78 in comparison with untreated control plants.
4.7.3.13. Expression pattern of MYB domain protein 15 (MYB 15)
The analysis of RT-PCR showed that expression of MYB15 gene remained
statistically similar in both inoculated and uninoculated plants under normal growth
conditions (Fig. 4.37A). However, inoculation of drought tolerant CA containing
endophytic bacterial isolates differentially expressed the MYB15 under PEG-mediated
water deficit conditions. Plant treated with AR4 and AR14 showed markedly lower
expression of MYB15 compared to uninoculated control plants under PEG-induced water
deficit conditions (3%).
4.7.3.14. Expression pattern of abscisic acid dependent dehydrins (ERD10)
Abscisic acid responsive gene (ERD 10) was upregulated in non-inoculated and
incoulated plants under PEG-induced water deficit stress (3%) (Fig. 4.37B). Expression
of ERD10 in arabidopsis plant inoculated with AR4 and AR14 did change over
uninoculated control plants under stressed conditions.
4.7.3.15. Expression of ethylene responsive factor (ERF 13)
To analyze whether the expression of ERF13 enhances water deficit stress
tolerance, compared the expression of ERF13 in inoculated as well as non-inoculated
plants (Fig. 4.37C). Expression of ERF transcript was more in non-inoculated plants
under non-stressed (0%) as well as PEG-induced water deficit stress (3%). Inoculation
with drought tolerant CA containing endophytic bacterial isolates (AR4 and AR14)
showed varied response in expressing the ERF13 under normal as well as PEG-induced
water deficit stress. However, inoculation of plant with isolate AR14 showed marked
downregulation of ERF13 under non-stressed as well stressed conditions in comparison
with uninoculated plants.
148
![Page 169: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/169.jpg)
Control AR4 AR140
2
4
6
8
10
0% PEG 3% PEG
Endophytic bacteria
Relativ
e fold c
hange
MYB15 A
Control AR4 AR140
2
4
6 0% PEG 3% PEG
Endophytic bacteria
Relat
ive fo
ld ch
ange
ERF 13 C
Control AR4 AR140
10
20
30
40 0% PEG 3% PEG
Endophytic bacteria
Relativ
e fold c
hange
ERD 10 B
Fig. 4.37. Effect of drought tolerant CA containing endophytic bacterial isolates (AR4, AR14) on transcription factors and gene MYB15 (A), ERD10 (B), ERF13 (C) in Arabidopsis thaliana under normal (0%) as well as PEG-mediated water deficit conditions (3%)
149
![Page 170: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/170.jpg)
4.8. Characterization and identification of endophytic bacterial isolates
Selected drought tolerant CA containing endophytic bacterial isolates (WR2,
WS11, WL19, MR17, MS1, MG9, AR4 and AR14) were tested for various plant growth
promoting characters as shown in table 4.15. Results demonstrated that all the isolates
had ability to solubilize the phosphorus. Isolate WL19, MG9 and AR14 were found
efficient for P solubilization compared to other isolates. Siderophore production was
observed in all the isolates except MS1. Among the isolates, isolate WS11 and MR17
were found more efficient for siderophore production. Exopolysaacrharide production
was also found in all the selected isolates, while isolate WL19, MG9 and AR4 were more
efficient in exopolysacchride production. Selected isolates were also found positive for
catalase and oxidase activity where maximum oxidase activity was observed in isolate
AR14. All the isolates had ability to produce organic acids. Among isolates, WL19, MSI,
MG9 and AR14 were more efficient in organic acid production. Cellulase activity was
also present in all the isolates except MS1. Xylanase activity was absent in all isolates
except MS1. Protease activity also varied among the isolates. Maximum aggregation
ability was observed with isolate WR2 while minimum was observed with isolate MS1.
Selected drought tolerant endophytic bacteria except AR4 and AR14 were tested for their
survival in sterilized soil. Among the isolates, isolate MR17 showed maximum
population 6.7 CFU × 105 mL-1 followed by WL19 6.1 CFU × 105 mL-1.
Selected endophytic bacterial isolates WR2, WS11 and WL19 from wheat were
diagonosed as different strains of Bacillus on the basis of 16S rRNA gene sequence
similarities in Genbank (Fig 4.38). Endophytic bacterial isolates MR17, MS1 and MG9
from maize also showed clostest match to different Bacillus spp. However, isolates AR4
and AR14 from Arabidopsis were identified as Microbacterium and Psychrobacter sp.,
respectively (Fig 4.38).
150
![Page 171: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/171.jpg)
Table 4.15: Characterization of selected drought tolerant endophytic bacterial isolates
(+) represents presence (-) shows absence and ND shows no detection of characteristics All the characters are average of three replicates
151
Characteristics WR2 WS11 WL19 MR17 MS1 MG9 AR4 AR14
P-solubilization + + ++ ++ + ++ + +++
Siderophore production ++ +++ + +++ - + + ++
Exopolysaccharide production + ++ +++ ++ ++ +++ +++ ++
Chitinase ++ ++ +++ ++ ++ +++ - -
Catalase + + + + + + + +++
Oxidase - - + - - + - ++
Organic acid production + + ++ + ++ ++ + ++
Aggregation 6.7 3.7 5.3 4.3 1.4 4.9 2.2 3.6
Starvation Test
(CFU ×104 mL-1)
4.3 1.2 3.9 1.8 4.2 1.6 1.1 2.2
Survival in soil
(CFU × 105 mL-1)
4.3 5.2 6.1 6.7 4.9 5.8 ND ND
Cellulase + + + + - + + +
Xylanase - - - + - - ND ND
Protease + - ++ + - ++ ND ND
![Page 172: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/172.jpg)
Bacillus sp. WL19
Bacillus sp. MG9
Bacillus sp. WR2
Bacillus sp. WS11
Bacillus sp. MR17
Psychrobacter sp. AR14
Microbacterium sp. AR4
Bacillus sp. MS1
100
100
10099
100
0.05
Fig. 4.38. Identification of selected endophytic bacterial isolates on the basis of 16S rRNA gene sequence similarities
152
![Page 173: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/173.jpg)
Chapter V
DISCUSSION
Drought impairs plant growth and crop productivity throughout the world
especially in the arid and semiarid regions. In this study, number of endophytic bacterial
isolates were isolated from two different crops (wheat and maize) and tested for their
capacity to tolerate the drought stress. Selected drought tolerant isolates were also
screened for CA activity. The drought tolerant bacterial endophytes containing high CA
activity were further screened for plant growth promotion under non-stressed as well as
PEG-6000 induced water deficit stress in axenic conditions. Three efficient endophytic
bacterial isolates (WR2, WS11, WL19 from wheat while MR17, MSI and MG9 from
maize) were evaluated in pot and field trials. These isolated were also characterized for
plant growth facilitating activities and identified. Moreover, effect drought tolerant
endophytic bacterial isolates on gene expression was studied to understand the
mechanism underlying the drought tolerance.
5.1. Drought tolerance ability of bacterial endophytes
Potential of endophytic bacteria isolated from wheat and maize plants was
assessed under PEG-induced water deficit stress (-0.36, -0.61, -1.09, -1.91 and -3.20
MPa). Among the 150 isolates from each crop, 50 isolates showed growth under normal
(-0.36 MPa) as well as stressed conditions (-3.20 MPa). Growth of isolates at -3.20 MPa
depicts their capacity to survive in severe water deficit conditions which might be due to
production of exopolysaccharides (EPS), catalases and oxidases. Production of EPS
occurs by bacteria in response to stress conditions (Roberson and Firestone 1992).
Presumably, EPS provide microenvironment which holds more water and desiccated
gently than the enclosing environment, thus protect the bacterial strain from fluctuation in
water potential and drying (Hepper, 1975). Generation of exopolysacchrides has been
reported to protect Azospirillum brasilense Sp245 cell from the desiccation (Konnova et
al., 2001). Furthermore, production of oxidases and catalases is helpful for protecting the
nucleic acid from stress induced disintegration and regulating cellular metabolism in
stressed environment (Boumahdi et al., 1999). Catalases scavenge hydrogen peroxide
(H2O2) and maintain the cellular metabolism, thus reduced the PEG induced cell damage
(Hussain et al., 2015). Rise in supply of soluble sugars, free amino acids, protein, and
EPS in bacteria under water scarce conditions may also be attributed to their survival
153
![Page 174: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/174.jpg)
ability (Vardharajula et al., 2011). Earlier, it has also been described that drought tolerant
rhizobia accumulate the osmolytes and modulate the cell morphology for its survival
under stressed environment (Busse and Bottomley, 1989). Results of present study are
similar to Yandigeri et al. (2012) and Abolhasani et al. (2010) where they found the
growth of endophytic actinobacterial isolates at -0.73 MPa and Shinorhizobium sp. at -3.5
MPa, respecitively.
5.2. Carbonic anhydrase activity of drought tolerant isolates
Isolates which showed higher survival ability under PEG-induced water deficit
stress were tested for CA activity. Out of 50, 10 isolates (from each crop) showing high
CA activity were further selected. Increase in CA activity at initial growth phase might be
due to phenomenon of sparking effect, where CO2 is needed to fulfill biosynthetic
demand and is vital for the organism to overcome lag phase (Dean and Ward, 1992).
Zhang et al. (2011) also reported that synthesis of CA is closely related to cell growth.
Bacillus mucilaginosus captured the atmospheric CO2 through bacterially produced CA
(Zhang et al., 2010). These results are in accordance with Ramanan et al. (2009) where
they purified and characterized the plant type CA from Bacillus subtilis
5.3. Screening of CA producing drought tolerant endophytic bacteria for growth
promotion in wheat and maize seedlings under PEG-imposed water deficit
stress in axenic conditions
Plants are usually exposed to different abiotic stress environments, among them,
drought is the major problem associated with growth and development of plants, affecting
agricultural demand throughout the world. In the current study, potential of drought
tolerant CA producing endophytic bacterial isolates was checked for growth in wheat and
maize growth. Among the isolates, isolate WL19, WS11 and WR2 showed significant
increase in wheat growth whereas isolate MG9, MR17 and MS1 proved to be efficient
isolates for improving maize growth. However, effect was more obvious in drought
sensitive cultivar and hybrid of both crops (Uqab-2000 and H2) compared to tolerant ones
(Fsd-2008 and H1). Isolates improved the plant growth by stimulating root length and
root growth under normal (-0.04 MPa) as well as PEG-induced water deficit conditions (-
1.23 MPa). Expansion of root growth might be attributed to auxin (IAA) production by
endophytic bacterial isolates. Synthesis of auxin affects the root system by improving size
and number of adventitious roots (Moreno-Gutierrez et al., 2012). Bacterial induced
154
![Page 175: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/175.jpg)
changes in root may be attributed to increase in the root surface, resulting in improved
water and nutrient uptake that may cause positive influences on growth of plant (Somers
et al., 2004). Moreover, improved root growth has been suggested to enhance phosphorus
uptake (Jones and Darrah, 1994). There are some reports which suggest that inoculation
of seed with Pseudomonas putida GR12-2 increase the seedling root length up to 2-3 fold
compared to non-inoculated control (Glick et al., 1986; Caron et al., 1995).
In the present study, endophytic bacterial isolates (WR2, WS11, WL19 for wheat
and MR17, MS1 and MG9 for maize) significantly increased the shoot fresh biomass
under non-stressed as well as stressed conditions, especially in Uqab-2000 and H2 hybrid.
Significant enhancement in shoot fresh weight by the endophytic bacterial isolates might
be attributed to CA activity that provides higher photoassimilates to plants through
increasing CO2 assimilation rate in both wheat and maize plants. Moreover, under
drought stress, endogenous level of plant hormone ethylene increases and results in
decreases root and shoots growth. Bacterial may also rescue the plant from stress and
regulate the normal growth by producing ACC-deaminase that degrade ACC, ethylene
precursor (Mayak et al., 2004).
Moreover, inoculation of drought tolerant CA containing endophytic bacteria
isolated from wheat and maize improved chlorophyll content, CA activity, CO2
assimilation rate (A), transpiration rate (E), stomatal conductance (gs) and substomatal
CO2 conductance (Ci) in both crops, however, increase was greater in sensitive cultivars
Uqab-2000 and H2 hybrid of wheat and maize, respectively, compared to non-inoculated
control plants. Increase in photosynthetic rate might be due to increase in CA activity by
the inoculation of drought tolerant CA producing endophytic bacteria. Association
between photosynthetic rate and CA activity was confirmed by Khan (1994) and XinBin
et al. (2001) in higher plants. Afroz et al. (2005) found improvement in net CO2
assimilation rate due to stimulatory effect of CA activity by the application of gibberellin
IIIGA3 in mustard. Inhibition in CA activity with the application of ethoxyzolamide
caused 80-90% decrease in photosynthesis at lower CO2 concentration, indicating the role
of C3 in photosynthesis (Badger and Pfanz, 1995). However, bacterially synthesized CA
and its role in photosynthesis rate is still need to be explored. Furthermore, CA activity
has been reported for regulating the stomatal conductance and protecting the plant from
adverse environmental conditions (Wei-Hong et al., 2014). Naveed et al. (2014b) also
found similar results where inoculation with endophytic bacterial strains PsJN improved
155
![Page 176: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/176.jpg)
the chlorophyll content, photosynthesis and efficacy of PSII of Mazruka cultivar in maize
compared to other control treatments.
Based on above observation, it may be concluded that endophytic bacterial
isolates WR2, WS11 and WL19 proved to be efficient for improving growth of wheat and
MR17, MS1 and MG9 for maize, respectively under non-stressed as well as PEG-induced
water deficit stress. In case of cultivars and hybrid, effect of endophytic bacterial
inoculation was more prominent in Uqab-2000 and H2 than Fsd-2008 and H1.
5.4. Evaluation of selected endophytic bacterial isolates for wheat and maize in pot
trials
Drought tolerant CA containing plant growth promoting isolates (WR2, WS11
and WL19 from wheat and MR17, MS1 and MG9 from maize) were selected from in
vitro screening and tagged with Gus marker to study their response for plant growth
promotion and colonization efficiency under non-stressed as well as water deficit stress
conditions (100, 70 and 40% FC). Isolates showed varied response for improving
photosynthesis and plant biomass of wheat and maize under normal (100% FC) as well as
water deficit (70 and 40% FC) conditions. Severe water deficit stress (40% FC) markedly
reduced all the growth parameters. However, inoculation of drought tolerant CA
containing bacterial endophytes improved plant growth under non-stressed and stressed
conditions, especially in sensitive cultivars (Uqab-2000 and H2 hybrid) by modulating
their root and shoot growth with different growth promoting activities including
production of phytohormones, P-solubilization, synthesis of phytohormones, ACC-
deaminase activity and production of siderophore. The root and shoot growth was
increased in wheat and maize plants exposed to water deficit stress (40% FC) which is
attributed to impact of CA activity on photosynthesis that not only enhances the
photosynthesis but also improves plant growth. It is assumed that plant excretes more
photoassimilates due to higher photosynthetic rate and attracts more microbial community
that performs beneficial function and improves plant growth. Moreover, increase in root
growth might be due to IAA production. Indole acetic acid enhances root formation by
stimulating cell division, enhancing cell enlargement and increasing surface area of root
(Dey et al., 2004; Gray and Smith, 2005). Production of auxin has been noticed as major
tool for facilitating the early growth in wheat plant (Khalid et al., 2004) in conjunction
with phosphrous solubilization (Rajput et al., 2013). In our experiments, isolates WL19
and MG9 exhibiting more indole acetic acid production under normal as well as stressed
156
![Page 177: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/177.jpg)
condition showed more root growth and shoot biomass compared to other isolates.
Moreover, these isolates showed higher P solubilization under stressed condition than
non-stressed condition indicating that P-solubilization enhances in response to stress.
However, increase was more in sensitive cultivars than tolerant. These observations are in
line with Forchetti et al. (2010) where drought sensitive genotype B59 showed dramatic
increase in root biomass in the presence of endophytic bacterial strain under water stress.
CA activity was decreased in both crops at 70% and 40% FC especially in drought
sensitive cultivar and hybrid which could be attributed to inhibition of stress-activated
enzymes or other metabolic dysfunctions (Hopkins, 1995). These results confirm the
findings of Guliyev et al. (2008) where CA activity was decreased in Garagilchig and
Giymatli under limited water supply but contradicts the findings of those who reported
that CA activity decreased in wheat in response to mild water deficit stress and increased
in response to severe water deficit conditions mediated by PEG. Findings of present study
are also in line with the research findings described by Talaat and Shawky (2014) where
they found that CA activity also decreased in Giza 168 and Sids 1 under salinity stress
(4.7 and 9.4 dS m-1). However, inoculation with drought tolerant CA producing
endophytic bacteria enhanced the CA activity. Colonization of wheat plant with
mycorhizae inoculation enhanced the CA activity under salinity stress (Talaat and
Shawky, 2014).
Photosynthesis is the major physiological response of plants under water scarce
conditions due to stomatal closure and inhibition of enzyme activity involved in
photosynthesis (Tataeizadeh, 1998). Plant inoculated with drought tolerant CA containing
endophytic bacteria improved the chlorophyll contents, photosynthetic rate and stomatal
and substomatal conductance. Better performance of CA activity and higher
photosynthetic rate was observed by Talaat and Shawky (2014) with mycorhizae
inoculation. The positive effect might be accounted for increased accumulation of
carbohydrate in grain, most probably due to enhanced CO2 assimilation under stressed
conditions (Talaat and Shawky, 2014). Many researchers have described improvement in
photosynthetic rate by inoculation of growth facilitating bacteria (Vardharajula et al.,
2011; Yandigeri et al., 2012). Moreover, inoculation of osmotolerant bacteria facilitated
the chlorophyll content of wheat under drought (Chakraborty et al., 2013).
The relative water content (RWC), indicator of water deficit (Fisher, 2000)
decreased in many plants under water scarce conditions (Liu et al., 2002). However,
157
![Page 178: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/178.jpg)
inoculation with drought tolerant CA containing bacterial endophytes (WL19 and MG9)
enhanced RWC in both crops especially in Uqab-2000 and H2 hybrid. Inoculated plants
developed effective root system and enhanced water uptake (Dodd et al., 2010). On the
other hand, electrolyte leakage enhanced under water deficit stress (40%FC) in non-
inoculated plants, though the inoculation of isolates WL19 and MG9 reduced the damage
caused by drought compared to uninoculated control. A direct correlation has been found
between water stress and membrane damage but bacterial inoculation reduced the adverse
effect of drought on membrane (Vardharajula et al., 2011).
Proline contents were increased in both crops (wheat, maize) under drought stress
(70 and 40% FC). These osmoprotectants or compatible solutes support plants to
protecting their enzyme activity under limited moisture conditions (Saravanakumar et al.,
2011). Proline serves as protective osmolyte and scavenger of hydroxyl radical which
protects macromolecules from denaturation (Kishor et al., 1995). However, inoculation of
bacterial endophytes improved the proline content in wheat and maize. Increased proline
contents (Theocharis et al., 2012) and enhanced accumulation of free aminaocid and
sugar (Vardharajula et al., 2011) was observed with beneficial bacteria. Reactive oxygen
species inducing lipid peroxidation are generated under stress conditions (Sgherriet et al.,
2000). Results revealed that endophytic bacterial inoculation (WL19 and MG9)
minimized the damage caused by malondialdehyde (MDA) by decreasing MDA contents
in both crops under non-stressed (100% FC) and water deficit conditions (40% FC).
On the basis of these studies and their findings, it can be speculated that drought
tolerant CA containing endophytic bacteria not only improve the wheat and maize growth
but also mimic the adverse impacts of water deficit stress on plant growth. These
beneficial bacteria increased the photosynthetic rate and plant biomass in both cultivars of
wheat (Uqab-2000 and Fsd-2008) and maize hybrid (H1 and H2). However, effect of
inoculation was more obvious in Uqab-2000 and H2 hybrid. Moreover, respective isolates
vigorously colonized different tissues (root, shoot and leaves) under well watered and
limited water conditions. Therefore, selected bacterial strains seems to be valuable for
growth promotion under limited water conditions. However, potential of tested isolates
under field needs to be explored.
5.5. Interaction between endophytic bacterial population and plant tissues
Results regarding colonization of different tissues of both wheat cultivars (Fsd-
158
![Page 179: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/179.jpg)
2008 and Uqab-2000) and maize hybrids (H1 and H2) with Gus labelled drought tolerant
CA containing endophytic bacterial isolates revealed that colonization of wheat and
maize with their respective isolates decreased as the water deficit stress increased, most
likely due to water deficit stress and its effect on bacterial isolates. Colonization of tissues
by isolates decreased under mild (70% FC) and severe (40% FC) stress compared to well
watered (100% FC) conditions. Moreover, reltively less CFU was recorded in leaf tissue
of wheat (Fsd-2008 and Uqab-2000) and maize (H1 and H2) compared to shoot and root
tissues under normal as well as stressed conditions. These findings are in line with
Gusmaini et al. (2013) where they reported that population of endophytic bacterial
consortia was higher in root tissue compared to stem and leaves. Similarly, more diverse
bacterial population was found in root than the stem of rice (Wang et al., 2016). Direct
contact and close vicinity made the greater chance to get access into root of plants.
Microorganisms can enter from soil to root and their population ranged from 105-107 CFU
g-1 fresh weight (Hallmann, 2001).
However, interaction between endophytic bacterial population and plant cultivar
showed that endophytic population was greatly decreased in drought sensitive cultivars of
both wheat and maize crops (Uqab-2000 and H2) compared to drought tolerant cultivars
(Fsd-2008 and H1). These results are in line with Naveed et al. (2014b) where less
population of endophytic bacteria (Enterobactor sp. FD 17 and Burkholderia
phytofirmans PsJN) was observed in Mazruka than in Kaleo genotypes under well
watered as well as drought stress conditions. Under stressed condition, variety of
physiological alterations result in change in root exudation that influences the
performance of strain (Bais et al., 2006). Similarly, endophytic bacterial strain showed
more persistence in shoot tissue of two maize cultivars (Peso and Morignon) compared to
other cultivars (Naveed et al. 2013).
5.6. Evaluation of selected endophytic bacterial isolates in field trial
Limited supply of water is one of the severe environmental constraints that badly
affect the crop productivity. Therefore, plant adaptability to water deficit stress is required
to stimulate crop production. Wheat and maize are important cereals throughout the
world. Improving productivity of wheat and maize by drought tolerant CA containing
endophytic bacteria is one promising area for ensuring food security. Potential of selected
drought tolerant CA containing endophytic bacterial isolates (WL19, WS11,WR2 from
wheat while MG9, MR17, MS1 from maize) were evaluated in field conditions for
159
![Page 180: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/180.jpg)
facilitating the growth, CA activity, photosynthesis, yield and antioxidants activity of
drought sensitive cultivar in wheat and drought sensitive hybrid in maize where water
deficit stress was induced by cutoff the irrigation at different growth stages in wheat
( tillering, flowering or grain filling) and maize (vegetative or reproductive). Water
deficit-mediated yield reduction has been suggested by many researchers that depends on
severity and period of drought (Farooq et al., 2009). Limited moisture supply at critical
growth stage, negatively influences crop growth in comparison to non-stressed control
plants. Irrigation skipped at tillering and grain filling phase of wheat and reduced
irrigation at reproductive stage of maize negatively influence the photosynthetic rate and
crop yield. In maize, water deficit stress at vegetative stage caused 25-60% reduction
(Atteya et al., 2003) and 63-87% at reproductive stage (Kamara et al., 2003). Similarly,
plant shows variable response to limited moisture supply at different growth stages
(Gupta et al., 2001) because unfavorable conditions badly effect expansion of
reproductive tissues and yield (Mogensen et al., 1985; Kettlewell et al., 2010).
Inoculation of drought tolerant CA containing endophytic bacteria significantly
improved the growth and yield of both crops at all growth stages, especially at tillering
and grain filling in wheat and reproductive stage in maize. Naveed et al. (2014a) found
that the growth of wheat was increased with endophytic bacterial inoculation especially
where irrigation withdrawal at tillering or flowering phases of wheat. Growth promoting
activities known to be involved in this process are generation of phytohormones, ACC
deaminase activity and siderophore production. Inoculation of drought tolerant
endophytic S. olivaceus DE10 improved the number of tillers, grain yield and biomass of
wheat (Yandigeri et al., 2012).
Our results also revealed that CA activity decreased when wheat and maize plants
were subjected to water deficit conditions. Recent investigations on wheat depicted that
CA activity, at flag leaf stage, rasied to its maximum value and after that lowered to its
minimum value before going to rise at wheat dough stage. Furthermore, CA activity
decreased in awn, glume and grain of Garagilchig and Giymatli cultivars under water
limited environment in comparison with well watered environment at milk and dough
stage (Guliyev et al., 2008). However, CA activity was significantly higher at milk stage
in ear parts compared to leaf tissues (Li et al., 2004).
Significant decrease in chlorophyll content, photosynthetic assimilation rate,
stomatal conductance and rate of transpiration was noticed when drought stress was
160
![Page 181: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/181.jpg)
imposed at tillering, grain filling and reproductive stage in wheat and maize, respectively;
might be attributed to decrease in CA activity. Khan et al. (2008) found that
photosynthetic rate was decreased with decreasing CA activity under Cd stress in wheat,
indicating the importance of CA in maintaining the photosynthesis at different levels of
Cd. However, inoculation with drought tolerant CA containing endophytic bacteria
enhanced the chlorophyll contents, photosynthetic rate, stomatal conductance and
substomatal conductance. Earlier reports have suggested that increased photosynthetic
rate was due to increased CA activity in Chickpea (Hayat et al., 2012) which regulated
the constant supply of CO2 for Rubisco (Okabe et al., 1980). The increased
photosynthesis has been attributed to increase plant growth that ultimately resulted in
better production of carbohydrates (photoassimilates) and increased dry matter (Hayat et
al., 2012). Stomatal conductance was also affected by endophytic bacteria might be due to
their presence in stomatal cell of plant (Compant et al., 2005) and associated with
different compounds synthesized by bacteria such as coronatine and jasmonate (Brader et
al. 2014). In the present study under field conditions, water use efficiency significantly
decreased under stressed condition compared to normal conditions but inoculation of
drought tolerant CA containing bacteria did not show significant difference with respect
to un-inoculated control in both wheat and maize crops. The findings are in accordance to
outcomes of Naveed et al. (2014a).
Skipped irrigation at any growth stage also affected the protein contents and total
soluble sugars. However, inoculation of drought tolerant CA containing endophytic
bacteria improved the protein contents and soluble sugars compared to uninoculated
plants. Greater accumulation of sugar in stressed plants might be as a result of hydrolysis
of starch to sugars. The outcomes of present study are in line with Naveed et al. (2014a)
where they found that protein contents were increased by endophytic bacteria.
Antioxidants activity (glutathione reductase, GR; ascorbate peroxidase, APX; and
catalase) also increased in both crops under water deficit stress. Antioxidant activity
usually increases in plants under drought and acts as adaptational reaction (Reddy et al.,
2004). In the current experiment, antioxidant content in leaves of plants treated with
endophytic bacteria was significantly reduced compared to uninoculated control plants
under skipped irrigation. These outcomes are aligned with Upadhyay et al. (2012) where
they found that CAT, GR and APX activity decrease in plants treated with bacterial
strains compared to control plants under salinity stress.
161
![Page 182: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/182.jpg)
. Inoculation with drought tolerant CA containing endophytic bacterial isolates
(WL19, WR2, WS11 from wheat and MG9, MR17 and MS1 from maize) improved their
mineral nutrition under non-stressed as well as stressed conditions. The increase might be
attributed to IAA production that enhanced mineral uptake by stimulating the root growth
(Gray and Smith, 2005). Bacterial inoculation also enhances the P solubilization that
ultimately improves the P availability through organic acid production and phosphatase
activity (Rodriguez et al., 2006). Significant enhancement in nutrient concentration has
been suggested by bacterial inoculation (Nadeem et al., 2006). Inoculation of maize plant
with Pseudomonas tolaasii IEXb enhanced P content by 56% in maize than control plants
(Viruel et al., 2014). Increased phosphorus has been reported by Psuedomonas sp. in
many crop species (Gusain et al., 2015, Fankem et al., 2015, Babana and Antoun, 2006).
It may be concluded from the above discussion that drought tolerant CA
containing endophytic bacteria not only improve plant growth but also mitigate the
adverse effect of drought in both crops. These bacterial isolates alleviate the deleterious
impacts of drought by improving CA activity, photosynthetic rate, inducing protein
accumulation, decreasing antioxidants contents as well as enhancing nutrient acquisition.
In fact, present study provides novel information about plant stimulation under water
deficit condition.
5.7. Influence of drought tolerant CA containing endophytic bacteria on plant
growth promotion and gene expression
Water deficit stress is a major limitation that affects food production around the globe.
Improvement of water deficit stress tolerance using drought tolerant endophytic bacteria
is considered as promising strategy to overcome this environmental limitation. However,
biochemical and molecular mechanisms controlling plant/endophyte interaction under
limites supply of water remain unclear. In the current study, two drought tolerant CA
containing endophytic bacterial isolates were tested to insight the mechanisms underlying
the water deficit stress tolerance enhancement in Arabidopsis thaliana plant when treated
with endophytic bacterial isolates. Inoculated plant showed greater root length, lateral
root development, fresh biomass of root and shoot compared to uninoculated plant. Such
diverse impacts have also been stated by Poupin et al. (2013). They showed that plant
growth facilitating bacteria enhanced growth parameters and accelerated the growth rate
in Arabidopsis thaliana. Increase in root growth might be due to IAA production.
Interestingly, IAA acid produced by PGPB plays a vital role in growth stimulating traits
162
![Page 183: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/183.jpg)
of plant and is required for proficient rhizosphere colonization in Arabidopsis (Zuniga et
al., 2013). Auxin are involved in lateral root development and elongation of hypocotyls
(Overvoorde et al., 2010). In this study, results showed that endophytic bacterial isolates
enhanced drought tolerance which might be related to acceleration of transcriptional
response also with long term regulation of several genes. Expression pattern of
dehydration responsive protein and element RD22 and RD29B was greatly modified by
the inoculation of endophytic bacterial isolates. This can be attributed to faster sensing of
PEG-induced water deficit stress through dehydration signaling. Transcriptional response
of RD22 was also upregulated in root of arabidopsis plant inoculated with Burkholderia
phytofirmans PsJN (Pinedo et al., 2015)
Results of present study showed that expression of P.R.1.2. was enhanced by the
inoculation of endophytic bacteria. Our outcomes are aligned with Ryu et al. (2007)
where inoculation of Psuedomonas chlororaphis O6 induced resistance against pathogen.
Several WRKY transcription factors (WRKY57, WRKY8) were also differentially
expressed in plants inoculated with AR4 and AR14. However, WRKY transcription
factor are involved in pathogen induced stress and drought stress (Seki et al., 2002: Chen
et al., 2012). It is interesting that expression of ethylene responsive factor, At ERF7, ERF
13 and Zat 10 was repressed in endophytes treated plants compared with non-inoculated
plants during PEG treatment. These research findings are similar to Seki et al. (2002).
Based on all research experiments and their outcomes, it can be perposed that
drought tolerant CA containing endophytic bacteria are beneficial for wheat and maize
not only under well watered but also under water deficit conditions. Improvement in
photosynthesis and plant biomass of wheat and maize especially in sensitive cultivars,
most likely because of drought tolerant CA containing endophytic bacterial isolates
Bacillus sp. (WR2, WS11 and WL19 from wheat while MR17, MS1 and MG9 from
maize). Moreover, these bacterial isolates posses P-solublization and IAA producing traits
which play dundamental role in growth promotion. Thus, endophytic bacterial isolates
proved to be suitable for enhancing photosynthesis and growth of wheat and maize under
water deficit stress conditions. Endophytic bacterial strains Psychrobacter sp. (AR14) and
Microbacterium sp. (AR4) influenced the expression of different genes and transcription
factors under stressed conditions in Arabidopsis. However, different field experiments are
suggested to check their performance and extensive evaluation in field. Molecular studies
are required to confirm role of bacterially synthesized CA in photosynthesis.
163
![Page 184: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/184.jpg)
Chapter V
SUMMARY
Water deficit stress is a major hazard to the production of food crop, affecting
agricultural demand throughout the world. Enhancement in plant growth is required to
sustain global food production under water limited condition. Drought tolerant
endophytic bacteria have recently been reported for facilitating the plant growth and crop
productivity under water deficit conditions. Being, relatively simple and cost effective,
usage of endophytic bacteria has emerged as promising tool for improving the plant
growth. Ability to colonize the interior of plant as well as production of growth
promoting compounds (indole acetic acid, polysaccharides and stress hormone) in plants
has made these bacteria highly valuable for agricultural research. Moreover, CA
producing ability of endophytic bacteria seems to be beneficial for improving
photosynthetic rate and biomass under stressed conditions. Thus, a number of
experiments were carried out to screen the efficient drought tolerant CA containing plant
growth promoting endophytic bacteria for wheat and maize under water stress. The
selected drought tolerant CA containing endophytic bacterial isolates (WR2, WS11,
WL19 from wheat and MR17, MS1, MG9 from maize) were tested in pot and field for
wheat and maize. Moreover, potential of endophytic bacterial isolates was also evaluated
for gene expression in Arabidopsis thaliana a model plant, to understand the mechanism
of drought tolerance by bacterial endophytes.
Results of these studies are summarized as below:
1. One hundred and fifty isolates were isolated from different tissues of wheat and
maize crop and assayed for drought tolerance. Fifty drought tolerant isolates from
each crop were analyzed for CA activity. Ten drought tolerant isolates with higher
CA activity from each crop were selected for growth promotion in wheat (C3) and
maize (C4).
2. All the 10 drought tolerant CA containing endophytic bacterial isolates were
screened for plant growth promotion in drought tolerant and drought sensitive
cultivars of wheat (Fsd-2008 and Uqab-2000) and hybrids of maize (H1 and H2).
Inoculation significantly enhanced the root length, shoot length, root and shoot
dry weight, chlorophyll content, CA activity, photosynthetic rate transpiration
rate, stomatal and substomatal conductance under normal (-0.04 MPa) as well as
164
![Page 185: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/185.jpg)
PEG induced water deficit conditions (-1.09, -1.23 MPa) in both crops. In wheat,
isolates WR2, WS11and WL19 significantly enhanced the growth, CA activity,
chlorophyll content and photosynthetic rate in both cultivars, however, increase
was more for Uqab-2000 than Fsd-2008. However, minimum increase CA activity
and photosynthetic rate was observed with isolate WS22 in both wheat cultivars.
In maize, isolates MR17, MS1 and MG9 showed significant increase in growth,
CA activity, chlorophyll content, photosynthetic rate, stomatal and substomatal
conductance in both hybrids, though, increase was more pronounced for H2 than
H1. However, isolate MS7 and MG2 showed smaller increase for above
parameters in both hybrids.
3. Selected drought tolerant CA containing endophytic bacterial isolates (WR2,
WS11, and WL19 and MR17, MS1 and MG9) were labeled with Gus marker and
evaluated in pot for improving photosynthesis and plant growth of wheat and
maize. The endophytic bacterial inoculants improved photosynthesis and plant
yield under normal (100% FC) as well stressed conditions (70 and 40% FC) in
both wheat cultivars (Fsd-2008 and Uqab-2000) and maize hybrids (H1 and H2).
However, increase was more in drought sensitive cultivar in wheat (Uqab-2000)
and hybrid in maize (H2). These isolates efficiently colonized the different tissues
of wheat and maize, however, their CFU decreased with increasing distance from
root to leaves as well as with increasing water stress (70 and 40% FC). Isolates
WL19 and MG9 proved to be efficient for IAA production and P-solubilization
under normal and PEG- mediated water deficit conditions compared to other
isolates.
4. Selected bacterial isolates (WR2, WS11, and WL19 from wheat and MR17, MS1
and MG9 from maize) were also evaluated in field conditions for improving
physiology, yield and mineral contents of wheat and maize. The endophytic
bacterial isolates improved photosynthetic rate, yield and mineral contents in
irrigated plants as well as in plants where irrigation was skipped at tillering,
flowering, or grain filling stage of wheat as well as vegetative or reproductive
stage of maize. Moreover, decrease in antioxidants contents was also observed by
the inoculation of isolates under irrigated and stressed conditions.
5. Drought tolerant CA containing endophytic bacteria were isolated and screened
for plant growth promotion at Plant Microbe interaction Laboratory, The
University of Queensland. Two drought tolerant CA containing plant growth
165
![Page 186: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/186.jpg)
promoting endophytic bacteria were selected for gene expression study. Drought
stress modified the expression of several stress related genes in Arabidopsis
thaliana. However, inoculation with drought tolerant CA containing endophytic
bacteria AR4 and AR14 not only enhanced the growth of Arabidopsis thaliana but
also stimulated the expression of stress related gene and transcription factors
under water deficit stress. Expression of RD29B, LEA, and DREB2A was
upregulated whereas as expression of AtERF7, ERF13 and Zat 10 was
downregulated by the inoculation of isolates compared to uninoculated control
plants.
6. From the= research studies, it can be proposed that inoculation with WR2, WS11,
and WL19 could be beneficial for improving photosynthesis and productivity of
wheat (C3) under water deficit conditions while MR17, MS1 and MG9 proved to
be efficient for maize (C4) under waterlimited conditions. Moreover, inoculation
of isolates (AR4 and AR14) could mitigate the drought stress by influencing the
gene expression of Arabidopsis thaliana under water deficit conditions.
Inoculation with these isolates can increase crop yield and enhance net benefits by
efficient utilization of water resources which ultimately may help to alleviate
poverty through sustainable crop production and seems achieving the target of
food security.
166
![Page 187: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/187.jpg)
Future directions
Carbonic anhydrase encoding gene in endophytic bacteria may be identified and
need to generation of CA negative mutant may be helpful to confirm the role of
bacterially produced CA in photosynthesis
Gene expression studies should may be conducted to find out the exact
mechanism of drought tolerance by endophytic bacteria in both wheat and maize
Ways to improve colonization efficiency of endophytic bacteria in reproductive
tissues of plants need to be explored
Potential of endophytic bacterial isolates containing CA activity should be studied
for other corps under different abiotic stresses viz drought or salinity
Multistrain inoculation of drought tolerant CA containing endophytic bacteria
may be studied to get maximum benefits.
REFERENCES
167
![Page 188: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/188.jpg)
Abeles, F.B., P.W. Morgan and Jr. M.E. Saltveit. 1992. Ethylene in plant biology (2nd
Ed). San Diego, Academic Press.
Abolhasani, M., A. Lakzian, A. Tajabadipour and G. Haghnia. 2010. The study salt and
drought tolerance of Sinorhizobium bacteria to the adaptation to alkaline
condition. Aust. J. Basic Appl. Sci. 4: 882-886.
Achal, V. and X. Pan. 2011. Characterization of urease and carbonic anhydrase producing
bacteria and their role in calcite precipitation. Curr. Microbiol. 62: 894-902.
Adams, P. and J. Kloepper. 1996. Seed borne bacterial endophytes in different cotton
cultivars. Phytopathology 86: 97
Afroz, S., F. Mohammad, S. Hayat and M.H. Siddiqui. 2005. Exogeneous application of
gibberellic acid counteracts the ill effects of sodium chloride in mustard. Turk. J.
Biol. 29: 233-236.
Afzal, M., S. Yousaf, T.G. Reichenauer and A. Sessitsch. 2012. The inoculation method
affects colonization and performance of bacterial inoculant strains in the phy-
toremediation of soil contaminated with diesel oil. Int. J. Phytorem. 14: 35-47.
Agarwal, V.K. and J.B. Sinclair. 1996. Principles of seed pathology. Lewis Pub., Boca
Raton, Florida.
Alef, K. 1994. Biologische Bodensanierung-Methodenbuch. Wiley-VCH, Weinheim,
Germany.
Ali S, T.C. Charles and B.R. Glick. 2012. Delay of flower senescence by bacterial
endophytes expressing ACC deaminase. J. Appl. Microbiol. 5: 1139-1144.
Ali, M.M. and D. Vora. 2014. Bacillus Thuringiensis as endophyte of medicinal plants:
Auxin producing biopesticide. Int. Res. J. Environ. Sci. 3: 27-31.
Allahverdiyev, T. 2015. Effect of drought stress on some physiological traits of durum
(Triticum durum Desf.) and bread (Triticum aestivum L.) wheat genotypes. J.
Stress Physiol. Biochem. 11: 29-38.
Almeselmani, M., F. Abdullah, F. Hareri, M. Naaesan, M.A. Ammar, O.Z. Kanbar and A.
Saud. 2011. Effect of drought on different physiological characters and yield
component in different Syrian durum wheat varieties. J. Agri. Sci. 3: 127-133.
Amaresan, A., V. Jayakumar, K. Kumar and N. Thajuddin. 2012. Isolation and
characterization of plant growth promoting endophytic bacteria and their effect on
tomato (Lycopersicon esculentum) and chilli (Capsicum annuum) seedling
growth. Ann. Microbiol. 62: 805-810.
168
![Page 189: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/189.jpg)
Andrade, L.F., G.L.O.D.D. Souza, S. Nietsche, A.A. Xavier, M.R. Costa, A.M.S.
Cardoso, M.C.T. Pereira and D.F.G.S. Pereira. 2014. Analysis of the abilities of
endophytic bacteria associated with banana tree roots to promote plant
growth. Microb. Genet. Genom. Mol. Biol. J. Microbiol. 52: 27-34.
Andrade, L.F., G.L.D. Souza, S. Nietsche, A.A. Xavier, M.R. Costa, A.M. Cardoso, M.C.
Pereira and D.F. Pereira. 2014. Analysis of the abilities of endophytic bacteria
associated with banana tree roots to promote plant growth. J. Microbiol. 52: 27-
34.
Anjum, S., X.Y. Xie, L.C. Wang, M.F. Saleem, C. Man and L. Wang. 2011.
Morphological, physiological and biochemical responses of plants to drought
stress. Afr. J. Agri. Res. 6: 2026-2032.
Anjum, S.A., L.C. Wang, J. Salhab, I. Khan and M. Saleem. 2010. An assessment of
drought extent and impacts in agriculture sector in Pakistan. J. Food Agri.
Environ. 8: 1359-1363.
Anjum, S.A., M.F. Saleem, M.A. Cheema, M.F. Bilal and T. Khaliq. 2012. An
assessment to vulnerability, extent, characteristics and severity of drought hazard
in Pakistan. Pak. J. Sci. 64: 138-145.
Apel, K. and H. Hirt. 2004. Reactive oxygen species: metabolism, oxidative stress, and
signal transduction. Annu. Rev. Plant Biol. 55: 373-399.
Arshad, M., B. Shaharoona and T. Mahmood. 2008. Inoculation with Pseudomonas spp.
containing ACC deaminase partially eliminates the effects of drought stress on
growth, yield, and ripening of pea (Pisum sativum L.). Pedosphere 18: 611-620.
Ashraf, M. and N.A. Akram. 2009. Improving salinity tolerance of plants through
conventional breeding and genetic engineering: an analytical comparison.
Biotechnol. Adv. 27: 744-52.
Ashraf, M., S.H. Berge and O.T. Mahmood. 2004. Inoculating wheat seedling with
exopolysaccharides producing bacteria restricts sodium uptake and stimulates
plant growth under salt stress. Biol. Fertil. Soils 40: 57-162.
Ashraf, M.Y., A.H. Khan and A.R. Azmi. 1992. Cell membrane stability and its relation
with some physiological process in wheat. Acta Agron. Hung. 41: 182-191.
Atteya, A.M. 2003. Alteration of water relations and yield of corn genotypes in response
to drought stress. Bulg. J. Plant Physiol. 29: 63-76.
169
![Page 190: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/190.jpg)
Babana A. and H. Antoun. 2006. Effect of tilemsi phosphate rock-solubilizing
microorganisms on phosphorus uptake and yield of field-grown wheat (Triticum
aestivum L.) in Mali. Plant Soil 287:51-58.
Bacon, C.W. and D.M. Hinton. 2006. Bacterial endophytes: the endophytic niche, its
occupants, and its utility. p. 155-194. In: S.S. Gnanamanickam (ed.) Plant-
associated bacteria. Springer, Netherlands.
Badger, M.R. and G.D. Price. 1994. The role of carbonic anhydrase in photosynthesis.
Annu. Rev. Plant Physiol. Plant Mol. Biol. 45: 369-392.
Badger, M.R. and H. Pfanz. 1995. Effect of carbonic anhydrase inhibition on
photosynthesis by leaf pieces of C3 and C4 plants. Aust. J. Plant Physiol. 22: 45-
49.
Bais, H.P., T.L. Weir, L.G. Perry. S. Gilroy and J.M. Vivanco. 2006. The role of root
exudates in rhizosphere interactions with plants and other organisms. Annu. Rev.
Plant Biol. 57: 233-266.
Balsanelli, E., R.V. Serrato, V.D. Baura, G. Sassaki, M.G. Yates, L.U. Rigo, F.O.
Pedrosa, E.M. de Souza and R.A. Monteiro. 2010. Herbaspirillum seropedicae
rfbB and rfbC genes are required for maize colonization. Environ. Microbiol. 12:
2233-2244.
Barraquio, W.L., L. Revilla and J.K. Ladha. 1997. Isolation of endophytic diazotrophic
bacteria from wetland rice. Plant Soil 194: 15-24.
Bartels, D. and R. Sunkar. 2005. Drought and salt tolerance in plants. Crit. Rev. Plant
Sci. 24: 23-58.
Bashan, Y. and L.E. de-Bashan. 2005. Fresh-weight measurements of roots provide
inaccurate estimates of the effects of plant growth-promoting bacteria on root
growth: a critical examination. Soil Biol. Biochem. 37: 1795-1804.
Bates, L.S., R.P. Waldern and I.D. Teare. 1973. Rapid determination of free proline for
water status studies. Plant Soil 39: 205-207.
Beattie, G.A. and S.E. Lindow. 1995. The secret life of foliar bacterial pathogens on
leaves. Annu. Rev. Phytopathol. 33: 145-172.
Benhamou, N., J.W. Kloepper and S. Tuzun. 1998. Induction of resistance against
Fusarium wilt of tomato by combination of chitosan with an endophytic bacterial
strain: ultrastructure and cytochemistry of the host response. Planta 204: 153-168.
Benhamou, N., S. Gagne, D.L. Quere and L. Dehbi. 2000. Bacterial-mediated induced
resistance in cucumber: beneficial effect of the endophytic bacterium Serratia
170
![Page 191: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/191.jpg)
plymuthica on the protection against infection by Pythium ultimum. Biochem. Cell
Biol. 90: 45-56.
Bent, E., and C. Chanway. 1998. The growth-promoting effects of a bacterial endophyte
on lodgepole pine are partially inhibited by the presence of other rhizobacteria.
Can. J. Microbiol. 44: 980-988.
Berg, G. and J. Hallmann. 2006. Control of plant pathogenic fungi with bacterial
endophytes. In: B. Schulz, C. Boyle and T. Sieber (eds.) Microbial Root
Endophytes. Springer‐Verlag. Berlin. p. 53-69.
Berg, G., L. Eberl and A. Hartmann. 2005. The rhizosphere as a reservoir for
opportunistic human pathogenic bacteria. Environ. Microbiol. 7: 1673-1685.
Bochner, B. 1989. Breathprints at the microbial level. ASM News. 55: 536-539.
Bohm, M., T. Hurek and B. Reinhold-Hurek. 2007. Twitching motility is essential for
endophytic rice colonization by the N2-fixing endophyte Azoarcus sp. strain
BH72. Mol. Plant Microb. Interact. 20: 526-533.
Boumahdi, M., P. Mary and J.P. Hornez. 1999. Influence of growth phases and
desiccation on the degrees of unsaturation of fatty acids and the survival rates of
rhizobia. J. Appl. Microbiol. 87: 611-619.
Brader, G., S. Compant, B. Mitter, F. Trognitz and A. Sessitsch. 2014. Metabolic potential
of endophytic bacteria. Curr. Opin. Bitotech. 30-37.
Bradford, M. 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Ann. Biochem.
72: 248-254.
Brandi, A., P. Pietroni, C.O. Gualerzi and C.L. Pon. 1996. Post-transcritional regulation
of CspA expression in Escherichia Coli. Mol. Microbiol. 19: 231-240.
Busse, M.D. and P.J. Bottomley. 1989. Growth and nodulation responses of Rhizobium
meliloti to water stress induced by permeating and non-permeating solutes. Appl.
Environ. Microbiol. 10: 2431-2436.
Caemmerer, S.V., T. Lawson, K. Oxborough, N.R. Baker, T.J. Andrews and C.A. Raines.
2004. Stomatal conductance does not correlate with photosynthetic capacity in
transgenic tobacco with reduced amounts of Rubisco. J. Exp. Bot. 55: 1157-1166.
Cakmak, I. and H. Marschner. 1992. Magnesium deficiency and high light intensity
enhance activities of superoxide dismutase, ascorbate peroxidase, and glutathione
reductase in bean leaves. Plant Physiol. 98: 1222-1227.
171
![Page 192: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/192.jpg)
Capasso, C. and C.T. Supuran. 2015. An overview of the alpha-, beta-and gamma-
carbonic anhydrases from Bacteria: can bacterial carbonic anhydrases shed new
light on evolution of bacteria? J. Enzyme Inhibit. Med. Chem. 30: 325-332.
Caron, M., C.L. Patten and S. Ghosh. 1995. Effects of plant growth promoting
rhizobacteria Pseudomonas putida GR-122 on the physiology of canola roots.
Proc. Plant Growth Regul. Soc. America. 7: 18-20.
Castro-Sowinski, S., Y. Herschkovitz, Y. Okon and E. Jurkevitch. 2007. Effects of
inoculation with plant growth-promoting rhizobacteria on resident rhizosphere
microorganisms. FEMS Microbiol. Lett. 276: 1-11.
Chakraborty, U., B.N. Chakraborty, A.P. Chakraborty and P.L. Dey. 2013. Water stress
amelioration and plant growth promotion in wheat plants by osmotic stress
tolerant bacteria. World J. Microbiol. Biotechnol. 29: 789-803.
Chang, W.S., M.V.D. Mortel, L. Nielsen, G.N.D. Guzman, X. Li and H.J. Halverson.
2007. Alginate production by Pseudomonas putida creates a hydrated
microenvironment and contributes to biofilm architecture and stress tolerance
under water limiting conditions. J. Bacteriol. 189: 8290-8299.
Chanway, C.P., M. Shishido, J. Nairn, S. Jungwirth, J. Markham, G. Xiao and F.B. Holl.
2000. Endophytic colonization and field responses of hybrid spruce seedlings after
inoculation with plant growth promoting rhizobacteria. For. Ecol. Manag.133: 81-
88.
Chaves, M.M., J. Flexas and C. Pinheiro. 2009. Photosynthesis under drought and salt
stress: regulation mechanisms from whole plant to cell. Ann. Bot. 103: 551-560.
Chaves, M.M., J.P. Maroco and J.S. Pereira. 2003. Understanding plant response to
drought-from genes to the whole plant. Funct. Plant Biol. 30: 239-64.
Chen, L.G., Y. Song, S.J. Li, L.P. Zhang, C.S. Zou, D.Q. Yu. 2012. The role of WRKY
transcription factors in plant abiotic stresses. Biochem. Biophys. 1819: 120-128.
Chernin, L.S., M.K. Winson, J.M. Thompson, S. Haran, B.W. Bycroft, I. Chet, P.
Williams and G.S.A.B. Stewart. 1998. Chitinolytic activity in Chromobacterium
violaceum: substrate analysis and regulation by Quorum sensing. J. Bacteriol. 180:
4435-4441.
Chi, F., S.H. Shen, H.P. Cheng, Y.X. Jing, Y.G. Yanni and F.B. Dazzo. 2005. Ascending
migration of endophytic Rhizobia, from roots to leaves, inside rice plants and
assessment of benefits to rice growth physiology. Appl. Environ. Microb. 71:
7271-7278.
172
![Page 193: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/193.jpg)
Chiarini. L., A. Bevivino, C. Dalmastri, S. Tabacchioni and P. Visca. 2006. Burkholderia
cepacia complex species: health hazards and biotechnological potential. Trends
Microbiol. 14: 277-286.
Chinnusamy, V., J. Zhu and J.K. Zhu. 2007. Cold stress regulation of gene expression in
plants. Trends Plant Sci. 12: 444-451.
Cho, K.M., S.Y. Hong, S.M. Lee, YH. Kim, G.G. Kahng, Y.P. Lim, H. Kim and H.D.
Yun. 2007. Endophytic bacterial communities in ginseng and their antifungal
activity against pathogens. Microb. Ecol. 54: 341-351.
Ciais, P., M. Reichstein, N. Viovy, A. Granier, J. Ogee, V. Allard, M. Aubinet, N.
Buchmann, C. Bernhofer, A. Carrara, F. Chevallier, N.D. Noblet, A.D. Friend, P.
Friedlingstein, T. Grunwald, B. Heinesch, P. Keronen, A. Knohl, G. Krinner, D.
Loustau, G. Manca, G. Matteucci, F. Miglietta, J.M. Ourcival, D. Papale, K.
Pilegaard, S. Rambal, G. Seufert, J.F. Soussana, M.J. Sanz, E.D. Schulze, T.
Vesala and R. Valentini. 2003. An unprecedented reduction in the primary
productivity of Europe during 2003 caused by heat and drought. Nature 437: 529-
33.
Cocking, E. 2003. Endophytic colonization of plant roots by nitrogen-fixing bacteria.
Plant Soil 252: 169-175.
Cohen, A.C., R. Bottini and P. Piccoli. 2008. Azospirillum brasilense Sp. 245 produces
ABA in chemically-defined culture medium and increases ABA content in
arabidopsis plants. Plant Growth Regul. 54: 97-103.
Cominelli, E., L. Conti, C. Tonelli and M. Galbiati. 2013. Challenges and perspectives to
improve crop drought and salinity tolerance. New Biotechnol. 30: 355-361.
Compant, S., B. Mitter, J.G. Colli-Mull, H. Gangl and A. Sessitsch. 2011. Endophytes of
grapevine flowers, berries, and seeds: identification of cultivable bacteria,
comparison with other plant parts, and visualization of niches of colonization.
Microb. Ecol. 62: 188-197.
Compant, S., B. Reiter, A. Sessitsch, J. Nowak, C. Clement and E.A. Barka. 2005.
Endophytic colonization of Vitis vinifera L. by plant growth-promoting bacterium
Burkholderia sp. Strain PsJN. Appl. Environ. Microbiol. 71: 1685-1693.
Compant, S., C. Clement and A. Sessitsch. 2010. Plant growth-promoting bacteria in the
rhizo- and endosphere of plants: their role, colonization, mechanisms involved and
prospects for utilization. Soil Biol. Biochem. 42: 669-78.
173
![Page 194: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/194.jpg)
Coombs, J.T. and C.M.M. Franco. 2003. Visualization of an endophytic streptomyces
species in wheat seed. Appl. Environ. Microbiol. 69: 4260-4262.
Cornic, G. 2000. Drought stress inhibits photosynthesis by decreasing stomatal aperture:
Not by affecting ATP synthesis. Trend Plant Sci. 5: 187-188.
Cornic, G., J. Ghasghaie, B. Genty and J.M. Briantais. 1992. Leaf photosynthesis is
resistant to a mild drought stress. Photosynthetica 27: 295-309.
Costa, J.M. and J.E. Loper. 1994. Characterization of siderophore production by the
biological control agent Enterobacter cloacae. Mol. Plant Microb. Interact. 7:
440-448.
Coventry, H.S. and I.A. Dubery. 2001. Lipopolysaccharides from Burkholderia
cepacia contribute to an enhanced defensive capacity and the induction of
pathogenesis-related proteins in Nicotiana tabacum. Phys. Mol. Plant
Pathol. 58:149-158.
Das, A. and A. Varma. 2009. Symbiosis: the art of living. p. 1-28. In A. Verma and A.C.
Kharkwal (eds.) Symbiotic fungi principles and practice. Springer, Berlin.
Dean, C.R. and O.P. Ward. 1992. The use of EDTA or polymixin with lysozyme for the
recovery of intracellular products from Eschericia coli. Biotechnol. Tech. 6: 133-
138.
de-Bashan L.E., J.P. Hernandez and Y. Bashan. 2012. The potential contribution of plant
growth promoting bacteria to reduce environmental degradation-A comprehensive
evaluation. Appl. Soil Ecol. 61: 171-189.
Deng, X., L. Shan, S. Inanaga and M. Inoue. 2004. Water saving approaches for
improving wheat production. J. Sci. Food Agri. 85: 1379-1388.
Dey, R., K.K. Pal, D.M. Bhatt and S.M. Chauhan. 2004. Growth promotion and yield
enhancement of peanut (Arachis hypogaea L.) by the application of plant growth
promoting rhizobacteria. Microbiol. Res. 159: 371-394.
Di Fiore, S., and M. Del Gallo. 1995. Endophytic bacteria: their possible role in the host
plant. p. 3-14. In: I. Fendrik I, M.D. Gallo, J. Vanderleyden and M. de Zamaroczy
(eds.) Azospirillum VI and related microorganisms, NATO ASI Series G:
ecological sciences. Springer-Verlag, Berlin, Heidelberg.
Dodd, I.C., N.Y. Zinovkina, V.I. Safronova and A.A. Belimov. 2010. Rhizobacterial
mediation of plant hormone status. Ann. Appl. Biol. 157: 361-379.
174
![Page 195: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/195.jpg)
Dong, Z., M.J. Canny, M.E. McCully, M.R. Roboredo, C.F. Cabadilla, E. Ortega and R.
Rodes. 1994. A nitrogen-fixing endophyte of sugarcane stems. A new role for the
apoplast. Plant Physiol. 105: 1139-1147.
Dorr, J., T. Hurek and B. Reinhold‐Hurek. 1998. Type IV pili are involved in plant-
microbe and fungus-microbe interactions. Mol. Microbiol. 30: 7-17.
Doty, S.L., B. Oakley, G. Xin, J.W. Kang, G. Singleton, Z. Khan, A. Vajzovic and T.S.
James. 2009. Diazotrophic endophytes of native black cottonwood and willow.
Symbiosis 47: 23-33.
Dreesen, P.E., H.J.D. Boeck, I.A. Janssens and I. Nijs. 2012. Summer heat and drought
extremes trigger unexpected changes in productivity of a temperate
annual/biannual plant community. Environ. Exp. Bot. 79: 21-30.
Dudeja, S.S., R. Giri, R. Saini, P. Suneja-Madan and E. Kothe. 2012. Interaction of
endophytic microbes with legumes. J. Basic Microbiol. 52: 248-60.
Dulai, S., I. Molnar, J. Pronay, A. Csernak, R. Tarnai and M. Molnarlang. 2006. Effects
of drought on photosynthetic parameters and heat stability of PSII in wheat and in
Aegilops species originating from dry habitats. Acta Biol. Szeged. 50: 11-17.
Duncan, D.B. 1955. Multiple range and multiple F-test. Biometrics.11: 1- 42.
Dwivedi, R.S. and N.S. Randhawa. 1974. Evolution of rapid test for the hidden hunger of
zinc in plants. Plant Soil 40: 445-451.
Edwards, D.C. and T.B. Mckee. 1997. Characteristics of 20th century drought in the
United States at multiple time scales. Climatol. rep. 97-2, Colorado State Univ.,
Fort Collins, Colorado.
Egener, T., T. Hurek and B.R. Hurek. 1999. Endophytic expression of nif genes of
Azoarcus sp. strain BH 72 in Oryza sativa roots. Mol. Plant Microb. Interact. 12:
813-819.
Elbeltagy, A., H. Suzuki and K. Minamisawa. 2001. Endophytic colonization and in
planta nitrogen fixation by a Herbaspirillum sp. isolated from wild rice species.
Appl. Environ. Microbiol. 67: 5285-5293.
Elbeltagy, A., K. Nishioka, H. Suzuki, T. Sato, Y. Sato and H. Morisaki, H. Mitsui and K.
Minamisawa. 2000. Isolation and characterization of endophytic bacteria from
wild and traditionally cultivated rice varieties. Soil Sci. Plant Nutr. 46: 617-629.
Etesami, H., H.M. Hosseini and H.A. Alikhani. 2014. Bacterial biosynthesis of 1-
aminocyclopropane-1-caboxylate (ACC) deaminase, a useful trait to elongation
175
![Page 196: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/196.jpg)
and endophytic colonization of the roots of rice under constant flooded conditions.
Physiol. Mol. Biol. Plant. 20: 425-434.
Fallik, E. and Y. Okon. 1996. Inoculants of Azospirillum brasilense: biomass production,
survival and growth promotion of Setaria italic and Zea mays. Soil Biol.
Biochem. 28: 123-126.
Fankem H., G.V.T. Chakounte, L. Ngonkot, H.L. Mafokoua, D.T. Dondjou, C. Simo, D.
Nwaga and F.X. Etoa. 2015. Common bean (Phaseolus vulgaris L.) and soya bean
(Glycine max) growth and nodulation as influenced by rock phosphate solubilizing
bacteria under pot grown conditions. Int. J. Agric. Policy Res. 5: 242-250.
Farooq, M., A. Wahid, N. Ahmad and S.A. Asad. 2010. Comparative efficacy of surface
drying and re-drying seed priming in rice: changes in emergence, seedling growth
and associated metabolic events. Paddy Water Environ. 8: 15-22.
Farooq, M., A. Wahid, N. Kobayashi, D. Fujita and S.M.A. Basra. 2009. Plant drought
stress: effects, mechanisms and management. Agron. Sust. Develop. 29: 185-212.
Fishal, E.M., S. Meon and W.M. Yun. 2010. Induction of tolerance to fusarium wilt and
defense-related mechanisms in the plantlets of susceptible Berangan Banana pre-
inoculated with Pseudomonas sp. (UPMP3) and Burkholderia sp. (UPMB3). Agri.
Sci. China 9: 1140-1149.
Fisher, D.B. 2000. Long distance transport. p. 730-784. In: B.B. Buchanan, W. Gruissem
and R. Jones (ed.) Biochemistry and molecular biology of plants. Am. Soci. Plant
Biol. Rockville.
Fleury D., J.S. Stephen, H. Kuchel and P. Langridge. 2010. Genetic and genomic tools to
improve drought tolerance in wheat. J. Exp. Bot. 61: 3199-3210.
Flexas, J. and H. Medrano. 2002. Drought-inhibition of photosynthesis in C-3 plants:
Stomatal and nonstomatal limitation revisited. Ann. Bot. 89: 183-1890.
Flexas, J., J. Bota, F. Loreto, G. Cornic and T.D. Sharkey. 2004. Diffusive and metabolic
limitations to photosynthesis under drought and salinity in C3 plants. Plant Biol.
6: 1-11.
Forchetti, G, O. Masciarelli, S. Alemano, D. Alvarez and G. Abdala. 2007. Endophytic
bacteria in sunflower (Helianthus annuus L.): isolation, characterization, and
production of jasmonates and abscisic acid in culture medium. Appl. Microbiol.
Biotechnol. 76: 1145-1152.
Forchetti, G., O. Masciarelli, M.J. Izaguirre, S. Alemano, D. Alvarez and G. Abdala.
2010. Endophytic bacteria improve seedling growth of sunflower under water
176
![Page 197: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/197.jpg)
stress, produce salicylic acid, and inhibit growth of pathogenic fungi. Curr.
Microbiol. 61: 485-93.
Furnkranz, M., B. Lukesch, H. Muller, H. Huss, M. Grube and G. Berg. 2011. Microbial
diversity inside pumpkins: microhabitat-specific communities display a high
antagonistic potential against phytopathogens. Microb. Ecol. doi:10.1007/s00248-
011-9942-4.
Gagne-Bourque, F., B.F. Mayer, J.B. Charron, H. Vali, A. Bertrand and S. Jabaji. 2015.
Accelerated growth rate and increased drought stress resilience of the model
grass Brachypodium distachyon colonized by Bacillus subtilis B26. PLoS ONE
10(6): e0130456. doi:10.1371/journal. pone.0130456
Gasser, I., M. Cardinale, H. Muller, S. Heller, L. Eberl, N. Lindenkamp, C. Kaddor, A.
Steinbuchel and G. Berg. 2011. Analysis of the endophytic lifestyle and plant
growth promotion of Burkholderia terricola ZR2-12. Plant Soil 347: 125-136.
Glick, B.R. 2005. Modulation of plant ethylene levels by the bacterial enzyme ACC
deaminase. FEMS Microbiol. Lett. 251: 1-7.
Glick, B.R. 2013. Bacteria with ACC deaminase can promote plant growth and help to
feed the world. Microbiol. Res. 169: 30-39.
Glick, B.R., D.M. Penrose and J.P. Li. 1998. A model for the lowering of plant ethylene
concentrations by plant growth-promoting bacteria. J. Theoretical. Biol. 190: 63-
68.
Glick, B.R., H.E. Brooks and J.J Pasternak. 1986. Physiological effects of plasmid DNA
transformation of Azotobacter vinelendi. Can. J. Microbiol. 32: 145-148.
Gomez-Lama Cabanas, C., E. Schiliro, A. Valverde-Corredor and J. Mercado-Blanco.
2014. The biocontrol endophytic bacterium Pseudomonas fluorescens PICF7
induces systemic defense responses in aerial tissues upon colonization of olive
roots. Front. Microbiol. 5:427.10.3389/fmicb.2014.00427
Gosal, S.S., S.H. Wani and K.S. Manjit. 2009. Biotechnology and drought tolerance. J.
Crop Imp. 23: 19-54.
Govindarajan, M., J. Balandreau, S.W. Kwon, H.Y. Weon and C. Lakshminarasimhan.
2008. Effects of the inoculation of Burkholderia vietnamensis and related
endophytic diazotrophic bacteria on grain yield of rice. Microb. Ecol. 55: 21-37.
Gray, E.J. and D.L. Smith. 2005. Intracellular and extracellular PGRP: commonalities and
distinctions in the plant-bacterium signaling processes. Soil Biol. Biochem. 37:
395-412.
177
![Page 198: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/198.jpg)
Guliyev, N., S. Bayramov and H. Babayev. 2008. Effect of water deficit on Rubisco and
carbonic anhydrase activities in different wheat genotypes. p. 1465-1468. In: J.F.
Allen, E. Gantt, J.H. Golbeck, and B. Osmond (ed.) Photosynthesis. Energy from
the Sun: 14th Int. Cong. Photosyn. Springer.
Gunatilaka, A.A.L. 2006. Natural products from plant-associated microorganisms:
distribution, structural diversity, bioactivity, and implications of their
occurrence. J. Nat. Prod. 69:509-526.
Gupta, G., J. Panwar, M. Akhtar and P. Jha. 2012. Endophytic nitrogen-fixing bacteria as
biofertilizer. p. 183-221. In: E. Lichtfouse (ed.) Sustainable agriculture reviews.
Springer, Netherlands.
Gupta, N.K., S. Gupta and A. Kumar. 2001. Effect of water stress on physiological
attributes and their relationship with growth and yield of wheat cultivars at
different stages. J. Agron. Crop Sci. 186: 55-62.
Gusain, Y.S., R. Kamal, C.M. Mehta, U.S. Singh and A.K. Sharma. 2015. Phosphate
solubilizing and indole-3-acetic acid producing bacteria from the soil of Garhwal
Himalaya aimed to improve the growth of rice. J. Environ. Biol. 36: 301-307.
Gusmaini, S.A. Aziz, A. Munif, D. Sopandie and N. Bermawie. 2013. Isolation and
selection of endophytic bacteria consortia from medicinal plant (Andrographis
Paniculata) as plant growth promoting agents. J. Agron. 12:113-121.
Hallmann, J., A. Quadt-Hallmann, W. Mahaffee, J. Kloepper. 1997. Bacterial endophytes
in agricultural crops. Can. J. Microbiol. 43: 895-914.
Hallmann, J. 2001. Plant interaction with endophytic bacteria. p.87-119. In: M.J. Jeger
and N.J Spence (eds). Biotic interaction in plant pathogen association. CAB
International, USA.
Harb, A., A. Krishnan, M.M.R. Ambavaram and A. Pereira. 2010. Molecular and
physiological analysis of drought stress in arabidopsis reveals early responses
leading to acclimation in plant growth. Plant Physiol. 154: 1254-1271.
Hardoim, P., L.V. Overbeek and J.V. Elsas. 2008. Properties of bacterial endophytes and
their proposed role in plant growth. Trends Microbiol. 16: 463-471.
Hardoim, P.R., A. Campisano, M. Doring and A. Sessitsch. 2015. The hidden world
within plants: ecological and evolutionary considerations for defining functioning
of microbial endophytes. Microbiol. Mol. Biol. Rev. 79: 293-320.
Harris, D., R.S. Tripathi and A. Joshi. 2002. On farm seed priming to improve crop
establishment and yield in dry direct seeded rice. p. 231-240. In: S. Pandey, M.
178
![Page 199: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/199.jpg)
Mortimer, L. Wade, T.P. Tuoung, K. Lopes and B. Hardy (ed.) Direst seedlings:
Research strategies and opportunities. Int. Res. Inst. Manila, Philippines.
Hatch, M.D. 1987. C4 photosynthesis: a unique blend of modified biochemistry, anatomy
and ultrastructure. Biochim. Biophys. Acta. 895: 81-106.
Haupt-Herting, S. and H.P. Fock. 2000. Exchange of oxygen and its role in energy
dissipation during drought stress in tomato plants. Physiol. Plant 110: 489-495.
Havaux, M. O. Canaani and S. Malkin. 1986. Photosynthetic response of leaves to water
stress, expressed by photoacoustics and related methods I. Probing the
photoacoustic method as a indicatoor for water stress in vivo II. The effect of
rapid drought on electron transport and the relative activities of the two
photosystems. Plant physiol. 82: 827-839.
Hayat, Q., S. Hayat, M.N. Alyemeni and A. Ahmad. 2012. Salicylic acid mediated
changes in growth, photosynthesis, nitrogen metabolism and antioxidant defense
system in Cicer arietinum L. Plant Soil Environ. 58: 417-423.
Hayat, R., S. Ali, U. Amara, R. Khalid and I. Ahmed. 2010. Soil beneficial bacteria and
their role in plant growth promotion: a review. Ann Microbiol. 60: 579-598.
Hedge, J.E. and B.T. Hofreiter. 1962. Methods in Carbohydrate Chemistry (17th Ed.).
Academic Press, New York.
Hepper, C.M. 1975. Extracellular polysaccharides of soil bacteria. In: N. Walker (ed) Soil
microbiology, a critical review. Wiley, New York, p. 93-111.
Hisar, O., P. Beydemir, I. Gulçin, P.A. Hisar, T. Yanik and O.I. Kufrevioglu. 2005. The
effects of melatonin hormone on carbonic anhydrase enzyme activity in rainbow
trout (Oncorhynchus mykiss) erythrocytes in vitro and in vivo. Turk. J. Vet. Anim.
Sci. 29: 841-845.
Holliday, P. 1989. A dictionary of plant pathology. Cambridge Univ. Press, Cambridge.
Honma, M. and T. Shimomura. 1978. Metabolism of 1-aminocyclopropane-1-carboxylic
acid. Agric. Biol. Chem. 43: 1825-1831.
Hopkins, W.G. 1995. Introduction to plant physiology, John Wiley and Sons, New York.
Huang, J. 1986. Ultrastructure of bacterial penetration in plants. Annu. Rev. Phytopathol.
24: 141-157.
Hussain, M., M.A. Malik, M. Farooq, M.Y. Ashraf and M.A. Cheema. 2008. Improving
drought tolerance by exogenous application of glycine betaine and salicyclic acid
in sunflower. J. Agron. Crop Sci. 194: 193-199.
179
![Page 200: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/200.jpg)
Hussain, M.B., Z.A. Zahir, H.N. Asghar and M. Asghar. 2015. Can catalase and
exopolysaccharides producing rhizobia ameliorate drought stress in wheat? Int. J.
Agric. Biol. 16: 3-13.
Iniguez, A.L., Y. Dong and E.W. Triplett. 2004. Nitrogen fixation in wheat provided by
Klebsiella pneumoniae 342. Mol. Plant Microbiol. Interact. 17: 1078-1085.
Iniguez, A.L., Y. Dong, H.D. Carter, B.M.M. Ahmer, J.M. Stone and E.W. Triplett. 2005.
Regulation of enteric endophytic bacterial colonization by plant defenses. Mol.
Plant Microb. Interact. 18: 169-178.
Ivanchenko, M.G., G.K. Muday and J.G. Dubrovsky. 2008. Ethylene-auxin interactions
regulate lateral root initiation and emergence in Arabidopsis thaliana. Plant J. 55:
335-347.
Jackson, M.L. 1962. Soil chemical analysis. Prentice Hall, Inc. Englewood Cliffs, New
York.
Jajarmi, V. 2009. Effects of water stress on germination indices in seven wheat cultivars.
World Academy Sci. Eng. Technol. 37: 105-106.
Jambunathan, N. 2010. Determination and detection of reactive oxygen species (ROS),
lipid peroxidation, and electrolyte leakage in plants. p. 291-297. In: R. Sunkar
(ed.) Plant Stress tolerance, methods in molecular biology Humana press,
Springer, New York Dordrecht, Heidelberg, London.
James, E.K., E.L. Olivares, A.L.M.D. Oliveira, F.B.J.D. Reis, L.G.D. Silva and V.M.
Reis. 2001. Further observations on the interaction between sugar cane and
Gluconobacter diazotrophicus under laboratory and greenhouse conditions. J.
Exp. Bot. 52: 747-760.
Jasim, H.S., M. Idris, A. Abdullah and A.A.H. Kadhum. 2014. Effects of
physicochemical soil properties on the heavy metal concentrations of Diplazium
esculentum (medicinal plant) from the UKM and Tasik Chini, Malaysia. Int. J.
Chem. Tech. Res. 6: 5519-5527.
Jha, P.N. and A. Kumar. 2007. Endophytic colonization of Typha australis by a plant
growth-promoting bacterium Klebsiella oxytoca strain GR-3 J. Appl. Microbiol.
103: 1311-1320.
Jones D.L. and P.R. Darrah. 1994. Role of root derived organic acids in the
mobilization of nutrients from the rhizosphere. Plant and Soil 166: 247-257.
Jordan, A., S. Haidacher, G. Hanel, E. Hartungen, L. Mark, H. Seehauser, R.
Schottkowsky, P. Sulzer and T.D. Mark. 2009. A high resolution and high
180
![Page 201: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/201.jpg)
sensitivity proton-transfer-reaction time-offlight mass spectrometer (PTR-TOF-
MS). Int. J. Mass Spectrom. 286: 122-128.
Josephine, F.S., V.S. Ramya, N. Devi, S.B. Ganapa, K.G. Siddalingeshwara, N.
Venugopal and T. Vishwanatha. 2012. Isolation, production and characterization
of protease from Bacillus Sp. isolated from soil sample. J. Microbiol. Biotech.
Res. 2: 163-168.
Kaaria, P., V. Matiru and M. Ndungu. 2012. Antimicrobial activities of secondary
metabolites produced by endophytic bacteria from selected indigenous Kenyan
plants. Afric. J. Microbiol. Res. 6: 7253-7258.
Kamara A.Y., A. Menkir, B. Badu-Apraku and O. Ibikunle. 2003. The influence of
drought stress on growth, yield and yield components of selected maize
genotypes. J. Agr. Sci. 141: 43-50.
Kaya, M.D., G. Okcu, M. Atak, Y. Cikili and O. Kolsarici. 2006. Seed treatments to
overcome salt and drought stress during germination in sunflower (Helianthus
annuus L.). J. Agron. 24: 291-295.
Kettlewell, P.S., W.L. Heath and I.M. Haigh. 2010. Yield enhancement of droughted
wheat by film antitranspirant application: Rationale and evidence. Agric. Sci. 1:
143-147.
Khalid, A., M. Arshad and Z.A. Zahir. 2004. Screening plant growth promoting
rhizobacteria for improving growth and yield of wheat. J. Appl. Microbiol. 46:
473-480.
Khan, A.L., M. Hamayun, S.M. Kang, Y.H. Kim, H.Y. Jung, J.H. Lee and I. Lee. 2012.
Endophytic fungal association via gibberellins and indole acetic acid can improve
plant growth under abiotic stress: an example of Paecilomyces formosus LHL10
C. Microbiol. 12: 3. doi: 10.1186/1471-2180-12-3.
Khan, N.A. 1994. Variation in carbonic anhydrase activity and its relationship with
photosynthesis and dry mass of mustard. Photosynthetica 30: 317-320.
Khan, N.A., S. Singh, N.A. Anjum and R. Nazar. 2008. Cadmium effects on carbonic
anhydrase, photosynthesis, dry mass and antioxidative enzymes in wheat
(Triticum aestivum) under low and sufficient zinc. J. Plant Interact. 3: 31-37.
Kim, Y.C., B.R. Glick, Y. Bashan and C.M. Ryu. 2012. Enhancement of plant drought
tolerance by microbes. p. 383-413. In: R. Aroca (ed.) Plant responses to drought
stress: from morphological to molecular features. Springer-Verlag, Berlin,
Heidelberg.
181
![Page 202: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/202.jpg)
Kishor, P.B.K., Z. Hong, G.H. Miao, C.A.A. Hu and D.P.S. Verma.1995. Overexpression
of Δ1-pyrroline-5-carboxylate synthetase increases proline production and confers
osmotolerance in transgenic plants. Plant Physiol. 108: 1387-1394.
Kloepper, J.W. and M.N. Schroth. 1978. Plant growth promoting rhizobacteria on
radishes. p. 879-882. In: Proc. 4th Int. Conf. Plant Path. Bact. Angers, France.
Kobayashi, D.Y. and J.D. Palumbo. 2000. Bacterial endophytes and their effects on plants
and uses in agriculture. In: C.W. Bacon and J.F. Jr. White (eds.) Microbial
endophytes. Dekker, New York, p. 199-233.
Konnova, S.A., O.S. Brykova, O.A. Sachkova, I.V. Egorenkova and V.V. Ignatov. 2001.
Protective role of the polysaccharide containing capsular components of
Azospirillum brasilense. Microbiol. 70: 436-440.
Koutsompogeras, P., A. Kyriacou and I. Zabetakis. 2007. The formation of 2,5-dimethyl-
4-hydroxy-2H-furan-3-one by cell-free extracts of Methylobacterium
extorquens and strawberry (Fragaria x ananassa cv. Elsanta). Food Chem. 104:
1654-1661.
Kpomblekou, K. and M.A. Tabatabai. 1994. Effect of organic acids on release of
phosphorus from phosphate rocks. Soil Sci. 158: 442-453.
Kuklinsky-Sobral, J., W. Araujo, R. Mendes, I. Geraldi, A. Pizzirani-Kleiner and J.
Azevedo. 2004. Isolation and characterization of soybean-associated bacteria and
their potential for plant growth promotion. Environ. Microbiol. 6: 1244-1251.
Labuschagne, N., T. Pretorius and A.H. Idris. 2010. Plant growth promoting rhizobacteria
as biocontrol agents against soil-borne plant diseases. p. 211-230. In: D.K.
Maheshwari (ed.) Plant growth and health promoting bacteria, microbiology
monographs. Springer, Verlag, Berlin, Heidelberg.
Ladha, J.K. and P.M. Reddy. 1995. Extension of nitrogen fixation to rice: Necessity and
possibilities. Geo J. 35: 363-372.
Lamb, T.G., D.W. Tonkyn and D.A. Kluepfel. 1996. Movement of Pseudomonas
aureofaciens from the rhizosphere to aerial plant tissue. Can. J. Microbiol. 42:
1112-1120.
Lee, S., M. Flores-Encarnacion, M. Contreras-Zentella, L.Garcia- Flores, J.E. Escamilla
and C. Kennedy. 2004. Indole-3-acetic acid biosynthesis is deficient in
Gluconacetobacter diazotrophicus strains with mutations in cytochrome C
biogenesis genes. J. Bacteriol. 186: 5384-539.
182
![Page 203: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/203.jpg)
Lepetz, V., M. Massot, D.S. Schmeller and J. Clobert. 2009. Biodiversity monitoring:
some proposals to adequately study species’ responses to climate change.
Biodivers. Conserv. 18: 3185-3203.
Li, X., J. Hou, K. Bai, X. Yang, J. Lin, Z. Li and T. Kuang. 2004. Activity and
distribution of carbonic anhydrase in leaf and ear parts of wheat (Triticum
aestivum L.). Plant Sci.166: 627-632s.
Li, Z. J., Q.H. Luo. W. M. Wu, and L. Han. 2009. The effects of drought stress on
photosynthetic and chlorophyll fluorescence characteristics of Populus euphratica
and P. pruinosa. Arid Zone Res. 24: 5-9.
Lins, M.R.C.R., J.M. Fontes, N.M. Vasconcelos, D.M.S. Santos, O.E. Ferriera, J.L.
Azevedo, J.M. Araujo and G.M.S. Lima. 2014. Plant growth promoting potential
of endophytic bacteria isolated from cashew leaves. Afr. J. Biotech. 13: 3360-
3365.
Lisar, S.Y.S., R. Motafakkerazad, M.M. Hossain and I.M.M. Rahman. 2012. Water
Stress in Plants: Causes, effects and responses. In: I.M.M. Rahman (ed.) Water
Stress, In Tech, New York, USA, doi: 10.5772/39363.
Liu, B., H. Qiao, L. Huang, H. Buchenauer, Q. Han, Z. Kang and Y. Gong. 2009.
Biological control of take-all in wheat by endophytic Bacillus subtilis E1R-j and
potential mode of action. Biol. Cont. 49: 277-285.
Liu, Y., G. Fiskum and D. Schubert. 2002. Generation of reactive oxygen species by
mitochondrial electron transport chain. J. Neurochem. 80: 780-787.
Loaces, I., L. Ferrando and A.F. Scavino. 2011. Dynamics, diversity and function of
endophytic siderophore-producing bacteria in rice. Microb. Ecol. 61: 606-618.
Long, H.H., D.D. Schmidt and I.T. Baldwin. 2008. Native bacterial endophytes promote
host growth in a species-specific manner; phytohormone manipulations do not
result in common growth responses. PLoS ONE 3:2702.
doi:10.1371/journal.pone.0002702
Lopez-Fernnndez, S., P. Sonego, M. Moretto, M. Pancher, K. Engelen, I. Pertot and A.
Campisano. 2015. Whole-genome comparative analysis of virulence genes unveils
similarities and differences between endophytes and other symbiotic bacteria.
Front. Microbiol. 6:419. doi: 10.3389/fmicb.2015.00419.
Lucangeli, C. and R. Bottini. 1997. Effects of Azospirillum spp. on endogenous
gibberellin content and growth of maize (Zea mays L.) treated with uniconazole.
Symbiosis 23: 63-72.
183
![Page 204: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/204.jpg)
Luquet, D., A. Vidal, M. Smith and J. Dauzat. 2005 ‘More crop per drop’: how to make it
acceptable for farmers? Agric. Water Manag. 76:108-119.
MacFaddin, J.F. 1980. Biochemical tests for identification of medical bacteria. Williams
and Wilkins, Baltimore, USA.
Madhaiyan, M., S. Poonguzhali, J. Ryu and T. Sa. 2006. Regulation of ethylene levels in
canola (Brassica campestris) by 1-aminocyclopropane- 1-carboxylate deaminase-
containing Methylobacterium fujisawaense. Planta 224: 268-278.
Madi, L. and Y. Henis. 1989. Aggregation in Azospirillum brasilense Cd: conditions and
factors involved in cell-to-cell adhesion. Plant Soil 115: 89-98.
Mahaffee, M.F. and J.W. Klopper. 1997. Department of plant pathology, Alabama
Agriculture experiment station, Biological control institute, Auburn University,
AL. 26849, U.S.A
Mahaffee, W.F., E.M. Bauske, J.W.L.V. Vuurde, M.V.D. Wolf, M.V.D. Brink and J.W.
Kloepper. 1997. Comparative analysis of antibiotic resistance, immunofluorescent
colony staining, and a transgenic marker (bioluminescence) for monitoring the
environmental fate of a rhizobacterium. Appl. Environ. Microbiol. 63: 1617-1622
Majeed, A., M.K. Abbasi, S. Hameed, A. Imran and N. Rahim. 2015. Isolation and
characterization of plant growth-promoting rhizobacteria from wheat rhizosphere
and their effect on plant growth promotion. Front. Microbiol. 6:198. doi:
10.3389/fmicb.2015.00198
Malfanova, N., F. Kamilova, S. Validov, A. Shcherbakov, V. Chebotar, I. Tikhonovich
and B. Lugtenberg. 2011. Characterization of Bacillus subtilis HC8, a novel plant-
beneficial endophytic strain from giant hogweed. Microb. Biotech. 4: 523-532.
Malfanova, N., F. Kamilova, S. Validov, V. Chebotar and B. Lugtenberg. 2013. Is L-
arabinose important for the endophytic lifestyle of Pseudomonas spp.? Arch
Microbiol. 195: 9-17.
Malinowski, D.P., G.A. Alloush and D.P. Belesk. 2000. Leaf endophyte Neotyphodium
coenophialum modifies mineral uptake in tall fescue. Plant Soil Sci. 227: 115-126.
Manivannan, P., C.A. Jaleel, R. Somasundaram and R. Panneerselvam. 2008.
Osmoregulation and antioxidant metabolism in drought-stressed Helianthus
annuus under triadimefon drenching. C.R. Biol. 331: 418-425.
Marasco, R., E. Rolli, B. Ettoumi, G. Vigani, F. Mapelli, S. Borin, A.F. Abou-Hadid,
U.A. El-Behairy, C. Sorlini, A. Cherif, G. Zocchi and D. Daffonchio. 2012. A
184
![Page 205: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/205.jpg)
drought resistance-promoting microbiome is selected by root system under desert
farming. PLoS ONE 7: e48479 doi: 10.1371/journal.pone.0048479.
Marasco, R., E. Rolli, G. Vigani, S. Borin, C. Sorlini, H. Ouzari, G. Zocchi and
D. Daffonchio. 2013. Are drought-resistance promoting bacteria cross-compatible
with different plant models? Plant Signal. Behav. 8: e26741 doi:
10.4161/psb.26741.
Mary, J.G., J.C. Stark, K.O. Brien and E. Souza, 2001. Relative sensitivity of spring
wheat grain yield and quality parameters to moisture deficit. Crop Sci. 41: 327-
335.
Mayak, S., T. Tirosh and B.R. Glick. 2004. Plant growth-promoting bacteria that confer
resistance to water stress in tomato and pepper. Plant Sci. 166: 525-530.
Mazhar, M., M. Nawaz, A.I. Mirza and K. Khan. 2015. Socio-political impacts of
meteorological droughts and their spatial patterns in Pakistan. South As. Stud. 30:
149-157.
McCully M.E. 2001. Niches for bacterial endophytes in crop plants: a plant biologist’s
view. Aust. J. Plant. Physiol. 28: 983-990
Mehta, S. and C.S. Nautiyal. 2001. An efficient method for qualitative screening of
phosphate solubilizing bacteria. Curr. Microbiol. 43: 57-58.
Melloul, M., D. Iraqi, M. El Alaoui, G. Erba, S. Alaoui, M. Ibriz and E. Elfahime. 2014.
Identification of differentially expressed genes by cDNA-AFLP technique in
response to drought Stress in Triticum durm. Food Technol. Biotechnol. 52: 479-
488.
Melnick, R., N. Zidack, B. Bailey, S. Maximova, M. Guiltinan and P. Backman. 2008.
Bacterial endophytes: Bacillus spp. from annual crops as potential biological
control agents of black pod rot of cacao. Biol. Cont. 46: 46-56.
Mendes, R., A.A. Pizzirani-Kleiner, W.L. Araujo and J.M. Raaijmakerset. 2007.
Diversity of cultivated endophytic bacteria from sugarcane: genetic and
biochemical characterization of Burkholderia cepacia complex isolates. Appl.
Environ. Microbiol. 73: 7259-7267.
Meneses, C.H.S.G., L.F.M. Rouw, J.L. Simoes-Araujo, M.S. Vidal and J.I. Baldani. 2011.
Exopolysaccharide production is required for biofilm formation and plant
colonization by the nitrogen-fixing endophyte Gluconacetobacter diazotrophicus.
Mol. Plant-Microb Interact. 24: 1448-58.
185
![Page 206: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/206.jpg)
Merzaeva, D.V. and I.G. Shirokikh. 2010. The production of auxins by the endophytic
bacteria of winter rye. Appl. Biochem. Microbiol. 46: 44-50.
Milosevic, T., N. Milosevic and I. Glisic. 2012. Effect of tree conduce on the precocity,
yield and fruit quality in apricot on acidic soil. Rev. Cien. Agron. 43: 177-183.
Mishra, V. and K. A. Cherkauer. 2010. Retrospective droughts in the crop growing
season: Implications to corn and soybean yield in the Midwestern United States,
Agri. For. Meteorol. 50: 1030-1045.
Misra, A.K. 2014. Climate change and challenges of water and food security. Int. J. Sust.
Built Environ. 3: 153-165.
Mittler, R. 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7:
405-410.
Mogensen, V.O., H.E. Jensen and M.A. Rab. 1985. Grain yield, yield components,
drought sensitivity and water use efficiency of spring wheat subjected to water
stress at various growth stages. Irrigation Sci. 6: 131-140.
Moller, I.M., P.E. Jensen and A. Hansson. 2007. Oxidative modifications to cellular
components in plants. Annu. Rev. Plant Physiol. 58: 459-481.
Montanez, A, A.R. Blanco, C. Barlocco and M. Beracochea. 2012. Characterization of
cultivable putative endophytic plant growth promoting bacteria associated with
maize cultivars (Zea mays L.) and their inoculation effects in vitro. Appl. Soil
Ecol. 58: 21-28.
Montesinos, E. 2003. Development, registration and commercialization of microbial
pesticides for plant protection. Int. Microbiol. 6: 245-252.
Moodie, C.D., H.W. Smith and R.A. McCreery. 1959. Laboratory Manual for Soil
Fertility. Department of Agronomy, State College of Washingtion Pullman,
Washington, USA. p. 1-75.
Moreno-Gutierrez, C., G. Battipaglia, P. Cherubini, M. Saurer, E. Nicolas, S. Contreras
and J.I. Querejeta. 2012. Stand structure modulates the long-term vulnerability of
Pinus halepensis to climatic drought in a semiarid Mediterranean ecosystem. Plant
Cell Environ. 35: 1026-1039.
Morrissey, J.P., J.M. Dow, G.L. Mark and F.O. Gara. 2004. Are microbes at the root of a
solution to world food production. EMBO Rep. 5: 922-926.
Mujtaba, S.M. and S.M. Alam. 2002. Drought phenomenon and crop growth.
http://www.Pakistaneconomist. com/issue2002/issue13/i&e4.htm
186
![Page 207: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/207.jpg)
Muthukumarasamy, R., I. Cleenwerck, G. Revathi, M. Vadivelu, D. Janssens, B. Hoste,
K.U. Gum, K. Park, C.Y. Son, T. Sa and J. Caballero-Mellado. 2005. Natural
association of Gluconoacetobacter diazotrophicus and diazotrophic Acetobacter
peroxydans with wetland rice. Syst. Appl. Microbiol. 28: 277-286.
Nadeem, S.M., Z.A. Zahir, M. Naveed, M. Arshad and S.M. Shahzad. 2006. Variation in
growth and ion uptake of maize due to inoculation with plant growth promoting
rhizobacteria under salt stress. Soil Environ. 25: 78-84.
Nagarajkumar, M., R. Bhaskaran and R. Velazhahan. 2004. Involvement of secondary
metabolites and extracellular lytic enzymes produced by Pseudomonas
fluorescens in inhibition of Rhizoctonia solani, the rice sheath blight
pathogen. Microbiol. Res. 159: 73-81.
Nakano, Y. and K. Asada. 1981. Hydrogen peroxide is scavenged by ascorbate-specific
peroxidase in spinach chloroplasts. Plant Cell Physiol. 22: 867-280.
Nasopoulou, C., J. P. Pohjanen, J.J. Koskimaki, I. Zabetakis and A.M. Pirttila. 2014.
Localization of strawberry (Fragaria × ananassa) and Methylobacterium
extorquens genes of strawberry flavour biosynthesis in strawberry tissue by in situ
hybridization. J. Plant Physiol. 171: 1099-1105.
Navari-izzo, F. and N. Rascio. 1999. Plant response to water deficit conditions. Handbook
of plant and crop stress. Marcel Dekker Inc., New York, p 231-270.
Naveed, M., M.B. Hussain, Z. A. Zahir, B. Mitter and A. Sessitsch. 2014a. Drought
stress amelioration in wheat through inoculation with Burkholderia phytofirmans
strain PsJN. Plant Growth Regul. 73:121-131.
Naveed, M., B. Mittera, T.G. Reichenauer, K. Wieczorekc and A. Sessitsch. 2014b.
Increased drought stress resilience of maize through endophytic colonization by
Burkholderia phytofirmans PsJN and Enterobacter sp. FD17. Environ. Exp. Bot.
97: 30-39.
Nawangsih, A.A., I. Damayanti, S. Wiyono and J.G. Kartika. 2011. Selection and
characterization of endophytic bacteria as biological control agents of tomato
bacteria wilt disease. Hayati. 18: 66-70.
Nawaz, A., M. Farooq, S.A. Cheema, A. Yasmeen and A. Wahid. 2013. Stay green
character at grain filling ensures resistance against terminal drought in wheat. Int.
J. Agri. Biol. 15: 1272-1276.
Neilands, J.B. and K. Nakamura. 1991. In: CRC handbook of microbial iron
chelates. Winkelmann G, editor. Florida: CRC Press; 1991. p. 1-14.
187
![Page 208: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/208.jpg)
Nezhadahmadi, A., Z.H. Prodhan and F. Golam. 2013. Drought tolerance in wheat. Sci.
World J. doi:10.1155/2013/610721.
Nogueira, R.J.M.C., J.A.P.M. Moraes, H.A. Burity and E.B. Neto. 2001. Modifications in
vapor diffusion resistance of leaves and water relations in barbados cherry plants
under water stress. R. Bras. Fisiol. Veg. 13: 75-87.
Nogues, S. and N.R. Baker. 2000. Effects of drought on photosynthesis in Mediterranean
plants grown under enhanced UV-B radiation. J. Exp. Bot. 51: 1309-1317.
Nonami, H. 1998. Plant water relations and control of cell elongation at low water
potentials. J. Plant Res. 111: 373-382.
Okabe, K., A. Lindlar, M. Tsuzuki and S. Miyachi. 1980. Effects of carbonic anhydrase
on ribulose 1,5-bisphosphate carboxylase and oxygenase. FEBS Lett. 114: 142-
144.
Okunishi, S., K. Sako, H. Mano, A. Imamura and H. Morisaki. 2005. Bacterial flora of
endophytes in the maturing seed of cultivated rice (Oryza sativa). Microb.
Environ. 20: 168-177.
Oteino, N., R.D. Lally, S. Kiwanuka, A. Lloyd, D. Ryan, K.J. Germaine and D.N.
Dowling. 2015. Plant growth promotion induced by phosphate solubilizing
endophytic Pseudomonas isolates. Front. Microbiol. 6: 1-9.
Overvoorde, P., H. Fukaki, T. Beeckman. 2010. Auxin control of root development. Cold
Spring Harb. Perspect. Biol. 2: 1-16.
Owen, N.L. and N. Hundley. 2004. Endophytes the chemical synthesizers inside plants.
Sci. Prog. 87: 79-99.
Pakistan Economic Survey, 2014-15. Government of Pakistan, Finance Division.
Economic Adviser Wing, Islamabad.
Parry, M.L., O.F. Canziani, J.P. Palutikof, P.J.V.D. Linden and C.E. Hanson. Climate
Change 2007: Impacts, adaptation and vulnerability. Contribution of working
group II to the fourth assessment report of the intergovernmental panel on climate
change. Cambridge Univ. Press, Cambridge, United Kingdom.
Patel, P.P., P.M. Rakhashiya, K.S. Chudasama and V.S. Thaker. 2012. Isolation,
purification and estimation of zeatin from Corynebacterium aurimucosum. Eur. J.
Exp. Biol. 1: 1-8.
Perez-Garcia, A., D. Romero and A.D. Vicente. 2011. Plant protection and growth
stimulation by microorganisms: biotechnological applications of Bacilli in
agriculture. Curr. Opin. Biotechnol. 22:187-193.
188
![Page 209: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/209.jpg)
Perez-Martin, A., C. Michelazzo, J.M. Torres-Ruiz, J. Flexas, J.E. Fernandez, L.
Sebastiani and A. Diaz-Espejo. 2014. Regulation of photosynthesis and stomatal
and mesophyll conductance under water stress and recovery in olive trees:
correlation with gene expression of carbonic anhydrase and aquaporins. J. Exp.
Bot. 65: 3143-3156.
Pillay, V.K. and J. Nowak. 1997. Inoculum density, temperature, and genotype effects on
in vitro growth promotion and epiphytic and endophytic colonization of tomato
(Lycopersicon esculentum L.) seedlings inoculated with a Pseudomonas
bacterium. Can. J. Microbiol. 43: 354-361.
Pinedo, I., T. Ledger, M. Greve and M.J. Poupin. 2015. Burkholderia phytofirmans PsJN
induces long-term metabolic and transcriptional changes involved in Arabidopsis
thaliana salt tolerance. Front plant Sci. 6: 466.
Poupin, M.J., T. Timmermann, A. Vega, A. Zuniga and B.G. Alez. 2013. Effects of the
plant growth-promoting bacterium Burkholderia phytofirmans PsJN throughout
the Life Cycle of Arabidopsis thaliana. PLoS ONE 8: e69435.
doi:10.1371/journal.pone.0069435
Prasad M.P. and S. Dagar. 2014. Identification and characterization of endophytic
bacteria from fruits like avacado and black grapes. Int. J. Curr. Microbiol. App.
Sci. 3: 937-947.
Price, A.H., J.E. Cairns, P. Horton, H.G. Jones and H. Griffiths. 2002. Linking drought-
resistance mechanisms to drought avoidance in upland rice using a QTL approach:
progress and new opportunities to integrate stomatal and mesophyll responses. J.
Exp. Bot. 53: 989-1004.
Puente, M.E., C.Y. Li and Y. Bashan. 2009a. Rock-degrading endophytic bacteria in
cacti. Environ. Exp. Bot. 66: 389-401.
Puente, M.E., C.Y. Li, and Y. Bashan. 2009b. Endophytic bacteria in cacti seeds can
improve the development of cactus seedlings. Environ. Exp. Bot. 66: 402-408.
Quadt-Hallmann, A., N. Benhamou and J.W. Kloepper. 1997. Bacterial endophytes in
cotton: mechanisms of entering the plant. Can. J. Microbiol. 43: 577-582.
Raaijmakers, J.M., and D.M. Weller. 2001. Exploiting the genetic diversity of
Pseudomonas spp: characterization of superior colonizing P. fluorescens strain
Q8r1-96. Appl. Environ. Microbiol. 67: 2545-2554.
189
![Page 210: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/210.jpg)
Rajput, L., A. Imran, F. Mubeen and F.Y. Hafeez. 2013. Salt-tolerant PGPR
strain Planococcus rifietoensis promotes the growth and yield of wheat (Triticum
aestivum L.) cultivated in saline soil. Pak. J. Bot. 45: 1955-1962.
Ramakers, C, J.M. Ruijter, R.H. Deprez, A.F. Moorman . 2003. Assumption-free analysis
of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett..
339: 62-6.
Ramanan, R., K. Kannan, S.D. Sivanesan and T. Chakrabarti. 2009. Bio-sequestration of
carbon dioxide using carbonic anhydrase enzyme purified from Citrobacter
freundii. W. J. Microbiol. Biotechnol. 25: 981-987.
Ramesh, R., A.A. Joshi and M.P. Ghanekar. 2009. Pseudomonads: major antagonistic
endophytic bacteria to suppress bacterial wilt pathogen, Ralstonia solanacearum
in the eggplant (Solanum melongena L.). World J. Microbiol. Biotechnol. 25: 47
55.
Ramos, H.J.O., M.G. Yates, F.O. Pedrosa and E.M. Souza. 2011. Strategies for bacterial
tagging and gene expression in plant-host colonization studies. Soil Biol.
Biochem. 43: 1626-1638.
Randall, D.A., R.A. Wood, S. Bony, R. Colman, T. Fichefet, J. Fyfe, V. Kattsov, A.
Pitman, J. Shukla, J. Srinivasan, R.J. Stouffer, A. Sumi and K.E. Taylor. 2007.
Climate models and their evaluation. In: S. Solomon, D. Qin, M. Manning, Z.
Chen, M. Marquis, K.B. Averyt, M. Tignor and H.L. Miller (ed.) Climate Change
2007: The Physical Science Basis. Contribution of Working Group I to the Fourth
Assessment Report of the Intergovernmental Panel on Climate Change.
Cambridge Univ. Press, Cambridge, United Kindom, New York, USA.
Raven, J.A. 1995. Photosynthetic and non-photosynthetic roles of carbonic anhydrase in
algae and cyanobacteria. Phycologia 34: 93-101.
Raza, M.A.S., M.F. Saleem, M.Y. Ashraf, A. Ali and H.N Asghar. 2012. Glycine betaine
applied under drought improved the physiological efficiency of wheat (Triticum
aestivum L.) plant. Soil Environ. 31: 67-71.
Reddy, A.R., K.V. Chaitanya and M. Vivekanandan. 2004. Drought induced responses of
photosynthesis and antioxidant metabolism in higher plants. J. Plant Physiol. 161:
1189-1202.
Reguera, M., Z. Peleg and E. Blumwald. 2012. Targeting metabolic pathways for genetic
engineering abiotic stress-tolerance in crops. Biochim. Biophys. Acta.1819: 186-
194.
190
![Page 211: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/211.jpg)
Reinhold-Hurek, B. T. Hurek T. 1998. Interactions of gramineous plants with Azoarcus
spp. and other diazotrophs: Identification, localization, and perspectives to study
their function. Crit. Rev. Plant Sci. 17: 29-54.
Reinhold-Hurek, B., T. Maes, S. Gemmer, M.Van. Montagu and T. Hurek. 2006. An
endoglucanase is involved in infection of rice roots by the not cellulose
metabolizing endophyte Azoarcus sp. strain BH72. Mol. Plant-Microb. Interact.
19: 181-188.
Roberson, E.B. and M.K. Firestone. 1992. Relationship between desiccation and
exopolysaccharide production in soil Pseudomonas sp. Appl. Environ. Microbiol.
58: 1284-1291.
Rodriguez, H., R. Fraga, T. Gonzalez and Y. Bashan. 2006. Genetics of phosphate
solubilization and its potential applications for improving plant growth-promoting
bacteria. Plant Soil 287: 15-21.
Roncato-Maccari, L.D.B., H.J.O. Ramos, F.O. Pedrosa, Y. Alquini, L.S. Chubatsu, M.G.
Yates, L.U. Rigo, M.B.R. Steffens and E.M. Souza. 2003. Endophytic
Herbaspirillum seropedicae expresses nif genes in gramineous plants. FEMS
Microbiol. Ecol. 45: 39-47.
Rosenblueth, M. and E. Martinez-Romero. 2006. Bacterial endophytes and their
interactions with hosts. Mol. Plant Microb. 19: 827-837.
Rothballer, M., B. Eckert, M. Schmid, A. Fekete, M. Schloter, A. Lehner, S. Pollmann
and A. Hartmann. 2008. Endophytic root colonization of gramineous plants by
Herbaspirillum frisingense. FEMS Microbiol. Ecol. 66: 85-95.
Roy, N. and M.R. Habib. 2009. Isolation and characterization of xylanase producing
strain of Bacillus cereus from soil. Iran. J. Mirobiol. 2: 49-53.
Ryan, R.P., K. Germaine, A. Franks, D.J. Ryan and D.N. Dowling. 2008. Bacterial
endophytes: recent developments and applications. FEMS Microbiol. Lett. 278: 1-
9.
Ryu, C.M., B.R. Kang, S.H. Han, S.M. Cho, J.W. Kloepper, A.J. Anderson and Y.C.
Kim. 2007. Tobacco cultivars vary in induction of systemic resistance
against Cucumber mosaic virus and growth promotion by Pseudomonas
chlororaphis O6 and its gacS mutant. Eur. J. Plant Pathol. 119: 383-390.
Ryu, R.J. and C.L. Patten. 2008. Aromatic amino acid-dependent expression of indole-3-
pyruvate decarboxylase is regulated by TyrR in Enterobacter cloacae UW5. J.
Bacteriol. 190: 7200-7208.
191
![Page 212: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/212.jpg)
Sadasivam, S. and A. Manickam. 1992. Biochemical methods for agricultural sciences.
Wiley Eastern Ltd., New Delhi, India.
Safarnejad, A. 2004. Characterization of somaclones of Medicago sativa L. for drought
tolerance. J. Agric. Sci. Technol. 6: 121-127.
Sakuma, Y., K. Maruyama, Y. Osakabe, Q. Feng, M. Seki, K. Shinozaki and K.
Yamaguchi-Shinozaki. 2006. Functional analysis of an arabidopsis transcription
factor, DREB2A, involved in drought-responsive. Plant Cell 18: 1292-309.
Saravanakumar, D., M. Kavino, T. Raguchander, P. Subbian and R. Samiyappan. 2011.
Plant growth promoting bacteria enhance water stress resistance in green gram
plants. Acta Physiol. Plant 33:203-209.
Sarwar, M., M. Arshad, D.A. Martens and W.T. Jr. Frankenberger. 1992. Tryptophan
dependent biosynthesis of auxins in soil. Plant Soil. 147: 207-215.
Scherwinski, K., R. Grosch and G. Berg. 2008. Effect of bacterial antagonists on lettuce:
active biocontrol of Rhizoctonia solani and negligible, short-term effects on non-
target microorganisms. FEMS Microbiol. Ecol. 64: 106-16.
Schmid, M., J.I. Baldani and A. Hartmann. 2006. The genus Herbaspirillum. The
Prokaryotes 5: 141-50.
Schroeder, J.I., G.J. Allen, V. Hugouvieux, J.M. Kwak and D. Waner. 2001. Guard cell
signal transduction. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52: 627-658.
Schulz, B. and C. Boyle. 2005. The endophytic continuum. Mycol. Res. 109: 661-686.
Schulz, B. and C. Boyle. 2006. What are endophytes? p. 1-13. In: B. Sculz, C. Boyle and
T.N. Sieber (eds.) Microbial root endophytes. Springer-Verlag, Berlin,
Heidelberg.
Schwyn, B. and J.B. Neilands. 1987. Universal chemical assay for the detection and
determination of siderophores. Anal. Biochem. 160: 47-56.
Seki, M., M. Narusaka, J. Ishida, T. Nanjo, M. Fujita, Y. Oono, A. Kamiya, M.
Nakajima, A. Enju, T. Sakurai, M. Satou, K. Akiyama, T. Taji, K. Yamaguchi-
Shinozaki, P. Carninci, J. Kawai, Y. Hayashizaki and K. Shinozaki. 2002.
Monitoring the expression profile of 7000 arabidopsis genes under drought cold
and high-salinity stresses using a full length cDNA Mircoroarray. Plant J. 279-
292.
Sessitsch, A., B. Reiter, U. Pfeifer and E. Wilhelm. 2002. Cultivation-independent
population analysis of bacterial endophytes in three potato varieties based on
192
![Page 213: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/213.jpg)
eubacterial and Actinomycetes-specific PCR of 16S rRNA genes FEMS
Microbiol. Ecol. 39: 23-32.
Sevilla, M., R.H. Burris, N. Gunapala and C. Kennedy. 2001. Comparison of benefit to
sugarcane plant growth and 15N incorporation following inoculation of sterile
nitrogen fixation outside and inside plant tissues19 plants with Acetobacter
diazotrophicus wild-type and Nif- mutant strains. Mol. Plant-Microb. Interact. 14:
358-366.
Sgherri, C.L.M., M. Maffei and F. Navari-Izzo. 2000. Antioxidative enzymes in wheat
subjected to increasing water deficit and rewatering. J. Plant Physiol. 157: 273-
279.
Sgroy, V., F. Cassan, O. Masciarelli, M.F. Del Papa, A. Lagares and V. Luna. 2009.
Isolation and characterization of endophytic plant growth-promoting (PGPB) or
stress homeostasis-regulating (PSHB) bacteria associated to the halophyte
Prosopis strombulifera. Appl. Microbiol. Biotech. 85: 371-381.
Shakir, M.A., B. Asghari and M. Arshad. 2012. Rhizosphere bacteria containing ACC
deaminase conferred drought tolerance in wheat grown under semi-arid climate.
Soil Environ. 31: 108-112.
Sharma, A. and B.N. Johri. 2003. Growth promoting influence of siderophore-producing
Pseudomonas strains GRP3A and PRS9 in maize (Zea mays L.) under iron
depriving conditions. Microbiol. Res. 158: 243-248.
Sheibani-Tezerji, R., T. Rattei, A. Sessitsch, F. Trognitz and B. Mitter. 2015.
Transcriptome profiling of the endophyte Burkholderia phytofirmans PsJN
indicates sensing of the plant environment and drought stress. mBio 6:e00621-15.
doi:10.1128/mBio.00621-15.
Sheramati, I, S. Tripathi, A. Varma and R. Oelmuller. 2008. The root-colonizing
endophyte Piriformaspora indica confers drought tolerance in arabidopsis by
stimulating the expression of drought stress-related genes in leaves. Mol. Plant
Microb. Interact. 2: 799-807
Shi, Y., K. Lou, and C. Li. 2010. Growth and photosynthetic efficiency promotion of
sugar beet (Beta vulgaris L.) by endophytic bacteria. Photosyn. Res. 105: 5-13.
Shinozaki, K. and K. Yamaguchi-Shinozaki. 2007. Gene networks involved in drought
stress response and tolerance. J. Exp. Bot. 58: 221-227.
193
![Page 214: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/214.jpg)
Shinozaki, K., K. Yamaguchi-Shinozaki and M. Seki. 2003. Regulatory network of gene
expression in the drought and cold stress responses. Curr. Opin. Plant Biol. 6:
410-417.
Shokri, D. and G. Emtiazi. 2010. Indole-3-acetic acid (IAA) production in symbiotic and
non-symbiotic nitrogen-fixing bacteria and its optimization by Taguchi design.
Curr. Microbiol. 61: 217-225.
Silva, E.C., R.J.M.C. Nogueira, A.D.N. Azevedo and V.F. Saints. 2003. Stomatal
behavior and potential leaf water on three woody species grown under water
stress. Acta. Bot. Bras. 17: 231-246.
Singleton, V.L., R. Orthofer and R.M. Lamuela-Raventos. 1999. Analysis of total phenols
and other oxidation substrates and antioxidants by means of Folin-Ciocalteu
reagent. Methods Enzymol.1299: 152- 178.
Sly, W.S. and P.Y. Hu. 1995. Human carbonic anhydrases and carbonic anhydrase
deficiencies. Annu. Rev. Biochem. 64: 375-401.
Smith, I.K., T.L. Vierheller and C.A. Thorne. 1988. Assay of glutathione reductase in
crude tissue homogenates using 5, 5´-dithiobis (2-nitrobenzoic acid). Anal.
Biochem. 175: 408-413.
Solomon, S.D., D. Qin, M. Manning, Z. Chen, M. Marquis, K.B. Averyt, M. Tignor and
H. L. Miller. 2007. Climate Change 2007: The Physical Scientific Basis:
Contribution of working group I to the fourth assessment report of the
intergovernmental panel on climate change, Cambridge Univ. Press, New York,
996 p.
Somers, E., J. Vanderleijden and M. Srinivasan. 2004. Rhizosphere bacterial signalling: a
love paradebeneath our feet. Crit. Rev. Microbiol. 30: 205-240.
Sorensen, J. and A. Sessitsch. 2006. Plant-associated bacteria-lifestyle and molecular
interactions. p. 211-236. In: J.D. van Elsas, J.K. Jansson, J.K. Trevors (eds.)
Modern soil microbiology. CRC Press.
Steel, K.J. 1961. The oxidase reaction as a toxic tool. J. Gen. Microbiol. 25: 297-306.
Steel, R.G.D., J.H. Torrie and D.A. Dicky. 1997. Principles and Procedures of Statistics-
A Biometrical Approach. (3rd Ed.) McGraw Hill Book International Co.,
Singapore. p. 204-227.
Stikic, R., Z. Jovanovic and L. Prokic. 2014. Mitigation of plant drought stress in a
changing climate. Botanica SERBICA 38: 35-42.
194
![Page 215: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/215.jpg)
Strobel, G., B. Daisy, U. Castillo and J. Harper. 2004. Natural products from endophytic
microorganisms. J. Nat. Prod. 67: 257-268.
Studer, A.J., A. Gandin, A.R. Kolbe, L. Wang, A.B. Cousins and T.P. Brutnell. 2014. A limited role for carbonic anhydrase in C4 photosynthesis as revealed by a ca1ca2 double mutant in maize. Plant. Physiol. 165:608-617.
Sturz, A.V. and J. Nowak. 2000. Endophytic communities of rhizobacteria and the
strategies required to create yield enhancing associations with crops. Appl. Soil
Ecol. 15:183-190.
Sturz, A.V., B.R. Christie and J. Nowak. 2000. Bacterial endophytes: potenti al role in
developing sustainable systems of crop production. Crit. Rev. Plant Sci. 19: 1-30.
Sun, Y., Z. Cheng and B. Glick. 2009. The presence of a 1-aminocyclopropane-1-
carboxylate (ACC) deaminase deletion mutation alters the physiology of the
endophytic plant growth-promoting bacterium Burkholderia phytofirmans PsJN.
FEMS Microbiol. Lett. 296: 131-136.
Supuran, C.T. 2008. Carbonic anhydrases: novel therapeutic applications for inhibitors
and activators. Nat. Rev. Drug Discov. 7: 168-81.
Supuran, C.T. 2011. Carbonic anhydrase inhibitors and activators for novel therapeutic
applications. Future Med. Chem. 3: 1165-80.
Suzuki, T., M. Shimizu, A. Meguro, S. Hasegawa, T. Nishimura and H. Kunoh. 2005.
Visualization of infection of an endophytic Actinomycete Streptomyces galbus in
leaves of tissue-cultured Rhododendron. Actinomycetologica 19: 7-12.
Sziderics, A.H., F. Rasche, F. Trognitz, A. Sessitsch and E. Wilhelm. 2007. Bacterial
endophytes contribute to abiotic stress adaptation in pepper plants (Capsicum
annuum L.) Can. J. Microbiol. 53: 1195-1202.
Taiz, L. and E. Zeiger. 2010. Plant Physiol (5th Ed.). Sinauer Assoc. Inc. Publ.
Massachusetts, USA.
Tal, S. and Y. Okon. 1985. Production of the reserve material poly- beta-hydroxybutyrate
and its function in Azospirillum brasilense Cd. Can. J. Microbiol. 31: 608-613.
Talaat, N.B. and B.T. Shawky. 2014. Protective effects of arbuscular mycorrhizal fungi
on wheat (Triticum aestivum L.) plants exposed to salinity. Environ. Exp. Bot. 98:
20-31.
195
![Page 216: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/216.jpg)
Tan, R.X. and W.X. Zou. 2001. Endophytes: a rich source of functional metabolites. Nat.
Prod. Rep. 18: 448-459.
Tataeizadeh, Z. 1998. Drought-induced responses in plant cells. Int. Rev. Cytol. 182: 193-
247.
Teulat, B., N. Zoumarou-Wallis, B. Rotter, H.B.S. Bahri and D. This. 2003. QLT for
relative water content in field grown barley environment and their stability across
the Mediterranean environments. Theor. Appl. Genet. 108:181-188.
Theocharis, A., S. Bordiec, O. Fernandez, S. Paquis, S. Dhondt-Cordelier, F. Baillieul, C.
Clement and E.A. Barka. 2012. Burkholderia phytofirmans PsJN primes Vitis
vinifera L. and confers a better tolerance to low nonfreezing temperatures. Mol.
Plant Microbe Interact. 25: 241-249.
Thomashow, L.S. and D.M. Weller. 1996. Current concepts in the use of introduced
bacteria for biological disease control: mechanisms and antifungal metabolites. p.
187-235. In: G. Stacey and N. Keen (eds.) Plant-microbe interaction. Champman
and Hall, New York.
Timmusk, S. 2003. Mechanism of action of the plant growth promoting Bacterium
Paenibacillus polymyxa. Comprehansive summaries of uppsala dissertations from
the Faculty of Science and Technology 908. Acta Univ. Upsaliensis Uppsala,
Sweden. p 40.
Timmusk, S. and E. Nevo. 2011. Plant root associated biofilms: perspectives for natural
product mining. p. 285-300. In: D.K. Maheshwari (ed.) Bacteria in agrobiology:
Plant nutrient management. Springer-Verlag, Berlin, Heidelberg.
Timmusk, S. and E.G.H. Wagner. 1999. The plant growth-promoting rhizobacterium
Paenibacillus polymyxa induces changes in Arabidopsis thaliana gene expression:
a possible connection between biotic and abiotic stress responses. Mol. Plant
Microb. Int.12: 951-959.
Timmusk, S. and L. Behers. 2012. Rhizobacterial application for sustainable water
management on the areas of limited water resources. Irrig. Drainage Syst. Eng. 1:
e111. doi: 10.4172/2168-9768.1000e111
Timmusk, S., I.A. Abd El-Daim, L. Copolovici, T. Tanilas, A. Kannaste, L. Behers, E.
Nevo, G. Seisenbaeva, E. Stenstrom and U. Niinemets. 2014. Drought-tolerance
of wheat improved by rhizosphere bacteria from harsh environments: enhanced
biomass production and reduced emissions of stress volatiles. PLoS ONE 9:
e96086. doi:10.1371/journal.pone.0096086
196
![Page 217: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/217.jpg)
Timmusk, S., I.A.A. El-Daim, L. Copolovici, T. Tanilas, A. Kannaste, L. Behers, E.
Nevo, G. Seisenbaeva, E. Stenstrom and U. Niinemets. 2011. Drought-tolerance
of wheat improved by rhizosphere bacteria from harsh environments: enhanced
biomass production and reduced emissions of stress volatiles. PLoS ONE 6:
e17968. 10.1371/journal.pone.0017968
Timmusk, S., N. Grantcharova and E.G.H. Wagner. 2005. Paenibacillus polymyxa
invades plant roots and forms biofilms. Appl. Environ. Microbiol. 71: 7292-7300.
Tiwari A, P. Kumar, S. Singh and S.A. Ansari. 2005. Carbonic anhydrase in relation to
higher plants. Photosynthetica 43: 1-11.
Tran, L.S.P., K. Nakashima, Y. Sakuma, S.D. Simpson, Y. Fujita, and K. Maruyama.
2004. Isolation and functional analysis of Arabidopsis stress-inducible NAC
transcription factors that bind to a drought-responsive cis-element in the early
responsive to dehydration stress 1 promoter. Plant Cell 16: 2481-2498.
Tripp, B.C., K. Smith and J.G. Ferry. 2001. Carbonic anhydrase new insights for an
ancient enzyme. J. Biol. Chem. 276: 48615-48618.
U.S. Salinity Lab. Staff. 1954. Diagnosis and improvement of saline and alkali soils.
USDA Hand Book No. 60. Washington. DC, USA. 160p.
UmaMaheswari, T., K. Anbukkarasi, T. Hemalatha and K. Chendrayan. 2013. Studies on
phytohormone producing ability of indigenous endophytic bacteria isolated from
tropical legume crops. Int. J. Curr. Microbiol. App. Sci. 2: 127-136.
United States Department of Agriculture (USDA). 2011. Natural resources conservation
service. http://soils.usda.gov/technical/aids/investigations/texture/ (accessed on
25.09.2011).
Upadhyay, R., K. Ramalakshmi, L.J.M. Rao. 2012. Microwave assisted extraction of
chlorogenic acids from green coffee beans. Food Chem. 130: 184-188.
Van, L.L.C., P.A.H.M. Bakker and C.M.J. Pieterse. 1998. Systemic resistance induced by
rhizophere bacteria. Annu. Rev. Phytopath. 36 453-483.
Vardharajula, S., S.Z. Ali, M. Grover, G. Reddy and V. Bandi. 2011. Drought-tolerant
plant growth promoting Bacillus spp.: effect on growth, osmolytes, and
antioxidant status of maize under drought stress. J. Plant Interact. 6: 1-14.
Verma, V.C., S.K. Gond, A. Mishra, A. Kumar, R.N. Kharwar and A.C. Gange. 2009.
Endophytic actinomycetes from Azadirachta indica A. Juss.: isolation, diversity
and antimicrobial activity. Microb. Ecol. 57: 749-756.
197
![Page 218: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/218.jpg)
Vessey, J.K. 2003. Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:
571-586.
Vincent, J.M. 1970. A manual for the practical study of root nodule bacteria (First Ed.)
Oxford Publ. Int. Biolog. Program, p. 164.
Viruel, E., L.E. Erazzu, L.M. Calsina, M.A. Ferrero, M.E. Lucca, F. Sineriz. 2014.
Inoculation of maize with phosphate solubilizing bacteria: effect on plant growth
and yield. J. Soil Sci. Plant Nutr. 14: 819-831.
Wahid, A., S. Gelani, M. Ashraf and M.R. Foolad. 2007. Heat tolerance in plants: an
overview. Environ. Exp. Bot. 61: 199-223.
Walter, J., C. Beierkuhnlein, R. Hein, J. Nagy, U. Rascher, E. Willner and A. Jentsch.
2011. Do plants remember drought? Evidence for drought memory in grasses.
Environ. Exp. Bot. 71: 34-40.
Wang, W., B. Vinocur and A. Altman. 2003. Plant responses to drought, salinity and
extreme temperatures: towards genetic engineering for stress tolerance. Planta
218:1-14.
Wang, W., Y. Zhai, L. Cao, H. Tan and R. Zhang. 2016. Endphytic bacterial and fungal
microbiota in sprouts, roots and stem of rice (Oryza sativa L.). Mirobiol. Res.
188-189:1-8.
Watanabe, F.S. and S.R. Olsen. 1965. Test of an aerobic acid method for determination of
phosphorus in water and NaHCO3 extracts. Soil Sci. Soc. Am. Proc. 29: 677-678.
Wei-Hong, S., W. Yan-You, S. Zhen-Zhen, W. Qiu-Xia and W. Xin-Yu. 2014.
Enzymatic characteristics of higher plant carbonic anhydrase and its role in
photosynthesis. J. Plant Stud. 3: 39-44.
Welbaum, G.E., A.V. Sturz, Z. Dong and J. Nowak. 2004. Managing soil microorganisms
to improve productivity of agro-ecosystems. Crit. Rev. Plant Sci. 23: 75-193.
Weller, D.M. 1988. Biological control of soil borne plant pathogens in the rhizosphere
with bacteria. Annu. Rev. Phytopathol. 26: 379-407.
Weyens, N., D.V. Lelie, S. Taghavi, L. Newman and J. Vangronsveld. 2009. Exploiting
plant-microbe partnerships to improve biomass production and remediation.
Trend. Biotech. 27: 591-598.
Wilson, K.J., A. Sessitsch, J.C. Corbo, K.E. Giller, A.D.L. Akkermans and R.A.
Jefferson. 1995. Glucuronidase (GUS) transposons for ecological and genetic
studies of rhizobia and other gram-negative bacteria. Microbiology 141: 1691-
1705.
198
![Page 219: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/219.jpg)
Wolf, B. 1982. The comprehensive system of leaf analysis and its use for diagnosting
crop nutrient status. Comm. Soil Sci. Plant Anal. 13:1035-1059.
Wollum, A.G. 1982. Cultural methods for soil microorganisms. p. 781-802. In: A.L.
Page, R. H. Miller and D. R. Keeney (ed.) Methods of soil analysis. Part 2.
Chemical and microbiological properties (2nd Ed.). Am. Soc. Agron. Madison,
Wis.
Wood, A.J. 2005. Eco-physiological adaptations to limited water environments. p.1-13.
In: M.A. Jenks and P.M. Hasegawa (ed.) Plant abiotic stress. Blackwell Publish.
Ltd. UK.
XinBin, D., Z. RongXian, L. Wei, XiaMing, C. ShuQing. 2001. Effect of carbonic
anhydrase in wheat leaf on photosynthetic function under low CO2 concentration.
Sci. Agric. Sinica. 34: 97-100.s
Yamaguchi-Shinozaki, K. and K. Shinozaki. 2005. Organization of cis-acting regulatory
elements in osmotic- and cold-stress-responsive promoters. Trends Plant Sci. 10:
88-94.
Yandigeri, M.S., K.K. Meena, D. Singh, N. Malviya, D.P. Singh, M.K. Solanki, A.K.
Yadav and D.K. Arora. 2012. Drought-tolerant endophytic actinobacteria promote
growth of wheat (Triticum aestivum) under water stress conditions. Plant Growth
Regul. 68: 411-420.
Yang, J., J.W. Kloepper and C.M. Ryu. 2009. Rhizosphere bacteria help plants tolerate
abiotic stress. Trends Plant Sci. 14: 1-4.
Yang, S., X. Zhang, Z. Cao, K. Zhao, S. Wang, M. Chen and X. Hu. 2014. Growth-
promoting Sphingomonas paucimobilis ZJSH1 associated with Dendrobium
officinale through phytohormone prod of production and nitrogen fixation.
Microb. Biotechnol. 7: 611-20.
Yin, L., H. Lin and Z. Xiao. 2010. Purification and characterization of a cellulase from
Bacillus subtilis YJ1. J. Marine Sci. Technol. 18: 466-471.
You, M., T. Nishiguchi, A. Saito, T. Isawa, H. Mitsui and K. Minamisawa. 2005.
Expression of the nifH gene of a Herbaspirillum endophyte in wild rice species:
daily rhythm during the light-dark cycle. Appl. Environ. Microbiol. 71: 8183-
8190.
Yu, S., X.X. Zhang, Q.J. Guan, T. Takano and S.K. Liu. 2007. Expression of a carbonic
anhydrase gene is induced by environmental stresses in Rice (Oryza sativa L.).
Biotech. Lett. 29: 89-94.
199
![Page 220: Higher Education Commissionprr.hec.gov.pk/jspui/bitstream/123456789/11611/1/Ana... · Web viewstrain PsJN increased the chlorophyll content, CO 2 assimilation rate and water use efficiency](https://reader035.vdocument.in/reader035/viewer/2022071404/60f88480f5bbd1419e0390b7/html5/thumbnails/220.jpg)
Zachow, C., J. Fatehi, M. Cardinale, R. Tilcher and G. Berg. 2010. Strain-specific
colonization pattern of Rhizoctonia antagonists in the root system of sugar beet.
FEMS Microbiol. Ecol. 74: 124-35.
Zachow, C., R. Tilcher and G. Berg. 2008. Sugar beet-associated bacterial and fungal
communities show a high indigenous antagonistic potential against plant
pathogens. Microb. Ecol. 55: 119-129.
Zakria, M., J. Njoloma, Y. Saeki and S. Akao. 2007. Colonization and nitrogen-fixing
ability of Herbaspirillum sp. strain B501 gfp1 and assessment of its growth-
promoting ability in cultivated rice. Microb. Environ. 22: 197-206.
Zhang, Z., B. Lian, W. Hou, M. Chen, X. Li and Y. Li. 2011. Bacillus mucilaginosus can
capture atmospheric CO2 by carbonic anhydrase. Afr. J. Microbiol. Res. 5: 106-
112.
Zhang, Z., B. Lian, W. Hou, M. Chen, X. Li, W. Shen and Y. Li. 2010. Optimization of
nutritional constituents for carbonic anhydrase production by Bacillus
mucilaginosus K02. Afr. J. Biotechnol. 10: 8403-8413.
Zlatev, Z. and I. Yordanov. 2004. Effects of soil drought on photosynthesis and
chlorophyll fluorescence in common bean plants. Bulg. J. Plant Physiol. 30: 3-18.
Zuniga, A., M.J. Poupin, R. Donoso, T. Ledger and N. Guiliani, R.A. Gutierrez and B.
Gonzalez. 2013. Quorum Sensing and indole-3-ccetic acid degradation play a role
in colonization and plant growth promotion of Arabidopsis
thaliana by Burkholderia phytofirmans PsJN. Mol. Plant. Microb. Interact. 26:
546-553.
200