identification and characterisation of potential ... · identification and characterisation of...
TRANSCRIPT
Identification and characterisation of potential
neuroprotective proteins induced by erythropoietin (EPO)
preconditioning of cortical neuronal cultures
By
Sherif Boulos BSc (Hons) MedSci DipEd
This thesis is presented for the Degree of Doctor of Philosophy of the University of
Western Australia,
Centre for Neuromuscular and Neurological Disorders and the School of Biomedical
and Chemical Sciences
September 2007
ii
ABBREVIATED CONTENTS
Page
TITLE PAGE i
ABBREVIATED CONTENTS ii-iii
SUMMARY iv-v
DEDICATION vi
ACKNOWLEDGEMENTS vii
DECLARATION xiii
PUBLICATIONS ARISING FROM THIS THESIS ix
PATENTS ARISING FROM THIS THESIS ix
PUBLISHED ABSTRACTS ARISING FROM THIS THESIS x-xi
PRIZES AND AWARDS ARISING FROM THIS THESIS xii
TABLE OF CONTENTS xiii-
xvi
Chapter 1 General introduction and aims 1
Chapter 2 Materials and methods 25
Chapter 3 Erythropoietin preconditioning in neuronal cultures:
signalling, protection from in vitro ischaemia and
proteomic analysis
43
Chapter 4 Assessment of CMV, RSV and SYN1 promoters and the
woodchuck post-transcriptional regulatory element in
adenovirus vectors for transgene expression in cortical
neuronal cultures
55
iii
Chapter 5 Cloning, adenoviral mediated expression and preliminary
assessment of neuroprotective activity of proteins
differentially expressed in cortical neuronal cultures
following erythropoietin exposure
69
Chapter 6 Peroxiredoxin 2 over-expression protects cortical neuronal
cultures from ischaemic and oxidative injury but not
glutamate excitotoxicity, whilst Cu/Zn superoxide
dismutase 1 over-expression only protects against
oxidative injury
78
Chapter 7 Evidence that intracellular cyclophilin A and cyclophilin
A/CD147 receptor mediated ERK1/2 signalling can
protect neurons against in vitro oxidative and ischaemic
injury
89
Chapter 8 General discussion and significance of this study 102
Chapter 9 References 114
iv
SUMMARY
Clinical therapeutic agents to directly inhibit ischaemic neuronal death are presently
unavailable. One approach to developing therapeutics is based upon the identification
of proteins up-regulated by ‘preconditioning’, a natural adaptive response utilised by the
neural cells to counter damaging insults, such as ischaemia. Thus, my project aimed to
firstly identify proteins differentially expressed following erythropoietin (EPO)
mediated neuronal preconditioning and secondly to assess whether any of these proteins
possessed neuroprotective activity using in vitro ischaemia like models. To achieve the
first aim, it was shown that in vitro neuronal EPO preconditioning could: (i) induce cell
signal changes in neuronal cultures, (ii) protect neurons against in vitro ischaemia and
(iii) induce differential protein expression. Overall, 40 differentially expressed proteins
were identified in cortical neuronal cultures following EPO preconditioning.
In order to investigate the neuroprotective or neurodamaging activity of proteins
induced by EPO preconditioning I developed an adenoviral expression system for use in
neuronal cultures. To this end, I assessed the suitability of four promoters
(cytomegalovirus [CMV], rous sarcoma virus [RSV], human synapsin 1 [hSYN1], rat
synapsin 1 [rSYN1]) previously used to express proteins in neuronal cultures and
demonstrated the superiority of the RSV promoter for this purpose. The woodchuck
post-transcriptional regulatory element (WPRE) was incorporated to enhance protein
expression and a green fluorescent protein (EGFP) reporter cassette was incorporated to
enable tracking of the virus. Finally, in order to validate this adenoviral expression
system, I over-expressed the anti-apoptotic protein Bcl-XL in neuronal cultures and
subsequently confirmed its neuroprotective activity in the in vitro ischaemia and
oxidative stress models used in my project.
Using this adenoviral vector system and the in vitro oxidative stress model I assessed a
number of proteins up-regulated by EPO preconditioning. The results of this
preliminary study indicated that cyclophilin A (CyPA), peroxiredoxin 2 (PRDX2) and
superoxide dismutase 1 (SOD1) over-expression were neuroprotective. It was
subsequently verified that adenoviral mediated over-expression of CyPA and PRDX2,
v
but not SOD1 in cortical neuronal cultures could protect neurons from in vitro
ischaemia. I also confirmed that CyPA mRNA increased in the rat hippocampus in
response to 3 minutes of global cerebral ischaemia. Interestingly, an increase in CyPA,
PRDX2 or SOD1 protein was not observed in the same experimental paradigm.
To investigate CyPA’s mode of action I confirmed that cultured neurons, but not
astrocytes, express the CyPA receptor, CD147. It was also demonstrated that
administration of exogenous CyPA protein to neuronal cultures could protect neurons
against oxidative and ischaemic injury. I further demonstrated that exogenous
administration of CyPA induces a rapid and transient activation of the extracellular
signal-regulated kinase (ERK) 1/2 pathway in neuronal cultures. From this observation,
I have proposed that the extracellular mediated neuroprotective activity of CyPA occurs
via CD147 receptor signalling and activation of ERK1/2 pro-survival pathways.
Based on the findings reported in this thesis, the neuroprotective activities of PRDX2
and CyPA warrant further investigation as targets for the development of new therapies
to treat cerebral ischaemia.
vi
for
Lyndall, Henry and Lucy
vii
ACKNOWLEDGEMENTS
Firstly, I wish to express my sincerest gratitude to my supervisors; Adjunct A/Prof
Bruno Meloni, Professor Neville Knuckey and Dr Peter Arthur.
In particular, I am especially indebted to Adjunct A/Prof Bruno Meloni. Throughout
the past four years Adjunct A/Prof Meloni has generously and unfailingly metered out a
virtual mountain of practical advice and encouragement. On a personal level, and by no
means less important, Adjunct A/Prof Meloni has offered his friendship and humour.
The sum-total of these contributions, which cannot be understated, made the task of
completing this thesis all the more bearable and hence achievable.
I also wish to acknowledge those within the Stroke Research Group, some of whom
have contributed directly to this thesis, others for simply making the days at work
enjoyable, and the few who bridged both camps. These include Kate Thomas, Amanda
Meade, Kym Campbell, Bernadette Majda, Hongdong Zhu, Amerigo Carello, Sharon
Lee, Jane Cross, Tom Hamilton and Christina Bojarski.
Finally to all the staff and students of the Australian Neuromuscular Research
Institute/Centre for Neuromuscular and Neurological Disorders, thank you for sharing
your wonderful space.
viii
DECLARATION
I hereby declare that this thesis is my own account of my research and that all other
sources have been acknowledged and my contribution clearly identified. This thesis
and its main content have not previously been submitted or accepted for any other
degree in this or any other institution.
Signed…………………………………………………….
Sherif Boulos
28/9/2007
ix
PUBLICATIONS ARISING FROM THIS THESIS
Meloni BP, Tilbrook PA, Boulos S, Arthur PG and Knuckey, NW (2006).
Erythropoietin preconditioning in neuronal cultures: signalling, protection from in vitro
ischaemia, and proteomic analysis. J Neurosci Res 83(4):584-93.
Boulos S, Meloni BP, Arthur PG, Bojarski C and Knuckey, NW (2006). Assessment of
CMV, RSV and SYN1 promoters and the woodchuck post-transcriptional regulatory
element in adenovirus vectors for transgene expression in cortical neuronal cultures.
Brain Res 1102(1):27-38.
Boulos S, Meloni BP, Arthur PG, Majda B, Bojarski C and Knuckey, NW (2006).
Evidence that intracellular cyclophilin A and cyclophilin A/CD147 receptor mediated
ERK1/2 signalling can protect neurons against in vitro oxidative and ischaemic injury.
Neurobiol. Dis 25: 54-64
Boulos S, Meloni BP, Arthur PG, Bojarski C and Knuckey, NW (2007). Peroxiredoxin
2 over-expression protects cortical neuronal cultures from ischaemic and oxidative
injury but not glutamate exposure, whilst Cu/Zn superoxide dismutase 1 over-
expression only protects against oxidative injury. J Neurosci Res (published online July
2007).
PATENTS ARISING FROM THIS THESIS
Mr Sherif Boulos, Dr Bruno Meloni, and Prof Neville Knuckey (2005). Neuroactive
peptides and methods for their use. Provisional patent application (February 2005),
PCT application (February 2006), international patent application (August 2007).
PUBLISHED ABSTRACTS ARISING FROM THIS THESIS
x
Boulos, S, Meloni, BP, Arthur PG and Knuckey, NW (2003). Overexpressing
potentially neuroprotective genes in neurons, Sir Charles Gairdner Hospital Research
Week, Perth, Western Australia.
Boulos S, Meloni, BP, Bojarski, C, Arthur, PG and Knuckey, NW (2004). Proteins up-
regulated by erythropoietin (EPO) can protect cortical neurons in an in vitro model of
stroke. Combio, Perth, Western Australia.
Boulos, S, Meloni, BP, Bojarski C, Arthur, PG and Knuckey, NW (2004). Proteins up-
regulated by erythropoietin can protect cortical neuronal cultures in an in vitro model of
stroke. Australasian Stroke Society Meeting, Hobart, Tasmania.
Boulos, S, Meloni, BP, Bojarski, C, Lee, S, Arthur, PG and Knuckey, NW (2005).
Erythropoietin up-regulates a protein which can protect cortical neuronal cultures in an
in vitro model of stroke. Australian Neuroscience Society Annual Meeting, Perth,
Australia.
Boulos, S, Meloni, BP, Arthur, PG and Knuckey, NW (2005). An improved adenoviral
vector system for use in neuronal cultures. Combined Biological Science Meeting,
Perth, Australia.
Boulos S, Meloni BP, Arthur PG, Bojarski C, and Knuckey NW (2005). Using
adenoviral vectors to identify proteins which can protect cultured cortical neurons in
models of stroke. Symposium of Western Australian Neuroscience, 23rd Symposium,
Perth, Western Australia.
Boulos S, Meloni BP, Arthur PG, Bojarski C, and Knuckey NW (2006). Intracellular
and extracellular cyclophilin A is neuroprotective in cultured cortical neurons.
Australian Neuroscience Society 26th Annual Meeting, Sydney, Australia.
Boulos S, Meloni BP, Arthur PG, Bojarski C, and Knuckey NW (2006) Intracellular
xi
and extracellular cyclophilin A is neuroprotective in cultured cortical neurons. The
Global College of Neuroprotection & Neuroregeneration Third Annual Conference,
Uppsala, Sweden.
Boulos S, Meloni BP, Arthur PG, Bojarski C, and Knuckey NW (2006). Using
adenoviral vectors to identify proteins which can protect cultured cortical neurons in
models of stroke. Symposium of Australian Society of Medical Research, Perth,
Western Australia.
Boulos S, Meloni BP, Arthur PG, Bojarski C, and Knuckey NW (2006) Intracellular
and extracellular cyclophilin A is neuroprotective in cultured cortical neurons.
Symposium of Western Australian Neuroscience, 24th
Symposium, Perth, Western
Australia.
Boulos S, Meloni BP, Arthur PG, Bojarski C, and Knuckey NW (2006) Intracellular
and extracellular cyclophilin A is neuroprotective in cultured cortical neurons.
Combined Biological Sciences Meeting (CBSM), Perth, Australia.
Boulos S, Meloni BP, Arthur PG, Bojarski C, and Knuckey NW (2007). Peroxiredoxin
2 over-expression protects cortical neuronal cultures from ischaemic and oxidative
injury but not glutamate excitotoxicity, whilst Cu/Zn superoxide dismutase 1 over-
expression only protects against oxidative injury. 7th
International Brain Research
Organisation (IBRO) World Congress of Neuroscience (Australian Neuroscience
Meeting), Melbourne, Australia.
xii
PRIZES AND AWARDS ARISING FROM THIS THESIS
Combined Biological Sciences Meeting (Perth Meeting) 2006
(Society of Biochemical Sciences - Best Poster Award)
Title: Intracellular and extracellular CyPA is neuroprotective
Australian Society of Medical Research Symposium 2006
(Department of Health Award 2006 - Oral Prize)
Title: Using adenoviral vectors to identify proteins which can protect cultured cortical
neurons in models of stroke
Society of Western Australian Neurosciences 2005
(Encouragement award - Oral prize)
Title: Using adenoviral vectors to identify proteins which can protect cultured cortical
neurons in models of stroke
Combio (Australian and International Meeting) 2004
(Society of Biochemical Sciences - Best Poster Award)
Title: Proteins up-regulated by erythropoietin (EPO) can protect cortical neurons in an
in vitro model of stroke
Sir Charles Gairdner Hospital (Research Week) 2003
(Best Poster Award)
Title: Over-expressing potentially neuroprotective proteins in neurons
xiii
TABLE OF CONTENTS
Chapter 1 General Introduction and aims
1
1.00 Cerebral ischaemia 2
1.01 Available neuroprotective therapies 2
1.02 Brain injury following cerebral ischaemia 3
1.03 Modes of neuronal cell death following cerebral ischaemia 3
1.04 Mechanisms involved in ischaemic neuronal death 4
1.04.1 Disruption of calcium homeostasis 4
1.04.1.1 Activation of calcium ion permeable channels 5
1.04.1.1a Glutamate sensitive calcium channels and receptors 5
1.04.1.1b Activation of other calcium channels 6
1.04.2 Calcium overload and general damaging processes 6
1.04.2.1 Activation of proteolytic enzymes 7
1.04.2.2 Activation of neuronal nitric oxide synthase (nNOS) 7
1.04.2.3 Activation of phospholipase A2 8
1.04.2.4 Activation of endonucleases 8
1.04.2.5 Protein kinase activation and cell death signalling 8
1.05 Oxidative/nitrosative stress 9
1.05.1 Mitochondrial derived ROS 9
1.05.2 Non-mitochondrial sources of ROS 10
1.05.3 Nitric oxide synthase and ROS/RNS 11
1.05.4 Other ROS related pathways 11
1.06 Types of cell death following cerebral ischaemia 11
1.06.1 Necrosis 12
1.06.2 Autophagy 12
1.06.3 Necroptosis 13
1.06.4 Apoptosis 13
1.06.4.1 Caspases 14
1.06.4.2 Mitochondrial dependent apoptosis – intrinsic pathway 14
1.06.4.3 Bcl-2 family protein regulators of apoptosis 15
1.06.4.4 Death receptor mediated apoptosis – extrinsic pathway 15
1.06.4.5 Caspase independent neuronal cell death 16
1.07 The inflammatory response following cerebral ischaemia 16
1.07.1 Cytokine/chemokine release 16
1.07.2 Immune cell infiltration 17
1.07.3 Microglia and astrocyte activation 17
1.07.4 Disruption of blood brain barrier function and brain oedema 17
1.08 Neuroprotection 18
1.09 Neuronal preconditioning 18
1.09.1 Neuronal preconditioning, gene expression and mechanisms 19
1.09.2 Preconditioning, neurotrophic factors and programmed cell
survival
20
1.09.3 Non-neuronal effects of preconditioning 21
1.10 EPO and the central nervous system 21
1.10.1 EPO mediated preconditioning/neuroprotection 23
xiv
1.10.2 EPO induced signalling and protein expression 23
1.11 General and specific aims
24
Chapter 2 Materials and methods
25
Materials 26
2.01.1 Mammalian cell lines, bacterial strains, adenoviral
and plasmid DNA
26
2.01.2 Chemicals and enzymes 28
2.01.3 Antibodies 30
2.02 Solutions and culture media 31
Methods 33
2.03 DNA procedures 33
2.03.1 General handling 33
2.03.2 Preparative procedures 33
2.03.2.1 RNA extraction
2.03.2.2 Genomic DNA extraction
2.03.2.3 Plasmid extractions
2.03.2.4 First strand synthesis of cDNA
2.03.2.5 Polymerase chain reaction (PCR)
2.03.2.6 PCR and restriction fragment purification
33
33
34
34
35
35
2.03.3 DNA Modifying Procedures 36
2.03.3.1 Restriction enzyme digestion
2.03.3.2 Ligations
2.03.3.3 A-tailing
2.03.3.4 Dephosphorylation of 5’ ends
2.03.3.5 Creating blunt end termini from 5’ and 3’ overhangs
2.03.3.6 Site directed mutagenesis
36
36
36
37
37
38
2.03.4 Analytical procedures 38
2.03.4.1 Agarose gel electrophoresis
2.03.4.2 Quantitation of DNA and RNA
2.03.4.3 DNA Sequencing
38
39
39
2.04 Bacterial cell procedures 40
2.04.1 Maintenance of bacterial cells 40
2.04.2 Transformation 40
2.04.2.1 Preparation of chemically competent JM109 E.coli cells
2.04.2.2 Preparation of electro-competent BJ5183 E.coli cells
carrying pAdeasy
2.04.2.3 Transformation of DNA into bacteria
40
41
41
41
Chapter 3 Erythropoietin preconditioning in neuronal cultures:
signalling, protection from in vitro ischaemia and
proteomic analysis
43
Chapter 4 Assessment of CMV, RSV and SYN1 promoters and
the woodchuck post-transcriptional regulatory
element in adenovirus vectors for transgene
expression in cortical neuronal cultures
55
xv
Chapter 5 Cloning, adenoviral mediated expression, and
preliminary assessment of the neuroprotective
activity of proteins differentially expressed in
cortical neuronal cultures following erythropoietin
exposure
69
5.01 Introduction 70
5.02 Materials and methods 70
5.02.1 DNA and cloning methods 70
5.02.2 Cell culture, adenovirus methods and statistical analysis 71
5.02.3 Western blotting 71
5.03 Results 71
5.3.1 Derivation of cDNA and generation of recombinant
adenovirus
72
5.3.2 Preliminary assessment of selected recombinant adenoviral
vectors
72
5.04 Discussion 73
Chapter 6
Peroxiredoxin 2 over-expression protects cortical
neuronal cultures from ischaemic and oxidative
injury but not glutamate exposure, whilst Cu/Zn
superoxide dismutase 1 over-expression only protects
against oxidative injury
78
Chapter 7
Evidence that intracellular cyclophilin A and
cyclophilin A/CD147 receptor mediated ERK1/2
signalling can protect neurons against in vitro
oxidative and ischaemic injury
89
Chapter 8 General discussion and significance of this study 102
8.01 Background and aims 103
8.02 EPO preconditioning mediated gene expression 104
8.03 Development of an adenoviral expression system 104
8.04 Assessment of candidate neuroprotective proteins 105
8.05 The neuroprotective activity of PRDX2 105
8.06 SOD1 mediated neuronal protection 107
8.07 Neuroprotective activity of intracellular CyPA 107
8.08 Chaperone and trafficking functions of CyPA 108
8.09 CyPA and apoptosis 109
8.10 Cyclophilin A mediated CD147 receptor activation 109
8.11 A putative biphasic response of CyPA 110
8.12 CyPA and its pro-inflammatory activity 111
8.13 Alzheimer’s disease, CD147 and CyPA 111
xvi
8.14 Significance of this study 112
Chapter 9
References
114
Chapter One
General introduction and aims
INTRODUCTION
2
1.00 Cerebral ischaemia
Cerebral ischaemia can cause serious injury to the brain and occurs when blood flow to
the whole (global cerebral ischaemia) or part of the brain (focal cerebral
ischaemia/stroke) is interrupted. Focal cerebral ischaemia/stroke, the most common
type of cerebral ischaemia, occurs following thrombo-embolic occlusion or rupture of a
cerebral artery. Global cerebral ischaemia occurs following cardiac arrest, hypotension,
closed head injury and subarachnoid haemorrhage. The central pathological feature of
cerebral ischaemia is neuronal cell death (Siesjo, 1992a, Johnson et al, 1995; Linnik,
1995). This neuronal loss results in serious memory disturbances, neurological deficits
and death (Davis et al, 1986; Siesjo, 1992b). In Australia, cerebral ischaemia
(focal/global) affects over 100,000 people annually and accounts for a third of all
deaths, and the majority of new disabilities (Stroke-National Goals, Targets &
Strategies, 1995). Each year the direct and indirect cost of stroke alone to the
Australian community is estimated to exceed $2 billion. Clearly, cerebral ischaemia has
a profound social and economic impact on our community. Hence, minimising
neuronal death following cerebral ischaemia would improve patient quality of life and
lessen the social and economic impact to the community.
1.01 Available neuroprotective therapies Currently there is no totally effective neuroprotective treatment that can directly inhibit
the neuronal death that occurs following cerebral ischaemia. To date, the only FDA
approved treatment for stroke is the clot dissolving agent tissue plasminogen activator
(tPA) to re-establish blood flow to the affected brain region. However, tPA is only
useful following thrombo-embolic stroke and must be administered within 3 hours of
stroke onset. Unfortunately, most stroke patients do not attend medical care until 4-6
hours after stroke symptoms commence (Saver et al, 2004), and for these reasons, it is
estimated that tPA is only administered in 1-3% of stroke patients (Armstead et al,
2006). Inducing hypothermia (33C) can be beneficial, but its use is presently limited
3
to comatose cardiac-arrest patients (Bernard et al, 2002). Therefore, there is an urgent
need to identify new drug targets in order to develop alternative treatment approaches
capable of reducing brain damage following cerebral ischaemia.
1.02 Brain injury following cerebral ischaemia
Brain injury following cerebral ischaemia can be either acute or delayed. In focal
cerebral ischaemia, the so-called ischaemic core encounters the severest blood flow
deficits which results in low ATP levels, ionic disruption and metabolic failure. The
combination of these factors causes ‘acute cell death’ which occurs within minutes to
hours (Lipton, 1999; Lo et al, 2003; Trendelenburg and Dirnagl, 2005). Surrounding
the ischaemic core is the less densely ischaemic ‘penumbra’, which receives residual
perfusion from collateral blood vessels, and therefore, experiences a relatively milder
insult. Depending on the degree and duration of ischaemia, neurons within the
penumbra may recover or eventually die in a delayed fashion over hours to days (Astrup
et al, 1981: Lipton, 1999). Following transient global cerebral ischaemia (usually 3-15
minutes), the damage is more diffuse with only the most vulnerable regions of the brain
affected, such as the CA1 hippocampal pyramidal neurons, cortical neurons (in layers 3
and 5), the Purkinje cells of the cerebellum, and dorsolateral striatum neurons (Lo et al,
2003). Neuronal damage resulting from global cerebral ischaemia generally leads to
delayed cell death which occurs over several hours to days.
1.03 Modes of neuronal cell death following cerebral ischaemia
It is now apparent that neuronal cell death occurring within ischaemic tissue is
heterogeneous and can arise via necrosis, apoptosis, autophagy and by the recently
identified process termed ‘necroptosis’ (Lipton, 1999; Yuan et al, 2003; Degterev et al,
2005). Moreover, within and between affected neuronal populations, individual
neurons may undergo different cell death mechanisms and exhibit characteristics of
4
more than one mode of cell death (Unal-Cevik et al, 2004). Non-neuronal cells are also
affected by ischaemia, with oligodendrocytes being particularly vulnerable, followed
by, but in no particular order, astrocytes, microglia and endothelial cells (Lo et al,
2003).
1.04 Mechanisms involved in ischaemic neuronal death
The molecular and biochemical events that initiate ischaemic cell damage and death are
multiple and consist mainly of processes related to excitotoxicity, calcium
dysregulation, oxidative/nitrosative stress, protease activation, cell death signalling,
altered gene expression and inflammation.
1.04.1 Disruption of calcium homeostasis
Calcium ions are involved in many important cellular functions such as modulating
enzyme activity, signalling, cell growth, differentiation, neurotransmitter release,
synaptic plasticity and membrane excitability. Thus, in order to maintain normal
cellular activity, it is vital that intracellular calcium is tightly regulated within neurons,
especially since the extracellular level of calcium is around 10,000 fold higher than the
intracellular level. Neuronal calcium homeostasis, which is heavily dependent on ATP,
is achieved by balancing calcium influx, extrusion and storage (Pringle, 2004).
Following cerebral ischaemia, this fine balance becomes compromised and calcium
levels rise rapidly. Several mechanisms account for this rise and include; calcium
influx due to increased ion channel permeability; release from intracellular stores
(predominantly the endoplasmic reticulum and mitochondria), impaired calcium
extrusion across the plasma membrane (which is mediated by calcium-ATPase and
sodium/calcium exchangers), and altered calcium sequestration by the calcium binding
proteins calbindin and calmodulin (Won et al, 2002; Pringle 2004). Finally, because of
its central role in many cellular process, the dysregulation of calcium homeostasis leads
to the activation of many damaging processes, some of which are discussed below.
5
1.04.1.1 Activation of calcium permeable ion channels
As mentioned above, whilst a number of processes lead to increased calcium levels
following cerebral ischaemia, probably the most important mechanism is calcium entry
following the activation of calcium permeable channels and transporters. Those known
to be involved in cerebral ischaemia include the glutamate receptor ion channels,
voltage dependent calcium channels (VDCCs), acid sensitive ion channels (ASICs),
sodium calcium exchangers (NCXs) and the transient receptor potential (TRP) channels.
1.04.1.1a Glutamate sensitive calcium channels and receptors
Glutamate, which is the principal excitory neurotransmitter of the brain, interacts with
cell membrane bound ionotropic glutamate gated ion channel receptors. These
ionotropic glutamate receptors are referred to by the agents which selectively activate
them: NMDA (N-methyl-D-aspartate), AMPA (-amino-3-hydroxy-5-methyl-4-
isoazolepropionic acid) and kainic acid receptors. Depending on the receptor, activation
by glutamate generally causes calcium and/or sodium ion influx. Glutamate also binds
and stimulates a fourth, non-ion channel (metabotropic) receptor, selectively activated
by quisqualate (QA), which induces G-protein activation of phospholipase C (PLC) and
subsequent endoplasmic release of calcium. Ischaemia leads to membrane
depolarisation and a pathological increase in presynaptic glutamate release. The
elevation in glutamate is proportional to the severity of ischaemia, and this receptor
mediated over-stimulation is known as excitotoxicity (Lipton and Rosenberg, 1994).
Whilst sodium and its associated water influx contribute to neuronal swelling, the influx
of calcium is regarded as the major neurotoxic trigger (Choi, 1987). The peculiarities of
each glutamate receptor subtype, their cellular prevalence, and co-occurrence with other
receptors, presumably gives rise to the differing vulnerabilities of neuronal populations
to excitotoxic damage (Lipton and Rosenberg, 1994). For example, the CA1
6
hippocampal neurons, which exhibit high NMDA concentrations, a receptor whose brief
activation (<3min) can lead to neuronal death, are highly susceptible to cerebral
ischaemia (Benveniste et al, 1984, Takagi et al, 1993).
1.04.1.1b Activation of other calcium channels
In addition to glutamate receptor activation, ischaemic neuronal cell death is also
associated with the activation of other calcium channels. For example, the VDCCs,
which occur on both pre and post-synaptic neuronal terminals, are involved in
ischaemic neuronal cell death, although the precise mechanism is yet to be determined
(Pringle, 2004). The transient receptor potential melastatin (TRPM) channels, and in
particular, TRPM7 and TRPM2, which are highly expressed in brain, are also associated
with calcium dependent neurotoxicity (Aarts et al, 2003; Aarts and Tymianski, 2005;
Kaneko et al, 2006). These two receptors increase intracellular calcium following
reactive oxygen species (ROS) mediated activation (Aarts et al, 2003). Finally, the
ASICs, which become activated at low extracellular pH, become permeable to calcium
and thus cause intracellular levels to rise. Since acidosis occurs following ischaemia, it
is thought that activation of ASICs contributes to neuronal injury (Xiong et al, 2006).
1.04.2 Calcium overload and general damaging processes
As already mentioned, elevated intracellular calcium can lead to a range of disturbances
affecting protein function, cell signalling and enzyme activity. Presumably, the
combination of these distinct damaging processes has a cumulative impact on neuronal
cell viability. Some of the more important processes are summarised below.
1.04.2.1 Activation of proteolytic enzymes
7
Excess calcium activates a number of proteolytic enzymes including the calpain and
cathepsin group of proteins. The best understood member of this group, calpain I, is a
calcium dependent cysteine protease (Sorimachi et al, 1997) which can cleave vital
proteins such as -spectrin, calcium dependent-ATPase, protein kinase C, NCX,
apoptosis inducing factor (AIF) and nuclear factor kappa B (NF-B). Damage to these
particular proteins can affect dendrite activity, cellular transportation, gene expression
and neuronal survival. Cathepsins, which are released from lysosomes, also contribute
to proteolytic damage following cerebral ischaemia, although their contribution to cell
death is not yet known (Won et al, 2002; Golstein and Kroemer, 2007).
1.04.2.2 Activation of neuronal nitric oxide synthase (nNOS)
Calcium influx caused by NMDA receptor activation leads to the activation of neuronal
NOS nitric oxide synthase (nNOS) and hence nitric oxide (NO) production. In addition,
although NO is a normal cellular messenger, following ischaemia and over-activation of
the NMDA receptor, NO is over-produced which is likely to contribute to neuronal cell
death (Dawson et al, 1991; Dawson et al, 1996, Dawson and Dawson, 1996). The cell
damaging effects of NO are mediated by peroxynitrite (ONOO-), which arises through
the interaction of NO with the superoxide anion (O2¯; Lipton et al, 1993; Bonfoco et al,
1995). In addition, excess NO also leads to neuronal damage through the activation of
the nuclear protein, poly (ADP-ribose) polymerase (PARP; Dawson, 1995). The
damaging effects of nNOS activation are evident in animal studies which report that
nitric oxide synthase knockout mice have smaller infarcts compared to their normal
littermates (Dawson et al, 1991).
1.04.2.3 Activation of phospholipase A2
8
Calcium can activate the cytosolic enzyme phospholipase A2 which is associated with
increased neuronal damage following cerebral ischaemia (Clapp et al, 1995; Bonventre
et al, 1997). Phospholipase A2 cleaves cellular glycerophospholipids, causing the
release of free fatty acids, such as arachidonic acid, which can act as precursors for the
synthesis of potentially neurotoxic metabolites, such as prostaglandins and leukotrienes
which are involved in post-ischaemic inflammation (Bazan et al, 1995; Won et al,
2002).
1.04.2.4 Activation of endonucleases
Calcium overload or acidification can activate calcium/magnesium
dependent
endonucleases and DNAse II respectively, which proceed to cleave DNA at non-
nucleosome sites (Won et al, 2002). The net effect is DNA fragmentation, which can
sometimes produce a characteristic DNA ladder of 200 bp intervals when visualised by
agarose gel electrophoresis (Robertson et al, 2000).
1.04.2.5 Protein kinase activation and cell death signalling
It is well recognised that the mitogen-activated protein kinases (MAPK), which can be
activated by calcium (as well as ROS) also play an important role in the fate of neurons
following ischaemia (Sugino et al, 2000; Nozaki et al, 2001). This family comprises
three major members; the extracellular regulated kinases (ERK), p38 and the stress
activated protein kinase (SAPK) also referred to as c-Jun N-terminal kinase (JNK). In
the context of ischaemia, p38 and JNK can mediate cellular stress by the transcriptional
activation of cell death processes, post-translational modification of apoptotic proteins
and by inducing pro-inflammatory cytokine transcription (Mehta et al, 2007). By
contrast, the activation of ERK1/2 (p42/p44) in cerebral ischaemia is less clear, with
some studies supporting a pro-survival role and others a pro-death role. Depending on
the time of administration and the injury paradigm, inhibitors of ERK1/2 can be either
neuroprotective or neurodamaging (Hetman and Gozdz, 2004; Chu et al, 2004). One
9
ERK1/2 activated pathway thought to enhance neuronal survival involves the activation
of the cAMP-response element-binding protein (CREB) transcription factor, which
enhances the expression of pro-survival proteins such as Bcl-2 and BDNF (Han and
Holtzman, 2000; Jin et al, 2002; Alonso et al, 2004; Costes et al, 2006; Sahin et al,
2006).
Although elevated calcium is detrimental, evidence suggests that at least one pro-
survival signalling pathway is also activated by calcium following mild cerebral
ischaemia. In this case, excess calcium binds calmodulin (CaM), which in turn
activates a family of both substrate restricted and unrestricted calcium dependent/CaM
kinases (Cheng et al, 2003; Xu et al, 2007). It is believed that some of these kinases,
CaMKI, CaMKII and CaMKIV may be involved in the phosphorylation of CREB,
enabling its translocation to the nucleus, thereby increasing the expression of pro-
survival proteins described previously (Shieh et al, 1998)
1.05 Oxidative/nitrosative stress
1.05.1 Mitochondrial derived ROS
In order to maintain a high metabolic activity and an extensive transmembrane ion
conveyor system, neurons require a continuous supply of ATP. The production of ATP
relies on a high oxygen turnover within the brain which drives mitochondrial oxidative
phosphorylation. However, the generation of ROS such as the hydroxyl ion (OH¯),
hydrogen peroxide (H2O2) and O2¯ ion that occurs during oxidative phosphorylation are
themselves toxic to cells. In order to inactivate ROS, cells have evolved specific
mechanisms which include amongst others, the superoxide dismutases (Cu/Zn
SOD/SOD1 and Mn SOD/SOD2), glutathione, catalase, and glutathione peroxidase.
Paradoxically, even during ischaemia, at least in the early stages, mitochondria are able
to generate potentially damaging ROS, presumably from residual oxygen levels
(Abramov et al, 2007). However, when blood flow and oxygen is resupplied
10
(reperfusion) following cerebral ischaemia, ROS levels can rise to the extent that the
natural coping mechanisms are seriously overwhelmed. As a result, these potentially
injurious species begin to accumulate and cause protein, lipid, DNA/RNA and
carbohydrate damage (Lo et al, 2003). This process, which is widely known as
oxidative stress or reperfusion injury, is an important contributor of neuronal cell death.
In one example oxidative stress is thought to contribute to the formation of toxic protein
aggregates. Indeed, the up-regulation of molecular chaperones such as heat shock
protein 70 (HSP70) can significantly reduce brain damage following cerebral ischaemia
presumably by disaggregating and refolding damaged proteins (Giffard et al, 2004).
Alternatively, damage to the lipid components of neuronal cell membranes such as
arachidonic acid, causes lipid peroxidation, which not only compromises the cell
membrane, but results in the formation of highly toxic by-products such as
malondialdehyde (Bagenholm et al, 1997). To this end, enhancing ROS scavenging
defences by increasing SOD1, catalase or glutathione peroxidase expression has been
shown to reduce brain injury in animal stroke models (Chan et al, 1998; Guegan, 1999;
Crack et al, 2001; Ishibashi et al, 2002; Gu et al, 2004).
1.05.2 Non-mitochondrial sources of ROS
Reactive oxygen species production can also result from the activity of nicotinamide
adenine dinucleotide phosphate (NADPH) oxidase and xanthine oxidase (XO), which
appear to contribute to overall ROS levels at distinct phases during ischaemia-
reperfusion (Abramov et al, 2007). Nicotinamide adenine dinucleotide phosphate
(NADPH) oxidase activity, which is calcium dependent, appears to contribute to ROS at
the late or reperfusion phase (Abramov et al, 2007). Xanthine oxidase is normally
inactive but increased calcium causes the proteolytic mediated conversion of xanthine
dehydrogenase (XDH) into XO, which is capable of converting oxygen at low tension
into O2¯ (Granger et al, 1981; Harrison, 2004; Abramov et al, 2007). In addition to its
ROS generating activity, XO has also recently been shown to cause the production of
reactive nitrogen species (RNS; Harrison, 2004), another important group of cell
11
damaging chemical species associated with ischaemic injury. Finally, specific
inhibitors of XO and NADPH are highly neuroprotective in both in vitro and in vivo
ischaemia models, thus confirming their contribution to ROS/RNS generation in
ischaemic neuronal injury (Manning et al, 1984; Palmer et al, 1990; Abramov et al,
2007).
1.05.3 Nitric oxide synthase and ROS/RNS
As described previously (1.04.2.2), increased ROS levels can stimulate nNOS which
can lead to the formation of RNS, such as the highly toxic agent peroxynitrite (Dawson,
1995).
1.05.4 Other ROS related pathways
Increased ROS production also causes activation of the mitogen-activated protein
kinase (MAPK) signalling pathways, some of which can initiate cell death (see
1.04.2.5). Finally, cell death can be directly linked to oxidative stress, as ROS
generation can facilitate mitochondrial transition pore formation (MTP), a step which
inhibits oxidative phosphorylation and ATP production, eventually triggering the
release of apoptotic factors (see below, programmed cell death) from the inner and outer
mitochondrial membranes (Kroemer and Reed, 2000).
1.06 Types of cell death following cerebral ischaemia
The culmination of damaging processes initiated by cerebral ischaemia can eventually
lead to cell death. In general, the duration and severity of the ischaemic insult often
dictates the mode and time course of cell death. As mentioned earlier, neurons can die
by one or more processes resembling necrosis, apoptosis, autophagy or necroptosis. A
brief summary describing features of the different forms of cell death is provided below.
12
1.06.1 Necrosis
Necrosis, which is generally regarded as the haphazard disintegration of the cell, is
preceded by cell swelling, which terminates in rupture of the cell membrane and the
release of potentially inflammatory cellular factors. This at least has been the
conventional view of necrosis, however, new evidence is challenging this assumption.
Indeed, Golstein and Kroemer (2006) suggest that necrosis exhibits features typical of
controlled processes such as mitochondrial dysfunction, enhanced ROS generation,
ATP depletion and proteolysis by calpains and cathepsins (Golstein and Kroemer,
2006). Intriguingly, simultaneous inhibition of apoptosis and autophagy can lead to
necrosis, which was recently proposed as the evolutionary default pathway of cell death
(Golstein and Kroemer, 2007).
1.06.2 Autophagy
Autophagy (‘meaning eats oneself’ - Greek) is a normal house-keeping process enabling
eukaryotes to eliminate used or damaged proteins and cytoplasmic organelles and to
recycle proteins during nutrient starvation and stress (Larsen and Sulzer, 2002; Levine
and Klionsky, 2004; Meijer and Codogno, 2004; Klionsky, 2006). This outcome is
achieved via the formation of double-membrane vacuoles known as the
autophagosomes, which fuse with lysosomes whose degrading enzymes proceed to
breakdown the contents (Levine and Klionsky, 2004; Levine, 2005; Levine and Yuan,
2005). Autophagy not only provides a mechanism for neurons to eliminate potentially
toxic protein aggregates (Hara et al, 2006; Komatstu et al, 2006a; Komatstu et al,
200b), but it also functions as a cell death pathway for neuronal development
(Schweichel and Merker, 1973) and in some pathological situations (Rubinsztein et al,
2005). Whilst the contribution of autophagy to cell death following ischaemia is still
unknown it appears that ‘autophagic cell death’ does occur in some in vitro and in vivo
13
ischaemia models (Lipton, 1999; Larsen and Sulzer, 2002; Mizushima et al, 2002;
Adhami et al, 2006).
1.06.3 Necroptosis
Necroptosis is a recently described cell death pathway which shares morphological
features of both necrosis and autophagy (Degterev et al, 2005). In order to further
characterise necroptosis, Degterev et al (2005) identified an inhibitor of necroptosis
they called necrostatin-1 (Nec-1). They subsequently showed that administration of
Nec-1 could reduce infarct size in a mouse model of focal cerebral ischaemia, thus
confirming the involvement of necroptosis in ischaemic injury (Degterev et al, 2005).
1.06.4 Apoptosis
By far the best characterised mode of cell death following cerebral ischaemia is
apoptosis and hence warrants considerable attention. Apoptosis is a biological process
involving many proteins and cellular elements that orchestrate the manner in which a
cell degenerates and eventually dies. Controlling the process of cell death, is believed
to limit damage to neighbouring tissue by preventing the leakage of potentially harmful
cellular components. Within the brain, apoptosis appears to plays a central role in
normal embryonic brain development. By contrast, ischaemic induced neuronal
apoptosis is a pathobiological event, triggered by a host of death signals including
calcium influx, ROS production, DNA damage, death receptor (DR) activation,
mitochondrial damage and growth factor depletion (Mehta et al, 2006).
Cells undergoing apoptosis display a range of morphological characteristics distinct
from other modes of cell death. During apoptosis the following features may be
present; cell shrinkage, membrane blebbing and cell fragmentation (apoptotic bodies).
Simultaneously, DNA is specifically cleaved at internucleosomal zones revealing a
characteristic ‘laddering pattern’, which can be visualised by DNA gel electrophoresis
14
or comet assay. Apoptotic cells may also externalise membrane phosphatidyl serine
(PS) residues, which prompts macrophages to ingest them, thereby preventing the
release of cellular factors capable of triggering inflammation.
1.06.4.1 Caspases
Apoptosis can be either caspase-dependent or caspase-independent. Caspases, which
are responsible for the degradation of key cellular proteins, comprise a family of some
14 cysteine proteases, which play a central role in apoptosis (Ellis and Horvitz, 1986;
Shi, 2004). Normally present as inactive zymogens (or pro-enzymes) they undergo
specific proteolytic cleavage in response to apoptotic signalling, which renders them
active. Activated caspases are categorised as either initiator (caspase-2, -8, -9, -10 and -
12), or effector (caspase-3, -6 and -7) caspases depending on whether they merely
initiate a ‘caspase cascade’ (the former) or actually participate in proteolysis (the latter).
Caspase-3 is activated following ischaemia and peptide inhibitors which mimic
substrate cleavage sites can significantly reduce tissue damage in animal models of
stroke (Namura et al, 1998; Loddick et al, 1996; Fink et al, 1998; Himi et al, 1998).
1.6.4.2 Mitochondrial dependent apoptosis – Intrinsic pathway
Mitochondria are central to apoptosis, primarily because of their role as a reservoir for a
host of apoptogenic proteins including cytochrome c (cyt c), AIF, the inhibitor of
apoptosis (IAP) and the procaspases-2, -3, -8 and -9. A key step in the initiation of
apoptosis is the release of cyt c and caspase-9 from the mitochondria which combine to
form and stabilise the apoptosome with apoptotic protease activating factor (Apaf1). In
the presence of ATP, procaspase-9 is converted to caspase-9, which cleaves and
activates caspase-3, -6 and -7, which then proceed to degrade their respective substrate
which includes lamin-, -spectrin and PARP (Nath et al, 1996; Zhao et al, 2001; De
Blasio et al, 2003).
1.06.4.3 Bcl-2 family protein regulators of apoptosis
15
At the mitochondrial level, apoptosis is regulated by the interaction between pro- and
anti-apoptotic proteins belonging to the so-called Bcl-2 family. The cardinal member of
this family, Bcl-2, originally cloned as an oncogene from follicular B-cell lymphoma,
was found by Vaux et al, (1988) to prevent apoptosis. Members of this family possess
Bcl-2 homology (BH) in a number of discrete domains referred to as BH1, BH2, BH3
and BH4. Members are further subgrouped according to the combination and
arrangement of BH domains, which ultimately determines the structure and functions of
the member protein. For example, the pro-apoptotic proteins BAD and BID belong to
the BH3-only group, whereas, Bcl-2 and Bcl-XL are anti-apoptotic BH multi-domain
proteins. The third subgroup comprises the BH multi-domain pro-apoptotic proteins,
which include BAX and BAK. In the final step preceding cyt c release, Bax (a
cytosolic protein) and Bak (which is located in the mitochondrial membrane) become
‘activated’, undergo oligomerisation, and in the case of Bax, become inserted into the
mitochondrial membrane. Exactly how cyt c or other apoptogenic proteins are released
from the mitochondria is not clear, but evidence indicates that oligomeric forms of BAX
and BAK may act as membrane pores (Muchmore et al, 1996; Schlesinger and Saito,
2006).
1.06.4.4 Death receptor mediated apoptosis – extrinsic pathway
Evidence of death receptor mediated apoptosis, has also demonstrated in cerebral
ischaemia (Jin et al, 2001). This mode of apoptosis involves specific ligands such as
Fas ligand (FasL), tumour necrosis factor (TNF) and TNF-related apoptosis-inducing
ligand (TRAIL), which bind to cell surface DRs containing death domain sequences
belonging to the tumour necrosis factor receptor (TNFR) family. In this case multiple
procaspase-8 and/or procaspase-2 molecules are recruited and activated by the activated
receptor, eventually leading to formation of the death inducing signalling complex
(DISC). Caspase-8/2 intern activates procaspase-3 which initiates the caspase cascade.
Inhibition of TNF and FasL binding results in a dramatic reduction in infarct volume
(Martin-Villalba et al, 2001), suggesting an important role in ischaemic neuronal death.
16
1.06.4.5 Caspase independent neuronal cell death
Apoptotic neuronal death following cerebral ischaemia can also occur independently of
caspase activation, via a pathway involving the mitochondrial AIF protein. Following
ischaemia, AIF exits the mitochondria and traverses the nuclear membrane, causing
chromatin condensation and extensive DNA fragmentation, presumably by recruiting
nucleases and proteases, which bind and degrade DNA/protein complexes (Ye et al,
2002; Cande et al, 2002; Hong et al, 2004, Mehta et al, 2007). The mitochondrial
release of AIF is partly regulated by PARP, a DNA-repair and protein modifying
enzyme, which becomes activated following DNA damage induced by cerebral
ischaemia (Mehta et al, 2007). Mice carrying homozygous deletions of the PARP gene
are protected from stroke (Endres et al, 1997), whereas recombinant virus mediated
gene transfer of PARP renders PARP-/-
recipient mice more susceptible to ischaemic
damage (Goto et al, 2002).
1.07 The inflammatory response following cerebral ischaemia
An inflammatory response associated with cerebral ischemia can significantly
exacerbate brain injury. The main inflammatory events contributing to brain damage in
cerebral ischaemia are described below.
1.07.1 Cytokine/chemokine release
The generation of ROS associated with ischaemia-reperfusion and degenerating tissue
initiates the secretion of a number of inflammatory cytokines including TNF and
interlukin-1 (IL-1; Wang et al, 2006). In addition, chemokines such as monocyte
chemoattractant protein-1 (MCP-1) and macrophage inflammatory protein-1 (MIP-1)
17
are also released. The combined action of a number of cytokines/chemokines results in
the recruitment of more immune cells from the circulatory system (Chen et al, 2003).
1.07.2 Immune cell infiltration
Inflammatory modulators released by infarcted tissue signal endothelial cells to express
adhesion molecules (E-selectin, P-selectin, intercellular adhesion molecule-1 [ICAM-
1]) enabling circulating leukocytes (predominantly neutrophils) and other inflammatory
cells (lymphocytes) to attach to, and infiltrate the brain parenchyma. These immune
cells then secrete and generate more inflammatory cytokines and cytotoxic agents, such
as matrix metalloproteinases (MMPs), NO and ROS (Wang et al, 2006).
1.07.3 Microglia and astrocyte activation
Within the brain microglia and astrocytes become activated and secrete damaging
substances further exacerbating neuronal cell death. The role of microglia and damage
in ischaemic stroke is less conclusive, and whilst some studies suggest they contribute
to brain injury, others suggest otherwise (Wang et al, 2007).
1.07.4 Disruption of blood brain barrier function and brain oedema
Another group of factors associated with brain inflammation are the prostaglandins.
These inflammatory mediators are generated when arachidonic acid, released following
breakdown of the phospholipid cell membrane bilayer, is converted by cyclooxygenase
(COX) into the precursor prostaglandin H2 (PGH2). Prostaglandin production within
the brain leads to brain oedema and increased blood brain barrier (BBB) permeability
(Wang et al, 2006).
18
The combined effects of these distinct inflammatory processes culminate in secondary
tissue damage and exacerbation of the initial ischaemic episode.
1.08 Neuroprotection
As described above, following cerebral ischaemia a number of complex and interrelated
processes and cell death mechanisms are set in motion which eventually culminate in
neuronal cell death. A major goal of stroke research is the development of
neuroprotective drugs that inhibit neuronal death. Despite significant efforts, at present
no neuroprotective drug therapy is available clinically to prevent neuronal cell death
following cerebral ischaemia. Thus, there is an urgent need to explore and develop new
treatments.
In addressing the need for neuroprotective therapy it is now widely recognised that
neuroprotection will rely on the administration of multiple drugs, to target a number of
key cell death or cell survival processes. Such strategies may utilise agents which
activate cell survival mechanisms, block cell death pathways, limit oxidative stress,
antagonise calcium mediated toxicity, reduce inflammation and enhance post-ischaemic
neuro-regeneration. Thus, it is essential that new targets be identified and characterised
in order for the development of neuroprotective drugs. One approach to identify new
therapeutic targets is to explore the molecular events involved in neuronal
preconditioning.
1.09 Neuronal preconditioning
Preconditioning occurs when cells exposed to a sub-lethal stress or agent become
resistant to a subsequent damaging insult. Preconditioning was first observed in the
nervous system by Dahl and Balfour (1964), who demonstrated that rats exposed to
brief anoxia develop an increased capacity to resist a more prolonged and damaging
anoxic exposure. This phenomenon, broadly referred to as cerebral ‘preconditioning’ or
19
‘ischaemic tolerance’, has come to include exposure to both non-damaging ischaemia as
well as other non-damaging stimuli, which induces the acquisition of tolerance to
damaging external stress (Kitagawa et al, 1990; Kitagawa et al, 1991). Neuronal
preconditioning also occurs in vitro in brain slices and in neuronal cultures.
The induction of preconditioning can be either acute or delayed. Although acute
preconditioning develops rapidly, it is acquired by post-translational modifications and
its effects are only short-lived. By contrast, delayed preconditioning, which involves
transcriptional changes and de novo protein synthesis takes hours and days to develop,
and can provide protection for up to 7 days.
1.09.1 Neuronal preconditioning, gene expression and mechanisms
Studies utilising both microarray and proteomics have confirmed that preconditioning
involves many gene families, affecting cell cycle regulation, metabolism, inflammation,
excitoxicity, ion homeostasis and signal transduction. Thus preconditioning is not
simply the activation of dormant survival genes, but a coordinated marshalling of
complex cellular processes for the purpose of priming the cell against an impending
insult (Gidday, 2006).
Patterns of gene regulation induced by preconditioning are distinct from the brain’s
response to stress and can involve a selective dampening of potentially damaging
pathways (Stenzel-Poore et al, 2003; Stenzel-Poore et al, 2007). For example,
preconditioning can inhibit both pro-inflammatory cytokine and pro-apoptotic protein
synthesis (Pera et al, 2004; Zhan et al, 2002; Qi et al, 2001). Conversely, mechanisms
imparting resistance to injury are enhanced. For example, increased expression of
inhibitory neurotransmitters retard calcium influx (Grabb et al, 2002; Dave et al, 2005)
whilst increases in SOD1, SOD2, glutathione peroxidase and haeme oxygenase
suppress ROS levels (Arthur et al, 2004, Gidday, 2006). In this way, excitotoxic and
oxidative impacts on the cell are minimised. Additionally protein synthesis is
maintained, protein aggregation is moderated and DNA repair mechanisms are
20
facilitated (Nakagomi et al, 1993; Sugawara et al, 2001; Liu et al, 2005).
Preconditioning can also preserve and stabilise brain mitochondria enabling sustained
oxidative phosphorylation with minimal respiratory chain dysfunction (Dave et al,
2001; Zhang et al, 2003).
Exemplifying the highly coordinated and deliberate nature of the response to
preconditioning stimuli, protein expression appears to exhibit characteristic temporal
patterns. For example, some genes are activated within minutes to hours such as
vascular endothelial growth factor (VEGF) and erythropoietin (EPO), days later such as
-actin, transiently such as metallothionen II, and still others in a protracted fashion
such as Bcl-2 and the heat shock proteins (Gidday, 2006).
1.09.2 Preconditioning, neurotrophic factors and programmed cell survival
Many neurotrophic factors have been directly implicated in development of the tolerant
phenotype. Amongst those shown to be involved are, EPO, VEGF, nerve growth factor
(NGF), brain derived neurotrophic factor (BDNF), basic fibroblast growth factor
(bFGF) and insulin like growth factor-1 (IGF-1; Sakaki et al, 1995; Truettner et al,
2002; Ruscher et al, 2002; Prass et al, 2003; Yanamoto et al, 2004; Wang et al, 2004).
These factors appear to impart what has been termed ‘programmed cell survival’
(Gidday, 2006). The associated cell-signalling changes initiated by these factors appear
to affect gene expression involved in pathways relevant to neuronal cell death and
survival in ischaemia.
In neurons, trophic factors associated with preconditioning such as EPO and BDNF,
initiate some of their pro-survival signalling through a common pathway, which
involves the activation of phosphotidylinositol-3-kinase (PI3K) and Akt (also referred
to as protein kinase B). This step is thought crucial for the induction of ischaemic
tolerance (Miao et al, 2005; Yin et al, 2005; Gidday, 2006) and neurotrophic support
(Datta et al, 1997). Once activated, Akt phosphorylates the pro-apoptotic factor BAD,
which is promptly captured by the cytoplasmic protein 14-3-3 (Zha et al, 1996; Datta et
21
al, 1997). In this way BAD is prevented from binding and inactivating the anti-
apoptotic binding Bcl-XL. Importantly, besides blocking cell death processes,
preconditioning is also capable of increasing the expression of anti-apoptotic proteins.
For example, evidence indicates that preconditioning activates the transcriptional factor
CREB, which increases Bcl-2 and Bcl-XL synthesis (Meller et al, 2005).
1.09.3 Non-neuronal effects of preconditioning
Within the brain, the effects on the vasculature, such as endothelial cells and smooth
muscle represent an important aspect of ischaemic tolerance. Indeed, Dawson et al
(1999) demonstrated that intravenous administration of lipopolysaccharide (LPS)
induced significant ischaemic tolerance against focal cerebral ischaemia which was
associated with improved microvascular perfusion, but not collateral blood flow. They
hypothesised that secondary ischemic damage was abrogated at least partly by the effect
on the microvasculature. Furthermore, in a later study, Rosenzweig et al (2004) found
evidence that LPS mediated preconditioning could attenuate the inflammatory response
and that TNF was involved in mediating this tolerance (Rosenzweig et al, 2007). Thus,
preconditioning can act at many levels, and on many systems, and in response to
different stimuli.
1.10 EPO and the central nervous system
Erythropoietin is a 30 kDa cytokine produced mainly in adult kidney, which acts
primarily to stimulate red blood cell production in response to low oxygen tension or
oxygen deficiency due to anaemia. However, EPO, which is also expressed in the brain
(Digicaylioglu et al, 1995; Marti et al, 1996; Bernaudin et al, 1999), is thought to be
critical for normal brain development where it acts by preventing neuronal apoptosis,
stimulating neurogenesis and directing neuronal migration (Konishi et al, 1993; Yu et
al, 2002; Tsai et al, 2006; Noguchi et al, 2007).
22
Within the central nervous system, neurons and astrocytes both produce EPO under low
oxygen tension (Masuda et al, 1994; Marti et al, 1996; Masuda et al, 1997). By
contrast, the EPO receptor (EPO-R), which also increases in response to hypoxia, is
expressed by neurons, astrocytes, microglia, oligodendrocytes and brain derived
endothelial cells (Masuda et al, 1993; Digicaylioglu et al, 1995; Marti et al, 1996;
Masuda et al, 1997; Morishita et al, 1997; Bernaudin et al, 1999; Nagai et al, 2001).
Erythropoietin expression is controlled via the cytoplasmic hypoxia inducible
transcription factor (HIF-1), which under normoxic conditions is degraded. Hypoxia
leads to the stabilisation of the HIF-1 subunit, which forms a dimer with the HIF-1
subunit that translocates to the nucleus and initiates EPO expression (Wang and
Semenza, 1995; Wang et al, 1995; Masson and Ratcliffe, 2004). By contrast, EPO-R
expression is directly regulated by EPO. In this instance, EPO induces the expression
of the transcriptional factor GATA-3, which binds to a GATA consensus sequence
within the EPO-R promoter and initiates transcription (Noguchi et al, 2007).
Of particular relevance, EPO has been shown to be neuroprotective both in vivo and in
vitro and can ameliorate injury caused by hypoxia, ischaemia, glutamate toxicity and
free radical injury (Morishita et al, 1997; Sakanaka, et al, 1998; Sadamoto et al, 1998;
Kawakami et al, 2001). For example, both prior and post-ischaemic administration
exposure of EPO has been shown to reduce brain damage following global and focal
ischaemia, and in preventing ischaemic induced learning disability in animal models
(Bernaudin et al, 1999; Sadamoto et al, 1998; Calapai et al, 2000; Sakanaka et al,
1998). Mechanisms underlying the preconditioning and post-injury neuroprotective
behaviour of EPO appear to differ, reflecting the diverse roles played by EPO. For
example, whereas preconditioning events predominantly, but not exclusively target cell
survival signalling (Digicaylioglu and Lipton 2001; Ruscher et al, 2002), post-injury
neuroprotection occurs indirectly and can involve angiogenesis (Marti et al 2004; Wang
et al, 2004), neurogenesis and neural migration (Tsai et al, 2006). More importantly, in
a recent pilot proof-of-concept clinical study of patients suffering acute stroke
(Göttingen EPO Stroke-Trial), those who received intravenous recombinant human
EPO, had reduced infarct size and improved clinical outcome (Ehrenreich et al, 2002).
Furthermore, non-erthyropoietic derivatives of EPO, such as carbamylerythropoietin
23
and asialoerythropoietin, which do not increase hematocrit levels, are also
neuroprotective in animal stroke models (Erbayraktar et al, 2003; Villa et al, 2007).
1.10.1 EPO mediated preconditioning/neuroprotection
Erythropoietin appears particularly important to the development of ischaemic tolerance
in the brain (Ruscher et al, 2002). Its effects are mediated following its binding to the
EPO-R and possibly the common beta receptor (betacR; Brines et al, 2004). Following
its induction by ischaemia/hypoxia, full EPO mediated preconditioning, which requires
some new protein synthesis, is achieved after 8 hours (Morishita et al, 1997). Whilst
the mechanism(s) underlying EPO mediated neuroprotection are not fully known, it
appears that a number of pathways are activated following receptor binding and include
the modulation of apoptotic pathways as well as de-novo protein synthesis (Morishita et
al, 1997).
1.10.2 EPO induced signalling and protein expression
Originally, much of our knowledge of EPO mediated intracellular signalling and its
phenotypic effects were gleaned from studies of erythropoiesis. Nevertheless,
preconditioning/neuroprotection is thought to be initiated, at least in part, by the binding
of EPO to the EPO-R, an event which induces receptor dimerisation and auto-
phosphorylation and activation of the Janus tyrosine kinase 2 (JAK2). Once activated,
JAK2 activates the PI3K signalling pathways (Digicaylioglu and Lipton, 2001; Chong
et al, 2002), which mediates neuroprotection by promoting NF- driven transcription
and Akt signalling which promotes BAD inactivation (Digicaylioglu and Lipton, 2001;
Chong et al, 2002; Chong et al, 2003a/b; Digicaylioglu et al, 2004). In addition, JAK2
also activates ERK1/2 signalling and the transcription factor signal transducer and
activator of transcription 5A (STAT5), both of which can increase the expression of
anti-apoptotic proteins (Kilic et al, 2005a; Kilic et al, 2005b; Um and Lodish, 2006;
Park et al, 2006; Zhang et al, 2007).
24
Whilst EPO stimulates at least four known signalling pathways and several protein
changes involved in neuronal protection (Chong et al, 2002; Um and Lodish, 2006),
little is known about other potential neuroprotective proteins that may be up- or down-
regulated as a consequence of EPO preconditioning in neurons. Thus, despite our
knowledge of EPO biology, which suggests a potential therapeutic benefit for EPO in
cerebral ischaemia, the underlying mechanism(s) of EPO mediated neuroprotection are
not fully understood. Furthermore, it is very likely that some of these neuroprotective
mechanisms will be mediated, at least in part, by changes in neuronal protein
expression. Therefore, identifying and assigning functions to these proteins will
contribute to our understanding of EPO mediated neuroprotection and potentially reveal
new targets for drug development.
1.11 General and specific aims
The aim of my project was to identify proteins involved in EPO induced
preconditioning and characterise their potential as targets for the development of drugs
to reduce brain damage following cerebral ischaemia.
The specific aims of my project are:
(i) To identify proteins differentially expressed in neuronal culture following
exposure to EPO,
(ii) To develop a reliable and efficient adenoviral vector system to over-express
proteins in neuronal culture* and,
(iii) Over-express selected candidate proteins differentially expressed following
EPO preconditioning in neuronal cultures and determine their influence on
neuronal survival using in vitro models of neuronal cell death relevant to
ischaemia.
* The rationale behind the need to develop an adenoviral vector expression system is
outlined in the introduction of Chapter 3.
Chapter Two
Materials and methods
26
MATERIALS
Materials not listed here can be found in the relevant chapters.
2.01.1 Mammalian cell lines, bacterial strains, adenoviral and
plasmid DNA
Descriptions, sources and uses for E.coli strains, mammalian cell lines, adenoviral
genomes and plasmids are listed in tables 2.1, 2.2 and 2.3.
Table 2.1 Escherichia coli strains
Strain Genotype Source Purpose
JM109 e14-(McrA-) recA1 endA1
gyrA96 thi-1 hsdR17(rK-
mK+) supE44 relA1 D(lac-
proAB) [F’ traD36 proAB
lacIqZDM15]
Promega General host for plasmid
preparation, plasmid
transformation, cDNA
cloning and sequencing
BJ5183 endA sbcBC rec BC galK
met thi- 1 bioT hsdR (Strr)
(host for pAd Easy
Adenoviral vector)
QBiogene Recombination permissive
host to produce recombinant
adenoviral plasmid DNA
Table 2.2 Cell lines
Strain Genotype Source Purpose
HEK293 Complements adenoviral
replication
QBiogene Cell line for viral
preparation and
amplification
Table 2.3 Plasmids
27
Strain Description Source Purpose
pGEM.TEasy Allows blue/white
selection of clones for
identification of
recombinants, contains T7
and Sp6 RNA polymerase
sequences for sequencing,
and Ampicillin resistance
(AmpR) selection marker
Promega T/A cloning and
sequencing plasmid
pCMV-Shuttle Contains CMV promoter,
multiple cloning sites and
SV40 polyadenylation
signal sequence plus sites
for directed recombination
with pAd Easy-1 and
Kanamycin resistance
(KmR) selection marker
QBiogene Original adenoviral
vector cloning plasmid
pAdEasy-1 Avirulent viral genome
containing site specific
recombination sequences
matching those on pCMV-
Shuttle vector, ∆E1 gene
and ∆E2 gene, AmpR
QBiogene Plasmid/genome for
generating adenoviral
vectors
pEGFP-N1 CMV promoter, multiple
cloning site with
downstream EGFP cDNA
sequence and SV40
polyadenylation sequence
and KmR
selection marker
Clontech Source of EGFP cDNA,
CMV promoter, and
SV40 polyadenylation
sequence
pDsRed-
Express-C1
CMV promoter, with
DsRed-Express cDNA,
downstream multiple
cloning site and SV40
polyadenylation sequence
and KmR
selection marker
Clontech Source of DsRed-
Express cDNA
2.01.2 Chemicals and enzymes
28
Chemicals and enzymes were obtained from the sources listed in Table 2.4. Unless
otherwise indicated, all reagents were of analytical or biochemical grade.
Table 2.4 Chemicals and Enzymes
Item Supplier Details
Adenosine triphosphate
(ATP)
Sigma
Agarose (Biotechnology
grade)
Ameresco
Antarctic phosphatase NEB Biolabs
Antibiotics Sigma
Sigma
Ampicillin (sodium salt)
Kanamycin sulphate
Bacterial culture media Amresco
Difco
Difco
Agar
Bacto-tryptone
Bacto-Yeast extract
Bovine serum albumin
(BSA)
Sigma
Promega
Powdered
At 10 mg/ml in water
5-bromo-4-chloro-3-indolyl-
-galactopyranoside (X-gal)
Promega
Bradford reagent Bio-Rad Bio-Rad protein assay reagent
Calcium chloride BDH
Chloroform BDH
Deoxynucleotide
triphosphates (dNTPs)
Promega dATP, dGTP, dCTP, dTTP
N1N-dimethylformamide BDH
Dimethylsulphoxide
(DMSO)
Sigma
Di-sodium hydrogen
orthophosphate
Sigma
DNA molecular weight
marker standard (1.0 kb
ladder)
Promega
DNA molecular weight
marker standard (Lambda
HindIII digest)
Promega
EDTA BDH
EGTA BDH
Ethanol BDH
Ethidium bromide Sigma
Glacial acetic acid BDH
D-(+)-Glucose BDH
Glycerol Sigma
Human recombinant
cyclophin A (hrCyPA)
Biomol
Hydrochloric acid BDH
29
IPEGAL Sigma
Isopropyl alchol BDH
Isopropylthio--D-
galactoside (IPTG)
Boehringer
Mannheim
Klenow polymerase Promega
Magnesium chloride BDH
Manganese chloride BDH
Methanol BDH
M-MLV Reverse
transcriptase, RNase H minus
Point mutant
Promega
Pfu DNA polymerase Promega
Potassium chloride BDH
Protein molecular weight
marker
Invitrogen
Protease inhibitors Roche Complete cocktail
Restriction enzymes Promega, New
England (NEB)
Biolabs
Afl II, Apa I, Bam HI, Eco RI,
Eco RV, Hind III, Kpn I, Mlu I,
Nhe I, Not I, Pac I, Pme I, Sal I,
Sca I, Spe I, Sma I, Stu I, Xba I,
Xho I, Xma I
RNasin ribonuclease
Inhibitor
Promega
Sodium acetate BDH
Sodium dihydrogen
orthophosphate
Sigma
Sodium dodecyl sulphate
(SDS)
Sigma
Sodium hydroxide BDH
Taq DNA polymerase Promega
Triton X-100 Sigma
Trizol reagent Invitrogen
Trizma base Sigma
Tween20 Sigma
T4 DNA ligase Promega
2.01.3 Antibodies
Antibodies and their sources used in this thesis are listed in Table 2.5.
30
Table 2.5 Antibodies
Antibody (anti-) Source Supplier
Bcl-XL Rabbit BD Biosciences
CD147 Goat Santa Cruz
Cyclophilin A (CyPA) Rabbit Biomol
Extracellular signal regulated
kinase (ERK) 1 and 2
Rabbit Santa Cruz
Green fluorescent protein (GFP) Rabbit BD Biosciences
Glial fibrillary acidic protein
(GFAP)
Mouse monoclonal Sigma
Goat (secondary) conjugated with
horse radish peroxidase (HRP)
Rabbit Zymed
Mouse (secondary) conjugated
with horse radish peroxidase
(HRP)
Sheep Amersham
Mouse Alexa 488 (secondary) Goat Molecular Probes
Neuron specific enolase (NSE) Rabbit DAKO
Peroxiredoxin II (PRDX2) Rabbit LabFrontier, Korea
Phosphatidylethanolamine-
binding protein (PEBP)
Goat Santa Cruz
Phosphorylated extracellular
signal regulated kinase (ERK) 1/2
Mouse monoclonal Santa Cruz
Protein kinase C (PKCZ)
Rabbit Santa Cruz
Red fluorescent protein (RFP) Rabbit BD Biosciences
Rabbit (secondary) conjugated
with horse radish peroxidase
(HRP)
Donkey Amersham
Rabbit Alexa 546 (secondary) Goat Molecular Probes
Rho guanine dissociation inhibitor
(GDI-1)
Rabbit Santa Cruz
Superoxide dismutase 1 (SOD1) Rabbit Stressgen Bioreagents,
USA
-Tubulin Mouse (monoclonal) Pharmagen
Voltage dependent anion channel
(VADC1)
Goat Santa Cruz
Note: Antibodies not listed here can be found in the relevant section
2.02 Solutions and culture media
31
Unless otherwise stated, all general purpose solutions and media were prepared using
Milli-Q water, autoclaved and stored at room temperature. All media and solutions
used in the preparation of chemically competent and electrocompetent bacterial cells
were prepared in sterile water for irrigation (WFI: Baxter). Antibiotic stock solutions
were prepared using WFI and sterilised by microfiltration/0.2 m. Commonly used
solutions and their composition are listed in Table 2.6.
Table 2.6 Commonly used solutions
Solutions Composition
2xYT media Bacto-tryptone (15 g), Bacto-yeast (10 g),
NaCl (5 g) dissolved in Milli-Q water to a
final volume of one litre
Ampicillin 50 mg/ml stock; dissolved in WFI,
sterilised by microfiltration (0.2 m) and
stored at -20C
DNA loading dye 6x stock prepared in 1 x TAE buffer and
containing bromophenol blue (0.25%),
xylene cyanol ff (0.25%) and 30%
glycerol
dNTPs 10 mM stock solution was prepared by
mixing 100 l of each constituent (dATP,
dTTP, dCTP and dGTP each at 100 mM)
with 600 l of WFI, dispensing 100 l
aliquots and stored at -20C
Ethidium bromide Prepared as 10 mg/ml stock with WFI.
Stored in the dark, at 4C
MgCl2 (1M) Dissolved in WFI and sterilised by
microfiltration/0.2 m
MgSO4 (1M) Dissolved in WFI and sterilised by
microfiltration/0.2 m
MOPS SDS running buffer Supplied as 20x stock (Invitrogen) and
composed of MOPS (1 M); Tris Base (1
M); SDS (69.3 mM); EDTA (20.5 mM)
made up in ultrapure water. Unadjusted 1x
buffer is pH 7.7
NuPAGE lauryl dodecyl sulphate (LDS)
sample buffer
Supplied as 4x stock (Invitrogen) and
composed of glycerol (4 g); Tris-Base
(0.682 g); Tris HCl (0.666 g); LDS (0.8
32
g); EDTA (0.006 g); Serva Blue G250
(0.75 ml of 1% solution); phenol red (0.25
ml of 1% solution) made up in 10ml of
ultrapure water. Unadjusted 1x buffer is
pH 8.5
NuPAGE transfer buffer Supplied as 20x stock (Invitrogen) and
composed of bicine (500 mM); Bis-Tris
(500 mM); EDTA (20.5 mM);
chlorobutanol (1 mM) made up in
ultrapure water. Unadjusted1x buffer is
pH 7.2
Oligonucleotides (Custom) Synthetic oligonucleotides were ordered
as 250ng/ml solutions from Proligo
(USA) and stored at -20C
Phosphate buffered saline (PBS) pH7.5 10x stock was prepared by dissolving 11.5
g of di-sodium hydrogen orthophosphate
anhydrous (80 mM), 2.96 g sodium
dihydrogen orthophosphate (20 mM), 5.84
g sodium chloride (100 mM) in Milli-Q
water to1000 ml
SOB++ Bacto-tryptone (20 g), Bacto-yeast (5 g),
NaCl (0.5 g) and KCl (0.186 g) dissolved
in WFI to a final one litre volume and
sterilised. Prior to use, 20 ml of MgCl2 (1
M stock) and MgSO4 (1 M stock) was
added to a final concentration of 10 mM
Sodium acetate Prepared as 3 M solution (pH 5.2) in
Milli-Q, adjusted with glacial acetic acid
and autoclaved
TAE A one litre, 50x stock solution was
prepared by combining Trizma base (242
g), 57.1 ml of glacial acetic acid and 100
ml of 0.5 M EDTA (pH 8.0) with Milli-Q
water
TB Buffer HEPES (10 mM), CaCl2 (15 mM), KCl
(250 mM) were dissolved in WFI and the
pH adjusted to 6.7 with KOH, prior to
adding MnCl2 (55 mM). The solution was
sterilised by microfiltration/0.2 m and
stored at -4C a 15g/L of agar was added to liquid media for preparation of solid media
METHODS
33
Methods not listed in this section are described in detail in the relevant chapters.
2.03 DNA procedures
2.03.1 General handling
All plasticware, solutions and buffers used in conjunction with DNA or RNA were
either certified free of DNases or RNases as supplied by the manufacturer or prepared
in-house and sterilised appropriately. In general, preparations of oligonucleotides, DNA
and RNA were reconstituted in sterile WFI and stored at -20C. For analytical or
preparative work, oligonucleotides, DNA or RNA samples were handled aseptically,
and were thawed and maintained on ice when in use.
2.03.2 Preparative procedures
2.03.2.1 RNA extraction
Total RNA was extracted from tissue cultures or animal tissue samples using TRIZOL
Reagent, a mono-phasic solution of phenol and isothiocyanate and used according to the
manufacturer’s instructions. Total RNA was resuspended in sterile WFI at 0.2 to 1.0
g/ml and stored at -80C
2.03.2.2 Genomic DNA extraction
Total genomic DNA was extracted from cells grown in culture using the MasterPure
Complete DNA and RNA Purification Kit from Epicentre Technologies. Total genomic
DNA was resuspended in sterile WFI and stored at -20C.
2.03.2.3 Plasmid extractions
34
Small-scale isolation of purified plasmid DNA from E.coli was performed with the
Wizard Plus SV Minipreps DNA Purification System Kit (Promega). Single colonies
were inoculated into 1.8 ml of 2xYT medium (containing an appropriate antibiotic) in
microfuge tubes fitted with a PTFE membrane lid (LidBacEppendorf) and grown 16-18
hours at 37C with shaking at 1400 rpm. Cells were pelleted by centrifugation and
plasmid DNA was recovered by following the manufacturer’s instructions. Plasmid
DNA was eluted from the mini-column in 80-100 l sterile WFI.
2.03.2.4 First strand synthesis of cDNA
In the annealing step, total RNA (typically 1.0 g) was combined with the appropriate
primer in WFI, incubated at 80C for 5 minutes and cooled rapidly on ice for 5 minutes
to prevent secondary structures reforming. Primers for isolating full length cDNA
sequences consisted of either 100-500 ng of Oligo (dT)15 (Promega) or 100 ng of gene
specific primer. For analysing RNA transcript levels, 100 ng of random hexamers
(Promega) were used.
For first strand synthesis, annealed primer-templates were gently mixed with 1x M-
MLV Reverse Transcriptase Reaction buffer (Promega), RNasin Ribonuclease
Inhibitor (1 Unit; Promega), dNTP (0.5 mM), M-MLV Reverse Transcriptase, RNase H
Minus, Point Mutant (Promega) 200 Units. Reactions using Oligo (dT)15 were
incubated at 40C for 60 minutes, gene-specific primers were incubated at 40-55C for
60 minutes and random hexamers were initially incubated at room temperature for 10
minutes, followed by 40-55C for 50 minutes. Reactions were inactivated by heating to
70C for 15 minutes. cDNA was used as the template for second strand synthesis and
PCR amplification or otherwise stored at -20C.
2.03.2.5 Polymerase chain reaction (PCR)
35
Polymerase chain reaction was used to generate fragments for vector construction, for
cloning and for assessing transgene transcript levels. Routinely, reaction components
were combined with sterile WFI in a total volume of 50 l and comprised: 50-500 pg of
template (genomic DNA, plasmid DNA or first strand cDNA), 1x enzyme specific
reaction buffer (as supplied by the enzyme manufacturer), 200 M of dNTPs, 100 ng of
each forward and reverse oligonucleotide primers and 1-2 Units of the DNA
synthesising enzyme. For reactions utilising Taq DNA polymerase, a Mg2+
concentration of 1.5 mM was used. Selection of a DNA polymerase was based on the
final product and was chosen from either Taq DNA polymerase (Promega), high fidelity
ThermalAce (Invitrogen), or high fidelity Pfu DNA polymerase (Promega). Cycling
conditions for each reaction were dependent on the template source and GC ratio,
primer to template annealing temperature, DNA polymerase and expected length and
eventual use of the PCR product. Generally, after initial denaturation at 94-98C of 2-3
minutes (1x), reactions were exposed to 20-35 cycles of denaturation at 94-98C for 30-
45 seconds, primer template annealing at 50-60C for 30-45 seconds and extension at
68-74C for a time calculation based on enzyme processivity and expected product
length. A further 10 minute extension completed the cycling protocol.
2.03.2.6 PCR and restriction fragment purification
PCR products and DNA fragments generated by restriction enzyme digestion were
purified from reactions or agarose gel slices using the Wizard SV Gel and PCR Clean-
Up System (Promega). Purified DNA was eluted from the mini-column in sterile WFI
and was suitable for subsequent cloning.
2.03.3 DNA modifying procedures
36
2.03.3.1 Restriction enzyme digestion
Restriction enzyme reactions were performed on plasmid DNA for both preparative and
analytical purposes. In general, restriction digests comprised DNA (0.2-3.0 g) in
sterile WFI and combined in a 20-80 l reaction volume with 1x restriction enzyme
buffer (supplied as a 10x stock by the enzyme manufacturer) and at least 4 Units of
enzyme per g of DNA. Reactions were allowed to proceed for at least 2 hours at the
temperature specified by the manufacturer. For double or triple digests, reactions were
either conducted separately followed by purification (as described in section 2.3.2.6) or
simultaneously if enzyme buffer conditions were compatible. Linearisation of plasmid
vector DNA by restriction digestion was performed for 12-18 hours using excess
restriction enzyme. For directional cloning into expression vectors, whereby the use of
two different restriction enzymes was necessary, digests were always performed
sequentially.
2.03.3.2 Ligations
For ligation reactions, insert DNA (100-250 ng) was combined with sterile WFI in a
volume of 25 l with: 1x T4 DNA ligase ligation buffer (supplied as a 10x stock by the
enzyme manufacturer, Promega); linearised plasmid vector DNA (25-50 ng) and T4
DNA ligase 4.5 Units. Ligation mixtures were incubated at room temperature for 12-18
hours and stored at -20C. Insert to plasmid DNA ratios were kept at a minimum of
3:1.
2.03.3.3 A-tailing
To increase ligation efficiency into the T/A cloning vector pGEM.TE, blunt-ended PCR
products generated using high fidelity (proofreading) DNA polymerases were first A-
tailed prior to ligation. In this reaction, Taq DNA polymerase transfers a 3’ terminal
deoxyadenosine to the PCR product to create an overhang, which is complementary to a
37
5’ deoxythymidine in the modified linearised pGEM.TE vector. For A-tailing, gel or
PCR purified fragments were combined with sterile WFI in a 25 l reaction volume
with: 1x Taq DNA polymerase reaction buffer; Mg2+
at a concentration of 3.0 mM;
dATP (10 M) and 1 unit of Taq DNA polymerase and incubated at 70C for 30
minutes. The reaction product was purified by the method described in section 2.3.2.6.
2.03.3.4 Dephosphorylation of 5’ ends
Whenever plasmid vector DNA digestion resulted in the formation of blunt-ends or
cohesive complementary overhangs, alkaline phosphatase was used to remove 5’ end
phosphate groups to prevent vector recircularisation. Following plasmid digestion, the
reaction mix was combined with 1x antarctic phosphatase reaction buffer (supplied as a
10x stock by the manufacturer, NEB Biolabs) and antarctic phosphatase (5 Units),
incubated at 37C for 15 minutes (5’ extensions or blunt ends) or 60 minutes (for 3’
extensions) and heat inactivated at 65C for 5 minutes. Vector DNA was purified using
the method described in section 2.3.2.6 prior to ligation.
2.03.3.5 Creating blunt end termini from 5’ and 3’ overhangs
DNA polymerase large (Klenow) fragment was used to convert both 5’ and 3’
protruding ends into blunt-ended linearised plasmid vector following restriction enzyme
digestion. Klenow catalyses in-fill DNA polymerisation for 5’ overhangs and can also
remove 3’ overhangs by exonuclease digestion. In this procedure, Klenow (1-5 Units)
and excess dNTPs (0.5 mM) were added to restriction digests, incubated at 30C for 15
minutes and then 75C for 10 minutes to inactivate Klenow. The resulting DNA was
subsequently purified as described in section 2.3.2.6.
2.03.3.6 Site directed mutagenesis
38
Where necessary, site directed mutagenesis was used to modify the nucleotide
sequences of plasmid vector constructs (see Chapters 4 and 5) and for correcting
sequence errors introduced during PCR amplification. Mutation of the target sequence
is achieved using an oligonucleotide, engineered to carry the mutation, as a primer to
synthesise double-stranded copies of the complete plasmid DNA by PCR. Methylated
parental plasmid DNA is selectively degraded by the methylation dependent Dpn1
cleavage, leaving the newly synthesised mutated daughter plasmid DNA, which is
recovered following bacterial transformation of a suitable host. Plasmid DNA, purified
from E.coli strain JM109 (dam+) and carrying the target sequence, was combined in
sterile WFI in a reaction volume of 50 μl with 1x Pfu DNA polymerase buffer (supplied
as a 10x stock by the manufacturer, Promega); dNTPs (200 μM); complementary
forward and reverse primers (designed with a Tm value 78C), and Pfu DNA
polymerase (2 Units). Cycling conditions and primer design were according to the
Quick-Change protocol of Stratagene. On completion of cycling, Dpn1 (5 Units) was
added to the reaction mix and incubated for at least 2 hours at 37C, and 1-2 l was
used to transform E.coli strain JM109.
2.03.4 Analytical procedures
2.03.4.1 Agarose gel electrophoresis
Plasmid DNA, RNA, restriction enzyme fragments and PCR products were mixed with
DNA loading dye and electrophoresed in agarose gels (0.7-2.5% w/v) using a TAE
buffer system. Gels were pre-stained with ethidium bromide (0.5 g/ml) and bands
were visualised by UV transillumination (Foto/UV21, Fotodyne transilluminator), sized
against DNA molecular weight markers and imaged/digitised following capture with a
digital camera (brand, Kodak).
2.03.4.2 Quantitation of DNA and RNA
39
Where necessary, DNA and RNA samples were quantified spectrophotometrically by
measuring absorbance at two wavelengths, 260 nm and 280 nm. The instrument used
for this purpose was the NanoDrop (Analytical Technologies) and the protocols
followed were described by the manufacturer. The concentration and purity of nucleic
acid in the sample is automatically calculated by the instrument, and whilst
concentrations were dependent on the quantity of starting material, pure preparations of
RNA and DNA routinely gave OD260/OD280 ratio’s of approximately 1.8.
2.03.4.3 DNA sequencing
The ABI PrisimBig Dye Terminator version 3.1 reaction ready fluorescent labelling
sequencing mix, employing Ampli Taq DNA Polymerase, was used to sequence
double-stranded DNA. Briefly, 2.0 l of stock reaction mixture was combined with: 25
ng of DNA oligonucleotide sequencing primer; 500-750 ng of purified double-stranded
plasmid DNA template and made up to 10 l with WFI. Cycling conditions used were:
initial denaturation at 96C for 1 minute, followed by 25 amplification cycles (96C for
30 seconds, 50C for 30 seconds and 60C for 4 minutes) and a final 11C hold. To
precipitate the resulting DNA product, samples were mixed with 20 l of WFI, 3 l of
sodium acetate (pH 5.2) and 75 l of ice-cold 100% ethanol. The samples were held at
room temperature (protected from light) for 20 minutes, and centrifuged at 18,500 g for
30 minutes. The entire supernatant was carefully aspirated and discarded. Two
hundred and fifty microlitres of 75% ethanol were added to the tube containing the
DNA pellet. The tube was gently inverted several times and centrifuged at 14 000 rpm
for 10 minutes. The entire supernatant was carefully aspirated and the DNA pellet dried
at 65C for 2 minutes. Dried samples were submitted to the Department of Clinical
Immunology (Royal Perth Hospital) or the Australian Neuromuscular Research Institute
(Queen Elizabeth II Medical Centre) sequencing facilities. Table 2.7 summarizes the
common sequencing primers of the various plasmid vector constructs.
Table 2.7 Sequencing primers used in this thesis
40
Primer Sequence (5’->3’) Plasmid type or
derivative
T7 taatacgactcactataggg pGEM-TEasy
Sp6 atttaggtgacactatagaa pGEM-TEasy
RSV forward cattgcagagatattgtatttaag pShuttle-RSV: plasmids
WPRE reverse gtaaaaagcaacatag pShuttle plasmids
2.04 Bacterial cell procedures
2.04.1 Maintenance of bacterial cells
For long-term storage, both recombinant and non-recombinant bacterial cells were
resuspended in 2xYT medium containing 15% glycerol, aliquoted out into sterile 2 ml
cryotubes (Nunc), snap frozen in liquid nitrogen and stored at -70C. Cells were
recovered from slightly thawed frozen aliquots using sterile loops or micropipette tips
and used to inoculate agar or liquid culture media.
2.04.2 Transformation
2.04.2.1 Preparation of chemically competent JM109 E.coli cells
The calcium chloride method described by Inoue et al (1990) was used to prepare
competent JM109 cells suitable for plasmid DNA transformation. Three millilitres
from an overnight culture of JM109 grown in 2xYT media at 37C were used to
inoculate 500 ml of fresh SOB++ media in a 3 l conical flask. The cells were grown at
28C with vigorous shaking (220 rpm) to an OD (600 nm) of between 0.4-0.6. The
cells were chilled on ice for at least 10 minutes, pelleted by centrifugation (4C) for 10
minutes at 2500 g, gently resuspended in 100 ml of ice-cold TB buffer, and incubated a
further 10 minutes on wet-ice. The cells were re-centrifuged (4C) for 10 minutes at
41
2500 g, gently resuspended in 18.6 ml of ice-cold TB buffer and 1.4 ml of DMSO, and
incubated a further 10 minutes on ice. The cell suspension was aliquoted into sterile 1.5
ml centrifuge tubes, snap frozen in liquid nitrogen and stored at -70C.
2.04.2.2 Preparation of electro-competent BJ5183 E.coli cells carrying
pAdeasy
A 3 ml aliquot from a fresh overnight culture of E.coli BJ5183 (pAdeasy) grown in LB
broth was inoculated into 500 ml of fresh LB broth containing ampicillin (50 g/ml).
Cells were grown at 37C, with vigorous shaking, to an OD (600 nm) of between 0.5-
0.8. The cells were chilled on ice for 30 minutes and then pelleted by centrifugation for
15 minutes at 4C x 4000g. After resuspension in 500 ml of ice cold WFI, the cells
were re-pelleted by centrifugation. This step was repeated and the cells were
resuspended in 10 ml of ice-cold 10% glycerol (v/v in WFI). As a final step, the
bacteria were re-pelleted, resuspended in 1.5 ml of fresh ice-cold 10% glycerol,
aliquoted (40 l) into fresh 0.6 ml tubes and snap-frozen in liquid nitrogen for storage at
-80C.
2.04.2.3 Transformation of DNA into bacteria
Use of chemically competent cells: 5-20 l volumes of either unligated, undigested
plasmid DNA (10-100 ng) or ligation mixtures containing cDNA inserts and linearised
plasmid DNA were gently mixed with 50-200 l of freshly thawed ice-cold chemically
competent E.coli cells in sterile 1.5 ml tubes. Cell/DNA mixtures were incubated on ice
for 10 minutes, heat-shocked at 42C for 45 seconds in a bench-top incubator
(Thermomixer Comfort, Eppendorf) and then placed on ice for a further 2 minutes. One
millilitre of fresh 2xYT broth kept at room temperature was added to the cells and the
culture incubated at 37C for 1 hour. Cells were pelleted by centrifugation at 18500 g
for 1 minute and resuspended in 100 l of 2xYT. Aliquots of the bacterial suspensions
were plated onto 2xYT agar selection plates containing the appropriate antibiotic and
grown for 16-20 hours at 37C. When the identification of DNA inserts was necessary,
42
cells transformed with derivatives of pGEM-Teasy were plated onto agar supplemented
with 0.1 mM IPGT and 40 g/ml of X-gal.
Use of electro-competent cells: a 40 l aliquot of electro-competent E.coli BJ5183
(pAdeasy) cells was thawed on ice and then gently diluted with fresh ice cold 10%
glycerol. Five microlitres of recombinant plasmid DNA were added to the cells and
gently mixed. The cell/DNA suspension was carefully transferred to a fresh sterile 2
mm electroporation cuvette (Biorad) and electroporated (2.5kV, 200 Ohms, 25 F)
using a Biorad electroporator. Cells were resuspended in 1 ml of 2xYT, transferred to a
1.5 ml tube, incubated with gentle shaking at 37C for 1 hour and then plated as
described above.
Chapter Three
Erythropoietin preconditioning in neuronal cultures: signalling,
protection from in vitro ischemia and proteomic analysis
44
This document:
A. Outlines the contribution made by each author for the following publication:
Meloni BP, Tilbrook PA, Boulos S, Arthur PG and Knuckey NW (2006).
Erythropoietin preconditioning in neuronal cultures: signaling, protection from in vitro
ischaemia and proteomic analysis. J Neurosci Res 83(4):584-93.
and
B. Signifies that each of the authors allows permission for the published work to be
included in the PhD thesis by Sherif Boulos
Contribution by each author:
Bruno Meloni 60%
Peta Tilbrook 15%
Sherif Boulos 10%
Peter Arthur 10%
Neville Knuckey 5%
Bruno Meloni (co-ordinating supervisor) on behalf of all authors
Erythropoietin Preconditioning inNeuronal Cultures: Signaling, ProtectionFrom In Vitro Ischemia, and ProteomicAnalysis
Bruno P. Meloni,1* Peta A. Tilbrook,2 Sherif Boulos,1,3
Peter G. Arthur,3 and Neville W. Knuckey1
1Department of Neurosurgery/Sir Charles Gairdner Hospital, Centre for Neuromuscular and NeurologicalDisorders/The University of Western Australia, and Australian Neuromuscular Research Institute,Perth, Western Australia, Australia2Western Australian Institute for Medical Research and Centre for Medical Research/The University ofWestern Australia, Perth, Western Australia, Australia3School of Biochemical and Chemical Sciences, The University of Western Australia,Perth, Western Australia, Australia
In this study we confirmed the presence of the erythro-poietin (EPO) receptor on both cultured cortical neuronsand PC12 cells and showed that EPO can inducechanges in p38, ERK, and JNK signaling molecules inthese cells. We induced EPO preconditioning in corticalneuronal cultures that protected neurons from a subse-quent in vitro ischemic insult (transient oxygen-glucosedeprivation). To investigate downstream changes inprotein expression in EPO-preconditioned cortical neu-ronal cultures, we used two-dimensional gel electro-phoresis. Overall, EPO preconditioning resulted in pro-tein up-regulation, and, from 84 of the most differen-tially expressed proteins selected for identification, theproteins or tentative proteins were identified in 57cases, representing 40 different proteins. Different pro-tein spots representing the same or closely related pro-tein(s) occurred for 13 of the identified proteins and arelikely to represent posttranslational modifications orproteolytic fragments of the protein. Two proteins (78-kD glucose-regulated protein and tropomyosin, fibro-blast isoform 1) were detected in control neuronal cul-tures, but not following EPO preconditioning treatment,whereas one protein (40S ribosomal protein SA) wasdetected only following EPO preconditioning. Most ofthe other proteins identified had not previously beenassociated with EPO preconditioning and will aid in theunderstanding of EPO’s neuroprotective response andpossibly the development of new therapeutic interven-tions to inhibit neuronal death in acute and chronicneurodegenerative diseases. VVC 2006 Wiley-Liss, Inc.
Key words: proteomics; neuroprotection; two-dimensionalelectrophoresis; oxygen-glucose deprivation
Erythropoietin (EPO) is produced by the fetal liver,adult kidney, and developing and mature central nervous
system (CNS). Liver and kidney production stimulateserythropoiesis, whereas, in the CNS, EPO is involved inbrain maturation and neuronal protection and repair(Genc et al., 2004). EPO production is stimulated by hy-poxia, hypoglycemia, and oxidative stress, and its biologi-cal effects are mediated via the EPO receptor (EPO-R)and other uncharacterized receptors (Genc et al., 2004;Leist et al., 2004). Neuroprotective effects of EPO havebeen shown to occur in the brain and in neuronal cellcultures and require endogenous or exogenous EPO ex-posure (Genc et al., 2004). Some studies have shown that,to induce a neuroprotective effect, a preexposure intervalof 3–8 hr is required, whereas other studies have pro-duced positive outcomes with shorter preexposure timesand exposure during and after insult (Morishita et al.,1997; Sakanaka et al., 1998; Ruscher et al., 2002). EPOpreconditioning and/or treatment in vivo and in vitrohave been shown to protect neuronal tissue or cells inmodels of hypoxia; ischemia; excitotoxicity; trauma; andoxidative, light and, metabolic stress (Morishita et al.,1997; Sakanaka et al., 1998; Bernaudin et al., 1999; Brineset al., 2000; Sinor and Greenberg, 2000; Digicayliogluand Lipton, 2001; Siren et al., 2001; Grimm et al., 2002;Wen et al., 2002).
Upon receptor activation, EPO triggers signalingpathways that ultimately result in new protein expressionand/or protein posttranslational changes required for neu-roprotection. Signaling pathways implicated in EPO-
*Correspondence to: Bruno P. Meloni, Australian Neuromuscular
Research Institute, A Block, 4th Floor, QEII Medical Centre, Nedlands,
Western Australia, Australia 6009. E-mail: [email protected]
Received 26 October 2005; Revised 21 November 2005; Accepted 27
November 2005
Published online 24 January 2006 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/jnr.20755
Journal of Neuroscience Research 83:584–593 (2006)
' 2006 Wiley-Liss, Inc.
induced neuroprotection include Janus kinase-2 (Jak2),Stat5, nuclear factor-jB (NFjB), extracellular signal-regulated kinases (ERK1, ERK2), protein kinase B (Akt-1), mitogen-activated protein kinase (MAPK), and phos-phatidylinositol 3-kinase [PI(3)K; Digicaylioglu and Lip-ton, 2001; Siren et al., 2001; Kretz et al., 2005; Liu et al.,2005]. Although it is likely that these signaling pathwaysultimately up-regulate neuroprotective proteins, only afew proteins (XIAP, IAP2, Bcl-xL, BDNF) have beenshown to be up-regulated following EPO exposure in thebrain or neurons (Digicaylioglu and Lipton, 2001; Wanget al., 2004; Sola et al., 2005; Viviani et al., 2005).
Further characterization of the proteins involved inEPO’s neuroprotective response has significant clinicalimplications. The identification of neuroprotective pro-teins may be used to refine and increase further the po-tency of neuroprotective treatments. This is especially rel-evant for prophylactic treatment or long-term treatmentof neurodegenerative diseases, insofar as high EPO plasmalevels may be ineffective and associated with undesirableside effects (Kennedy and Buchan, 2005). In addition,although it has been shown in animal models that admin-istration of EPO 6 hr after brain injury is beneficial(Brines et al., 2000), identifying the specific neuroprotec-tive mechanisms may allow an even wider therapeuticwindow. To this end, it is likely EPO stimulates the syn-thesis of proteins that block cell death pathways and stim-ulate cell survival pathways. Understanding the signalingmolecules and proteins involved in these pathways willallow the development of agents that mimic or blockthese neuroprotective and neurodamaging responses.
In this study, we have identified signaling moleculesactivated in neurons and PC12 cells following EPO expo-sure, evaluated EPO preconditioning in a neuronal invitro model of ischemia, and used two-dimensional elec-trophoresis to identify differential protein expression incortical neuronal cultures following EPO exposure.
MATERIALS AND METHODS
Cultivation of Cortical Neurons andEPO Preconditioning
Establishment of cortical cultures was as previouslydescribed (Meloni et al., 2002) and is briefly outlined below.Cortical tissue (four or five hemispheres) from E18–E19 ratswas dissociated in 2 ml of Hibernate E medium (Invitrogen,Carlsbad, CA) supplemented with 1.3 mM L-cysteine, 10 U/ml papain (Sigma, St. Louis, MO), and 50 U/ml DNase(Sigma) by trituration. Dissociated neurons were washed in 13ml cold Dulbecco’s modified Eagle’s medium (DMEM; Invi-trogen)/10% horse serum (Life Technologies, Bethesda, MD);centrifuged; and gently resuspended in Neurobasal (NB; Invi-trogen)/2% B27 supplement (Invitrogen), 1.6% fetal bovineserum (Invitrogen), 0.4% horse serum, 25 lM glutamate, 10lM 2-mercaptoethanol, 12 lg/ml penicillin, and 20 lg/mlstreptomycin. The neuronal cell concentration was adjusted to1.8–2 million neurons/2 ml, and 2 ml was inoculated intoeach well of a six-well plate (9 cm2; Costar, Cambridge, MA)or 35-mm glass dish precoated with poly-D-lysine (40 lg/ml;
70–150K; Sigma). Neuronal cultures were maintained in aCO2 incubator (5% CO2, 95% air balance, 98% humidity) at378C. On day in vitro (DIV) 4, one-third of the culture me-dium was removed and replaced with fresh NB/2% B27 con-taining the mitotic inhibitor cytosine arabinofuranoside (finalconcentration 1 lM; Sigma), and on DIV 8 one-half of theculture medium was replaced with NB/2% B27. At DIV 11between 1% and 2% of cells in neuronal cultures stain posi-tively for glial fibrillary acidic protein. Neuronal cultures wereexposed to EPO preconditioning (0.5 U/ml) on DIV 11 andin vitro ischemia on DIV 12. EPO preconditioning consistedof adding a 3100 concentrated stock of EPO (humanrecombinant; Janssen Cilag, Australia) prepared in balanced saltsolution (BSS: mM 88.7 NaCl, 5.4 KCl, 1.8 CaCl2, 0.8MgSO4, 1 NaH2PO4, 20 HEPES, pH 7.4) directly to neuro-nal cultures. EPO exposure was for 8, 12, or 24 hr before invitro ischemia and for 12 hr before protein isolation for two-dimensional electrophoresis. Controls consisted of DIV 12cortical neuronal cultures treated with an equivalent volumeof BSS.
In Vitro Ischemia Model
Exposure of neuronal cultures maintained in 35-mmglass dishes to in vitro ischemia to induce delayed pro-grammed cell death was as described previously (Arthur et al.,2004). Briefly, culture media were replaced with 2 ml BSSsupplemented with 2 mM lactate. Neuronal dishes weregassed directly with 100% nitrogen for 40 min at 378C. Afternitrogen gassing, 1.75 ml of BSS was removed from the cul-ture dish, 0.25 ml of NB supplemented with 2% N2 wasadded, and the cultures were placed into a CO2 incubator at378C. Nonischemic control cultures received the same BSSwash procedures and media additions as ischemic cultures butwere maintained in a CO2 incubator.
EPO Stimulation in Cortical Neurons and PC12 Cells
DIV 12 cortical neuronal cultures were maintained asdescribed above, and PC12 cultures were maintained inRPMI supplemented with 10% horse serum and 5% fetal calfserum. For EPO signaling experiments, neurons and PC12cells were plated onto 22-mm glass coverslips or 24-wellplates. PC12 cells were serum starved by incubation overnightin RPMI supplemented with 0.1% horse serum and 0.05% fe-tal calf serum. Cortical neurons were starved by replacingtwo-thirds of the medium with DMEM. Cells were stimu-lated with EPO (5 U/ml) for 15 min before being fixed andused for immunocytochemistry or for 15 or 30 min beforebeing lysed and having protein isolated for immunoblotting. A5 U/ml stimulation dose of EPO was used to ensure satura-tion of EPO-R and to elicit a maximum signaling response(Tilbrook et al., 1996). Immunocytochemistry for the EPO-Rwas performed on cells not stimulated with EPO.
Immunoblotting and Immunocytochemistry
Cells were lysed and 100 lg protein separated by SDS-PAGE, transferred to nitrocellulose membranes and analyzedby immunoblotting followed by incubation with horseradishperoxidase-conjugated antibodies. Visualization was by enhanced
Erythropoietin Preconditioning 585
Journal of Neuroscience Research DOI 10.1002/jnr
chemiluminescence (Amersham, Bucks, United Kingdom). Toquantify the expression of each protein, autoradiographs werescanned into Adobe Photoshop 5.0, and quantification ofband intensity was determined in NIH Image 1.62. Levels ofphosphorylated proteins detected were compared against theloading controls of either unactivated ERK2 and p46/p54JNK.
Cells were grown on coverslips, fixed in 2.5% parafor-maldehyde, and incubated in the presence of antibodies, fol-lowed by a fluorescein isothiocyanate-conjugating secondaryantibody (Amersham). Coverslips were mounted in 2.5%Dabco (Fluka Chemika, Buchs, Switzerland)/10% glycerol/TBS and examined by immunofluorescence.
Primary antibodies used were antiphospho-p38 [sc-7973; Santa Cruz Biotechnology (sc), Santa Cruz, CA], anti-phospho-p46/p54 JNK (sc-6254), anti-JNK (sc-571), anti-phosphotyrosine (sc-7020), antiphospho-ERK1/2 (sc-7383),and the loading control antibody anti-ERK2 (sc-154). A rab-bit antibody was made to the whole extracellular domain ofthe murine EPO-R. Controls for immunocytochemistry con-sisted of preimmune sera for the rabbit EPO-R and omittingprimary antibody.
Assessment of Neuronal Viability andStatistical Analysis
Neuronal viability was assessed 24 hr after in vitro ische-mia by using nuclear morphology following staining with thefluorescent dye 4,6-diamidino-2-phenylindole (DAPI; Sigma)as described previously (Arthur et al., 2004). Although we didnot distinguish between apoptotic and necrotic cell death inour model, on light microscopy and nuclear staining approxi-mately 60% of neurons have features resembling apoptosis,15% have features resembling necrosis, and 25% appear viable.One hundred cells were counted in each culture dish for alltreatments. Neuronal viability in control cultures was treatedas 100%. Viability data were analyzed by ANOVA, followedby post hoc Fisher’s PLSD test. P < 0.05 was considered tobe statistically significant.
Protein Isolation for Two-DimensionalGel Electrophoresis
Total protein was isolated from control and EPO-pre-conditioned neuronal cultures by removing all the media fromwells and washing once with phosphate-buffered saline, beforethe addition of lysis buffer [7 M urea, 2 M thiourea, 40 mMTris-HCl, 1% sulfobetaine 3-10, 2% CHAPS, 65 mM dithio-threitol (DTT), 1% Bio-Lyte carrier ampholytes, pH 3–10;Bio-Rad, Hercules, CA]. Sample was recovered from culturevessels and probe sonicated for 30 sec (Branson Sonifier 450constant duty cycle). Insoluble material was removed by cen-trifugation at 20,000g for 10 min at room temperature. Sam-ples were stored at –808C. Protein content was determined byamino acid analysis using Waters AccQ Tag chemistry (Milli-pore, Milford, MA) as previously described (Cohen et al.,1993).
Two-Dimensional Gel Electrophoresis
Two-dimensional electrophoresis was carried out on aMultiphor II flatbed electrophoresis system (Amersham Bio-
sciences, Piscataway, NJ) using 18-cm IPG gel strips with pHranges of 4–7, 4.5–5.5, and 6–11 (Amersham Biosciences).Sample corresponding to 80 lg protein was loaded onto pH4–7 and pH 4.5–5.5 IPG strips via in-gel rehydration, and pH6–11 strips were loaded at the anode using sample cups. Iso-electric focusing was carried out for a total of 95,000 V/hr at208C. Voltage was slowly increased from 300 to 5,000 V over8 hr and maintained at 5,000 V until the final V/hr productwas achieved. Each protein sample was run in triplicate. Afterisoelectric focusing, strips were equilibrated for 30 min in6 M urea, 2% SDS, 20% glycerol, 0.375 M Tris-HCl, pH 8.8,5 mM tributylphosphine, 2.5% acrylamide. Second-dimensionSDS-PAGE was performed by using 8–18% T 16- 3 18-cmpolyacrylamide slab gels run in a Protean II XL multicell ap-paratus (Bio-Rad) at 48C. Current conditions were 3 mA pergel for 6 hr, followed by 15 mA per gel for 14 hr. Followingsecond-dimension electrophoresis proteins were fluorescentlystained with Sypro Ruby (Molecular Probes, Eugene, OR)according to the manufacturer’s instructions.
Image Analysis of Two-Dimensional Gels
Gels were scanned with a Molecular Imager FX (Bio-Rad) equipped with a 488-nm external laser. Differential pro-tein expression profiles were analyzed by using Z3 V 2.0image-analysis software (Compugen Israel). Triplicate imagesfrom each of the preconditioning treatment and control sam-ples were used to compile a raw master reference gel compos-ite. The composite gels generated from each group and pHgradient were then used to compare the protein profilesbetween control and preconditioning treatments. The ac-quired image-analysis data were used to identify protein spotsdown-/up-regulated in preconditioning for subsequent identi-fication by MALDI-TOF mass spectrometry. Changes greaterthan 1.7-fold in protein expression compared with controlwere considered significant. Differences in protein expressionat the 1.7-fold level analyzed by unpaired t-test, confirmedstatistical significance at the 95% confidence limit.
Tryptic Digestion of Protein Spots
Protein spots were excised and placed in a 96-wellmicrotiter plate for digestion. Gel pieces were washed threetimes in 50% v/v acetonitrile, 25 mM NH4HCO3, pH 7.8,and dried in a SpeedVac centrifuge. Protein in gel pieces wassubjected to tryptic digestion at 378C for 16 hr in 8 ll (0.014lg/ll in 25 mM NH4HCO3, pH 7.8) sequencing-grade tryp-sin (Promega, Madison, WI) solution. Peptides were extractedfrom the gel pieces by using 8 ll of 10% (v/v) acetonitrile,1% (v/v) trifluoroacetic acid solution, and then desalted andconcentrated using ZipTips (Millipore, Bedford, MA). A 1-llaliquot was spotted onto a MALDI sample plate with 1 ll ofmatrix (a-cyano-hydroxycinnamic acid, 8 mg/ml in 50% v/vacetonitrile, 1% v/v trifluoroacetic acid) and allowed to airdry.
MALDI-TOF Mass Spectrometry
MALDI mass spectrometry was performed with aMicromass TofSpec 2E Time of Flight Mass Spectrometer. Anitrogen laser (337 nm) was used to irradiate the sample.
586 Meloni et al.
Journal of Neuroscience Research DOI 10.1002/jnr
Fig. 1. Immunocytochemistry of cultured cortical neurons and PC12 cells for EPO receptor(EPO-R) and signaling molecules before and 15 min following EPO stimulation (5 U/ml). Corti-cal neurons and PC12 cells stained with anti-EPO-R, antiphosphotyrosine (p-tyrosine), antiphos-pho-p38 (p-p38), antiphospho-ERK1/2 (p-ERK), and antiphospho-JNK (p-JNK).
Erythropoietin Preconditioning 587
Journal of Neuroscience Research DOI 10.1002/jnr
Spectra were acquired in reflectron mode in the mass range600–3,500 Da. A near-point calibration was applied and amass tolerance of 50 ppm used. The peptide masses generatedwere used to search against Rodentia entries in SwissProt byusing ProteinProbe on MassLynx.
RESULTS
EPO Signaling in Neurons and PC12 Cells
By using immunocytochemistry, we comparedEPO-R expression and the activation of several signalingproteins in cortical neuronal and PC12 cultures (Fig. 1).The EPO-R was detected in both cortical neurons andPC12 cells. In EPO-stimulated cortical neurons, stainingof phosphorylated (p-) p-p38 and p-ERK1/2 increased inintensity throughout the cytoplasm and/or nucleus, p-p46/p54 JNK produced intense spots in the nucleus, andp-tyrosine increased throughout the cytoplasm. In EPO-stimulated PC12 cells, staining of p-p38 did not increaseand remained cytoplasmic, p-ERK1/2 decreased in inten-sity throughout the cytoplasm and produced intense spotsin the nucleus, p-p46/p54 JNK produced intense spots inthe nucleus, and p-tyrosine localized to the membrane.
To examine EPO signaling further and to confirmresults obtained via immunocytochemistry in neurons andPC12 cells, we used immunoblotting (Fig. 2). In EPO-stimulated cortical neurons, immunoblot analysis at 15and 30 min poststimulation showed altered levels of p-ty-rosine. In addition, levels of p-p38 (1.2- and 1.8-fold), p-ERK1 (1.7- and 2.1-fold), and p-ERK2 (1.7- and 2.2-fold) increased at both time points, whereas p-p46 JNKand p-p54 JNK and loading control ERK2, p46 JNK andp54 JNK levels remained relatively unchanged. In EPO-stimulated PC12 cells, immunoblot analysis at 15 and 30min poststimulation showed increased levels of p-tyrosineand decreased levels of p-p38 (2.2- and 1.4-fold), p-ERK1 (4.3- and 3.0-fold), and p-ERK2 (2.8- and 3.2-fold) at both time points, whereas p-p46 JNK and p-p54JNK levels remained unchanged, as did loading controlsERK2, p46 JNK, and p54 JNK.
EPO Preconditioning and Neuroprotection
EPO preconditioning in cortical neuronal culturesprovided substantial protection from in vitro ischemia(Fig. 3). An 8-hr preconditioning interval increased neu-ronal survival from 26% to 61%, whereas 12- and 24-hrpreconditioning periods resulted in 89% neuronal sur-vival.
EPO Preconditioning and Two-DimensionalGel Electrophoresis
Overall EPO preconditioning in cortical neuronalcultures resulted in protein up-regulation; representativegels are shown in Figure 4. From the composite gelimages, 84 of the most differentially expressed proteinswere selected for protein identification, and the proteinor tentative protein(s) were identified in 57 cases, repre-senting 40 different proteins. The degrees of up-/down-
regulation of the 40 different proteins for each precondi-tioning treatment are summarized in Table I.
For two different, closely related protein families(ACTB/ACTG, HSC70/HSPA2), peptide masses gener-ated from protein spots were not able to distinguish thespecific proteins. Different protein spots representing the
Fig. 2. Effects of EPO stimulation (5 U/ml) on phosphotyrosine,p38, ERK, and JNK in cortical neurons and PC12 cells. A: Lysatesfrom unstimulated (–) or EPO-stimulated cortical neuronal and PC12cell cultures were immunoblotted with antiphosphotyrosine (p-tyro-sine). B: Lysates from unstimulated (–) or EPO-stimulated corticalneuronal and PC12 cell cultures were immunoblotted with antiphos-pho-p38 (p-p38), antiphospho-ERK1/2 (p-ERK1 and p-ERK2), andanti-ERK1/2. C: Lysates from unstimulated (–) or EPO-stimulatedcortical neuronal and PC12 cell cultures were immunoblotted withanti-JNK (p46 JNK and p54 JNK) and antiphospho-JNK (p-p46JNK and p-p54 JNK).
588 Meloni et al.
Journal of Neuroscience Research DOI 10.1002/jnr
same protein or closely related protein(s) occurred for 13of the identified proteins and are likely to represent post-translational modifications or proteolytic fragments of theprotein (Table I). For three proteins (HSC70, STMN1,TPM5) different protein spots representing posttransla-tional or proteolytic modifications of the same proteinwere observed to be up- and down-regulated. Two pro-teins (GRP78, TPM5) were detected in control neuronalcultures, but not following EPO preconditioning treat-ment, and one protein (RPSA) was detected only follow-ing EPO preconditioning.
DISCUSSION
We have shown in this study that EPO precondi-tioning can protect cortical neuronal cultures from a tran-sient oxygen-glucose deprivation model of in vitro ische-mia. Our findings are in line with previous in vitro studiesshowing that EPO preconditioning can protect neuronsin a variety of cell death models (Morishita et al., 1997;Sakanaka et al., 1998; Siren et al., 2001; Ruscher et al.,2002; Wen et al., 2002; Chong et al., 2003). We observedthat an 8-hr preconditioning interval prior to in vitro is-chemia increased neuronal survival from 26% to 61%, anda 12- or 24-hr interval increased neuronal survival from26% to 89%. The increased level of neuronal survival overextended post-EPO exposure times is in line with EPO’sneuroprotective response being reliant on the expressionof proteins involved in preconditioning.
EPO-R-activated signaling mechanisms are likely tobe responsible for the protein expression-mediated neuro-protective response. In support of this, we confirmed thepresence of the EPO-R on cultured cortical neurons andPC12 cells. Also, we detected activation and/or nuclear
translocation of phosphotyrosine-containing proteins,ERK, p38, and JNK, in EPO-stimulated cortical neuronalcultures. Similar signaling changes were detected in PC12cells; however, p-p38 and p-ERK1/2 were down-regu-lated following EPO stimulation. These differences likelyreflect divergent signaling pathways activated in corticalneurons and PC12 cells. Alternatively, it is possible thatneurons and/or PC12 cells possess different EPO-R-interacting signaling molecules that are responsible forthese signaling differences (Leist et al., 2004). Althoughseveral of these signaling molecules have previously beenimplicated in EPO neuronal cell signaling, p-p38 activa-tion had not previously been shown, nor EPO-inducednuclear translocation of JNK. Interestingly, Chong et al.(2003) did not observe significant p-p38 activation in pri-mary hippocampal cultures 10 min after EPO exposure.Our positive signaling findings confirm that EPO-R-mediated signaling events occur in cortical neuronal cul-tures and that these and other signaling pathways are likelyto lead to downstream changes in protein expression.
Proteomic analysis of protein expression in primarycortical neuronal cultures 12 hr after EPO precondition-ing identified 28 proteins as being either up- or down-regulated. Most of the proteins identified have not previ-ously been shown to be influenced by EPO and representproteins potentially involved in neuroprotective and neu-rodamaging pathways. Furthermore, many of the proteinsidentified following EPO preconditioning were identifiedin an earlier proteomic study from our laboratory follow-ing cycloheximide, heat stress, and MK801 precondition-ing, which suggests that similar neuroprotective pathwaysare activated following different preconditioning treat-ments (Meloni et al., 2005). However, six proteins identi-fied to be up-regulated following EPO preconditioning(PRDX2, ATP5A, PKCZ, CRMP1, LAMR1, ATP6E)were not observed to be differentially expressed in ourprevious proteomic study and are discussed below.
Peroxiredoxin 2 (PRDX2) belongs to a family ofproteins involved in redox regulation, because of theirantioxidant functions associated with the removal of cel-lular peroxides, including hydrogen peroxide and peroxy-nitrite (Wood et al., 2003). Hence, peroxiredoxin pro-teins are considered to provide protective roles againstoxidative stress and are linked to oxidant-mediated signal-ing pathways associated with cell survival and death.PRDX2 is expressed in neurons (Sarafian et al., 1999), soit is conceivable that up-regulation of PRDX2 is anEPO-mediated neuroprotective response. This is sup-ported by studies showing that overexpression of PRDX2can protect cells from oxidative stress-related insults(Zhang et al., 1997).
The ATP synthase alpha chain (ATP5A) is a regula-tory unit of the ATP synthase complex (complex V) that isresponsible for generating mitochondrial ATP via oxidativephosphorylation. Hence, up-regulation of this protein maybe suggestive that EPO stimulation in neurons can improveATP generation and in doing so enable cells to maintainATP levels better during energy-compromising conditions,such as ischemia. Interestingly, cytoplasmic accumulation of
Fig. 3. Efficacy of different EPO preconditioning intervals to protectcortical neurons from in vitro ischemia (transient oxygen-glucose de-privation). EPO (0.5 U/ml) was added to cortical neuronal cultures8, 12, or 24 hr prior to induction of in vitro ischemia, and neuronalviability was assessed via DAPI staining 24 hr after in vitro ischemia.Neuronal cells counts were expressed as percentage viable cells, withthe normal control taken as 100% viability. Data are expressed asmean 6 SEM; n ¼ 5; *P < 0.05 compared with in vitro ischemiawithout EPO.
Erythropoietin Preconditioning 589
Journal of Neuroscience Research DOI 10.1002/jnr
Fig. 4. Two-dimensional gels of proteins from control and EPO-preconditioned cortical neuronalcultures. A: Proteins separated using first-dimension pH 4–7 IPG strips. B: Proteins separatedusing first-dimension pH 4.5–5.5 IPG strips. C: Proteins separated using first-dimension pH 6–11IPG strips. Note: protein spots circled in control gels represent proteins down-regulated, whereasprotein spots circled in EPO gels represent up-regulated proteins.
ATP5A has been associated with tau aggregates of neurofi-brillary tangles in Alzheimer’s disease (Sergeant et al., 2003).Therefore, it is possible that, after cell stress and mitochon-drial dysfunction, ATP5A translocates to the cytosol andadopts other cellular functions associated with neurodegen-eration. Deceased protein levels of ATP5A have beendetected in the hippocampus of transgenic mice overex-pressing human Cu/Zn superoxide dismutase and display-ing mitochondrial swelling and vacuolization in neural tis-sue and neurological deficits (Shin et al., 2004).
Protein kinase Cf (PKCf) is a calcium-independent,phospholipid-dependent, serine- and threonine-specific ki-nase, which phosphorylates a range of cellular proteins. It isan atypical PKC isoform and plays a key role in neuronaldifferentiation and the NFjB signaling cell survival pathway(Wooten et al., 1999; Tan and Parker, 2003; Duran et al.,2003). Recent data also indicate that PCKf can be involvedin neuronal cell death (Koponen et al., 2003; Crisanti et al.,2005). After N-methyl-D-aspartate (NMDA) excitotoxicityin PC12 cells, caspase-mediated cleavage of PKC resulted
TABLE I. Differential Protein Expression Levels for Protein Spots Identified Following EPO Preconditioning
Spot number Protein (gene name/Genebank No.) �Fold up-/down-regulateda
Stress/chaperone/antioxidant
160 Fatty acid-binding protein, brain (FABP7/U02096) �1.7
98 78 kD glucose-regulated protein-precursor (GRP78/M14050) A
38, 39, 40, 100 Heat shock cognate protein 70 (HSC70/M19141) 1.7, 1.7, 1.7, �1.7
38, 39, 40 Heat shock protein (HSPA2/X15705) 1.7, 1.7, 1.7
78 Peptidyl-prolyl cis-transisomerase A (PPIA/M19533) 7.8
65 Peroxiredoxin 2 (PRDX2/U06099) 2.0
140 Cu/Zn superoxide dismutase (SOD1/Y00404) 1.8
Mitochondrial
176 ATP synthase alpha (ATP5A/L01062) 2.0
5 ATP synthase beta (ATP5B/M25301) �2.5
102 Heat shock protein 60 mitochondrial (HSP60/X54793) �1.7
101 Mitochondrial stress-70 protein (GRP75/S75280) �2.8
84, 85 Voltage-dependent anion channel 1 (VDAC1/AF048828) 1.7, 2.5
Metabolic/biochemical
79 Citrate synthase (CS/AK012151) 2.1
117 Creatine kinase B chain (CKB/M14400) 1.7
135 Fructose 1 6 biphosphatase (FBP1/J04112) 1.7
177 Fructose-biphosphate aldolase A (ALDOA/M12919) 2.1
187 Phosphoglycerate kinase-testis specific (PGK2/M31788) 2.2
184 Proteasome subunit alpha type 7 (AF019662) 1.8
80, 179 Glyceraldehyde 3-phosphate dehydrogenase (GAPD/M17701) 1.8, 3.1
Signaling
60 Guanine nucleotide-binding protein G (O) (GNAO1/M17526) 2.5
181 Protein kinase C zeta type (PKCZ/J04532) 1.8
18, 63 Rho GDP dissociation inhibitor 1 (GDI-1/AB055070) 2.9, 1.9
49 14-3-3 Protein epsilon (YWHAE/M84416) �1.8
62 14-3-3 Protein gamma (YWHAG/S55305) 1.8
Cytoskeletal
58, 59, 67, 68, 70, 125 Actin cytoplasmic 1 (ACTB/X03672) 3.2, 2.6, 1.9, 1.9, 1.8, 4.5
67, 68, 70 Actin cytoplasmic 2 (ACTG/X52815) 1.9, 1.9, 1.8
20, 93 Cofilin, nonmuscle isoform (CFL1/X62908) 2.2, 2.2
81 Elongation factor 1-alpha 1 (EEFIA1/X03558) 5.4
142 Alpha-internexin (INX/X52017) 1.7
23, 34, 52, 54 Stathmin (STMN1/J04979) 2.0, 1.9, �1.7, �1.7
48, 118 Tropomyosin, fibroblast isoform 1 (TPM5/X53753) A, 2.0
108 Tubulin alpha 1 (TUBA1/V01227) �2.0
55 Tubulin beta chain (TBB1/X03369) 1.8
Miscellaneous
172, 174 Collapsin response-mediator protein 1 (CRMP1/U52102) 2.2, 1.8
74 Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRPA2B1/AF073993) �9.3
129 H-2 Class 1 histocompatibility antigen, D-P alpha chain (HA14/M12381) 1.9
24, 66 Phosphatidylethanolamine-binding protein (PEBP/X75253) 1.9, 2.2
116 40S Ribosomal protein SA (RPSA/D25224) N
123, 162 Vacuolar ATP synthase catalytic subunit A (VAA1/U13837) 4.2, 1.8
183 Vacuolar ATP synthase catalytic subunit E (ATP6E/U13841) 1.8
aValues for �fold up-/down-regulation � 1.7 are statistically significant (P < 0.05). A, protein spot absent in EPO treatment gel; N, protein spot new
in EPO treatment gel.
Erythropoietin Preconditioning 591
Journal of Neuroscience Research DOI 10.1002/jnr
in the generation of a 50-kDa kinase active fragment thattranslocates to the nucleus, an event associated with apopto-sis (Crisanti et al., 2005). In an earlier study, inhibition ofPKCf prevented NMDA-induced death of cortical neurons(Koponen et al., 2003). This finding indicates that PKCfmay play a role in neuronal survival under normal cellularconditions and mild stress but switches to a prodeath roleduring more severe cellular insults.
Collapsin response-mediator protein 1 (CRMP1)belongs to a family of proteins expressed throughout thebrain during development and is involved in axonal guid-ance, neurite extension, and growth cone collapse (Char-rier et al., 2003). Based on studies relating to the collapsinresponse mediator protein family member CRPM2, thereis also evidence that they may be involved in the neuro-degenerative structural changes that occur in dying neu-rons following cerebral ischemia, Parkinson’s disease, andAlzheimer’s disease (Shirvan et al., 1999; Gu et al., 2000;Chung et al., 2005).
The 40S ribosomal protein SA (RPSA), also knownas laminin receptor precursor and p40, is a component of thesmall ribosomal subunit and belongs to the ribosomal pro-tein S2P family. Its overexpression is associated with tu-mor growth and metastasis (Clausse et al., 1996). Anti-sense-mediated down-regulation of RPSA in Hela cellsresults in apoptosis, whereas overexpression in these cellsresults in survival in serum-depleted media (Kaneda et al.,1998). The prosurvival features of RPSA indicate thatEPO up-regulation of this protein in neurons may protectneurons from apoptosis-inducing stimuli.
Vacuolar ATP synthase subunit E (ATP6E) is a com-ponent of the vacuolar proton pump ATPase, which is re-sponsible for acidifying a variety of intracellular compart-ments. Neurons use the vacuolar proton pump to accumu-late neurotransmitters in synaptic vesicles (Morel, 2003).EPO-mediated up-regulation of the E subunit may be a cel-lular response in order to improve neurotransmiter uptakeby the proton pump and thus reduce the level of extra-cellular excitatory transmitters. It is unknown whether theATP6E has other cellular functions unrelated to the vacuo-lar proton pump that may be involved in neuroprotection.
In summary, we have induced EPO preconditioningin cortical neuronal cultures and identified changes in sig-naling molecules in cortical neurons and PC12 cells afterEPO stimulation. Also, we identified 40 proteins differen-tially expressed in EPO-preconditioned cortical neuronalcultures. Although many of these differentially expressedproteins were identified by us in a previous proteomicpreconditioning study (Meloni et al., 2005), most of theproteins identified in the current study had not been impli-cated in EPO preconditioning. Six proteins were up-regu-lated in neuronal cultures in response to EPO precondi-tioning that were not identified in our previous study. It islikely that one or more of the identified proteins areinvolved in cellular pathways that promote cell survival andinhibit cell death. Further characterization of these proteinswill provide cellular targets for the development of newtherapeutic agents for the treatment of CNS injury.
ACKNOWLEDGMENTS
This study was supported by the Department ofNeurosurgery, Sir Charles Gairdner Hospital, and throughtwo Neurotrauma Research Project grants provided bythe Road Safety Council of Western Australia to B.P.M.,N.W.K., and P.A.T.
REFERENCES
Arthur PG, Lim SC, Meloni BP, Munns SE, Chan A, Knuckey NW.
2004. The protective effect of hypoxic preconditioning on cortical neu-
ronal cultures is associated with increases in the activity of several anti-
oxidant enzymes. Brain Res 1017:146–154.
Bernaudin M, Marti HH, Roussel S, Divoux D, Nouvelot A, MacKen-
zie ET, Petit E. 1999. A potential role for erythropoietin in focal per-
manent cerebral ischemia in mice. J Cereb Blood Flow Metab 19:643–
651.
Brines ML, Ghezzi P, Keenan S, Agello D, de Lanerolle NC, Cerami C,
Itri LM, Cerami A. 2000. Erythropoietin crosses the blood–brain bar-
rier to protect against experimental brain injury. Proc Natl Acad Sci
U S A 97:10526–10531.
Charrier E, Reibel S, Rogemond V, Aguera M, Thomasset N, Honnorat
J. 2003. Collapsin response mediator proteins (CRMPs): involvement
in nervous system development and adult neurodegenerative disorders.
Mol Neurobiol 28:51–64.
Chong ZZ, Lin S-H, Kang J-Q, Maiese K. 2003. Erythropoietin pre-
vents early and late neuronal demise through modulation of Akt1 and
induction of caspase 1, 3 and 8. J Neurosci Res 71:659–669.
Chung MA, Lee JE, Lee JY, Ko MJ, Lee ST, Kim HJ. 2005. Alteration
of collapsin response mediator protein-2 expression in focal ischemic rat
brain. Neuroreport 16:1647–1653.
Clausse N, Jackers P, Jares P, Joris B, Sobel ME, Castronovo V. 1996.
Identification of the active gene coding for the metastasis-associated
37LRP/p40 multifunctional protein. DNA Cell Biol 15:1009–1023.
Cohen SA, De Antonis K, Michaud DP. 1993. Compositional protein
analysis using 6-aminoquinolyl-n-hydrosuccinimidyl carbamate, a novel
derivitisation reagent. In: Angeletti RH, editor. Techniques in protein
chemistry IV. San Diego: Academic Press.
Crisanti P, Leon A, Lim DM, Omri B. 2005. Aspirin prevention of
NMDA-induced neuronal death by direct protein kinase Cf inhibition.
J Neurochem 93:1587–1593.
Digicaylioglu M, Lipton SA. 2001. Erythropoietin-mediated neuropro-
tection involves cross-talk between Jak2 and NF-kappaB signalling cas-
cades. Nature 412:641–647.
Duran A, Diaz-Meco MT, Moscat J. 2003. Essential role of RelA Ser311
phosphorylation by zetaPKC in NF-kappaB transcriptional activation.
EMBO J 22:3910–3918.
Genc S, Koroglu TF, Genc K. 2004. Erythropoietin and the nervous sys-
tem. Brain Res 1000:19–31.
Grimm C, Wenzel A, Groszer M, Mayser H, Seeliger M, Samardzija M,
Bauer C, Gassmann M, Reme CE. 2002. HIF-1-induced erythropoie-
tin in the hypoxic retina protects against light-induced retinal degenera-
tion. Nat Med 8:718–724.
Gu Y, Hamajima N, Ihara Y. 2000. Neurofibrillary tangle-associated col-
lapsin response mediator protein-2 (CRMP-2) is highly phosphorylated
on Thr-509, Ser-518, and Ser-522. Biochemistry 39:4267–4275.
Kaneda Y, Kinoshita K, Sato M, Saeki Y, Yamada R, Wataya-Kaneda
M, Tanaka K. 1998. The induction of apoptosis in HeLa cells by the
loss of LBP-p40. Cell Death Differ 5:20–28.
Kennedy J, Buchan AM. 2005. C-EPO: ready for prime-time precondi-
tioning? Cerebrovasc Dis 19:272–273.
Koponen S, Kurkinen K, Akerman KE, Mochly-Rosen D, Chan PH, Kois-
tinaho J. 2003. Prevention of NMDA-induced death of cortical neurons
by inhibition of protein kinase C zeta. J Neurochem 86:442–450.
592 Meloni et al.
Journal of Neuroscience Research DOI 10.1002/jnr
Kretz A, Happold CJ, Marticke JK, Isenmann S. 2005. Erythropoietin
promotes regeneration of adult CNS neurons via Jak2/Stat3 and PI3K/
AKT pathway activation. Mol Cell Neurosci 29:569–579.
Leist M, Ghezzi P, Grasso G, Bianchi R, Villa P, Fratelli M, Savino C,
Bianchi M, Nielsen J, Gerwien J, Kallunki P, Larsen AK, Helboe L, Chris-
tensen S, Pedersen LO, Nielsen M, Torup L, Sager T, Sfacteria A, Erbayr-
aktar S, Erbayraktar Z, Gokmen N, Yilmaz O, Cerami-Hand C, Xie
QW, Coleman T, Cerami A, Brines M. 2004. Derivatives of erythropoie-
tin that are tissue protective but not erythropoietic. Science 305:239–242.
Liu J, Narasimhan P, Yu F, Chan PH. 2005. Neuroprotection by
hypoxic preconditioning involves oxidative stress-mediated expression of
hypoxia-inducible factor and erythropoietin. Stroke 36:1264–1269.
Meloni BP, Majda BT, Knuckey NW. 2002. Evaluation of precondition-
ing treatments to protect near-pure cortical neuronal cultures from
in vitro ischemia induced acute and delayed neuronal death. Brain Res
928:69–75.
Meloni BP, Van Dyk D, Cole R, Knuckey NW. 2005. Proteome analy-
sis of cortical neuronal cultures following cycloheximide, heat stress and
MK801 preconditioning. Proteomics 5:4743–4753.
Morel N. 2003. Neurotransmitter release: the dark side of the vacuolar-
H þ ATPase. Biol Cell 95:453–457.
Morishita E, Masuda S, Nagao M, Yasuda Y, Sasaki R. 1997. Erythro-
poietin receptor is expressed in rat hipocampal and cerebral cortical
neurons, and erythropoietin prevents in vitro glutamate-induced neuronal
death. Neuroscience 76:105–116.
Ruscher K, Freyer D, Karsch M, Isaev N, Megow D, Sawitzki B, Priller
J, Dirnagl U, Meisel A. 2002. Erythropoietin is a paracrine mediator
of ischemic tolerance in the brain: evidence from an in vitro model.
J Neurosci 22:10291–10301.
Sakanaka M, Wen T-C, Matsuda S, Masuda S, Morishita E, Nagao M,
Sasaki R. 1998. In vivo evidence that erythropoietin protects neurons
from ischemic damage. Proc Natl Acad Sci U S A 95:4635–4640.
Sarafian TA, Verity MA, Vinters HV, Shih CC, Shi L, Ji XD, Dong L,
Shau H. 1999. Differential expression of peroxiredoxin subtypes in
human brain cell types. J Neurosci Res 56:206–212.
Sergeant N, Wattez A, Galvan-Valencia M, Ghestem A, David JP, Lemoine
J, Sautiere PE, Dachary J, Mazat JP, Michalski JC, Velours J, Mena-Lopez
R, Delacourte A. 2003. Association of ATP synthase alpha-chain with neu-
rofibrillary degeneration in Alzheimer’s disease. Neuroscience 117:293–303.
Shirvan A, Ziv I, Fleminger G, Shina R, He Z, Brudo I, Melamed E,
Barzilai A. 1999. Semaphorins as mediators of neuronal apoptosis. J
Neurochem 73:961–971.
Shin JH, London J, Le Pecheur M, Hoger H, Pollak D, Lubec G. 2004.
Aberrant neuronal and mitochondrial proteins in hippocampus of trans-
genic mice overexpressing human Cu/Zn superoxide dismutase 1. Free
Radic Biol Med 37:643–653.
Sinor AD, Greenberg DA. 2000. Erythropoietin protects cultured cortical
neurons, but not astroglia, from hypoxia and AMPA toxicity. Neurosci
Lett 290:213–215.
Siren AL, Fratelli M, Brines M, Goemans C, Casagrande S, Lewczuk P,
Keenan S, Gleiter C, Pasquali C, Capobianco A, Mennini T, Heumann
R, Cerami A, Ehrenreich H, Ghezzi P. 2001. Erythropoietin prevents
neuronal apoptosis after cerebral ischemia and metabolic stress. Proc
Natl Acad Sci U S A 98:4044–4049.
Sola A, Rogido M, Lee BH, Genetta T, Wen TC. 2005. Erythropoietin
after focal cerebral ischemia activates the Janus kinase-signal transducer
and activator of transcription signaling pathway and improves brain
injury in postnatal day 7 rats. Pediatr Res 57:481–487.
Tan SL, Parker PJ. 2003. Emerging and diverse roles of protein kinase C
in immune cell signalling. Biochem J 376:545–552.
Tilbrook PA, Bittorf T, Callus B, Busfield SJ, Ingley E, Klinken SP. 1996.
Regulation of the erythropoietin receptor and involvement of JAK2 in
differentiation of J2E erythroid cells. Cell Growth Differ 4:511–520.
Viviani B, Bartesaghi S, Corsini E, Villa P, Ghezzi P, Garau A, Galli CL,
Marinovich M. 2005. Erythropoietin protects primary hippocampal
neurons increasing the expression of brain-derived neurotrophic factor.
J Neurochem 93:412–421.
Wang L, Zhang Z, Wang Y, Zhang R, Chopp M. 2004. Treatment of
stroke with erythropoietin enhances neurogenesis and angiogenesis and
improves neurological function in rats. Stroke 35:1732–1737.
Wen T-C, Sadamoto Y, Tanaka J, Zhu P-X, Nakata K, Ma Y-J, Hata
R, Sakanaka M. 2002. Erythropoietin protects neurons against chemical
hypoxia and cerebral ischemic injury by up-regulation Bcl-xL expres-
sion. J Neurosci Res 67:795–803.
Wood ZA, Schroder E, Robin Harris J, Poole LB. 2003. Structure, mech-
anism and regulation of peroxiredoxins. Trends Biochem Sci 28:32–40.
Wooten MW, Seibenhener ML, Zhou G, Vandenplas ML, Tan TH.
1999. Overexpression of atypical PKC in PC12 cells enhances NGF-
responsiveness and survival through an NF-kappaB dependent pathway.
Cell Death Differ 6:753–764.
Zhang P, Liu B, Kang SW, Seo MS, Rhee SG, Obeid LM. 1997. Thio-
redoxin peroxidase is a novel inhibitor of apoptosis with a mechanism
distinct from that of Bcl-2. J Biol Chem 272:30615–30618.
Erythropoietin Preconditioning 593
Journal of Neuroscience Research DOI 10.1002/jnr
Chapter Four
Assessment of CMV, RSV and SYN1 promoters and the woodchuck
post-transcriptional regulatory element in adenovirus vectors for
transgene expression in cortical neuronal cultures
56
This document:
A. Outlines the contribution made by each author for the following publication:
Boulos S, Meloni BP, Arthur PG, Bojarski C and Knuckey NW (2006). Assessment of
CMV, RSV and SYN1 promoters and the woodchuck post-transcriptional regulatory
element in adenovirus vectors for transgene expression in cortical neuronal cultures.
Brain Res 1102(1):27-38.
and
B. Signifies that each of the authors allows permission for the published work to be
included in the PhD thesis by Sherif Boulos
Contribution by each author:
Sherif Boulos 86%
Bruno Meloni 8%
Peter Arthur 2%
Christina Bojarski 2%
Neville Knuckey 2%
Bruno Meloni (co-ordinating supervisor) on behalf of all authors
Research Report
Assessment of CMV, RSV and SYN1 promoters and thewoodchuck post-transcriptional regulatory element inadenovirus vectors for transgene expression in corticalneuronal cultures
Sherif Boulosa,c, ⁎, Bruno P. Melonia,b, Peter G. Arthurc,Christina Bojarskia,b, Neville W. Knuckeya,b
aCentre for Neuromuscular and Neurological Disorders, The University of Western Australia, and Australian Neuromuscular ResearchInstitute, AustraliabDepartment of Neurosurgery, Sir Charles Gairdner Hospital, Nedlands, Western Australian, AustraliacSchool of Biomedical and Chemical Sciences, The University of Western Australia, Australia
A R T I C L E I N F O A B S T R A C T
Article history:Accepted 18 April 2006Available online 27 June 2006
In order to investigate protein function in rat primary cortical neuronal cultures, wemodified an adenoviral vector expression system and assessed the strength and specificityof the cytomegalovirus (CMV), rous sarcoma virus (RSV), and rat and human synapsin 1(SYN1) promoters to drive DsRed-X expression. We also incorporated the woodchuck post-transcriptional regulatory element (WPRE) and a CMV promoter-enhanced greenfluorescent protein (EGFP) reporter cassette. We observed that the RSV promoter activitywas strong in neurons and moderate in astrocytes, while the CMV promoter activity wasweak-to-moderate in neurons and very strong in astrocytes. The rat and human SYN1promoters exhibited similar but weak activity in neurons, despite inclusion of theWPRE.Weconfirmed that the WPRE enhanced RSV promoter-mediated DsRed-X expression in a time-dependent fashion. Interestingly, we observed very weak SYN1-mediated DsRed-Xexpression in astrocytes and HEK293 cells suggesting incomplete neuronal-restrictivebehavior for this promoter. Finally, using our adenoviral expression system, wedemonstrated that RSV promoter-mediated Bcl-XL overexpression attenuated neuronaldeath caused by in vitro ischemia and oxidative stress.
© 2006 Elsevier B.V. All rights reserved.
Keywords:Viral vectorPromoterRat cortical neuronsTranscriptional enhancer
Abbreviations:CMV, cytomegalovirusRSV, rous sarcoma virushSYN1, human synapsin 1rSYN1, rat synapsin 1WPRE, woodchuckpost-transcriptionalregulatory elementAd, adenovirusEGFP, enhanced green fluorescentproteinmoi, multiplicity of infection
B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
⁎ Corresponding author. Australian Neuromuscular Research Institute, A Block, 4th Floor, QEII Medical Centre, Nedlands, WesternAustralia, 6009 Australia. Fax: +61 8 9346 3487.
E-mail address: [email protected] (S. Boulos).
0006-8993/$ – see front matter © 2006 Elsevier B.V. All rights reserved.doi:10.1016/j.brainres.2006.04.089
ava i l ab l e a t www.sc i enced i rec t . com
www.e l sev i e r. com/ l oca te /b ra in res
1. Introduction
Dissociated primary neuronal cultures are typically resis-tant to high rates of plasmid transfection. Consequently,neurobiologists have become increasingly reliant on the useof attenuated viral vectors such as adenovirus (Simons etal., 1999; Kugler et al., 2001; Matsuoka et al., 2000),lentivirus (Duale et al., 2004), herpes simplex virus (Lawr-ence et al., 1996; Harvey et al., 2003), and adeno-associatedvirus (Sun et al., 2003) to introduce genetic material intoneuronal cells. Adenovirus vectors are popular because theypermit the introduction of relatively large DNA sequences,are easy to construct and propagate, are safe to use, andcan be cultivated to high titers. To this end, adenovirusvectors have been used to manipulate gene expression invitro and in vivo in various cell types of the peripheral andcentral nervous systems (Glatzel et al., 2000; Glover et al.,2002; Kilic et al., 2002; Matsuoka et al., 2003) and have beenused to investigate the functions of various proteins inneuronal death (Tamatani et al., 2001), embryonic develop-
ment (Okuda et al., 2004; Canzoniere et al., 2004), andnormal cellular physiology (Li et al., 2005). Hence, due tothe advantages of adenovirus vectors over other viralvectors and their increasing use in neurobiology, anymodifications in vector design need to be assessed foruse in neuronal cell studies.
In this study, we made modifications to an existingadenoviral vector expression system by first incorporating aCMV/EGFP reporter cassette. Next, we assessed the influenceof the woodchuck post-transcriptional regulatory element(WPRE) on the rous sarcoma virus (RSV) promoter-mediatedDsRed-X transgene expression in cortical neuronal cultures.We also compared the capacity of the cytomegalovirus(CMV), RSV and the rat and human synapsin 1 (SYN1) genepromoters, in conjunction with the WPRE, to drive DsRed-Xexpression in cortical neuronal cultures. Finally, to validatethe vector system developed for this study, we generated arecombinant adenovirus incorporating the RSV promoterand WPRE to overexpress the anti-apoptotic protein, Bcl-XL,in cortical neuronal cultures. We used this virus to
Fig. 1 – Assembly of transgene and enhanced green fluorescent protein (EGFP) reporter expression cassettes bymodification ofthe original pCMV-shuttle vector (He et al., 1998); see Experimental procedures for detailed descriptions of vector derivation.Promoters are: human cytomegalovirus (CMV, 530 bp); human synapsin 1 (hSYN1, 495 bp); rat synapsin 1 (rSYN1, 495 bp); roussarcoma virus (RSV, 329 bp). The woodchuck post-transcriptional regulatory element (WPRE, 592 bp) was inserted immediatelydownstream of the polylinker. The polyadenylation sequence was derived from SV40 (He et al., 1998). The locations ofrestriction enzyme sites are indicated. Sequences are not drawn to scale.
28 B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
investigate the neuroprotective properties of Bcl-XL in an invitro model of ischemia and oxidative stress.
2. Results
2.1. Construction of adenoviral vectors
All the shuttle plasmids constructed to generate adenovirus inthis study are shown diagrammatically in Fig. 1. The modulardesign of the shuttle plasmid enables easy promoter andtransgene replacement, with or without the WPRE. Asexpected, all adenovirus constructs exhibited CMV-mediatedEGFP reporter expression during passage in HEK293 cells.Similarly, AdRSV:DsRed-X, AdRSV:DsRed-X/WPRE, andAdCMV:DsRed-X/WPRE adenovirus constructs exhibitedDsRed-X expression in HEK293 cells. In comparison to theAdRSV:Empty adenovirus vector, which exhibited no observ-able red fluorescence (DsRed-X), we noted that AdhSYN1:DsRed-X/WPRE and AdrSYN1:DsRed-X/WPRE constructs in-duced a low level of red fluorescence in some HEK293 cells(data not shown). This was a surprising finding and a possibleexplanation is provided in the discussion.
In preliminary testing using the AdRSV:DsRed-X/WPREvector, we obtained transduction rates of around 60–80% inneurons using a moi of 100 (data not shown), a findingconsistent with published data on adenoviral transduction ofdissociated neurons (Easton et al., 1998). It should be notedthat our neuronal cultures contain less than 2% astrocytes(Meloni et al., 2001), which are easily distinguished fromneurons when transduced with our adenoviral constructs dueto their morphological appearance and stronger CMV-drivenEGFP expression, detected by fluorescence microscopy.
2.2. The woodchuck post-transcriptional regulatoryelement (WPRE) enhances transgene expression in a timedependent fashion
To characterize the effect of the WPRE on RSV promoteractivity, we compared DsRed-X expression in adenoviralconstructs with and without the WPRE in neuronal cultures.The RSV promoter was selected for this experiment aspreliminary work involving plasmid transfection of shuttlevector constructs in neuronal cultures showed that the RSVpromoter exhibited the highest neuronal activity compared tothe CMV and SYN1 promoters. In addition, the influence of theWPRE on the RSV promoter had not been previously reported.At 24 h post-transduction, CMV-mediated EGFP reporterexpression was evident and demonstrated equivalent trans-duction levels between the AdRSV:DsRed-X and AdRSV:DsRed-X/WPRE adenovirus constructs (Fig. 2B). By contrast,at 24 h post-transduction, DsRed-X protein was undetectableby Western blotting (Fig. 2A) and was just visible byfluorescence microscopy, with cultures transduced with theWPRE containing construct showing slightly stronger DsRed-Xfluorescence (Fig. 2B panel g). At 48 h post-transduction, theWPRE induced only a slight increase in DsRed-X expression(Fig. 2A and B). However, by 72 and 96 h post-transduction, theWPRE had increased DsRed-X expression by 2.6-fold and 5.6-fold respectively (Figs. 2A and B).
2.3. Comparison of adenovirus-mediated transgeneexpression by different promoters in cortical neuronal cultures
We firstly tested the validity ofmeasuring gene expression as afunction of fluorescence by correlating specific protein expres-sion determined fluorometrically and by Western analysis foreach promoter construct (AdRSV:Empty, AdRSV:DsRed-X/WPRE,AdCMV:DsRed-X/WPRE,AdhSYN1:DsRed-X/WPRE,Adr-SYN1:DsRed-X/WPRE). A combined plot of relative proteinexpression attained for the two methods show matchingprofiles for each construct (Fig. 3A). Fluorescence imaging(Fig. 3D) provided additional qualitative data supporting goodcorrelation between fluorometric andWestern analysis. Thus,we confirmed that fluorescence provided a reliable andaccurate measure of transgene expression.
Since the CMV promoter displays preferential activity innon-neuronal cells (Kugler et al., 2001), EGFP expressingastrocytes were determined for each neuronal culture set andwere expressed as a percentage of total cells. Results comparingadenovirus-mediated DsRed-X expression from different pro-moters usingWestern analysis and/or fluorescence in neuronalcultures containing different populations of astrocytes aresummarized in Figs. 3A–D. In neuronal cultures containing0.5% astrocytes, the RSV promoter induced the greatest DsRed-X expression (Fig. 3A) at 2.2-fold above the CMV promoter, 5.9-fold above the hSYN1 promoter, and 13.5-fold above the rSYN1promoter. The human SYN1 promoter induced slightly higherDsRed-X expression compared with the rat SYN1 promoter inneuronal cultures containing 0.5% astrocytes (Fig. 3A). However,both SYN1 promoters exhibited comparable activity in neuro-nal cultures with 2.0% astrocytes (Fig. 3B). Nevertheless, bothSYN1 promoters displayed considerably lower activity com-pared to the RSV and CMV promoters. The RSV promoterexhibited similar DsRed-X expression as observed in culturesirrespective of the astrocyte population (Figs. 3A and B). Bycontrast, cultures containing 2.0% astrocytes caused CMVpromoter-mediated DsRed-X expression to increase 7.2-fold(Figs. 3B and D). The increase in fluorescence induced by CMV-mediated DsRed-X expression was attributable to high levelexpression in astrocytes (Fig. 3D, panel k). Thus, for the CMVpromoter, small changes in astrocyte cell numbers candramatically shift total transgene expression in cortical neuro-nal cultures. To explore this further, we compared the behaviorof each promoter in neuronal cultures enriched for astrocytes.
2.4. Comparison of adenovirus-mediated transgeneexpression by different promoters in cortical neuronal culturesenriched for astrocytes
Since adenovirus transduced astrocytes at high efficiency inthese experiments (data not shown), the moi was reduced to12.5 in astrocyte enriched cultures. The relative DsRed-Xexpression levels mediated by the CMV promoter were 10-fold above RSV promoter-driven levels (Fig. 3C). This resultreflected fluorescence imaging, which revealed intense CMVpromoter-mediated DsRed-X expression (Fig. 3D; panel l). Byfluorometric analysis, the human and rat SYN1 promotersexhibited no apparent DsRed-X expression (Fig. 3C), however,under fluorescence microscopy, we observed low level pro-moter activity in some astrocytes (equivalent data are shown
29B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
below: Section 2.5, Fig. 4). As the SYN 1 promoter is regarded asa neuron restrictive promoter, we decided to investigate thisfinding further.
2.5. Residual synapsin 1 gene promoter activity inastrocytes
To clarifywhether the SYN1promoterwas active in astrocytes,we re-transduced (moi 12.5) astrocyte enriched neuronalcultures with the AdhSYN:DsRed-X/WPRE and again observedSYN1-mediated DsRed-X expression using fluorescence mi-croscopy. Fig. 4A clearly shows astrocytes infected with theAdhSYN:DsRed-X/WPRE construct showing DsRed-X and EGFPco-expression (encircled). A control culture transduced withAdRSV:Empty displayed only EGFP expression. Using immu-nocytochemistry, we showed co-localization of specific glialfibrillary acidic protein (GFAP) staining (Fig. 4B panel f, arrow)and hSYN1-mediated DsRed-X expression by fluorescencemicroscopy in astrocytes (Fig. 4B panel e, arrow). To provideadditional confirmation, we detected DsRed-X immunoreac-tivity in neurons and astrocytes (Fig. 4C panels g and h;astrocytes are indicated by arrows). At the same time, theseexperiments were conducted using the rat SYN1 promoteradenovirus with identical results (data not shown).
2.6. Adenovirus-mediated Bcl-XL overexpressionattenuates neuronal death from in vitro ischemia andoxidative stress
To test the adenoviral vector system developed in this study,we selected the Bcl-XL protein as a transgene for use infunctional experiments. The Bcl-XL protein exhibits both anti-apoptotic and anti-necrotic behavior (Lee et al., 1999; Kugler etal., 2001; Kilic et al., 2002; Jordan et al., 2004). Since the RSVpromoter andWPRE displayed the strongest neuronal activity,we generated a Bcl-XL adenovirus vector based on thiscombination (AdRSV:Bcl-XL/WPRE; Fig. 1). We confirmed thatneuronal cultures transduced with AdRSV:Bcl-XL/WPRE over-expressed the Bcl-XL protein (Fig. 5A). Next, cortical neuronalcultures were transduced with AdRSV:Bcl-XL/WPRE and theAdRSV:Empty control vector prior to cumene hydroperoxideexposure or in vitro ischemia. In both models, adenovirus-mediated Bcl-XL overexpression significantly increased neu-ronal survival compared to control cultures transduced withAdRSV:Empty (Figs. 5B and C).
3. Discussion
In order to perform gene functional studies in corticalneuronal cultures, we modified the expression cassette of an
existing adenoviral vector system by incorporating severalfeatures. These features included the insertion of suitablerestriction enzyme cloning sites to enable the exchange ofpromoters, transgenes, regulatory elements, and polyadeny-lation sequences. The inclusion of the WPRE supportsenhanced transgene expression, and the independent EGFPreporter assists in monitoring viral propagation, titer deter-minations, normalization of transduction efficiency andallows direct visualization of cell morphology and viability(Lawrence et al., 1996; Yenari et al., 2001). While these featureshave been described separately elsewhere, we have combinedthese elements into a single adenovirus vector and demon-strated their efficacy in assessing transgene expression andpromoter strength and specificity in cortical neuronalcultures.
Strategies to improve transgene expression seek to usestrong promoters and/or incorporate transcriptional enhanc-ing elements. Brun et al. (2003) tested several post-transcip-tional elements and found theWPRE to be themost active in aneuronal background. TheWPRE (≈600 bp in size) is a cis-actingtripartite structure derived from the woodchuck hepatitisvirus (WHV) DNA genome, which acts posttranscriptionally toincrease both nuclear and cytoplasmic unspliced RNA levelswhen inserted in the 3′ untranslated region (Donello et al.,1998). It is thought that the WPRE acts early to increasetransgene expression, possibly by directing post-transcrip-tional processing (Zufferey et al., 1999). Furthermore, theWPRE has been shown to increase CMV and hSYN1 promoter-mediated expression in hippocampal neuronal cultures (Glov-er et al., 2002). While it reportedly functions to increase geneexpression, irrespective of the promoter used (Zufferey et al.,1999), we wanted to confirm and characterize this behaviorusing the RSV promoter, in cortical neuronal cultures. Wehave demonstrated that the WPRE increases RSV promoter-mediated transgene expression, in a time-dependent manner,up to at least 96 h after viral transduction. While Glover et al.(2002) reported the WPRE affected transgene expression at alltime points investigated, we only observed a substantial effectof the WPRE on RSV-mediated expression after 48 h. Thisdiscrepancy may reflect natural promoter behavior as we(data not shown), and others have noted (Smith et al., 2000)that the RSV promoter lags behind that of the CMV promoter.
A review of recent studies indicates the widespread use ofthe CMV promoter to drive adenoviral-mediated neuronalgene expression both in vitro and in vivo (Pi et al., 2004;Schmidt et al., 2005; Ebert et al., 2005). Despite this, wedemonstrated only weak to moderate CMV promoter activityin neurons and very strong activity in astrocytes, a findingconsistent with other published reports (Kugler et al., 2001).These findings argue against using the CMV promoter fortransgene expression in neuronal cultures or at least that care
Fig. 2 – Time course of RSV-mediated DsRed-X expression in primary cortical neuronal cultures transduced at amoi of 100witheither AdRSV:DsRed-X or AdRSV:DsRed-X/WPRE. (A) Quantitation of DsRed-X protein at 24-, 48-, 72-, and 96-h time points asdetermined by Western analysis. The vertical axis denotes DsRed-X expression relative to β-tubulin expression.(B) Fluorescence photomicrographs of representative cultures expressing EGFP at 24 h post-transduction and DsRed-X from24–96 h post-transduction. Images labeled a–e and f–j correspond to cultures transduced with AdRSV:DsRed-X andAdRSV:DsRed-X/WPRE respectively. Photomicrographs taken at 24 h show comparable EGFP expression indicating similarlevels of transduction efficiency. To avoid saturation of fluorescence signal, images e and j (highlighted in box frame) weretaken at a shutter speed of 200 ms, while the other images were taken at 500 ms.
30 B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
31B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
should be taken in selecting this promoter. By contrast, theRSV viral promoter has been less utilized, and few studieshave assessed its strength and specificity in neuronal culturescompared with the CMV promoter. We observed that the RSVpromoter exhibited robust neuronal expression, but onlymoderate activity in astrocytes, compared with the CMVpromoter. Interestingly, using an adeno-associated virus(serotype 2) vector, Shimazaki et al. (2000) found RSV-mediated bcl-2 expression in the gerbil hippocampus wasconfined to the CA1 pyramidal cells with no apparentastrocyte or microglia activity. However, in the case of theadeno-associated virus, a major contributing factor for theapparent promoter preferences may have been due to viraltropism. Indeed in another study, viral tropism accounted fordifferences in adenoviral (human serotype 5) CMV-mediatedexpression, which occurred preferentially in non-neuronalcells, while the opposite was true for lentivirus-mediated CMVexpression (Duale et al., 2004).
No previous study had directly compared human and ratSYN1 promoter activity. This is despite the fact that thehuman and rat SYN1 promoter differ in their sequence andthat the human SYN1 promoter is commonly used in genefunctional studies performed on rodents and/or neuronalcultures derived from rodents. We observed a slight differencein promoter activity between the human and rat SYN1promoters, but only in neuronal cultures containing 0.5%astrocytes. Despite this, our findings support the notion thatboth promoters are similarly effective in neurons of rodentorigin. However, comparison of SYN1, CMV and RSV promoteractivity based on DsRed-X expression in near pure neuronalcultures revealed that SYN1 promoter activity was consider-ably lower than CMV or RSV promoter activity, despite thepresence of the WPRE in all four promoter expressioncassettes.
The SYN1 promoter is reported to be neuron specific alone(Kugler et al., 2001), or in conjunction with theWPRE (Glover etal., 2002). While SYN1-driven expression was prominent inneurons, we observed occasional low level expression inastrocytes. It is unlikely that excess viral loads are responsible,as SYNI promoter-mediated DsRed-X expression in astrocytesoccurred following adenoviral transduction at a moi of 12.5and 100, and in astrocytes following transfection with nakedshuttle plasmid DNA (data not shown). This suggests that theSYN1 promoter is either leaky, at least within dissociatedneuronal cultures, or less restricted, as has been observed forthe neuron specific enolase (NSE) promoter (Kugler et al.,2001). NSE-mediated neuron-specific expression relies on thepresence of a neuron-restrictive silencer factor (NRSE) motifwithin the NSE promoter. In non-neuronal cells, a zinc fingertranscriptional factor binds to this motif blocking transcrip-tion. It has been postulated that the SYN1 gene promoterpossesses a motif comparable in function to the NSREelement. Indeed, Sauerwald et al. (1990) identified a sequencewithin the SYN1 promoter, beginning at nucleotide position−225 and extending to position 105 of the 5′ untranslatedsequence, as sufficient for cell-type-specific expression inneuroblastoma cells. This putative neuron restrictive se-quence was included in both SYN1 promoters used in thisstudy. Our data suggest that either additional sequences arerequired to obtain strict neuronal expression or, alternatively,
the SYN1 promoter used in this study, within the context ofour adenoviral construct, is insufficient to render full neuronalrestrictive expression. In support of our findings, Kilic et al.(2002) reported that both neuronal and non-neuronal cellswere protected by adenoviral vector-mediated Bcl-XL deliveryin a mouse model of focal ischemia, despite the use of theSYN1 promoter to drive expression. Furthermore, we haveobserved weak SYN1 promoter-mediated expression during
32 B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
Fig. 3 – Expression of DsRed-X in cortical neuronal cultures transduced with: AdRSV:Empty; AdRSV:DsRed-X/WPRE; AdCMV:DsRed-X/WPRE; AdhSYN1:DsRed-X/WPRE; AdrSYN1:DsRed-X/WPRE. (A) On DIV 9, neuronal cultures were transduced withadenovirus at a moi of 100 (n = 8). Fluorescence was measured 72 h post-transduction. Fluorescence images were capturedbefore collection of protein samples used in Western analysis. The astrocyte population was estimated at 0.5%. (B) On DIV 9,neuronal cultures were transduced with adenovirus at a moi of 100 (n = 8). Fluorescence was measured 72 h post-transductionand prior to fluorescence imaging. The astrocyte population was estimated at 2.0%. (C) On DIV 9, cortical neuronal culturesenriched for astrocytes were transduced with adenovirus at a moi of 12.5 (n = 8). Fluorescence was measured 72 hpost-transduction and prior to fluorescence imaging. (D) Fluorescent images of representative fields corresponding to culturesanalyzed by fluorescence and Western analysis (A–C). The vertical axis denotes DsRed-X expression relative to EGFPexpression.
33B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
adenoviral passage in HEK293 cells, a finding also reported byKugler et al. (2001). The reason for this behavior was notinvestigated but may be explained by a recent finding that
HEK293 cells express many neuronally specific proteins,including neurofilament (NF), which suggests this cell linehas some neuronal characteristics (Shaw et al., 2002).
Previous studies comparing adenoviral-mediated promoteractivity in neuronal cultures have relied on viral titre determi-nations to normalize transduction levels, which are usually
Fig. 5 – Transduction of neuronal cultures withAdRSV:Bcl-XL/WPRE and control vectors AdRSV:Empty andAdRSV:DsRed-X/WPRE: (A) Immunoblotting of proteinlysates prepared from neuronal cultures transduced withAdRSV:Bcl-XL/WPRE and control vector AdRSV:DsRed-X /WPRE (moi of 100) and probed with anti-Bcl-XL antibodyshowing overexpression of Bcl-XL. (B) Cortical neuronalcultures were transduced with recombinant adenovirus (moiof 75) on DIV 9 and 72 h post-transduction, cultures wereexposed to cumene hydroperoxide (20 μM). Neuronalsurvival was assessed 24 h later (n = 4, *P < 0.05). (C) Corticalneuronal cultures were transduced with recombinantadenovirus (moi of 75) on DIV 9 and 72 h post-transduction,cultures were exposed to in vitro ischaemia. Neuronalsurvival was assessed 24 h later (n = 4, *P < 0.05).
Fig. 4 – Photomicrographs of cortical neuronal culturestransduced on DIV 9 with AdRSV:Empty and AdhSYN:DsRed-X/WPRE and examined 72 hours later. (A) Highmagnification fluorescent images of identical fields showingco-expression of DsRed-X and EGFP by cells (encircled)displaying astrocytic morphology transduced with AdhSYN:DsRed-X/WPRE (panels c and d) at a moi of 12.5. Controlcultures transduced with AdRSV:Empty (panels a and b)exhibited only EGFP reporter expression when viewed undergreen and red filters. (B) High magnification of an astrocyte(denoted by arrow) showing co-localization of DsRed-Xexpression, as revealed by fluorescence imaging (panel e),and immunoreactivity with anti-GFAP antibody followingDAB staining (panel f). (C) Immunohistochemical staining ofneuronal cultures (at low and highmagnification) transducedwith AdhSYN:DsRed-X/WPRE, probed with anti-DsRedantibody, and stained with DAB. NOTE: DsRed-X staining incells displaying neuronal and astrocytic morphologies.
34 B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
performed in HEK cells and not in neurons. To our knowledge,this is the first study to quantify and compare differentpromoters by assaying activity as a function of viral transduc-tion efficiency using a reporter to normalize for transgeneexpression. Thus, our approach prevents erroneous resultsdue to potential differences in neuronal transduction efficien-cies of individual adenoviral vector constructs.
In order to evaluate the suitability of the RSV promoter fortesting gene function in neuronal culture, we generated arecombinant adenovirus expressing the anti-apoptotic pro-tein Bcl-XL under the control of this promoter. Adenoviral-mediated Bcl-XL expression has previously been shown toprotect neurons from glutamate induced cell death in vitro(Matsuoka et al., 2002) and from ischemia in vivo (Wiessner etal., 1999). In the present study, we demonstrated that corticalneuronal cultures transduced with Bcl-XL adenovirus weresignificantly protected following in vitro ischemia andcumene hydroperoxide exposure. The in vitro model ofischemia used in this study induces predominantly apoptoticcell death and has been described elsewhere (Meloni et al.,2001). Cumene hydroperoxide is a lipophilic form of hydrogenperoxide that localizes to the plasma membrane, where itdecomposes to the alkoxyl radical and hydroxy radicals(Halliwell and Gutteridge, 1999) and generates the reactivealdehyde malondialdehyde (MDA) (Gavino et al., 1981; Tsai etal., 1997; O'Neil et al., 1999), which contributes to oxidativestress and lipid peroxidation (Gavino et al., 1981; Koster andSlee, 1983; Persoon-Rothert et al., 1992; Vroegop et al., 1995). Inthis model, we observed neurons dying acutely by necrosis(cell swelling and lysis) and in a delayed fashion (cell andnuclear fragmentation), suggestive of apoptosis. Although theMTS assay does not differentiate between neuronal andastrocyte viability, since our cortical neuronal cultures containgreater than 98% neurons, the cell viability data derived in thisstudy provide a good overall reflection of neuronal survival.Thus, our modified recombinant adenovirus RSV expressioncassette is ideally suited for functional studies in near pureneuronal cultures and mixed neuronal/astrocyte cultures.Furthermore, at just 329 bp in size, the truncated RSVpromoter engineered for this study has the advantage ofbeing smaller than its parent wildtype, and the CMV and SYN1promoters, and thereby enables the insertion of largertransgenes into the expression cassette.
4. Experimental procedures
4.1. Construction and preparation of dual expressionadenovirus vectors
All DNA sequenceswere PCR derived, andwherever necessary,oligonucleotides contained appropriate restriction enzymerecognition sites (indicated below by underlining). ResultingPCR products were gel purified then cloned into pGEM-Teasy(Promega, USA) for bi-directional sequence verification.
4.1.1. Shuttle vector modificationsThe adenoviral shuttle vector, pShuttle-CMV, originally de-scribed by He et al. (1998), was modified by inserting an EGFPreporter, under CMV promoter control, downstream of the
existing polylinker. To allow insertion of different promotersinto pShuttle-CMV, an MluI site was created by site directedmutagenesis at map position 399 using oligonucleotides 5′gcccatatatggagttacgcgttacataacttacgg3′ and 5′ccgtaagttatg-taacgcgtaactccatatatgggc3′. Next, a second SV-40 polyadeny-lation signal sequence, derived using oligonucleotides 5′aggcctccgctagctaatcagccataccac3′ and 5′aggcctcttaagcactag-tatgagtttggacaaaccacaac3′, and incorporating StuI, SpeI, andAflII restriction enzyme sites was digested with StuI andcloned into the EcoRV site of pShuttle-CMV. The CMV-EGFPand polylinker sequence of pEGFP-N1 (BD Biosciences, USA)was derived using oligonucleotides 5′actagttagttattaatagtaat-caattacggg3′ and 5′cttaagttacttgtacagctcgtc3′ incorporating,SpeI and AflII restriction sites. Following removal of thepolylinker by restriction enzyme digestion, klenow treatmentand blunt-ended ligation, the CMV-EGFP fragment wasexcised by SpeI and AflII digestion and directionally clonedinto the modified pShuttle-CMV. A 562 bp region of the WPREderived using oligonucleotides 5′aagcttaatcaacctctggattac3′incorporating a HindIII site and 5′tctagacaggcggggaggcggccc3′incorporating an XbaI site was inserted immediately down-stream of the modified pShuttle-CMV polylinker.
4.1.2. Cloning of RSV promoterThe 329 bp truncated RSV sequence specifically designed for thisstudy was derived from the cloning vector pRc/RSV (Invitrogen)using oligonucleotides 5′acgcgtaaagcggggcttcggttgtac3′ incorpo-rating a MluI site and 5′ggtaccaatgtggtgaatggtcaaatggcg3′ incor-porating a KpnI site. According to the web-based promoterprediction computation software, Neural Network PromoterPrediction, bases 269–319 returned a score of 0.81.
4.1.3. Cloning of SYN1 promotersA 495 bp region from the distal most 3′ end of the human SYN1promoter was amplified from genomic DNA prepared fromhuman embryonic kidney (HEK) cells by nested PCR. Externaloligonucleotides were 5′gcctgtgtggatgtgggagactaat3′ and 5′tgcaggtctgtcatgtacccatttg3′ and internal oligonucleotides were 5′acgcgttgacgaccgaccccg3′ incorporating a MluI site and 5′ggtaccggctgcgacttgggg3′ incorporating aKpnI site. A 495 bp regionfromthedistal3′endof theratSYN1promoterwasderivedbyPCRamplification from genomic DNA prepared from a Sprague–Dawley rat using oligonucleotides 5′acgcgttaggagccttac-tacgggtcc3′ incorporating a MluI site and 5′ggtaccggtgg-cagcttggggc3′ incorporating a KpnI site. The human SYN1promoter sequence selected for this study corresponded to aregionthat reportedlydrivesneuron-specificexpression (Ralphetal., 2000; Glover et al., 2002). Although the human and rat SYN1promoter sequences differ along their ≈4.3 kb length, the rat andhumansequencesused in this studysharedextensivehomology,and reportedly contained motifs critical for neuronal restrictedexpression (Sauerwald et al., 1990).
4.1.4. Cloning of DsRed-Express cDNAThe cDNA sequence of DsRed-Express (abbreviated DsRed-X;from pDsRed-Express-C1, BD Biosciences) was derived usingthe oligonucleotides 5′gtcgacgccaccatggcctc3′ incorporating aSalI site and 5′gcggcccgcctacaggaacaggtggtg3′ incorporating aNot1 site. Supported by our own findings (data not shown)the DsRed-X red fluorescent protein displayed accelerated
35B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
maturation, reduced aggregation and brighter fluorescencecompared with the original DsRed protein (BD Biosciences).
4.1.5. Cloning of Bcl-XL cDNATotal RNA isolated froma Sprague–Dawley rat brainwas purifiedby the Trizol (Invitrogen) extractionmethod and subjected to RT-PCR. The cDNAsequence of the rat Bcl-XL genewas derivedusingthe oligonucleotides 5′gtcgacgccaccatgtctcagagc3′ incorporatinga SalI site and 5′ctcgagtcacttccgactgaagagtggc3′ incorporating aXho1 site.
4.1.6. Preparation of recombinant adenovirusRecombinant adenovirus (human adenovirus, serotype 5) wereprepared using the AdEasy vector system (Qbiogene) originallydescribed by He et al. (1998), with some modifications. pShuttleplasmid DNA was linearized by PmeI digestion and introducedinto E. coli strain BJ5183 carrying pAdeasy (Zeng et al., 2001), byelectroporation (Gene Pulser II, Biorad). Recombinants wereselected on media containing 50 μg/ml kanamycin, and theirplasmid DNA checked by PacI digestion. HEK293 cells grown to90%confluence in25-cm2 flaskswere transfectedwith3μgofPacIlinearized recombinant plasmid DNA using Lipofectamine2000(Invitrogen). Viral plaques appeared within 5–10 days and viralmaterialused forsubsequentamplificationof thevirus inHEK293before purification and concentration using the Adeno-X viruspurification kit (BD Biosciences). Infectious viral titers weredetermined by end-point dilution assay, as indicated by EGFPreporter expression.
4.2. Preparation of cortical neuronal cultures
All animal procedures were approved by the University ofWestern Australia Animal Ethics Committee. Establishmentof cortical cultures was previously described (Meloni et al.,2001), but briefly, cortical tissue from E18–E19 rats wasdissociated in Dulbelcco's modified Eagle medium (DMEM;Invitrogen, USA) supplemented with 1.3 mM L-cysteine,0.9 mM NaHCO3 10 U/ml papain (Sigma, USA) and 50 U/mlDNase (Sigma) and washed in cold DMEM/10% horse serum.Neurons were resuspended in Neurobasal (NB; Invitrogen)containing 2% B27 supplement (B27; Invitrogen). Beforeseeding, culture vessels, consisting of either 96 well-sizedplastic or glass wells (6 mm Dia.) were coated with poly-D-lysine (50 μg/ml; 70–150 K; Sigma) and incubated overnight atroom temperature (RT). The poly-D-lysine was removed andreplaced with NB (containing 2% B27; 4% fetal bovine serum;1% horse serum; 62.5 μM glutamate; 25 μM 2-mercaptoetha-nol; and 30 μg/ml streptomycin and 30 μg/ml penicillin).Neurons were plated to obtain around 10,000 viable neuronsper well on day in vitro (DIV) 9. Neuronal cultures weremaintained in a CO2 incubator (5% CO2, 95% air balance, 98%humidity) at 37 °C. On day DIV 4 one third of the culturemedium was removed and replaced with fresh NB/2% B27containing the mitotic inhibitor, cytosine arabinofuranoside(CARA; Sigma) at 1 μM and on DIV 8 one half of the culturemedium was replaced with NB/2% B27. On DIV 11, between0.5 and 2% of cells in neuronal cultures stain positively forglial fibrillary acidic protein (GFAP; Meloni et al., 2001). Forastrocyte enriched neuronal cultures, CARA was omittedduring cultivation.
4.3. Adenoviral transduction
On DIV 9, the media were removed from cortical neuronalcultures and purified virus in 50 μl of NB/2% B27 was added toeachwell and incubated for 3 h at 37 °C. The virus solutionwasremoved and replaced by an equal mix of conditioned mediaand fresh NB/2% B27. Unless otherwise stated, on DIV 11,transduced neuronal cultures were imaged by fluorescencemicroscopy or subjected to either cumene hydroperoxidetreatment or in vitro ischemia.
4.4. Western blotting
To isolate protein, neuronal cultures were treated with lysisbuffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl, 20 mM EDTA,0.1% SDS, 0.2% deoxycholic acid, containing Complete™protein inhibitor, Roche) and lysates centrifuged. Proteinconcentrations were determined by the Bradford assay(Biorad, USA). Equivalent amounts of protein (5–10 μg perlane) were loaded and separated on 4–12% gradient SDSpoly-acrylamide Bis-Tris mini-gels (NuPAGE; Invitrogen) andtransferred to a PVDF membrane. Membranes were blockedin PBS/T containing ovalbumin (1 mg/ml) for 1 h at RT beforewashing in PBS/T and PBS. Membranes were incubated at4 °C overnight in blocking solution containing primaryantibody, washed, and incubated in blocking solution con-taining horseradish peroxidase (HRP) conjugated secondaryantibody (donkey anti-rabbit or rabbit anti-mouse) for 1 h atRT. Protein bands were detected using ECL Plus (Amersham,UK), visualized by exposure to X-ray film (Hyperfilm;Amersham), scanned, and quantified using NIH image.Primary antibodies used were rabbit polyclonal anti-DsRed(1:16000; BD Biosciences), rabbit polyclonal anti-GFP (1:2000;BD Biosciences), mouse monoclonal anti-β-tubulin (0.5 μg/ml, Pharmingen, USA), and rabbit polyclonal anti-Bcl-XL
(1:1000: BD Biosciences). The detection and quantitation ofβ-tubulin and EGFP were used to normalize for proteinloading and adenovirus transduction levels, respectively.EGFP protein loading was corrected using β-tubulin levelsand subsequently used to normalize for DsRed-X proteinvalues.
4.5. Imaging and fluorometric analysis
4.5.1. Bright field and fluorescence imagingImage acquisition was performed using an Olympus IX70fluorescent microscope fitted with a cooled CCD digitalcamera (DP70, Olympus) under software control (DP con-troller, Olympus).
4.5.2. Quantitation of fluorescenceCortical neuronal cultures plated in black 96 well microtitreplates were transduced (n = 8) at a moi of 100, as describedabove, with the following recombinant adenoviruses; AdRSV:DsRedX/WPRE; AdCMV:DsRedX/WPRE; AdhSYN1:DsRed-X/WPRE, AdrSYN1:DsRed-X/WPRE. Seventy-two hours post-transduction, fluorescence was measured (FLUOstar OPTIMA;BMG Labtechnologies, Germany) using green and red excita-tion/emission wavelength filter pairs of 485P/520P and 560–10/590EM, respectively. Autofluorescence emitted by non-
36 B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
transduced controls was subtracted from total fluorescencevalues for each wavelength. To account for potentialvariation in adenovirus transduction efficiency, relativeDsRed-X expression was normalized against total EGFPfluorescence.
4.6. Immunocytochemistry
Neuronal cultures were fixed in PBS/formalin (4%, pH 7.5) for1 h, washed 3 times in PBS, treated with hydrogen peroxide(3%, in PBS) for 5–10 min to neutralize endogenous peroxi-dase activity, and washed in PBS/Tween 20 (0.1%; PBS/T).After blocking with horse serum for 20 min, cells wereincubated in primary antibody overnight at 4 °C. Cells werewashed in PBS/T then probed with a biotin conjugatedsecondary antibody (DAKO kit). Immunoreactivity wasdetected using HRP conjugated to streptavidin (DAKO) andDAB substrate (SigmaFast). A mouse monoclonal (I:500; IgG1isotype clone G-A-5; Sigma) detected GFAP while a rabbitpolyclonal DsRed antibody (1:16000; BD Biosciences) was usedto detect DsRed-X protein expression.
4.7. Cell death assays of neuronal cultures
4.7.1. In vitro ischemiaExposure of neuronal cultures to in vitro ischemia wasperformed by removing media from each well, washing in315 μl balanced salt solution (BSS; mM: 116 NaCl, 5.4 KCL,1.8 CaCl2, 0.8 MgSO4, 1 NaH2PO4; pH 7.0) and re-adding50 μl of BSS. Neuronal cultures were placed into ananaerobic chamber (Don Whitely Scientific, England) withan atmosphere of 5% CO2, 10% H2 and 85% argon, 98%humidity at 37 °C for 50 min. Following anaerobicincubation an equal volume of DMEM containing 2% N2supplement (Invitrogen) was added before placing culturewells into a CO2 incubator at 37 °C. Control culturesreceived the same BSS wash procedures and mediaadditions as ischemic cultures but were maintained in aCO2 incubator. Neuronal viability was assessed 48 h after invitro ischemia using the MTS assay (Promega). The MTSviability assay measures the mitochondrial conversion ofthe tetrazolium salt to a water-soluble brown formazansalt, which is measured spectrophotometrically (495 nm).Although we do not distinguish between apoptotic andnecrotic cell death following in vitro ischemia, as reportedpreviously (Meloni et al., 2001; Arthur et al., 2004), based onlight microscopy and nuclear staining, this model results inpredominantly apoptotic-like neuronal death. Neuronalviability in control cultures was treated as 100%. Viabilitydata was analyzed by ANOVA, followed by post hocFischer's PLSD test. P values <0.05% were consideredstatistically significant.
4.7.2. Cumene hydroperoxide treatmentThe culture media from transduced neuronal cultures wereremoved and replaced with 100 μl of DMEM/N2 1% contain-ing freshly prepared cumene hydroperoxide (Sigma) at afinal concentration of 25 μM. Cumene hydroperoxide wasdiluted in ethanol as a 100× stock. Cell survival was assessed24 h later using the MTS assay.
Acknowledgments
Many thanks to Ms Kate Thomas for her technical support andOzgene Pty Ltd. for providing a plasmid construct containingthe WPRE. This work was supported by the AustralianNeuromuscular Research Institute (ANRI), CWL Medical PtyLtd., the Neurotrauma Research Program/Road Safety Councilof Western Australia, and the Sir Charles Gairdner HospitalResearch Foundation.
R E F E R E N C E S
Arthur, P.G., Lim, S.C., Meloni, B.P., Munns, S.E., Chan, A., Knuckey,N.W., 2004. The protective effect of hypoxic preconditioning oncortical neuronal cultures is associated with increases in theactivity of several antioxidant enzymes. Brain Res. 1017,146–154.
Brun, S., Faucon-Biguet, N., Mallet, J., 2003. Optimization oftransgene expression at the posttranscriptional level inneural cells: implications for gene therapy. Mol. Ther. 7,782–789.
Canzoniere, D., Farioli-Vecchioli, S., Conti, F., Ciotti, M.T., Tata,A.M., Augusti-Tocco, G., Mattei, E., Lakshmana, M.K.,Krizhanovsky, V., Reeves, S.A., Giovannoni, R., Castano, F.,Servadio, A., Ben-Arie, N., Tirone, F., 2004. Dual control ofneurogenesis by PC3 through cell cycle inhibition andinduction of Math1. J. Neurosci. 24, 3355–3369.
Donello, J.E., Loeb, J.E., Hope, T.J., 1998. Woodchuck hepatitis viruscontains a tripartite posttranscriptional regulatory. J. Virol. 72,5085–5092.
Duale, H., Kasparov, S., Paton, J.F., Teschemacher, A.G., 2004.Differences in transductional tropism of adenoviral andlentiviral vectors in the rat brainstem. Exp. Physiol. 90, 71–78.
Easton, R.M., Johnson, E.M., Creedon, D.J., 1998. Analysis of eventsleading to neuronal death after infection with E1-deficientadenoviral vectors. Mol. Cell. Neurosci. 11, 334–347.
Ebert, A.D., Chen, F., He, X., Cryns, V.L., Bohn, M.C., 2005. Atetracycline-regulated adenovirus encodingdominant-negative caspase-9 is regulated in rat brain andprotects against neurotoxin-induced cell death in vitro, but notin vivo. Exp. Neurol. 191, S80–S94.
Gavino, V.C., Miller, J.S., Ikharebha, S.O., Milo, G.E., Cornwell, D.G.,1981. Effect of polyunsaturated fatty acids and antioxidants onlipid peroxidation in tissue cultures. J. Lipid Res. 22, 763–769.
Glatzel, M., Flechsig, E., Navarro, B., Klein, M.A., Paterna, J.C.,Bueler, H., Aguzzi, A., 2000. Adenoviral and adeno-associatedviral transfer of genes to the peripheral nervous system. Proc.Natl. Acad. Sci. U. S. A. 97, 442–447.
Glover, C.P., Bienemann, A.S., Heywood, D.J., Cosgrave, A.S., Uney,J.B., 2002. Adenoviral-mediated, high-level, cell-specifictransgene expression: a SYN1-WPRE cassette mediatesincreased transgene expression with no loss of neuronspecificity. Mol. Ther. 5, 509–516.
Halliwell, B., Gutteridge, J.M.C., 1999. Free Radicals in Biology andMedicine. Oxford Univ. Press, Oxford.
Harvey, B.K., Chang, C.F., Chiang, Y.H., Bowers, W.J., Morales, M.,Hoffer, B.J., Wang, Y., Federoff, H.J., 2003. HSV amplicondelivery of glial cell line-derived neurotrophic factor isneuroprotective against ischemic injury. Exp. Neurol. 183,47–55.
He, T.C., Zhou, S., da Costa, L.T., Yu, J., Kinzler, K.W.,Vogelstein, B., 1998. A simplified system for generatingrecombinant adenoviruses. Proc. Natl. Acad. Sci. U. S. A. 95,2509–2514.
37B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
Jordan, J., Galindo, M.F., Tornero, D., Gonzalez-Garcia, C., Cena, V.,2004. Bcl-x L blocks mitochondrial multiple conductancechannel activation and inhibits 6-OHDA-induced death inSH-SY5Y cells. J. Neurochem. 89, 124–133.
Kilic, E., Hermann, D.M., Kugler, S., Kilic, U., Holzmuller, H.,Schmeer, C., Bahr, M., 2002. Adenovirus-mediated Bcl-X(L)expression using a neuron-specific synapsin-1 promoterprotects against disseminated neuronal injury and braininfarction following focal cerebral ischemia inmice. Neurobiol.Dis. 11, 275–284.
Koster, J.F., Slee, R.G., 1983. Lipid peroxidation of humanerythrocyte ghosts induced by organic hydroperoxides.Biochem. Biophys. Acta 752, 233–239.
Kugler, S., Meyn, L., Holzmuller, H., Gerhardt, E., Isenmann, S.,Schulz, J.B., Bahr, M., 2001. Neuron-specific expression oftherapeutic proteins: evaluation of different cellular promotersin recombinant adenoviral vectors. Mol. Cell. Neurosci. 17,78–96.
Lawrence, M.S., Ho, D.Y., Sun, G.H., Steinberg, G.K., Sapolsky, R.M.,1996. Overexpression of Bcl-2 with herpes simplex virusvectors protects CNS neurons against neurological insults invitro and in vivo. J. Neurosci. 16, 486–496.
Lee, H.H., Dadgostar, H., Cheng, Q., Shu, J., Cheng, G., 1999.NF-kappa B-mediated up-regulation of Bcl-x and Bfl-1/A1 isrequired for CD40 survival signaling in B lymphocytes. Proc.Natl. Acad. Sci. U. S. A. 96, 9136–9141.
Li, H.W., Gao, Y.X., Matsuura, T., Martynyuk, A., Raizada, M.K.,Sumners, C., 2005. Adenoviral-mediated neuron specifictransduction of angiotensin II type 2 receptors. Regul. Pept. 126,213–222.
Matsuoka, N., Miyatake, S., Yukawa, H., Takahashi, J.C., Saiki, M.,Mori, H., Ishii, K., Akimoto, M., Hamada, H., Hashimoto, N.,2000. Adenovirus-mediated gene transfer of basic fibroblastgrowth factor promotes the survival of primary-cultured ratneuronal cells. NeuroReport 11, 2001–2006.
Matsuoka, N., Ishii, K., Akimoto, M., Hamada, H., Hashimoto, N.,Miyatake, S., 2002. Overexpression of basic fibroblast growthfactor and Bcl-xL with adenoviral vectors protects primarilycultured neurons against glutamate insult. Neurosurgery 50,857–862.
Matsuoka, N., Nozaki, K., Takagi, Y., Nishimura, M., Hayashi, J.,Miyatake, S., Hashimoto, N., 2003. Adenovirus-mediated genetransfer of fibroblast growth factor-2 increases BrdU-positivecells after forebrain ischemia in gerbils. Stroke 34, 1519–1525.
Meloni, B.P., Majda, B.T., Knuckey, N.W., 2001. Establishment ofneuronal in vitro models of ischemia in 96-well microtiterstrip-plates that result in acute, progressive and delayedneuronal death. Neuroscience 108, 17–26.
Okuda, T., Tagawa, K., Qi, M.L., Hoshio, M., Ueda, H., Kawano,H., Kanazawa, I., Muramatsu, M., Okazawa, H., 2004. Oct-3/4repression accelerates differentiation of neural progenitorcells in vitro and in vivo. Brain Res. Mol. Brain Res. 132,18–30.
O'Neil, B.J., McKeown, T.R., DeGracia, D.J., Alousi, S.S., Rafols, J.A.,White, B.C., 1999. Cell death, calcium mobilization, andimmunostaining for phosphorylated eukaryotic initiationfactor 2-alpha (eIF2alpha) in neuronally differentiated NB-104cells: arachidonate and radical-mediated injury mechanisms.Resuscitation 41, 71–83.
Persoon-Rothert, M., Egas-Kenniphaas, J.M., van derValk-Kokshoorn, E.J., van der Laarse, A., 1992. Cumenehydroperoxide induced changes in calcium homeostasis incultured neonatal rat heart cells. Cardiovasc. Res. 26,706–712.
Pi, R., Yin, W., Zheng, S., Qiu, P., Zhou, J., Guo, W., Su, T., Yan, G.,2004. Adenoviral mediated transfer of TIMP-3 partiallyprevents glutamate-induced cell death in primary cultured
cortical neurons of the rat. Brain Res. Mol. Brain Res. 127,136–139.
Ralph, G.S., Bienemann, A., Harding, T.C., Hopton, M., Henley, J.,Uney, J.B., 2000. Targeting of tetracycline-regulatable transgeneexpression specifically to neuronal and glial cell populationsusing adenoviral vectors. NeuroReport 11, 2051–2055.
Sauerwald, A., Hoesche, C., Oschwald, R., Kilimann, M.W., 1990.The 5′-flanking region of the synapsin I gene. A G+C-rich,TATA- and CAAT-less, phylogenetically conserved sequencewith cell type-specific promoter function. J. Biol. Chem. 265,14932–14937.
Schmidt, A., Bockmann, M., Stoll, A., Racek, T., Putzer, B.M., 2005.Analysis of adenovirus gene transfer into adult neural stemcells. Virus Res. 1, 1.
Shaw, G., Morse, S., Ararat, M., Graham, F.L., 2002. Preferentialtransformation of human neuronal cells by humanadenoviruses and the origin of HEK 293 cells. FASEB J. 16,869–871.
Shimazaki, K., Urabe, M., Monahan, J., Ozawa, K., Kawai, N., 2000.Adeno-associated virus vector-mediated bcl-2 gene transferinto post-ischemic gerbil brain in vivo: prospects for genetherapy of ischemia-induced neuronal death. Gene Ther. 7,1244–1249.
Simons, M., Beinroth, S., Gleichmann, M., Liston, P., Korneluk, R.G.,MacKenzie, A.E., Bahr, M., Klockgether, T., Robertson, G.S.,Weller, M., Schulz, J.B., 1999. Adenovirus-mediated genetransfer of inhibitors of apoptosis protein delays apoptosis incerebellar granule neurons. J. Neurochem. 72, 292–301.
Smith, R.L., Traul, D.L., Schaack, J., Clayton, G.H., Staley, K.J.,Wilcox, C.L., 2000. Characterization of promoter function andcell-type-specific expression from viral vectors in the nervoussystem. J. Virol. 74, 11254–11261.
Sun, Y., Jin, K., Peel, A., Mao, X.O., Xie, L., Greenberg, D.A., 2003.Neuroglobin protects the brain from experimental stroke invivo. Proc. Natl. Acad. Sci. U. S. A. 100, 3497–3500.
Tamatani, M., Matsuyama, T., Yamaguchi, A., Mitsuda, N.,Tsukamoto, Y., Taniguchi, M., Che, Y.H., Ozawa, K., Hori, O.,Nishimura, H., Yamashita, A., Okabe,M., Yanagi, H., Stern, D.M.,Ogawa, S., Tohyama, M., 2001. ORP150 protects againsthypoxia/ischemia-induced neuronal death. Nat. Med. 7,317–323.
Tsai, M.C., Chen, Y.H., Chiang, L.Y., 1997. Polyhydroxylated C60,fullerenol, a novel free-radical trapper, prevented hydrogenperoxide- and cumene hydroperoxide-elicited changes in rathippocampus in-vitro. J. Pharm. Pharmacol. 49, 438–445.
Vroegop, S.M., Decker, D.E., Buxser, S.E., 1995. Localization ofdamage induced by reactive oxygen species in cultured cells.Free Radical Biol. Med. 18, 141–151.
Wiessner, C., Allegrini, P.R., Rupalla, K., Sauer, D., Oltersdorf, T.,McGregor, A.L., Bischoff, S., Bottiger, B.W., van der Putten,H., 1999. Neuron-specific transgene expression of Bcl-XL butnot Bcl-2 genes reduced lesion size after permanent middlecerebral artery occlusion in mice. Neurosci. Lett. 268,119–122.
Yenari, M.A., Minami, M., Sun, G.H., Meier, T.J., Kunis, D.M.,McLaughlin, J.R., Ho, D.Y., Sapolsky, R.M., Steinberg, G.K.,2001. Calbindin d28k overexpression protects striatalneurons from transient focal cerebral ischemia. Stroke 32,1028–1035.
Zeng, M., Smith, S.K., Siegel, F., Shi, Z., Van Kampen, K.R., Elmets,C.A., Tang, D.C., 2001. AdEasy system made easier by selectingthe viral backbone plasmid preceding homologousrecombination. BioTechniques 31, 260–262.
Zufferey, R., Donello, J.E., Trono, D., Hope, T.J., 1999. Woodchuckhepatitis virus post transcriptional regulatory elementenhances expression of transgenes delivered by retroviralvectors. J. Virol. 73, 2886–2892.
38 B R A I N R E S E A R C H 1 1 0 2 ( 2 0 0 6 ) 2 7 – 3 8
Correction
Neuronal viability was assessed 24 h after in vitro ischaemia using the MTS assay
(Promega). This line should replace line 14 in subsection 4.7.1
Chapter Five
Cloning, adenoviral mediated expression, and preliminary
assessment of the neuroprotective activity of proteins differentially
expressed in cortical neuronal cultures following erythropoietin
exposure
70
5.01 Introduction
As reported in Chapter 2, 40 proteins were identified which were differentially
expressed in cortical neuronal cultures following exposure to EPO. Thus, a major aim
of this present study was to generate recombinant adenoviral vectors expressing
selected proteins. The next step of this study was to over-express these proteins in
neuronal cultures and to assess their impact on cell viability in the cumene model of
oxidative stress described in Chapter 4. Of the 40 proteins originally identified, 12
(Table 1) were selected for investigation on the basis that they fulfilled one or more of
the following criteria: (i) they exhibited a significant change in protein level compared
with the untreated control group and other differentially expressed proteins, (ii) the
scientific literature alluded to its involvement in cytoprotection, (iii) the protein is
known to reside in a cellular compartment previously reported to be involved in
neuronal cell death (i.e. VDAC and mitochondria) or, (iv) expression of the protein was
known to change in response to other preconditioning stimuli (Meloni et al, 2006).
5.02 Materials and methods
5.02.1 DNA and cloning methods
With the exception of SOD1, all cDNA coding sequences were derived by RT-PCR
using total rat RNA (rattus norvegicus sp.) as a template (see methods Chapter 2) and
gene specific primers (Table 1). Each forward and reverse primer encoded unique
restriction enzyme sites for directional cloning into the pRSV-shuttle plasmid (see
Chapter 4). In addition, to ensure optimal expression, each forward primer contained
the Kozak (CCACCATGG) consensus sequence. Polymerase chain reaction products
were ligated into pGEM-Teasy plasmid and sequence verified prior to insertion into the
pRSV-shuttle plasmid. Superoxide dismutase 1 cDNA was derived as described in
Chapter 6. Once inserted into the pRSV-shuttle plasmid, the 5’ and 3’ cDNA insertion
sites were checked for orientation and integrity. This was achieved using vector
71
specific forward and reverse squencing primers (3’RSV and 5’ WPRE see methods
2.3.4.3)
5.02.2 Cell culture, adenovirus methods and statistical analysis
Methodologies for recombinant adenovirus amplification and transduction (an moi of
75 was used in this study), preparation of cortical neuronal cultures and neuronal cell
death assays are described in Chapter 4 (see experimental procedures). Cultures
transduced with adenovirus did not display any toxicity when used within 4 days, which
is consistent with a previous finding on adenoviral mediated neuronal transduction
(Easton et al, 1998). Viability data are presented as meanSEM. The value of n refers
to the number of replicants per experiment. Differences between groups (empty vector
versus treatment group) were determined by ANOVA, followed by post-hoc Fischer’s
PLSD test. P values <0.05% were considered statistically significant. Unless otherwise
stated, all experiments were conducted at least three times.
5.02.3 Western blotting
General methods for western blotting are described in Chapter 4. Protein for western
analysis was collected 72 hours following adenoviral transduction. For antibodies and
immunoblot images not shown here, refer to Chapters 6 and 7. Other primary
antibodies used were rabbit polyclonal anti-GDI-1 (1:400; Santa Cruz), rabbit
polyclonal anti-VDAC (1:400; Santa Cruz), goat polyclonal anti-PEBP (1:200; Santa
Cruz) and goat polyclonal anti-PKC (1:200; Santa Cruz). Secondary antibodies used
were horseradish peroxidase (HRP) conjugated to either rabbit anti-goat (1:20000;
Zymed) or donkey anti-rabbit (1:40000; Amersham).
72
5.03 Results
5.03.1 Derivation of cDNA and generation of recombinant adenovirus
The cDNAs encoding all 12 proteins selected for investigation were successfully
derived and sequence verified (Table 1). As listed in Table 1, a recombinant adenovirus
was generated for each protein. Western analysis confirmed that 7 adenoviral vectors
(AdRSV:SOD1, AdRSV:CyPA, AdRSV:PRDX2, AdRSV:PEBP, AdRSV:PKCZ,
AdRSV:GDI-1, AdRSV:VADC1) specifically increased protein expression in either
cortical neurons or HEK293 cells (Figure 1, Table 1, Chapters 6 and 7). No specific
EEF1A1 protein over-expression was detected following transduction of
AdRSV:EEF1A1 in either HEK293 cells or neurons. The remaining adenoviral vectors
(AdRSV:FABP7, AdRSV:G(O), AdRSV:NME1 and AdRSV:STMN1) were not
subjected to western analysis.
5.03.2 Preliminary assessment of selected recombinant adenoviral vectors
A number of experiments were undertaken to assess the neuroprotective or
neurodamaging activity of adenoviral mediated over-expression of CyPA, PRDX2,
SOD1 and VDAC in the cumene model of oxidative stress. These studies demonstrated
that adenoviral mediated over-expression of CyPA, PRDX2 and SOD1 increased cell
viability, compared to the empty vector control, and in line with Bcl-XL protein over-
expression (Figure 2). By contrast, VDAC over-expression increased neuronal cell
death compared to the empty vector control (Figure 3). In the VDAC over-expression
experiment, glutamate receptor antagonists and adenoviral mediated CyPA over-
expression were included as positive controls (Figure 3).
73
5.04 Discussion
This study provided evidence that adenovirus mediated over-expression of CyPA,
PRDX2 and SOD1 could protect neuronal cultures from cumene mediated oxidative
stress. By contrast, adenoviral mediated over-expression of VDAC appeared to
increase neuronal cell death following oxidative stress. Evidence that VDAC over-
expression can increase neuronal cell death has previously been reported (Baines et al,
2005; Zaid et al, 2005; Abu-Hamad et al, 2006) and possible explanations include the
promotion of increased mitochondrial leakage, disruption of hydrogen ion gradient
integrity and increased MTP formation associated with apoptotic cell death.
Two attempts to generate a functional pRSV:EEF1A1 adenovirus were unsuccessful.
Whilst both attempts yielded adenovirus particles expressing normal GFP levels (as
indicated by fluorescence), neither could increase EEF1A1 protein expression. The
reasons for this are unknown, but it is possible that EEF1A1 is toxic to HEK293 cells,
which favoured the selection and growth of EEF1A1 expression defective adenovirus
particles.
Following the observation that CyPA, PRDX2 and SOD1 over-expression were
neuroprotective, I decided to focus my attention on these three proteins for the
remainder of the thesis. Thus, the adenoviral vectors AdRSV:GDI-1, AdRSV:PKC, or
AdRSV:PEBP were not assessed in the oxidative stress model and the adenoviral
vectors encoding G(o), NME1, FABP7 and STMN1 sequences were not tested for their
capacity to increase specific protein expression but these will be assessed in a future
study.
In summary, these preliminary findings indicated that CyPA, PRDX2 and SOD1 were
neuroprotective when over-expressed and they were consequently selected for further
characterisation, the results of which are reported in Chapters 6 and 7.
-tubulin
GD
pRSV:Empty
pRSV:GDI
VADC
-tubulin
pRSV:Empty
pRSV:VADC
PEB
CyPA
pRSV:Empty
pRSV:PEBP
PKCZ
CyPA
pRSV:Empty
pRSV:PKC
A B
C D
Figure 1. A: Western blot analysis of cortical neuronal cultures
transduced with AdRSV:Empty (moi of 75) and AdRSV:GDI-1 (moi
of 75) and probed with anti-GDI-1 antibody. B: Western blot analysis
of cortical neuronal cultures transduced with AdRSV:Empty (moi of
75) and AdRSV:VDAC (moi of 75) and probed with anti-VDAC
antibody. C: Western blot analysis of HEK293 cultures transduced
with AdRSV:Empty (moi of 75) and AdRSV:PEBP (moi of 75) and
probed with anti-PEBP antibody. D: Western blot analysis of HEK293
cultures transduced with AdRSV:Empty (moi of 75) and
AdRSV:PKCZ (moi of 75) and probed with anti-PKCZ antibody.
Cumene oxidative stress model
Cell
via
bili
ty (
%)
40
60
80
100
20
0
AdRSV: Empty Sham
AdRSV: Empty
AdRSV: Bcl-XL
AdRSV: CyPA
AdRSV: SOD1
AdRSV: PRDX2
*
* *
*
Figure 2. Cell viability of neuronal cultures
transduced with adenoviral constructs
AdRSV:Empty, AdRSV:Bcl-XL,
AdRSV:SOD1, AdRSV:CyPA and
AdRSV:PRDX2 at 24 hr following cumene
mediated oxidative stress. Cortical
neuronal cultures were transduced with
recombinant adenovirus (moi of 75) and
exposed to cumene or were sham treated.
Values are expressed as mean±SD (n=4),
and signficance level is *P<0.05.
Figure 3. Cell viability of neuronal
cultures transduced with adenoviral
constructs AdRSV:Empty,
AdRSV:VDAC and AdRSV:CyPA at
24 hr following cumene mediated
oxidative stress. Cortical neuronal
cultures were transduced with
recombinant adenovirus (moi of 75) and
exposed to cumene with or without
glutamate antagonists, or were sham
treated. Values are expressed as
mean±SD (n=4) and significance level
is *P<0.05.
Cumene oxidative stress model
AdRSV: Empty Sham
AdRSV: Empty
AdRSV: Empty
(+glutamate antagonists)
AdRSV: CyPA
AdRSV: VDAC
Cell
via
bili
ty (
%)
40
60
80
100
20
0
*
*
*
Chapter Six
Peroxiredoxin 2 over-expression protects cortical neuronal cultures
from ischaemic and oxidative injury but not glutamate exposure,
whilst Cu/Zn superoxide dismutase 1 over-expression only protects
against oxidative injury
79
This document:
A. Outlines the contribution made by each author for the following publication:
Boulos S, Meloni BP, Arthur PG, Bojarski C and Knuckey NW (2007). Peroxiredoxin 2
over-expression protects cortical neuronal cultures from ischemic and oxidative injury
but not glutamate exposure, whilst Cu/Zn superoxide dismutase 1 over-expression only
protects against oxidative injury. J Neurosci Res (published online July 2007).
and
B. Signifies that each of the authors allows permission for the published work to be
included in the PhD thesis by Sherif Boulos
Contribution by each author:
Sherif Boulos 86%
Bruno Meloni 8%
Peter Arthur 2%
Christina Bojarski 2%
Neville Knuckey 2%
Bruno Meloni (co-ordinating supervisor) on behalf of all authors
Peroxiredoxin 2 Overexpression ProtectsCortical Neuronal Cultures From Ischemicand Oxidative Injury but Not GlutamateExcitotoxicity, Whereas Cu/Zn SuperoxideDismutase 1 Overexpression Protects OnlyAgainst Oxidative Injury
Sherif Boulos,1,2* Bruno P. Meloni,1,3 Peter G. Arthur,2 Christina Bojarski,1,3
and Neville W. Knuckey1,3
1Centre for Neuromuscular and Neurological Disorders, The University of Western Australia,Australian Neuromuscular Research Institute, Nedlands, Western Australia, Australia2School of Biomedical and Chemical Sciences, The University of Western Australia,Nedlands, Western Australia, Australia3Department of Neurosurgery, Sir Charles Gairdner Hospital, Nedlands, Western Australia, Australia
We previously reported that peroxiredoxin 2 (PRDX2)and Cu/Zn superoxide dismutase 1 (SOD1) proteins areup-regulated in rat primary neuronal cultures followingerythropoietin (EPO) preconditioning. In the presentstudy, we have demonstrated that adenovirally medi-ated overexpression of PRDX2 in cortical neuronal cul-tures can protect neurons from in vitro ischemia (oxy-gen-glucose deprivation) and an oxidative insult (cu-mene hydroperoxide) but not glutamate excitotoxicity.We have also demonstrated that adenovirally mediatedoverexpression of SOD1 in cortical neuronal culturesprotected neurons only against the oxidative insult.Interestingly, we did not detect up-regulation of PRDX2or SOD1 protein in the rat hippocampus following ex-posure to either 3 min or 8 min of global cerebral ische-mia. Further characterization of PRDX2’s neuroprotec-tive mechanisms may aid in the development of a neu-roprotective therapy. VVC 2007 Wiley-Liss, Inc.
Key words: neuroprotection; cumene hydroperoxide;oxygen-glucose deprivation; in vitro; adenovirus
A clinically effective treatment that directly inhibitsthe neuronal death following cerebral ischemia andstroke remains elusive. However, in a process termed‘‘preconditioning,’’ neurons can become temporarily re-sistant to normally lethal levels of ischemia (Kitagawaet al., 1990; Pringle et al., 1999; Meloni et al., 2002;Dirnagl et al., 2003). Because preconditioning is relianton new protein synthesis, identification of the proteinsinvolved may provide therapeutic targets for the devel-opment of drugs to inhibit ischemic neuronal death. Tothis end, we reported that Cu/Zn superoxide dismutase
(SOD1) and peroxiredoxin 2 (PRDX2) are both up-regulated in cortical neuronal cultures following precon-ditioning with erythropoietin (EPO; Meloni et al.,2006). However, although the neuroprotective effects ofSOD1 overexpression in primary neuronal culture injurymodels have been investigated (Ying et al., 2000; Borgand London, 2002), the effects of PRDX2 overexpres-sion have not.
Peroxiredoxins are a family of intracellular antioxi-dant enzymes found in the cytosol, mitochondria, perox-isome, endoplasmic reticulum, and plasma membrane(Wood et al., 2003). Six distinct mammalian isozymes(PRDX 1–6) have been identified that share an N-ter-minal catalytic cysteine residue responsible for peroxidaseactivity (Fujii and Ikeda, 2002; Wood et al., 2003;Schroder et al., 2003). Along with SOD, catalase, andglutathione peroxidase, the peroxiredoxins form an inte-gral component of the cellular antioxidant defense sys-tem. In conjunction with thiol-specific reducing agentssuch as thioredoxin and/or glutathione, peroxiredoxins
Contract grant sponsor: Australian Neuromuscular Research Institute
(ANRI); Contract grant sponsor: CWL Medical Pty. Ltd.; Contract grant
sponsor: Neurotrauma Research Program/Road Safety Council of West-
ern Australia; Contract grant sponsor: Sir Charles Gairdner Hospital
Research Foundation.
*Correspondence to: Sherif Boulos, Australian Neuromuscular Research
Institute, A Block, 4th Floor, QEII Medical Centre, Nedlands, Western
Australia, Australia 6009. E-mail: [email protected]
Received 1 March 2007; Revised 4 May 2007; Accepted 12 May 2007
Published online 30 July 2007 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/jnr.21429
Journal of Neuroscience Research 85:3089–3097 (2007)
' 2007 Wiley-Liss, Inc.
are able to scavenge hydrogen peroxide (Fujii and Ikeda,2002), peroxynitrite (Bryk et al., 2000), and organichydroperoxides (Wood et al., 2003). Peroxiredoxins arealso implicated in cellular differentiation (Choi et al.,2005), proliferation (Prosperi et al., 1998), modulationof H2O2-mediated signalling (Kang et al., 1998, 2004),and, more recently, protein chaperoning (Jang et al.,2004; Moon et al., 2005; Rand and Grant, 2006).
Peroxiredoxin 2, originally named ‘‘thiol-specificantioxidant’’ (TSA), is also called ‘‘thioredoxin peroxi-dase 1,’’ ‘‘thioredoxin-dependent peroxide reductase 1,’’‘‘thiol-specific antioxidant protein,’’ ‘‘RSA,’’ ‘‘PRP,’’‘‘porcine natural killer cell-enhancing factor B,’’ and‘‘calpromotin’’ (Schroder et al., 1998; Kristensen et al.,1999). Peroxiredoxin 2 is highly expressed in the brain(Moore et al., 1991; Matsumoto et al., 1999) and is thepredominant cytosolic neuronal isozyme (Sarafian et al.,1999; Jin et al., 2005). Recent evidence suggests thatPRDX2 might also play an important role in the defenseagainst neurodegenerative diseases. For example, inamyotrophic lateral sclerosis (ALS), in which oxidativestress is implicated in the selective death of motor neu-rons, PRDX2 protein levels are increased in survivingneurons, presumably as a compensatory response (Katoet al., 2005). However, at the terminal stage of disease,which is associated with accelerated neuronal degenera-tion and neuronal death, PRDX2 overexpression is lost(Kato et al., 2005). Similarly, increased PRDX2 levelshave also been observed in post-mortem brain tissuefrom individuals with Down’s syndrome, Alzheimer’sParkinson’s, and Pick’s disease (Krapfenbauer et al.,2003; Basso et al., 2004).
Overexpression of PRDX2 has been shown to in-hibit or delay apoptosis induced by ceramide, etoposide,and cisplatin exposure (Zhang et al., 1997; Kim et al.,2000; Chung et al., 2001). In addition, PRDX2 overex-pression can protect PC12 cells from nerve growthfactor (NGF) and serum withdrawal and from the effectsof oxidative stress induced by t-butylhydroperoxide(Ichimiya et al., 1997; Simzar et al., 2000). Althoughthese studies have provided evidence that PRDX2 hascytoprotective properties in several injury models, noprevious study has examined the protective role of thisprotein in primary neuronal cultures. Thus, given thatPRDX2 is an important component of the cellular anti-oxidant defense system, and given our recent findingsshowing PRDX2 up-regulation in neuronal precondi-tioning, we sought to determine whether PRDX2 over-expression could protect cultured neurons against invitro ischemia (oxygen glucose deprivation), oxidativestress (cumene hydroperoxide), and excitotoxic (gluta-mate) injury. In conjunction with PRDX2 examination,we also assessed the neuroprotective property of SOD1overexpression in the same injury models. Finally, wealso investigated whether a 3-min nondamaging or an 8-min neurodamaging period of global ischemia couldincrease PRDX2 and SOD1 protein levels in the rathippocampus.
MATERIALS AND METHODS
Preparation of Recombinant Adenovirus
The rat cDNA sequence for PRDX2 was derived usingstandard cloning techniques. Briefly, total rat brain RNA waspurified from a male Sprague-Dawley rat, reverse transcribed,and amplified by PCR using a forward primer (50-GGTACCCCACCATGGCCTCCGGCAACGCGCAC-30) con-taining a KpnI restriction site (italicized) and Kozak sequenceand a reverse primer (50-CTCGAGTCAGTTGTGT TTGGAGAAGTATTCCTTGCTG-30) containing a XhoI restric-tion site (italicized). The resulting PCR product was purifiedby agarose gel electrophoresis and cloned into pGEM-TEasy(Promega, Madison, WI). A pCMV-shuttle plasmid encodingthe cDNA sequence of human SOD1 was kindly provided byDr. Amerigo Carello and sequence verified. The cDNA forPRDX2 and SOD1 were released by digestion with KpnI andXhoI and directionally subcloned into the expression vectorpRSV-WPRE/CMV-EGFP described previously (Bouloset al., 2006).
Recombinant adenoviruses were prepared according tothe method of He et al. (1998), with some modifications.Briefly, pShuttle plasmid DNA was linearised by PmeI diges-tion and introduced into Escherichia coli strain BJ5183 carryingpAdeasy (Zeng et al., 2001) by electroporation (Gene PulserII; Bio-Rad, Hercules, CA). Recombinants were selected onmedia containing 50 lg/ml kanamycin, and their plasmidDNA was checked by PacI digestion. HEK293 cells grown to90% confluence in 25-cm2 flasks were transfected with 3 lgPacI linearized recombinant plasmid DNA using Lipofect-amine2000 (Invitrogen, La Jolla, CA). Viral plaques appearedwithin 5–10 days, and viral material was used for subsequentamplification of the virus in HEK293 cells before purificationand concentration using the Adeno-X virus purification kit(BD Biosciences, San Jose, CA). Viral titers were determinedby end-point dilution assay, as indicated by enhanced greenfluorescent protein (EGFP) reporter expression.
Preparation of Cortical Neuronal Cultures
All animal procedures were approved by the Universityof Western Australia Animal Ethics Committee. Establishmentof cortical cultures was as previously described (Meloni et al.,2001); briefly, cortical tissue from E18–E19 Sprague-Dawleyrats was dissociated in Dulbelcco’s modified Eagle medium(DMEM; Invitrogen) supplemented with 1.3 mM L-cysteine,0.9 mM NaHCO3, 10 U/ml papain (Sigma, St. Louis, MO),and 50 U/ml DNase (Sigma) and washed in cold DMEM/10% horse serum. Neurons were resuspended in Neurobasal(NB; Invitrogen) containing 2% B27 supplement (B27; Invi-trogen). Before seeding, culture vessels, consisting of either96-well plastic or glass dishes (6 mm diameter; Alltech, Aus-tralia) were coated with poly-D-lysine (50 lg/ml; 70,000–150,000; Sigma) and incubated overnight at room tempera-ture. The poly-D-lysine was removed and replaced with NB(containing 2% B27, 4% fetal bovine serum, 1% horse serum,62.5 lM glutamate, 25 lM 2-mercaptoethanol, 30 lg/mlstreptomycin, and 30 lg/ml penicillin). Neurons were platedto obtain approximately 10,000 viable neurons per well onday in vitro (DIV) 9. Neuronal cultures were maintained in a
3090 Boulos et al.
Journal of Neuroscience Research DOI 10.1002/jnr
CO2 incubator (5% CO2, 95% air balance, 98% humidity) at378C. On DIV 4, one-third of the culture medium wasremoved and replaced with fresh NB/2% B27 containing themitotic inhibitor cytosine arabinofuranoside (Sigma) at 1 lM,and, on DIV 8, one-half of the culture medium was replacedwith NB/2% B27. Cultures were used on DIV 12, whenbetween 0.5–2% of cells stain positively for glial fibrillaryacidic protein (GFAP; Meloni et al., 2001).
Adenoviral Transduction
On DIV 9, the conditioned medium was removed fromcortical neuronal cultures and purified virus, diluted in 50 llof NB/2% B27, at the required multiplicity of infection (moi:75), was added to each well and incubated for 3 hr at 378C.The virus-containing media were removed and replaced by anequal mix of conditioned media and fresh NB/2% B27.Unless otherwise indicated, transduced neuronal cultures wereused on DIV 12. Exposure of cortical neuronal cultures to anmoi of 75 results in neuronal transduction levels of �60%(Boulos et al., 2006; unpublished findings).
Western Blotting
For protein extraction, brain tissue and cultured cellswere lysed in buffer [50 mM Tris-HCl, pH 7.5, 100 mMNaCl, 20 mM EDTA, 0.1% sodium dodecyl sulfate (SDS),0.2% deoxycholic acid, containing Complete protein inhibitor(Roche, Indianapois, IN)], vortexed briefly, and clarified bycentrifugation at 48C. Protein concentrations were determinedby the Bradford assay (Bio-Rad). Equivalent amounts of pro-tein (5–10 lg per lane) were loaded and separated on 4–12%gradient SDS-polyacrylamide Bis-Tris minigels, (NuPAGE;Invitrogen) and transferred to a PVDF membrane. Membraneswere blocked in phosphate-buffered saline/0.5% Tween 20(PBS/T) containing ovalbumin (1 mg/ml) for 1 hr at roomtemperature before washing in PBS/T and PBS. Membraneswere incubated at 48C overnight in blocking solution contain-ing primary antibody, washed, and incubated in blocking so-lution containing horseradish peroxidase (HRP)-conjugatedsecondary antibody for 1 hr at room temperature. Proteinbands were detected using ECL Plus (Amersham, Amersham,United Kingdom), visualized by exposure to X-ray film(Hyperfilm; Amersham), and scanned and quantified in NIHImage. As required, membranes were incubated for 10 min atroom temperature in stripping solution (Re-Blot WesternRecycling kit; Chemicon, Temecula, CA) prior to immuno-detection of control proteins. Primary antibodies used wererabbit polyclonal anti-PRDX2 (1:5,000; LabFrontier, Korea)antibody, anti-SOD1 antibody (0.2 lg/ml; Stressgen Biore-agents), mouse monoclonal anti-b-tubulin (0.5 lg/ml; Phar-mingen, San Diego, CA). Secondary antibodies were donkeyanti-rabbit IgG (1:25,000–1:50,000; Amersham), sheep anti-mouse IgG (1:10,000–1:20,000; Amersham), and rabbit anti-goat IgG (1:20,000; Zymed, South San Fransisco, CA).
Cell Death Assays
Exposure to In Vitro Ischemia. The media fromglass wells were removed, and wells washed in 315 ll bal-anced salt solution (BSS; in mM: 116 NaCl, 5.4 KCl, 1.8
CaCl2, 0.8 MgSO4, 1 NaH2PO4, pH 7.0), then resuppliedwith 50 ll of BSS alone or BSS containing glutamate receptorantagonists [1 lM MK801/10 lM 6-cyano-7-nitroquinoxaline(CNQX; Tocris, Ellisville, MO)]. Cultures were placed intoan anaerobic chamber (Don Whitely Scientific, England) withan atmosphere of 5% CO2, 10% H2, and 85% argon, 98% hu-midity at 378C for 50 min. After anerobic incubation, anequal volume of DMEM containing 2% N2 supplement (Invi-trogen) was added to each well before placing the wells into aCO2 incubator at 378C for 24 hr. Control cultures receivedthe same BSS wash procedures and media additions as ische-mic cultures but were maintained in a CO2 incubator.
Exposure to Cumene Hydroperoxide (Cumene).The media from cultures grown in plastic wells was removedand replaced with 100 ll DMEM/1% N2 containing freshlyprepared cumene (25 lM; Sigma) alone or cumene containingglutamate receptor antagonists. Cultures were incubated inCO2 at 378C for 24 hr.
Exposure to Glutamate. The media from culturesgrown in plastic wells was removed and replaced with 100 llof a 50:50 mixture of conditioned media and fresh NB2/2%B27 containing glutamate (100 lM; Sigma) alone or with glu-tamate receptor antagonists. After a 5-min incubation at 378C,the medium was replaced with 100 ll DMEM/1% N2 me-dium, and culture wells placed into a CO2 incubator at 378Cfor 24 hr.
Cell Viability, Light Microscopy, and StatisticalAnalysis. Cell viability was assessed 24 hr after in vitro is-chemia, cumene and glutamate treatment using the MTS assay(Promega). Although we did not distinguish between apopto-tic and necrotic cell death following in vitro ischemia, asreported previously (Meloni et al., 2001; Arthur et al., 2004),based on light microscopy and nuclear staining, this modelresults in predominantly apoptotic-like neuronal death. Cu-mene exposure induces extensive cell rounding, indicative ofapoptosis, which is supported by our findings that overexpres-sion of the antiapoptotic protein Bcl-XL provides high-levelneuronal protection in this injury model (Boulos et al., 2006).Similarly, although our glutamate model of excitotoxic injuryexhibits elements of necrosis such as calpain activation and cellswelling, it also exhibits apoptotic features such as positiveannexin V staining, and neuronal protection by Bcl-XL over-expression (recent unpublished findings). Image acquisitionwas performed in an Olympus IX70 under software control(DP controller; Olympus). Viability data are presented asmean 6 SEM. Differences between groups were determinedby ANOVA, followed by post-hoc Fischer’s PLSD test. P <0.05 was considered statistically significant. Unless otherwisestated, all experiments were conducted at least three times. Allscanned and digitized images were uniformly resized in AdobePhotoshop, without any further alteration.
Transient Global Cerebral Ischemia Model
This study was approved by the Animal Ethics Commit-tee of the University of Western Australia. The two-vesselocclusion with hypotension model of global cerebral ischemiawas performed on 8–10-week-old adult male Sprague-Dawleyrats as previously described (Zhu et al., 2004). During the
Neuroprotective Activity of PRDX2 and SOD1 3091
Journal of Neuroscience Research DOI 10.1002/jnr
procedure, both cranial and rectal temperature were measuredvia a thermocouple (Physitemp) and were maintained at 378C6 0.28C with a heating fan and pad. Rats were anesthetizedwith 3% halothane/27% O2/balanced NO2 and ventilatedbefore, during, and for at least 15 min after global cerebral is-chemia. Cerebral ischemia was recorded from the time whenthe EEG became isoelectric and was maintained for a durationof 3 min or 8 min. Ten minutes before and fifteen minutes
after the ischemic insult, PaO2, PaCO2 and pH were meas-ured with a pH/blood gas analyzer (ABL5 Radiometer, Co-penhagen, Denmark).
Experimental Groups
Animals were sacrificed and hippocampal tissue was im-mediately removed and stored at –808C, for subsequent pro-tein extraction, which was performed as described above. ForWestern blot analysis, experimental groups consisted of sham-operated or ischemic animals.
RESULTS
Construction of Recombinant Adenovirus ToOverexpress PRDX2 and SOD1 in CorticalNeuronal Cultures
The expression cassettes of our control vector(AdRSV:Empty) and viral vectors used to overexpressPRDX2 and SOD1 (AdRSV:PRDX2 and AdRSV:SOD1) are presented schematically in Figure 1A. Visual-ization of EGFP reporter expression confirmed that neu-ronal cultures were successfully transduced and thattransduction levels between each recombinant adenovi-rus were comparable (data not shown). Western blotanalysis confirmed that transduction of cortical neuronalcultures with the PRDX2 and SOD1 viral vectorsincreased specific protein levels (Fig. 1B,C).
Effect of PRDX2 and SOD1 Overexpression onCell Viability Following Cumene Exposure
Virally mediated PRDX2 and SOD1 overexpres-sion significantly increased neuronal survival followingcumene exposure from 33% to 66% and 50%, respec-tively (Fig. 2A). Photomicrographs of cumene-treatedcultures transduced with the control and PRDX2 andSOD1 viral vectors are provided in Figure 2B. Gluta-mate receptor antagonists significantly increased the via-bility of cultures following cumene exposure from 33%to 70%.
Effect of PRDX2 and SOD1 Overexpression onCell Viability Following In Vitro Ischemia
PRDX2 overexpression significantly increased theviability of cultures following in vitro ischemia from17% to 36% (Fig. 3). By contrast, adenovirally mediatedSOD1 overexpression had no effect on cell viability(Fig. 3). Glutamate receptor antagonists increased the vi-ability of cultures following in vitro ischemia from 17%to 31%.
Effect of PRDX2 and SOD1 Overexpression onCell Viability Following Glutamate Exposure
PRDX2 and SOD1 overexpression did not protectneurons against glutamate exposure (Fig. 4). Extensiveneuronal degeneration (cell membrane swelling and nu-clear shrinkage) was evident at 3 hr following glutamateexposure (data not shown). Glutamate receptor antago-nists significantly increased the viability of cultures fol-lowing glutamate exposure from 11% to 94%.
Fig. 1. A: Schematic of recombinant adenoviral vector constructsAdRSV:Empty (control), AdRSV:PRDX2, and AdRSV:SOD1,showing the transgene and reporter expression cassettes. The DNAelements are: rous sarcoma virus (RSV) promoter, woodchuck post-transcriptional regulatory element (WPRE), cytomegalovirus (CMV)promoter, enhanced green fluorescent protein (EGFP); the gray rec-tangles denote the SV40 polyadenylation signal sequence. B: Westernblot analysis of cortical neuronal cultures transduced with AdRSV:Empty (moi of 75) and AdRSV:PRDX2 (moi of 75) and probedwith anti-PRDX2 antibody. C: Western blot analysis of cortical neu-ronal cultures transduced with AdRSV:Empty (moi of 75) andAdRSV:SOD1 (moi of 75) and probed with anti-SOD1 antibody.
3092 Boulos et al.
Journal of Neuroscience Research DOI 10.1002/jnr
PRDX2 and SOD1 Protein Levels in the RatHippocampus Following 3- or 8-Min GlobalCerebral Ischemia
We initially investigated whether PRDX2 and/orSOD1 protein levels increased in the rat hippocampus24 hr after 3 min of global ischemia and found nochange in either protein compared with a 24-hr shamcontrol (Fig 5A). To determine whether PRDX2 orSOD1 protein is increased at any other time points, weanalyzed hippocampal protein levels at 6, 12, 18, and36 hr after 3 min and 8 min of global cerebral ischemia.PRDX2 and SOD1 protein levels were not significantly
Fig. 3. Cell viability of neuronal cultures transduced with adenoviralconstructs AdRSV:Empty, AdRSV:PRDX2, and AdRSV:SOD1 at24 hr following in vitro ischemia. Cortical neuronal cultures weretransduced with recombinant adenovirus (moi of 75) and exposed toin vitro ischemia, with or without glutamate antagonists, or weresham treated (n 5 3). Cell viability in sham cultures was treated as100%. Asterisks denote a statistically significant difference betweenthat treatment group and the control group.
Fig. 4. Cell viability of neuronal cultures transduced with adenoviralconstructs AdRSV:Empty, AdRSV:PRDX2, and AdRSV:SOD1 at24 hr following glutamate exposure. Cortical neuronal cultures weretransduced with recombinant adenovirus (moi of 75) and exposed toeither glutamate, with or without glutamate antagonists, or weresham treated (n 5 3). Cell viability in sham cultures was treated as100%. Asterisks denote a statistically significant difference betweenthat treatment group and the control group.
Fig. 2. Cell viability of neuronal cultures transduced with adenoviralconstructs AdRSV:Empty, AdRSV:PRDX2, and AdRSV:SOD1 at24 hr following exposure to cumene. A: Cortical neuronal cultureswere transduced with recombinant adenovirus (moi of 75) andexposed to either cumene, with or without glutamate antagonists, orwere sham treated (n 5 6). Cell viability in sham cultures was treatedas 100%. Asterisks denote a statistically significant difference betweenthat treatment group and the control group. B: Brightfield images ofsham neuronal cultures and neuronal cultures 24 hr following cu-mene treatment.
Neuroprotective Activity of PRDX2 and SOD1 3093
Journal of Neuroscience Research DOI 10.1002/jnr
different from control levels for any time point or dura-tion of global cerebral ischemia (Fig. 5Ba–d).
DISCUSSION
In the present study, we used three in vitro neuro-nal injury models to assess the neuroprotective activityof SOD1 and PRDX2 overexpression. We used gluta-mate receptor antagonists as a positive control, and theseincreased neuronal viability following in vitro ischemiaand glutamate exposure, as previously reported (Michaelsand Rothman, 1990; Koh and Choi, 1991; Kaku et al.,1993). Similarly, glutamate receptor antagonists increasedcell viability in the cumene-mediated oxidative stressmodel, indicating that cell death in this model also hasan excitotoxic component. This finding is consistent
with other studies, which have demonstrated an associa-tion among cumene, oxidative stress, and increased glu-tamate release (Tretter and Adam-Vizi, 1996; Matsu-moto et al., 1996; Tretter et al., 2002).
We have also shown that adenovirally mediatedSOD1 overexpression protected cultured cortical neu-rons against a cumene oxidative insult. This findingcomplements other studies reporting SOD1 overexpres-sion protecting against oxidative stressors, such as 6-hy-droxydopamine and 1-methyl-4-phenylpyridinium (Bar-kats et al., 2002, 2006). Cumene, which is a lipophilicorganic hydroperoxide, localizes to the plasma mem-brane, causing malondialdehyde (MDA) generation,which contributes to oxidative stress and lipid peroxida-tion (Gavino et al., 1981; Koster et al., 1983; Persoon-Rothert et al., 1992; Vroegop et al., 1995; Tsai et al.,
Fig. 5. Detection of PRDX2 and SOD1 protein in the rat hippo-campus following 3 or 8 min of global cerebral ischemia. A: Westernblot analysis of protein lysates probed with anti-PRDX2, anti-SOD1antibody, and anti-b-tubulin antibody (for loading control) fromsham-operated animals (lanes a–c) and animals exposed to 3 min ofischemia (lanes d–f; n 5 3). B: Time course of PRDX2 and SOD1
protein expression following 3 min or 8 min of ischemia. Westernblot analysis of protein lysates probed with anti-PRDX2 antibody,anti-SOD1 antibody, and anti-b-tubulin antibody (for loading con-trol). Each data point corresponds to the mean (n 5 3) protein value(relative to b-tubulin) 6 SEM. Control nonischemic animals (todetermine baseline levels) are represented by the 0.5-hr time point.
3094 Boulos et al.
Journal of Neuroscience Research DOI 10.1002/jnr
1997; O’Neil et al., 1999; Halliwell and Gutteridge,1999). Exactly how SOD1 improves neuronal survivalfollowing cumene exposure is unclear, but presumablydetoxifying superoxide ions is beneficial in this oxidativestress model. Nevetheless, the cell type and oxidativestressor are probably contributing factors with respect tocytoprotection provided by SOD1, insofar as overex-pression of SOD1 in SH-SY5Y cells increases sensitivityto hydrogen peroxide (Sanchez-Font et al., 2003).
In contrast to the cumene model, SOD1 overex-pression did not improve neuronal survival in the invitro ischemic and glutamate injury models. These find-ings are at variance with reports showing that SOD1overexpression can reduce neuronal cell death caused byboth in vitro ischemic (oxygen glucose deprivation) andglutamate insults (Chan et al., 1990; Barkats et al., 1996;Borg and London, 2002). Superoxide production hasbeen shown to occur following ischemic and glutamateinsults in neuronal cultures, so we cannot explain the ab-sence of SOD1-mediated protection in our models, butit is likely that differences in type and severity of injurymodels, neuronal culture system and method, and levelof SOD1 overexpression are responsible for these dis-crepancies.
With respect to PRDX2, we have demonstratedfor the first time that overexpression of this protein canprotect cortical neuronal cultures from cumene-medi-ated oxidative stress and in vitro ischemia. In the oxida-tive stress model, a likely protective mechanism ofPRDX2 overexpression may involve peroxidase-medi-ated inactivation of cumene by conversion to its lessharmful corresponding alcohol. Another neuroprotectivemechanism that could be operating in these modelsinvolves PRDX2 scavenging reactive oxygen and reac-tive nitrogen species (ROS/RNS) directly. The lattermechanism is in line with a previous study showing thatPRDX2 overexpression reduces ROS generation inPC12 cells exposed to menadione, a superoxide genera-tor; sodium nitropusside, a nitric oxide generator; andL-nitroarginine-D-methylester, an inhibitor of nitric ox-ide synthetase (Simzair et al., 2000). In addition, thePRDX2 protein is a homologue of alkylhydroperoxidereductase subunit C (AhpC) from Samonella typhimurium(Chae et al., 1994), which has been shown to protectHEK293 cells by eliminating peroxynitrite (Bryk et al.,2000).
Other recently identified functions of PRDX2might also contribute to the neuroprotection observed inour injury models. For example, oxidative stress inducesPRDX2 oligomerization, conferring a strong chaperonefunction (Moon et al., 2005), which may serve toattenuate the neurotoxicity caused by the misfolded andaggregated proteins known to form following ischemicand oxidative injury (Lee et al., 1999; Hu et al., 2000;Matsumoto et al., 2005). Indeed, Moon et al. (2005)demonstrated that the chaperone function of PRDX2prevented not only H2O2-mediated cell death of HeLacells but also the denaturation and aggregation of a-syn-uclein, a key component of Lewy bodies in Parkinson’s
and Alzheimer’s diseases. Furthermore, it is possible thatPRDX2 overexpression is suppressing neuronal celldeath signalling pathways. For example, activation of c-Jun NH2-terminal kinase (JNK) and p38 is decreased inHeLa cells overexpressing PRDX2 (Kang et al., 1998,2004). Finally, PRDX2 interacts with cyclophilin A(Jaschke et al., 1998; Lee et al., 2001), another abundantneuronal cytosolic protein (Goldner and Patrick, 1996)that we have shown is also neuroprotective in both theischemic and the oxidative stress models used in thepresent study (Boulos et al., 2007).
As with SOD1 overexpression, we found thatadenovirally mediated overexpression of PRDX2 wasunable to prevent the neuronal death caused by acuteglutamate excitotoxicity. Because of the severity of theexcitotoxic insult in our glutamate model, it is morelikely that the damaging action of calcium overload andprotease activation is the dominant mechanism of celldeath, rather than oxidative stress. However, in an invivo study, adenovirally mediated overexpression of themitochondrial PRDX3 isozyme was shown to inhibitprotein nitration, reduce gliosis, and protect neurons inthe rat hippocampus following treatment with the exci-totoxic agent ibotenic acid (Hattori et al., 2003). It ispossible that the mitochondrial location of the PRDX3isozyme was an important factor in minimizing the det-rimental effects of ibotenic acid neuronal toxicity in thismodel and/or that ibotenic acid-induced excitotoxicitydoes not cause the same type of acute injury observed inour in vitro glutamate model.
With respect to in vivo brain expression, we didnot detect PRDX2 and SOD1 protein up-regulation inthe rat hippocampus following either a nondamaging3-min or an 8-min CA1-damaging period of global ische-mia. Although a damaging period of global ischemia isknown to inhibit protein expression, we were surprisedthat the 3-min global ischemia, which is likely to repre-sent a preconditioning dose, did not up-regulate eitherprotein at the time points examined. Nonetheless, it ispossible that PRDX2 and SOD1 protein expression isup-regulated at a different time point(s) and/or within asubset of cells beyond detectable limits with Westernblot analysis. Alternatively, chronic long-term exposureto oxidative stress, which is associated with neurodege-nerative disorders, may be required to stimulate PRDX2overexpression.
In summary, we have provided evidence for aneuroprotective function for both PRDX2 and SOD1.Our results suggest that PRDX2 is a more potent neu-roprotectant than SOD1, and, unlike the case forSOD1, we have shown protection against in vitro ische-mia. Furthermore, the level of protection we obtainedfor PRDX2 (and SOD1) is likely to be an underesti-mate because of the incomplete nature of adenoviraltransduction of neurons (�60%) in culture. Taken to-gether, our data suggest that PRDX2 is a potential ther-apeutic target for the development of a treatment toprevent neuronal death in ischemic and neurodegenera-tive diseases.
Neuroprotective Activity of PRDX2 and SOD1 3095
Journal of Neuroscience Research DOI 10.1002/jnr
ACKNOWLEDGMENT
The authors thank Ms. Kate Thomas for her tech-nical support.
REFERENCES
Arthur PG, Lim SC, Meloni BP, Munns SE, Chan A, Knuckey NW.
2004. The protective effect of hypoxic preconditioning on cortical neu-
ronal cultures is associated with increases in the activity of several anti-
oxidant enzymes. Brain Res 1017:146–154.
Barkats M, Bemelmans AP, Geoffroy MC, Robert JJ, Loquet I, Horellou P,
Revah F, Mallet J. 1996. An adenovirus encoding CuZnSOD protects cul-
tured striatal neurones against glutamate toxicity. Neuroreport 7:497–501.
Barkats M, Millecamps S, Bilang-Bleuel A, Mallet J. 2002. Neuronal transfer
of the human Cu/Zn superoxide dismutase gene increases the resistance of
dopaminergic neurons to 6-hydroxydopamine. J Neurochem 82:101–109.
Barkats M, Horellou P, Colin P, Millecamps S, Faucon-Biguet N, Mallet
J. 2006. 1-Methyl-4-phenylpyridinium neurotoxicity is attenuated by
adenoviral gene transfer of human Cu/Zn superoxide dismutase. J Neu-
rosci Res 83:233–242.
Basso M, Giraudo S, Corpillo D, Bergamasco B, Lopiano L, Fasano M.
2004. Proteome analysis of human substantia nigra in Parkinson’s dis-
ease. Proteomics 4:3943–3952.
Borg J, London J. 2002. Copper/zinc superoxide dismutase overexpres-
sion promotes survival of cortical neurons exposed to neurotoxins in
vitro. J Neurosci Res 70:180–189.
Boulos S, Meloni BP, Arthur PG, Bojarski C, Knuckey NW. 2006.
Assessment of CMV, RSV and SYN1 promoters and the woodchuck
posttranscriptional regulatory element in adenovirus vectors for trans-
gene expression in cortical neuronal cultures. Brain Res 1102:27–38.
Boulos S, Meloni BP, Arthur PG, Majda B, Bojarski C, Knuckey NW.
2007. Evidence that intracellular cyclophilin A and cyclophilin A/
CD147 receptor-mediated ERK1/2 signalling can protect neurons
against in vitro oxidative and ischemic injury. Neurobiol Dis 25:54–64.
Bryk R, Griffin P, Nathan C. 2000. Peroxynitrite reductase activity of
bacterial peroxiredoxins. Nature 407:211–215.
Chae HZ, Robison K, Poole LB, Church G, Storz G, Rhee SG. 1994.
Cloning and sequencing of thiol-specific antioxidant from mammalian
brain: alkyl hydroperoxide reductase and thiol-specific antioxidant
define a large family of antioxidant enzymes. Proc Natl Acad Sci U S
A 91:7017–7021.
Chan PH, Chu L, Chen SF, Carlson EJ, Epstein CJ. 1990. Attenuation
of glutamate-induced neuronal swelling and toxicity in transgenic mice
overexpressing human CuZn-superoxide dismutase. Acta Neurochir
Suppl 51:245–247.
Choi MH, Lee IK, Kim GW, Kim BU, Han YH, Yu DY, Park HS,
Kim KY, Lee JS, Choi C, Bae YS, Lee BI, Rhee SG, Kang SW. 2005.
Regulation of PDGF signalling and vascular remodelling by peroxire-
doxin II. Nature 435:347–353.
Chung YM, Yoo YD, Park JK, Kim YT, Kim HJ. 2001. Increased
expression of peroxiredoxin II confers resistance to cisplatin. Anticancer
Res 21:1129–1133.
Dirnagl U, Simon RP, Hallenbeck JM. 2003. Ischemic tolerance and en-
dogenous neuroprotection. Trends Neurosci 26:248–254.
Fujii JI, Ikeda Y. 2002. Advances in our understanding of peroxiredoxin,
a multifunctional, mammalian redox protein. Redox Rep 7:123–130.
Gavino VC, Miller JS, Ikharebha SO, Milo GE, Cornwell DG. 1981.
Effect of polyunsaturated fatty acids and antioxidants on lipid peroxida-
tion in tissue cultures. J Lipid Res 22:763–769.
Goldner FM, Patrick JW. 1996. Neuronal localization of the cyclophilin
A protein in the adult rat brain. J Comp Neurol 372:283–293.
Halliwell B, Gutleridge JMC. 1999. Free radicals in biology and medi-
cine. Oxford Univ Press, 3rd ed., Oxford, UK.
Hattori F, Murayama N, Noshita T, Oikawa S. 2003. Mitochondrial per-
oxiredoxin-3 protects hippocampal neurons from excitotoxic injury in
vivo. J Neurochem 86:860–868.
He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B. 1998.
A simplified system for generating recombinant adenoviruses. Proc Natl
Acad Sci U S A 95:2509–2514.
Hu BR, Martone ME, Jones YZ, Liu CL. 2000. Protein aggregation af-
ter transient cerebral ischemia. J Neurosci 20:3191–3199.
Ichimiya S, Davis JG, O’Rourke DM, Katsumata M, Greene MI. 1997.
Murine thioredoxin peroxidase delays neuronal apoptosis and is
expressed in areas of the brain most susceptible to hypoxic and ischemic
injury. DNA Cell Biol 16:311–321.
Jang HH, Lee KO, Chi YH, Jung BG, Park SK, Park JH, Lee JR, Lee
SS, Moon JC, Yun JW, Choi YO, Kim WY, Kang JS, Cheong GW,
Yun DJ, Rhee SG, Cho MJ, Lee SY. 2004. Two enzymes in one; two
yeast peroxiredoxins display oxidative stress-dependent switching from a
peroxidase to a molecular chaperone function. Cell 117:625–635.
Jaschke A, Mi H, Tropschug M. 1998. Human T cell cyclophilin18
binds to thiol-specific antioxidant protein Aop1 and stimulates its activ-
ity. J Mol Biol 277:763–769.
Jin MH, Lee YH, Kim JM, Sun HN, Moon EY, Shong MH, Kim SU,
Lee SH, Lee TH, Yu DY, Lee DS. 2005. Characterization of neural
cell types expressing peroxiredoxins in mouse brain. Neurosci Lett
381:252–257.
Kaku DA, Giffard RG, Choi DW. 1993. Neuroprotective effects of glu-
tamate antagonists and extracellular acidity. Science 260:1517–1518.
Kang SW, Chae HZ, Seo MS, Kim K, Baines IC, Rhee SG. 1998.
Mammalian peroxiredoxin isoforms can reduce hydrogen peroxide gen-
erated in response to growth factors and tumor necrosis factor-alpha.
J Biol Chem 273:6297–6302.
Kang SW, Chang TS, Lee TH, Kim ES, Yu DY, Rhee SG. 2004. Cyto-
solic peroxiredoxin attenuates the activation of Jnk and p38 but poten-
tiates that of Erk in Hela cells stimulated with tumor necrosis factor-
alpha. J Biol Chem 279:2535–2543.
Kato S, Kato M, Abe Y, Matsumura T, Nishino T, Aoki M, Itoyama Y,
Asayama K, Awaya A, Hirano A, Ohama E. 2005. Redox system
expression in the motor neurons in amyotrophic lateral sclerosis (ALS):
immunohistochemical studies on sporadic ALS, superoxide dismutase 1
(SOD1)-mutated familial ALS, and SOD1-mutated ALS animal models.
Acta Neuropathol 110:101–112.
Kim H, Lee TH, Park ES, Suh JM, Park SJ, Chung HK, Kwon OY,
Kim YK, Ro HK, Shong M. 2000. Role of peroxiredoxins in regulat-
ing intracellular hydrogen peroxide and hydrogen peroxide-induced ap-
optosis in thyroid cells. J Biol Chem 275:18266–18270.
Kitagawa K, Matsumoto M, Tagaya M, Hata R, Ueda H, Niinobe M,
Handa N, Fukunaga R, Kimura K, Mikoshiba K, et al. 1990. ‘‘Ische-
mic tolerance’’ phenomenon found in the brain. Brain Res 528:21–24.
Koh JY, Choi DW. 1991. Selective blockade of non-NMDA receptors
does not block rapidly triggered glutamate-induced neuronal death.
Brain Res 548:318–321.
Koster JF, Slee RG. 1983. Lipid peroxidation of human erythrocyte
ghosts induced by organic hydroperoxides. Biochim Biophys Acta
752:233–239.
Krapfenbauer K, Engidawork E, Cairns N, Fountoulakis M, Lubec G.
2003. Aberrant expression of peroxiredoxin subtypes in neurodegenera-
tive disorders. Brain Res 967:152–160.
Kristensen P, Rasmussen DE, Kristensen BI. 1999. Properties of thiol-
specific anti-oxidant protein or calpromotin in solution. Biochem Bio-
phys Res Commun 262:127–131.
Lee JP, Palfrey HC, Bindokas VP, Ghadge GD, Ma L, Miller RJ, Roos
RP. 1999. The role of immunophilins in mutant superoxide dismutase-
1-linked familial amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A
96:3251–3256.
3096 Boulos et al.
Journal of Neuroscience Research DOI 10.1002/jnr
Lee SP, Hwang YS, Kim YJ, Kwon KS, Kim HJ, Kim K, Chae HZ.
2001. Cyclophilin a binds to peroxiredoxins and activates its peroxidase
activity. J Biol Chem 276:29826–29832.
Matsumoto A, Okado A, Fujii T, Fujii J, Egashira M, Niikawa N, Tani-
guchi N. 1999. Cloning of the peroxiredoxin gene family in rats and
characterization of the fourth member. FEBS Lett 443:246–250.
Matsumoto G, Stojanovic A, Holmberg CI, Kim S, Morimoto RI. 2005.
Structural properties and neuronal toxicity of amyotrophic lateral scle-
rosis-associated Cu/Zn superoxide dismutase 1 aggregates. J Cell Biol
171:75–85.
Matsumoto K, Lo EH, Pierce AR, Halpern EF, Newcomb R. 1996.
Secondary elevation of extracellular neurotransmitter amino acids in the
reperfusion phase following focal cerebral ischemia. J Cereb Blood
Flow Metab 16:114–124.
Meloni BP, Majda BT, Knuckey NW. 2001. Establishment of neuronal
in vitro models of ischemia in 96-well microtiter strip-plates that result
in acute, progressive and delayed neuronal death. Neuroscience 108:
17–26.
Meloni BP, Majda BT, Knuckey NW. 2002. Evaluation of precondition-
ing treatments to protect near-pure cortical neuronal cultures from in
vitro ischemia induced acute and delayed neuronal death. Brain Res
928:69–75.
Meloni BP, Tilbrook PA, Boulos S, Arthur PG, Knuckey NW. 2006.
Erythropoietin preconditioning in neuronal cultures: signaling, protec-
tion from in vitro ischemia, and proteomic analysis. J Neurosci Res
83:584–593.
Michaels RL, Rothman SM. 1990. Glutamate neurotoxicity in vitro: an-
tagonist pharmacology and intracellular calcium concentrations. J Neu-
rosci 10:283–292.
Moon JC, Hah YS, Kim WY, Jung BG, Jang HH, Lee JR, Kim SY, Lee
YM, Jeon MG, Kim CW, Cho MJ, Lee SY. 2005. Oxidative stress-de-
pendent structural and functional switching of a human 2-Cys peroxire-
doxin isotype II that enhances HeLa cell resistance to H2O2-induced
cell death. J Biol Chem 280:28775–28784.
Moore RB, Mankad MV, Shriver SK, Mankad VN, Plishker GA. 1991.
Reconstitution of Ca21-dependent K1 transport in erythrocyte membrane
vesicles requires a cytoplasmic protein. J Biol Chem 266:18964–18968.
O’Neil BJ, McKeown TR, DeGracia DJ, Alousi SS, Rafols JA, White
BC. 1999. Cell death, calcium mobilization, and immunostaining for
phosphorylated eukaryotic initiation factor 2-alpha (eIF2alpha) in neu-
ronally differentiated NB-104 cells: arachidonate and radical-mediated
injury mechanisms. Resuscitation 41:71–83.
Persoon-Rothert M, Egas-Kenniphaas JM, van der Valk-Kokshoorn EJ,
van der Laarse A. 1992. Cumene hydroperoxide induced changes in
calcium homeostasis in cultured neonatal rat heart cells. Cardiovasc Res
26:706–712.
Pringle AK, Thomas SJ, Signorelli F, Iannotti F. 1999. Ischemic pre-con-
ditioning in organotypic hippocampal slice cultures is inversely corre-
lated to the induction of the 72 kDa heat shock protein (HSP72). Brain
Res 845:152–164.
Prosperi MT, Ferbus D, Rouillard D, Goubin G. 1998. The pag gene
product, a physiological inhibitor of c-abl tyrosine kinase, is overex-
pressed in cells entering S phase and by contact with agents inducing
oxidative stress. FEBS Lett 423:39–44.
Rand JD, Grant CM. 2006. The thioredoxin system protects ribosomes
against stress-induced aggregation. Mol Biol Cell 17:387–401.
Sanchez-Font MF, Sebastia J, Sanfeliu C, Cristofol R, Marfany G, Gon-
zalez-Duarte R. 2003. Peroxiredoxin 2 (PRDX2), an antioxidant
enzyme, is under-expressed in Down syndrome fetal brains. Cell Mol
Life Sci 60:1513–1523.
Sarafian TA, Verity MA, Vinters HV, Shih CC, Shi L, Ji XD, Dong L,
Shau H. 1999. Differential expression of peroxiredoxin subtypes in
human brain cell types. J Neurosci Res 56:206–212.
Schroder E, Willis AC, Ponting CP. 1998. Porcine natural-killer-enhanc-
ing factor-B: oligomerisation and identification as a calpain substrate in
vitro. Biochim Biophys Acta 1383:279–291.
Schroder E, Jonsson T, Poole L. 2003. The role of erythrocyte peroxire-
doxin in detoxifying peroxides and in stimulating potassium efflux via
the Gardos channels. Blood 101:2897–2898.
Simzar S, Ellyin R, Shau H, Sarafian TA. 2000. Contrasting antioxidant
and cytotoxic effects of peroxiredoxin I and II in PC12 and NIH3T3
cells. Neurochem Res 25:1613–1621.
Tretter L, Adam-Vizi V. 1996. Early events in free radical-mediated
damage of isolated nerve terminals: effects of peroxides on membrane
potential and intracellular Na1 and Ca21 concentrations. J Neurochem
66:2057–2066.
Tretter L, Adam-Vizi V. 2002. Glutamate release by a Na1 load and oxi-
dative stress in nerve terminals: relevance to ischemia/reperfusion.
J Neurochem 83:855–862.
Tsai MC, Chen YH, Chiang LY. 1997. Polyhydroxylated C60, fullere-
nol, a novel free-radical trapper, prevented hydrogen peroxide- and
cumene hydroperoxide-elicited changes in rat hippocampus in-vitro.
J Pharm Pharmacol 49:438–445.
Vroegop SM, Decker DE, Buxser SE. 1995. Localization of damage
induced by reactive oxygen species in cultured cells. Free Radic Biol
Med 18:141–151.
Wood ZA, Schroder E, Robin Harris J, Poole LB. 2003. Structure,
mechanism and regulation of peroxiredoxins. Trends Biochem Sci
28:32–40.
Ying W, Anderson CM, Chen Y, Stein BA, Fahlman CS, Copin JC,
Chan PH, Swanson RA. 2000. Differing effects of copper, zinc super-
oxide dismutase overexpression on neurotoxicity elicited by nitric ox-
ide, reactive oxygen species, and excitotoxins. J Cereb Blood Flow
Metab 20:359–368.
Zeng M, Smith SK, Siegel F, Shi Z, Van Kampen KR, Elmets CA,
Tang DC. 2001. AdEasy system made easier by selecting the viral back-
bone plasmid preceding homologous recombination. Biotechniques
31:260–262.
Zhang P, Liu B, Kang SW, Seo MS, Rhee SG, Obeid LM. 1997. Thio-
redoxin peroxidase is a novel inhibitor of apoptosis with a mechanism
distinct from that of Bcl-2. J Biol Chem 272:30615–30618.
Zhu H, Meloni BP, Moore SR, Majda BT, Knuckey NW. 2004. Intra-
venous administration of magnesium is only neuroprotective following
transient global ischemia when present with post-ischemic mild hypo-
thermia. Brain Res 1014:53–60.
Neuroprotective Activity of PRDX2 and SOD1 3097
Journal of Neuroscience Research DOI 10.1002/jnr
Chapter Seven
Evidence that intracellular cyclophilin A and cyclophilin A/CD147
receptor mediated ERK1/2 signalling can protect neurons against in
vitro oxidative and ischaemic injury
90
This document:
A. Outlines the contribution made by each author for the following publication:
Boulos S, Meloni BP, Arthur PG, Majda B, Bojarski C and Knuckey NW (2006).
Evidence that intracellular cyclophilin A and cyclophilin A/CD147 receptor mediated
ERK1/2 signalling can protect neurons against in vitro oxidative and ischaemic injury.
Neurobiol Dis 25; 54-64
and
B. Signifies that each of the authors allows permission for the published work to be
included in the PhD thesis by Sherif Boulos
Contribution by each author:
Sherif Boulos 84%
Bruno Meloni 8%
Peter Arthur 2%
Bernadette Majda 2%
Christina Bojarski 2%
Neville Knuckey 2%
Bruno Meloni (co-ordinating supervisor) on behalf of all authors
Chapter Seven
Evidence that intracellular cyclophilin A and cyclophilin A/CD147
receptor mediated ERK1/2 signalling can protect neurons against in
vitro oxidative and ischaemic injury
90
This document:
A. Outlines the contribution made by each author for the following publication:
Boulos S, Meloni BP, Arthur PG, Majda B, Bojarski C and Knuckey NW (2006).
Evidence that intracellular cyclophilin A and cyclophilin A/CD147 receptor mediated
ERK1/2 signalling can protect neurons against in vitro oxidative and ischaemic injury.
Neurobiol Dis 25; 54-64
and
B. Signifies that each of the authors allows permission for the published work to be
included in the PhD thesis by Sherif Boulos
Contribution by each author:
Sherif Boulos 84%
Bruno Meloni 8%
Peter Arthur 2%
Bernadette Majda 2%
Christina Bojarski 2%
Neville Knuckey 2%
Bruno Meloni (co-ordinating supervisor) on behalf of all authors
Chapter Eight
General discussion and significance of this study
DISCUSSION
103
8.01 Background and aims
The only therapeutic agent available for the treatment of cerebral ischaemia is the clot
lysing agent tissue plasminogen activator (tPA; NINDS, 1995). However, tPA is only
effective against thrombo-embolic stroke and when administered within 3 hours from
stroke onset. Not surprisingly, only a small percentage of stroke patients, estimated at
1-3%, receive tPA. Thus, an important goal of cerebral ischaemia research is to develop
neuroprotective therapeutic agents that minimise the neuronal loss caused by the
disruption of blood flow. One approach is to develop therapeutic agents based upon
proteins up-regulated by ‘preconditioning’, a natural adaptive response utilised by the
brain to counter potentially damaging insults, such as ischaemia.
My project aimed to identify proteins involved in erythropoietin’s (EPO’s) neuronal
preconditioning response and to assess their influence on neuronal survival using in
vitro ischaemia models. In fulfilling this initial aim, proteins differentially expressed
following EPO preconditioning in neuronal cultures were identified and are described in
Chapter 3. However, in order to assess these proteins, it was first necessary to develop
a convenient and reliable method of over-expressing specific proteins in primary
cortical neuronal cultures. Thus, Chapter 4 describes the development of an adenoviral
vector expression system and its validation in two in vitro ischaemic models using the
known neuroprotective protein Bcl-XL. In Chapter 5, several candidate proteins were
evaluated for neuroprotective or neurodamaging activity and three of these,
peroxiredoxin 2 (PRDX2), superoxide dismutase 1 (SOD1) and cyclophilin A (CyPA),
were further characterised in Chapters 6 and 7. The main findings and significance of
this work in relation to cerebral ischaemia research and neuronal degeneration are
outlined below.
8.02 EPO preconditioning mediated gene expression
104
In the first aim described in Chapter 3, in vitro experiments were undertaken which
confirmed the delayed and efficacious neuroprotective response induced by EPO
preconditioning. In addition, cell signal activation of several components (extracellular
signal-regulated kinase 1/2 [ERK1/2], p38 and Jun N-terminal kinase [JNK]) of the
mitogen-activated protein kinase (MAPK) pathway were detected further confirming
the responsiveness of neurons to EPO. Using 2 dimensional electrophoresis, a total of
40 individual proteins were identified and classified as significantly up- or down-
regulated following EPO preconditioning. These proteins were heterogeneous in nature
and most had functions related to: signalling, the cellular stress response, mitochondrial
activity, metabolic/biochemical activity or the cytoskeleton.
8.03 Development of an adenoviral expression system
A substantial component of this thesis (Chapter 4) involved the development of a
flexible adenovirus vector system to express target proteins in neuronal cultures in order
to assess neuroprotective/neurodamaging activity of the expressed gene. Using this
system, I demonstrated the higher activity of the rous sarcoma virus (RSV) promoter in
cultured neurons compared to the cytomegalovirus (CMV) promoter; confirmed that the
woodchuck post-transcriptional regulatory element (WPRE) can substantially increase
transgene expression and; compared the activity of the rat and human synapsin 1
(SYN1) promoters. Furthermore, the inclusion of a green fluorescent protein (GFP)
reporter within this vector provided a convenient marker to monitor viral propagation
and viral transduction efficiency. Finally, in order to validate this adenoviral expression
system, I over-expressed the anti-apoptotic protein Bcl-XL in neuronal cultures and
subsequently confirmed its neuroprotective activity in the in vitro ischaemia and
oxidative stress models used in my project. Thus, I confirmed the suitability of this
system to assess if a given protein has neuroprotective activity.
The main finding of this study demonstrated the effectiveness of the RSV promoter in
driving protein expression in neurons. Nevertheless, each of the promoters investigated
105
possesses unique features and characteristics, and thus suitability, for different
applications and experimental paradigms. For instance, to investigate a secreted growth
factor, it may be preferable to use the CMV promoter and obtain strong astrocytic
expression at relatively low viral titres. Conversely, neuron-restrictive promoters such
as the SYN1 promoter are better suited to investigations of neuronal intracellular
protein function, especially in cases where non-neuronal cells such as astrocytes are
present such as in organotypic slices or cultures derived from adult brains.
Additionally, proteins that are neurotoxic at high levels are better suited to expression
from weaker promoters like the SYN1 promoter.
8.04 Assessment of candidate neuroprotective proteins
Twelve proteins were included for investigation as part of this thesis and the rationale
for their selection is explained in Chapter 5. Adenoviral vectors were generated for all
12 proteins, of which protein expression was confirmed for seven, four await expression
analysis and one failed to increase specific protein expression. Of the proteins initially
assessed, three (CyPA, PRDX2, SOD1) demonstrated significant neuroprotection and
these were further characterised and the findings are reported in Chapters 6 and 7. The
adenoviral vectors not investigated will be fully assessed for neuroprotective or
neurodamaging activity as part of ongoing studies within the Stroke Research Group at
the Australian Neuromuscular Research Institute.
8.05 The neuroprotective activity of PRDX2
I have provided evidence that PRDX2 can protect neurons against both ischaemic and
oxidative injury, and, as discussed previously (Chapter 6), hypothesised that this
cytoprotective activity may involve the antioxidant and/or chaperone functions of
PRDX2. Additionally, recent publications have shed further light on the potential
protective mechanisms employed by PRDX2. For example, the rate constant of PRDX2
for hydrogen peroxide (H2O2) was recently recalibrated and found to be comparable
106
with that of other potent antioxidants such as catalase and glutathione peroxidase
(Peskin et al, 2007). Notably, unlike catalase, neuronal cellular PRDX2 concentrations
are relatively high which further consolidates its status as a major neuronal antioxidant.
Consistent with these findings, increased PRDX2 expression, which occurs in
Alzheimer brains (Kim et al, 2001), was recently shown to protect neurons against
amyloid -peptide (A) toxicity mediated by A25-35, A35-25 and A40 (Yao et al,
2007) a component of which is linked to oxidative stress which is associated with
mitochondrial dysfunction (Lustbader et al, 2004; Casparsen et al, 2005). In addition,
recent evidence suggests that loss of PRDX2 function is related to the death of
dopaminergic neurons in sporadic forms of Parkinson’s disease (Qu et al, 2007). In this
case, PRDX2 fails to protect dopaminergic neurons from ROS damage because it is
inactivated by specific phosphorylation on Thr89
(Qu et al, 2007), a mechanism that also
inactivates PRDX1 activity (Chang et al, 2002). The inactivation of PRDX2 by
phosphorylation occurs when calcium dependent calpain I degrades the neuron-specific
activator p35 into p25, which stimulates cyclin-dependent kinase 5 (Cdk5) activity, of
which PRDX2 (Thr89
) is a substrate (Lee et al, 2000; Qu et al, 2007). Interestingly, p25
protein accumulates in the brains of patients with Alzheimer’s disease and has been
shown to increase in neurons following exposure to the A-peptide (Lee et al, 2000).
In my experiments, I found that PRDX2 over-expression could not protect against acute
glutamate excitotoxicity. Since acute excitotoxicity is a severe insult involving calcium
influx with calpain I as a major contributor to cell death, it could explain why PRDX2
over-expression did not increase neuronal viability. Although calpain is activated
following (in vitro/in vivo) ischaemia (Arai et al, 1991; Hong, 1994; Brana et al, 1999),
the extent of its activation in our ischaemia model may be insufficient to nullify the
neuroprotective effects of PRDX2 over-expression. An antibody capable of detecting
the phosphorylated form of PRDX2 (Qu et al, 2007) would aid in assessing this issue.
In summary, it appears that PRDX2 may play a general role in protecting neurons
against ischaemia and oxidative stress, as well as in age related neurodegeneration.
Finally, the demonstration that PRDX2 has cytoprotective activity in neurons is line
with the findings for other peroxiredoxin isoforms, namely PRDX3 (Hattori et al, 2003)
107
and PRDX5 (Plaisant et al, 2003), which have also been shown to protect neurons
against damaging insults.
8.06 SOD1 mediated neuronal protection
Superoxide dismutase 1 over-expression could protect against cumene induced
oxidative stress but not ischaemic injury or excitotoxic injury. The possible reasons are
outlined in Chapter 6.
8.07 Neuroprotective activity of intracellular CyPA
A key finding of this thesis is the discovery that CyPA over-expression significantly
mitigates oxidative and ischaemic injury in neuronal cultures. Several mechanisms may
account for this cytoprotective activity and these were discussed in Chapter 7.
However, recent evidence suggests that CyPA may function as a universal
cytoprotectant, induced in response to hypoxia (Choi et al, 2007). In support of this
notion, elevated CyPA expression has been reported in a number of tumour and cancer
cells (Shen et al, 2004; Howard et al, 2004; Yang et al, 2007, Choi et al, 2007).
Cyclophilin A appears to impart this protective response, at least in part, by reducing
ROS (Hong et al, 2002; Choi et al, 2007). As discussed in Chapter 7, CyPA’s
antioxidant function may be mediated, at least partly, through its capacity to stimulate
the peroxidase activity of PRDX2 (Jäschke et al, 1998; Lee et al, 2001).
The human CyPA Cys115
and Cys161
residues are responsible for the reduction and
activation of not only PRDX2, but all known PRDX isotypes, although only the
cytosolic peroxiredoxins are thought to be physiologically relevant (Lee et al, 2001).
By substituting either or both Cys residues for a neutral amino acid it should be possible
to determine if CyPA mediated stimulation of PRDX2 peroxidase activity contributes to
neuronal survival in our in vitro ischaemia related models. It is important to note that
this mutagenised form of CyPA would retain isomerase activity (Lee et al, 2001).
108
Given that CyPA and PRDX2 are interacting neuroprotective proteins, it is conceivable
that these highly abundant cytoplasmic proteins act in concert to provide an important
cellular mechanism for eliminating reactive oxygen species/reactive nitrogen species
(ROS/RNS) in neurons. This property could be investigated by over-expressing CyPA
and PRDX2 together in neuronal cultures and assessing how this influences neuronal
survival following oxidative and ischaemic stress.
It is also possible that CyPA possesses a distinct antioxidant function, unrelated to
PRDX2 activity. Evidence for this additional antioxidant function is supported by the
finding that CyPA transgenic mice are less sensitive to cyclosporine A mediated ROS
related toxicity compared to their wild-type littermates (Hong et al, 2004). In this
instance, it appears CyPA’s isomerase activity imparts an antioxidant function because
CyPA isomerase mutant (R55A) transgenic mice are more susceptible to cyclosporine A
mediated toxicity than either normal or CyPA transgenic mice (Hong et al, 2004).
Taken together, these findings indicate that the CyPA protein possesses isomerase
dependent antioxidant activity in addition to its PRDX2 related antioxidant activity.
8.08 Chaperone and trafficking functions of CyPA
As discussed in Chapter 7, a plausible mechanism for CyPA mediated cytoprotection
could involve its peptidyl isomerase activity or chaperone function, which participates
in protein folding (Lilie et al, 1993; Xu et al, 1995). In this instance, CyPA would
facilitate cell survival by maintaining native protein structures and suppressing the
formation of toxic protein aggregates generated following ischaemia. This mechanism
was proposed and discussed in Chapter 7.
More recently, a direct pro-survival role for CyPA in protein trafficking has also
recently emerged. In this instance, CyPA mediated protein trafficking was recently
demonstrated to be essential for cell surface expression of the sodium calcium
exchangers (NCX1, NCX2, NCX3; Rahamimoff et al, 2007), which are important in
calicum homeostasis (Jeffs et al, 2007). This is particularly relevant to ischaemia
109
because the NCXs play a role in neuronal survival following ischaemia and excitotoxic
injury (Bano et al, 2007; Jeffs et al, 2007). In addition, CyPA is also involved in the
expression of other receptors and growth factors with neuroprotective activity following
ischaemia including: granulocyte colony stimulating factor (G-CSF) fibroblast growth
factor (FGF) and insulin-like growth factor 2 receptor (Chen et al, 2007).
8.09 CyPA and apoptosis
Whilst I and others have demonstrated a cytoprotective function for CyPA, it also
appears that CyPA can participate in the apoptotic process in cells committed to dying
(Cande et al, 2004). In this instance CyPA interacts with the apoptosis inducing factor
(AIF) following its release from mitochondria, and in conjunction with AIF,
translocates to the nucleus and contributes to chromatinolysis (Cande et al, 2004). In
this capacity, CyPA is believed to contribute to chromatin degradation by virtue of its
endonuclease activity (Montegue et al, 1997). However, recent data has now revealed
that contaminating bacterial endonucleases found in preparations of recombinant CyPA
protein are responsible for its reported DNA degrading activity (Manteca and Sanchez,
2004). Nevertheless, a recent study by Zhu et al (2007) showed that 9 day old mice
lacking the CyPA gene had reduced brain damage compared to wild-type mice
following unilateral cerebral-hypoxia ischaemia. Thus, depending on the cellular
environment, it appears that CyPA can either promote cell survival or facilitate cell
death. This could be investigated further by examining how transgenic mice over-
expressing CyPA respond to cerebral ischaemia.
8.10 Cyclophilin A mediated CD147 receptor activation
An important finding of this thesis is the discovery that the application of recombinant
human CyPA is neuroprotective in neuronal cultures following oxidative and ischaemic
injury. Moreover, as confirmed in Chapter 7, neurons in culture express the CyPA
membrane receptor CD147. I thus proposed (Chapter 7) that it is likely that exogenous
110
CyPA mediates its neuroprotective function by activating pro-survival ERK1/2
signalling via the CD147 receptor. However, whilst verification of this CyPA/CD147
signalling pathway in vivo was beyond the scope of this project, recent findings by
Redell et al (2007) support my data. Redell et al (2007) have shown that exogenous
administration of CyPA protein significantly attenuated blood brain barrier permeability
(BBB) and tissue damage in a cortical/hippocampal stab wound injury model of
traumatic brain injury. The protective response mediated by CyPA in this stab wound
model suggests that administration of CyPA following cerebral ischaemia may also be
beneficial. Whether CyPA was responsible for directly protecting neurons and/or
whether neuronal loss was prevented by virtue of vascular preservation awaits further
investigation.
8.11 A putative biphasic response of CyPA
In Chapter 7, I reported that CyPA mRNA increased following a 3 minute non-
damaging period of global cerebral ischaemia, which is consistent with a recent finding
that hypoxia-inducible factor-1 (HIF) consensus sequences are present within the CyPA
promoter (Choi et al, 2007). Notably, CyPA protein expression has been shown to
increase rapidly within brain endothelia following traumatic brain injury (Redell et al,
2007) and in cardiac myocytes following hypoxia (Seko et al, 2004). Thus, increased
CyPA expression appears to occur in at least two distinct ways: i) directly and acutely,
via HIF mediated transcriptional activation and; indirectly and delayed, by for example,
via EPO mediated signalling (Meloni et al, 2006). Additionally, hypoxia, and possibly
trauma, also results in CyPA secretion (Seko et al, 2004; Redell et al, 2007). Within the
extracellular space CyPA appears to act as a paracrine and/or autocrine cytoprotectant,
probably through CD147 receptor signalling (Seko et al, 2004; Redell et al, 2007).
Taken together, it appears that the rapid up-regulation and secretion of CyPA provides
an immediate protective response, whilst the delayed up-regulation of CyPA provides a
longer lasting protective response.
8.12 CyPA and its pro-inflammatory activity
111
Whilst endogenous CyPA appears to be beneficial to cells/tissue both in vitro and in
vivo following injurious insults (Boulos et al, 2006; Redell et al, 2007), it also possesses
pro-inflammatory activity capable of stimulating immune cell migration and cytokine
production (Sherry et al, 1992; Jin et al, 2004; Kim et al, 2004). Indeed, the
extracellular form of CyPA was first described as a secretory factor released by
macrophages following lipopolysaccharide (LPS) exposure (Sherry et al, 1992).
Interestingly, macrophages also secrete granulocyte-macrophage colony stimulating
factor (G-CSF), which is neuroprotective in animal models of stroke (Zaks-Zilberman et
al, 2001; Schabitz et al, 2003). Thus, it is possible that the cytoprotective activity of
CyPA may have evolved to offset any tissue damaging effects caused by its
inflammatory function.
8.13 Alzheimer’s disease, CD147 and CyPA
Aside from its protective role in ischaemia, CD147 biology may also play a key role in
Alzheimer’s disease. For example, recent findings have revealed that CD147 is an
integral component of the -secretase membrane complex, where it acts as a negative
regulator. In other words, low CD147 receptor levels lead to increased -secretase
activity, resulting in increased -amyloid cleavage and A peptide production (Zhou et
al, 2005; Ko et al, 2007). Significantly, soluble A peptide, which is highly neurotoxic,
is regarded as the primary initiator of neuronal cell death in Alzheimer’s disease. This
suggests that CD147 expression may actually be compromised in Alzheimer’s patient
brains and hence warrants further investigation. Interestingly, CD147 knockout mice
have memory and sensory deficits (Naruhashi et al, 1997), symptoms which are
associated with Alzheimer’s disease. Another related finding is that CD147 expression
is modulated by the sterol carrier protein (SCP; Ko et al, 2007), whose function is
linked to cholesterol metabolism. The association of CD147 expression and cholesterol
is of interest as cholesterol metabolism is recognised as a contributing factor in
Alzheimer’s disease (Hirsch-Reinshagen and Wellington, 2007; Schipper, 2007).
112
My data also suggests that if CD147 expression is compromised in Alzheimer patients,
it may be contributing to neuronal loss due to reduced CyPA-CD147 mediated pro-
survival signalling. Indeed, down-regulation of G-CSF receptor expression was
recently proposed as a cause of neuronal loss in motor neuron disease (Tanaka et al,
2006). Supporting a notion of altered receptor signalling, aberrant ERK1/2 signalling in
response to bradykinin has been noted in Alzheimer patients, and was recently proposed
as a diagnostic marker of disease (Khan and Alkon, 2006). Whilst this observation is
not directly related to CD147 receptor activity, it does demonstrate that altered receptor
mediated signalling occurs in the Alzheimer’s disease phenotype.
The recent findings of Redell et al (2007), which demonstrated that extracellular CyPA
can preserve BBB permeability and vascular integrity, may also be relevant to
Alzheimer’s disease. This is because brain vascular dysfunction has been noted in
Alzheimer’s disease and in other neurodegenerative disorders (Zipser et al, 2007; Desai
et al, 2007; Bowman et al, 2007). Taken together, it appears that loss of CyPA-CD147
signalling could impact on a number of brain systems. Finally, if CD147 expression
declines with age then its expression status may not only have consequences for patients
with neurodegenerative disorders, but also for patients following cerebral ischaemia.
8.14 Significance of this study
Cortical neuronal cultures were used in this study because these neuronal subtypes are
known to be affected in stroke and can provide a useful in vitro model of ischaemia.
Nevertheless, neuronal cultures have their limitations as other components of the
nervous system, such as the blood brain barrier and glial cells are not represented. Thus
the neuroprotective functions of CyPA and PRDX2 require further investigation using
animal models of stroke. Despite this, the novel findings of this study demonstrate that
CyPA and PRDX2 have neuroprotective activity and are therefore legitimate
therapeutic targets for the design of drugs to limit neuronal death following cerebral
ischaemia, brain trauma and age related neurodegenerative disorders. Whilst the use of
recombinant viral vectors to facilitate increased specific protein expression in the CNS
113
is still under development, therapeutic agents based on the findings of this thesis could
take the form of compounds that increase specific protein expression at the
transcriptional level or could take advantage of cell membrane protein transduction
domains such as the TAT peptide to deliver neuroprotective proteins directly to the
CNS. Ultimately, this could result in better treatment options, improved patient
outcomes and reduced social and economic impacts on the community.
Chapter Nine
References
Aarts M, Iihara, K, Wei, WL, Xiong, ZG, Arundine, M, Cerwinski, W, MacDonald, JF
115
and Tymianski, M (2003). A key role for TRPM7 channels in anoxic neuronal
death. Cell 115(7): 863-77.
Aarts MM and Tymianski, M (2005). TRPM7 and ischemic CNS injury.
Neuroscientist 11(2): 116-23.
Abramov AY, Scorziello, A and Duchen, MR (2007). Three distinct mechanisms
generate oxygen free radicals in neurons and contribute to cell death during
anoxia and reoxygenation. J Neurosci 27(5): 1129-38.
Abu-Hamad S, Sivan, S and Shoshan-Barmatz, V (2006). The expression level of the
voltage-dependent anion channel controls life and death of the cell. Proc Natl
Acad Sci U S A 103(15): 5787-92.
Adhami F, Liao, G, Morozov, YM, Schloemer, A, Schmithorst, VJ, Lorenz, JN, Dunn,
RS, Vorhees, CV, Wills-Karp, M, Degen, JL, Davis, RJ, Mizushima, N, Rakic,
P, Dardzinski, BJ, Holland, SK, Sharp, FR and Kuan, CY (2006). Cerebral
ischemia-hypoxia induces intravascular coagulation and autophagy. Am J
Pathol 169(2): 566-83.
Alonso M, Medina, JH and Pozzo-Miller, L (2004). ERK1/2 activation is necessary
for BDNF to increase dendritic spine density in hippocampal CA1 pyramidal
neurons. Learn Mem 11(2): 172-8.
Arai A, Vanderklish, P, Kessler, M, Lee, K and Lynch, G (1991). A brief period of
hypoxia causes proteolysis of cytoskeletal proteins in hippocampal slices.
Brain Res 555(2): 276-80.
Armstead WM, Nassar, T, Akkawi, S, Smith, DH, Chen, XH, Cines, DB and Higazi,
AA (2006). Neutralizing the neurotoxic effects of exogenous and endogenous
tPA. Nat Neurosci 9(9): 1150-5.
Arthur PG, Lim, SC, Meloni, BP, Munns, SE, Chan, A and Knuckey, NW (2004). The
protective effect of hypoxic preconditioning on cortical neuronal cultures is
associated with increases in the activity of several antioxidant enzymes. Brain
Res 1017(1-2): 146-54.
Astrup J, Siesjo, BK and Symon, L (1981). Thresholds in cerebral ischemia - the
ischemic penumbra. Stroke 12(6): 723-5.
Bagenholm R, Nilsson, UA and Kjellmer, I (1997). Formation of free radicals in
hypoxic ischemic brain damage in the neonatal rat, assessed by an endogenous
spin trap and lipid peroxidation. Brain Res 773(1-2): 132-8.
Baines CP, Kaiser, RA, Purcell, NH, Blair, NS, Osinska, H, Hambleton, MA,
116
Brunskill, EW, Sayen, MR, Gottlieb, RA, Dorn, GW, Robbins, J and
Molkentin, JD (2005). Loss of cyclophilin D reveals a critical role for
mitochondrial permeability transition in cell death. Nature 434(7033): 658-62.
Bano D, Young, KW, Guerin, CJ, Lefeuvre, R, Rothwell, NJ, Naldini, L, Rizzuto, R,
Carafoli, E and Nicotera, P (2005). Cleavage of the plasma membrane
Na+/Ca2+ exchanger in excitotoxicity. Cell 120(2): 275-85.
Bazan NG, Rodriguez de Turco, EB and Allan, G (1995). Mediators of injury in
neurotrauma: intracellular signal transduction and gene expression. J
Neurotrauma 12(5): 791-814.
Benveniste H, Drejer, J, Schousboe, A and Diemer, NH (1984). Elevation of the
extracellular concentrations of glutamate and aspartate in rat hippocampus
during transient cerebral ischemia monitored by intracerebral microdialysis. J
Neurochem 43(5): 1369-74.
Bernard SA, Gray, TW, Buist, MD, Jones, BM, Silvester, W, Gutteridge, G and Smith,
K (2002). Treatment of comatose survivors of out-of-hospital cardiac arrest
with induced hypothermia. N Engl J Med 346(8): 557-63.
Bernaudin M, Marti, HH, Roussel, S, Divoux, D, Nouvelot, A, MacKenzie, ET and
Petit, E (1999). A potential role for erythropoietin in focal permanent cerebral
ischemia in mice. J Cereb Blood Flow Metab 19(6): 643-51.
Bonfoco E, Krainc, D, Ankarcrona, M, Nicotera, P and Lipton, SA (1995). Apoptosis
and necrosis: two distinct events induced, respectively, by mild and intense
insults with N-methyl-D-aspartate or nitric oxide/superoxide in cortical cell
cultures. Proc Natl Acad Sci U S A 92(16): 7162-6.
Bonventre JV, Huang, Z, Taheri, MR, O'Leary, E, Li, E, Moskowitz, MA and
Sapirstein, A (1997). Reduced fertility and postischaemic brain injury in mice
deficient in cytosolic phospholipase A2. Nature 390(6660): 622-5.
Boulos S, Meloni, BP, Arthur, PG, Majda, B, Bojarski, C and Knuckey, NW (2007).
Evidence that intracellular cyclophilin A and cyclophilin A/CD147 receptor-
mediated ERK1/2 signalling can protect neurons against in vitro oxidative and
ischemic injury. Neurobiol Dis 25(1): 54-64.
Bowman GL, Kaye, JA, Moore, M, Waichunas, D, Carlson, NE and Quinn, JF (2007).
Blood-brain barrier impairment in Alzheimer disease: stability and functional
significance. Neurology 68(21): 1809-14.
Brana C, Benham, CD and Sundstrom, LE (1999). Calpain activation and inhibition in
organotypic rat hippocampal slice cultures deprived of oxygen and glucose.
Eur J Neurosci 11(7): 2375-84.
Brines M, Grasso, G, Fiordaliso, F, Sfacteria, A, Ghezzi, P, Fratelli, M, Latini, R, Xie,
117
QW, Smart, J, Su-Rick, CJ, Pobre, E, Diaz, D, Gomez, D, Hand, C, Coleman,
T and Cerami, A (2004). Erythropoietin mediates tissue protection through an
erythropoietin and common beta-subunit heteroreceptor. Proc Natl Acad Sci U
S A 101(41): 14907-12.
Calapai G, Marciano, MC, Corica, F, Allegra, A, Parisi, A, Frisina, N, Caputi, AP and
Buemi, M (2000). Erythropoietin protects against brain ischemic injury by
inhibition of nitric oxide formation. Eur J Pharmacol 401(3): 349-56.
Cande C, Cohen, I, Daugas, E, Ravagnan, L, Larochette, N, Zamzami, N and
Kroemer, G (2002). Apoptosis-inducing factor (AIF): a novel caspase-
independent death effector released from mitochondria. Biochimie 84(2-3):
215-22.
Cande C, Vahsen, N, Kouranti, I, Schmitt, E, Daugas, E, Spahr, C, Luban, J, Kroemer,
RT, Giordanetto, F, Garrido, C, Penninger, JM and Kroemer, G (2004). AIF
and cyclophilin A cooperate in apoptosis-associated chromatinolysis.
Oncogene 23(8): 1514-21.
Caspersen C, Wang, N, Yao, J, Sosunov, A, Chen, X, Lustbader, JW, Xu, HW, Stern,
D, McKhann, G and Yan, SD (2005). Mitochondrial Abeta: a potential focal
point for neuronal metabolic dysfunction in Alzheimer's disease. Faseb J
19(14): 2040-1.
Chan PH, Kawase, M, Murakami, K, Chen, SF, Li, Y, Calagui, B, Reola, L, Carlson, E
and Epstein, CJ (1998). Overexpression of SOD1 in transgenic rats protects
vulnerable neurons against ischemic damage after global cerebral ischemia and
reperfusion. J Neurosci 18(20): 8292-9.
Chang TS, Jeong, W, Choi, SY, Yu, S, Kang, SW and Rhee, SG (2002). Regulation of
peroxiredoxin I activity by Cdc2-mediated phosphorylation. J Biol Chem
277(28): 25370-6.
Chen S, Zhang, M, Ma, H, Saiyin, H, Shen, S, Xi, J, Wan, B and Yu, L (2007). Oligo-
microarray analysis reveals the role of cyclophilin A in drug resistance. Cancer
Chemother Pharmacol (Epub).
Cheng A, Wang, S, Yang, D, Xiao, R and Mattson, MP (2003). Calmodulin mediates
brain-derived neurotrophic factor cell survival signaling upstream of Akt
kinase in embryonic neocortical neurons. J Biol Chem 278(9): 7591-9.
Choi DW (1987). Ionic dependence of glutamate neurotoxicity. J Neurosci 7(2): 369-
79.
Choi KJ, Piao, YJ, Lim, MJ, Kim, JH, Ha, J, Choe, W and Kim, SS (2007).
Overexpressed cyclophilin A in cancer cells renders resistance to hypoxia- and
cisplatin-induced cell death. Cancer Res 67(8): 3654-62.
Chong ZZ, Kang, JQ and Maiese, K (2002). Hematopoietic factor erythropoietin
118
fosters neuroprotection through novel signal transduction cascades. J Cereb
Blood Flow Metab 22(5): 503-14.
Chong ZZ, Kang, JQ and Maiese, K (2003). Erythropoietin fosters both intrinsic and
extrinsic neuronal protection through modulation of microglia, Akt1, Bad, and
caspase-mediated pathways. Br J Pharmacol 138(6): 1107-18.
Chong ZZ, Lin, SH, Kang, JQ and Maiese, K (2003). Erythropoietin prevents early
and late neuronal demise through modulation of Akt1 and induction of caspase
1, 3, and 8. J Neurosci Res 71(5): 659-69.
Chu CT, Levinthal, DJ, Kulich, SM, Chalovich, EM and DeFranco, DB (2004).
Oxidative neuronal injury. The dark side of ERK1/2. Eur J Biochem 271(11):
2060-6.
Clapp LE, Klette, KL, DeCoster, MA, Bernton, E, Petras, JM, Dave, JR, Laskosky,
MS, Smallridge, RC and Tortella, FC (1995). Phospholipase A2-induced
neurotoxicity in vitro and in vivo in rats. Brain Res 693(1-2): 101-11.
Costes S, Broca, C, Bertrand, G, Lajoix, AD, Bataille, D, Bockaert, J and Dalle, S
(2006). ERK1/2 control phosphorylation and protein level of cAMP-responsive
element-binding protein: a key role in glucose-mediated pancreatic beta-cell
survival. Diabetes 55(8): 2220-30.
Crack PJ, Taylor, JM, Flentjar, NJ, de Haan, J, Hertzog, P, Iannello, RC and Kola, I
(2001). Increased infarct size and exacerbated apoptosis in the glutathione
peroxidase-1 (Gpx-1) knockout mouse brain in response to
ischemia/reperfusion injury. J Neurochem 78(6): 1389-99.
Dahl NA and Balfour, WM (1964). Prolonged Anoxic Survival Due to Anoxia Pre-
Exposure: Brain Atp, Lactate, and Pyruvate. Am J Physiol 207: 452-6.
Datta SR, Dudek, H, Tao, X, Masters, S, Fu, H, Gotoh, Y and Greenberg, ME (1997).
Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death
machinery. Cell 91(2): 231-41.
Dave KR, Lange-Asschenfeldt, C, Raval, AP, Prado, R, Busto, R, Saul, I and Perez-
Pinzon, MA (2005). Ischemic preconditioning ameliorates excitotoxicity by
shifting glutamate/gamma-aminobutyric acid release and biosynthesis. J
Neurosci Res 82(5): 665-73.
Davis CB, Szucs, PA and McCombs, NJ (1986). The stroke patient: nursing care and
home health services. J Med Assoc Ga 75(2): 102-5.
Dawson DA, Furuya, K, Gotoh, J, Nakao, Y and Hallenbeck, JM (1999).
Cerebrovascular hemodynamics and ischemic tolerance: lipopolysaccharide-
induced resistance to focal cerebral ischemia is not due to changes in severity
of the initial ischemic insult, but is associated with preservation of
119
microvascular perfusion. J Cereb Blood Flow Metab 19(6): 616-23.
Dawson VL (1995). Nitric oxide: role in neurotoxicity. Clin Exp Pharmacol Physiol
22(4): 305-8.
Dawson VL and Dawson, TM (1996). Nitric oxide in neuronal degeneration. Proc Soc
Exp Biol Med 211(1): 33-40.
Dawson VL, Dawson, TM, London, ED, Bredt, DS and Snyder, SH (1991). Nitric
oxide mediates glutamate neurotoxicity in primary cortical cultures. Proc Natl
Acad Sci U S A 88(14): 6368-71.
Dawson VL, Kizushi, VM, Huang, PL, Snyder, SH and Dawson, TM (1996).
Resistance to neurotoxicity in cortical cultures from neuronal nitric oxide
synthase-deficient mice. J Neurosci 16(8): 2479-87.
De Blasio A, Musmeci, MT, Giuliano, M, Lauricella, M, Emanuele, S, D'Anneo, A,
Vassallo, B, Tesoriere, G and Vento, R (2003). The effect of 3-
aminobenzamide, inhibitor of poly(ADP-ribose) polymerase, on human
osteosarcoma cells. Int J Oncol 23(6): 1521-8.
Degterev A, Huang, Z, Boyce, M, Li, Y, Jagtap, P, Mizushima, N, Cuny, GD,
Mitchison, TJ, Moskowitz, MA and Yuan, J (2005). Chemical inhibitor of
nonapoptotic cell death with therapeutic potential for ischemic brain injury.
Nat Chem Biol 1(2): 112-9.
Desai BS, Monahan, AJ, Carvey, PM and Hendey, B (2007). Blood-brain barrier
pathology in Alzheimer's and Parkinson's disease: implications for drug
therapy. Cell Transplant 16(3): 285-99.
Digicaylioglu M, Bichet, S, Marti, HH, Wenger, RH, Rivas, LA, Bauer, C and
Gassmann, M (1995). Localization of specific erythropoietin binding sites in
defined areas of the mouse brain. Proc Natl Acad Sci U S A 92(9): 3717-20.
Digicaylioglu M, Garden, G, Timberlake, S, Fletcher, L and Lipton, SA (2004). Acute
neuroprotective synergy of erythropoietin and insulin-like growth factor I.
Proc Natl Acad Sci U S A 101(26): 9855-60.
Digicaylioglu M and Lipton, SA (2001). Erythropoietin-mediated neuroprotection
involves cross-talk between Jak2 and NF-kappaB signalling cascades. Nature
412(6847): 641-7.
Ehrenreich H, Hasselblatt, M, Dembowski, C, Cepek, L, Lewczuk, P, Stiefel, M,
Rustenbeck, HH, Breiter, N, Jacob, S, Knerlich, F, Bohn, M, Poser, W, Ruther,
E, Kochen, M, Gefeller, O, Gleiter, C, Wessel, TC, De Ryck, M, Itri, L,
Prange, H, Cerami, A, Brines, M and Siren, AL (2002). Erythropoietin therapy
for acute stroke is both safe and beneficial. Mol Med 8(8): 495-505.
Ellis HM and Horvitz, HR (1986). Genetic control of programmed cell death in the
120
nematode C. elegans. Cell 44(6): 817-29.
Endres M, Wang, ZQ, Namura, S, Waeber, C and Moskowitz, MA (1997). Ischemic
brain injury is mediated by the activation of poly(ADP-ribose)polymerase. J
Cereb Blood Flow Metab 17(11): 1143-51.
Erbayraktar S, Grasso, G, Sfacteria, A, Xie, QW, Coleman, T, Kreilgaard, M, Torup,
L, Sager, T, Erbayraktar, Z, Gokmen, N, Yilmaz, O, Ghezzi, P, Villa, P,
Fratelli, M, Casagrande, S, Leist, M, Helboe, L, Gerwein, J, Christensen, S,
Geist, MA, Pedersen, LO, Cerami-Hand, C, Wuerth, JP, Cerami, A and Brines,
M (2003). Asialoerythropoietin is a nonerythropoietic cytokine with broad
neuroprotective activity in vivo. Proc Natl Acad Sci U S A 100(11): 6741-6.
Fink K, Zhu, J, Namura, S, Shimizu-Sasamata, M, Endres, M, Ma, J, Dalkara, T,
Yuan, J and Moskowitz, MA (1998). Prolonged therapeutic window for
ischemic brain damage caused by delayed caspase activation. J Cereb Blood
Flow Metab 18(10): 1071-6.
Gidday JM (2006). Cerebral preconditioning and ischaemic tolerance. Nat Rev
Neurosci 7(6): 437-48.
Giffard RG, Xu, L, Zhao, H, Carrico, W, Ouyang, Y, Qiao, Y, Sapolsky, R, Steinberg,
G, Hu, B and Yenari, MA (2004). Chaperones, protein aggregation, and brain
protection from hypoxic/ischemic injury. J Exp Biol 207(Pt 18): 3213-20.
Golstein P and Kroemer, G (2007). Cell death by necrosis: towards a molecular
definition. Trends Biochem Sci 32(1): 37-43.
Goto S, Xue, R, Sugo, N, Sawada, M, Blizzard, KK, Poitras, MF, Johns, DC, Dawson,
TM, Dawson, VL, Crain, BJ, Traystman, RJ, Mori, S and Hurn, PD (2002).
Poly(ADP-ribose) polymerase impairs early and long-term experimental stroke
recovery. Stroke 33(4): 1101-6.
Grabb MC, Lobner, D, Turetsky, DM and Choi, DW (2002). Preconditioned resistance
to oxygen-glucose deprivation-induced cortical neuronal death: alterations in
vesicular GABA and glutamate release. Neuroscience 115(1): 173-83.
Granger DN, Rutili, G and McCord, JM (1981). Superoxide radicals in feline intestinal
ischemia. Gastroenterology 81(1): 22-9.
Gu W, Zhao, H, Yenari, MA, Sapolsky, RM and Steinberg, GK (2004). Catalase over-
expression protects striatal neurons from transient focal cerebral ischemia.
Neuroreport 15(3): 413-6.
Guegan C, Ceballos-Picot, I, Chevalier, E, Nicole, A, Onteniente, B and Sola, B
(1999). Reduction of ischemic damage in NGF-transgenic mice: correlation
with enhancement of antioxidant enzyme activities. Neurobiol Dis 6(3): 180-9.
121
Han BH and Holtzman, DM (2000). BDNF protects the neonatal brain from hypoxic-
ischemic injury in vivo via the ERK pathway. J Neurosci 20(15): 5775-81.
Hara T, Nakamura, K, Matsui, M, Yamamoto, A, Nakahara, Y, Suzuki-Migishima, R,
Yokoyama, M, Mishima, K, Saito, I, Okano, H and Mizushima, N (2006).
Suppression of basal autophagy in neural cells causes neurodegenerative
disease in mice. Nature 441(7095): 885-9.
Harrison R (2004). Physiological roles of xanthine oxidoreductase. Drug Metab Rev
36(2): 363-75.
Hattori F, Murayama, N, Noshita, T and Oikawa, S (2003). Mitochondrial
peroxiredoxin-3 protects hippocampal neurons from excitotoxic injury in vivo.
J Neurochem 86(4): 860-8.
Hetman M and Gozdz, A (2004). Role of extracellular signal regulated kinases 1 and 2
in neuronal survival. Eur J Biochem 271(11): 2050-5.
Himi T, Ishizaki, Y and Murota, S (1998). A caspase inhibitor blocks ischaemia-
induced delayed neuronal death in the gerbil. Eur J Neurosci 10(2): 777-81.
Hirsch-Reinshagen V and Wellington, CL (2007). Cholesterol metabolism,
apolipoprotein E, adenosine triphosphate-binding cassette transporters, and
Alzheimer's disease. Curr Opin Lipidol 18(3): 325-32.
Hong F, Lee, J, Piao, YJ, Jae, YK, Kim, YJ, Oh, C, Seo, JS, Yun, YS, Yang, CW, Ha,
J and Kim, SS (2004). Transgenic mice overexpressing cyclophilin A are
resistant to cyclosporin A-induced nephrotoxicity via peptidyl-prolyl cis-trans
isomerase activity. Biochem Biophys Res Commun 316(4): 1073-80.
Hong F, Lee, J, Song, JW, Lee, SJ, Ahn, H, Cho, JJ, Ha, J and Kim, SS (2002).
Cyclosporin A blocks muscle differentiation by inducing oxidative stress and
inhibiting the peptidyl-prolyl-cis-trans isomerase activity of cyclophilin A:
cyclophilin A protects myoblasts from cyclosporin A-induced cytotoxicity.
Faseb J 16(12): 1633-5.
Hong SC, Goto, Y, Lanzino, G, Soleau, S, Kassell, NF and Lee, KS (1994).
Neuroprotection with a calpain inhibitor in a model of focal cerebral ischemia.
Stroke 25(3): 663-9.
Hong X, Lei, L and Glas, R (2003). Tumors acquire inhibitor of apoptosis protein
(IAP)-mediated apoptosis resistance through altered specificity of cytosolic
proteolysis. J Exp Med 197(12): 1731-43.
Howard BA, Zheng, Z, Campa, MJ, Wang, MZ, Sharma, A, Haura, E, Herndon, JE,
2nd, Fitzgerald, MC, Bepler, G and Patz, EF, Jr. (2004). Translating
biomarkers into clinical practice: prognostic implications of cyclophilin A and
macrophage migratory inhibitory factor identified from protein expression
122
profiles in non-small cell lung cancer. Lung Cancer 46(3): 313-23.
Inoue H, Nojima, H and Okayama, H (1990). High efficiency transformation of
Escherichia coli with plasmids. Gene 96(1): 23-8.
Ishibashi N, Prokopenko, O, Reuhl, KR and Mirochnitchenko, O (2002).
Inflammatory response and glutathione peroxidase in a model of stroke. J
Immunol 168(4): 1926-33.
Jaschke A, Mi, H and Tropschug, M (1998). Human T cell cyclophilin18 binds to
thiol-specific antioxidant protein Aop1 and stimulates its activity. J Mol Biol
277(4): 763-9.
Jeffs GJ, Meloni, BP, Bakker, AJ and Knuckey, NW (2007). The role of the
Na(+)/Ca(2+) exchanger (NCX) in neurons following ischaemia. J Clin
Neurosci 14(6): 507-14.
Jin K, Graham, SH, Mao, X, Nagayama, T, Simon, RP and Greenberg, DA (2001). Fas
(CD95) may mediate delayed cell death in hippocampal CA1 sector after
global cerebral ischemia. J Cereb Blood Flow Metab 21(12): 1411-21.
Jin K, Mao, XO, Zhu, Y and Greenberg, DA (2002). MEK and ERK protect hypoxic
cortical neurons via phosphorylation of Bad. J Neurochem 80(1): 119-25.
Jin ZG, Lungu, AO, Xie, L, Wang, M, Wong, C and Berk, BC (2004). Cyclophilin A
is a proinflammatory cytokine that activates endothelial cells. Arterioscler
Thromb Vasc Biol 24(7): 1186-91.
Johnson CJ, Kittner, SJ, McCarter, RJ, Sloan, MA, Stern, BJ, Buchholz, D and Price,
TR (1995). Interrater reliability of an etiologic classification of ischemic
stroke. Stroke 26(1): 46-51.
Kaneko S, Kawakami, S, Hara, Y, Wakamori, M, Itoh, E, Minami, T, Takada, Y,
Kume, T, Katsuki, H, Mori, Y and Akaike, A (2006). A critical role of TRPM2
in neuronal cell death by hydrogen peroxide. J Pharmacol Sci 101(1): 66-76.
Kawakami M, Sekiguchi, M, Sato, K, Kozaki, S and Takahashi, M (2001).
Erythropoietin receptor-mediated inhibition of exocytotic glutamate release
confers neuroprotection during chemical ischemia. J Biol Chem 276(42):
39469-75.
Khan TK and Alkon, DL (2006). An internally controlled peripheral biomarker for
Alzheimer's disease: Erk1 and Erk2 responses to the inflammatory signal
bradykinin. Proc Natl Acad Sci U S A 103(35): 13203-7.
Kilic E, Kilic, U, Soliz, J, Bassetti, CL, Gassmann, M and Hermann, DM (2005).
Brain-derived erythropoietin protects from focal cerebral ischemia by dual
activation of ERK-1/-2 and Akt pathways. Faseb J 19(14): 2026-8.
123
Kilic U, Kilic, E, Soliz, J, Bassetti, CI, Gassmann, M and Hermann, DM (2005).
Erythropoietin protects from axotomy-induced degeneration of retinal ganglion
cells by activating ERK-1/-2. Faseb J 19(2): 249-51.
Kim SH, Fountoulakis, M, Cairns, N and Lubec, G (2001). Protein levels of human
peroxiredoxin subtypes in brains of patients with Alzheimer's disease and
Down syndrome. J Neural Transm Suppl(61): 223-35.
Kim SH, Lessner, SM, Sakurai, Y and Galis, ZS (2004). Cyclophilin A as a novel
biphasic mediator of endothelial activation and dysfunction. Am J Pathol
164(5): 1567-74.
Kitagawa K, Matsumoto, M, Kuwabara, K, Tagaya, M, Ohtsuki, T, Hata, R, Ueda, H,
Handa, N, Kimura, K and Kamada, T (1991). 'Ischemic tolerance' phenomenon
detected in various brain regions. Brain Res 561(2): 203-11.
Kitagawa K, Matsumoto, M, Tagaya, M, Hata, R, Ueda, H, Niinobe, M, Handa, N,
Fukunaga, R, Kimura, K, Mikoshiba, K and et al. (1990). 'Ischemic tolerance'
phenomenon found in the brain. Brain Res 528(1): 21-4.
Klionsky DJ (2006). Neurodegeneration: good riddance to bad rubbish. Nature
441(7095): 819-20.
Ko MH and Puglielli, L (2007). The sterol carrier protein SCP-x/pro-SCP-2 gene has
transcriptional activity and regulates the Alzheimer disease gamma-secretase. J
Biol Chem 282(27): 19742-52.
Komatsu M, Kominami, E and Tanaka, K (2006). Autophagy and neurodegeneration.
Autophagy 2(4): 315-7.
Komatsu M, Waguri, S, Chiba, T, Murata, S, Iwata, J, Tanida, I, Ueno, T, Koike, M,
Uchiyama, Y, Kominami, E and Tanaka, K (2006). Loss of autophagy in the
central nervous system causes neurodegeneration in mice. Nature 441(7095):
880-4.
Konishi Y, Chui, DH, Hirose, H, Kunishita, T and Tabira, T (1993). Trophic effect of
erythropoietin and other hematopoietic factors on central cholinergic neurons
in vitro and in vivo. Brain Res 609(1-2): 29-35.
Kroemer G and Reed, JC (2000). Mitochondrial control of cell death. Nat Med 6(5):
513-9.
Larsen KE and Sulzer, D (2002). Autophagy in neurons: a review. Histol Histopathol
17(3): 897-908.
Lee MS, Kwon, YT, Li, M, Peng, J, Friedlander, RM and Tsai, LH (2000).
124
Neurotoxicity induces cleavage of p35 to p25 by calpain. Nature 405(6784):
360-4.
Lee SP, Hwang, YS, Kim, YJ, Kwon, KS, Kim, HJ, Kim, K and Chae, HZ (2001).
Cyclophilin a binds to peroxiredoxins and activates its peroxidase activity. J
Biol Chem 276(32): 29826-32.
Levine B (2005). Eating oneself and uninvited guests: autophagy-related pathways in
cellular defense. Cell 120(2): 159-62.
Levine B and Klionsky, DJ (2004). Development by self-digestion: molecular
mechanisms and biological functions of autophagy. Dev Cell 6(4): 463-77.
Levine B and Yuan, J (2005). Autophagy in cell death: an innocent convict? J Clin
Invest 115(10): 2679-88.
Lilie H, Lang, K, Rudolph, R and Buchner, J (1993). Prolyl isomerases catalyze
antibody folding in vitro. Protein Sci 2(9): 1490-6.
Linnik MD, Miller, JA, Sprinkle-Cavallo, J, Mason, PJ, Thompson, FY, Montgomery,
LR and Schroeder, KK (1995). Apoptotic DNA fragmentation in the rat
cerebral cortex induced by permanent middle cerebral artery occlusion. Brain
Res Mol Brain Res 32(1): 116-24.
Lipton SA (1999). Neuronal protection and destruction by NO. Cell Death Differ
6(10): 943-51.
Lipton SA, Choi, YB, Pan, ZH, Lei, SZ, Chen, HS, Sucher, NJ, Loscalzo, J, Singel, DJ
and Stamler, JS (1993). A redox-based mechanism for the neuroprotective and
neurodestructive effects of nitric oxide and related nitroso-compounds. Nature
364(6438): 626-32.
Lipton SA and Rosenberg, PA (1994). Excitatory amino acids as a final common
pathway for neurologic disorders. N Engl J Med 330(9): 613-22.
Liu C, Chen, S, Kamme, F and Hu, BR (2005). Ischemic preconditioning prevents
protein aggregation after transient cerebral ischemia. Neuroscience 134(1): 69-
80.
Lo EH, Dalkara, T and Moskowitz, MA (2003). Mechanisms, challenges and
opportunities in stroke. Nat Rev Neurosci 4(5): 399-415.
Lo EH, Moskowitz, MA and Jacobs, TP (2005). Exciting, radical, suicidal: how brain
cells die after stroke. Stroke 36(2): 189-92.
Loddick SA, MacKenzie, A and Rothwell, NJ (1996). An ICE inhibitor, z-VAD-DCB
attenuates ischaemic brain damage in the rat. Neuroreport 7(9): 1465-8.
Lustbader JW, Cirilli, M, Lin, C, Xu, HW, Takuma, K, Wang, N, Caspersen, C, Chen,
125
X, Pollak, S, Chaney, M, Trinchese, F, Liu, S, Gunn-Moore, F, Lue, LF,
Walker, DG, Kuppusamy, P, Zewier, ZL, Arancio, O, Stern, D, Yan, SS and
Wu, H (2004). ABAD directly links Abeta to mitochondrial toxicity in
Alzheimer's disease. Science 304(5669): 448-52.
Manning AS, Coltart, DJ and Hearse, DJ (1984). Ischemia and reperfusion-induced
arrhythmias in the rat. Effects of xanthine oxidase inhibition with allopurinol.
Circ Res 55(4): 545-8.
Manteca A and Sanchez, J (2004). Recombinant cyclophilins lack nuclease activity. J
Bacteriol 186(18): 6325-6.
Marti HH, Wenger, RH, Rivas, LA, Straumann, U, Digicaylioglu, M, Henn, V,
Yonekawa, Y, Bauer, C and Gassmann, M (1996). Erythropoietin gene
expression in human, monkey and murine brain. Eur J Neurosci 8(4): 666-76.
Marti HH (2002). Neuroprotection and angiogenesis: dual role of erythropoietin in
brain ischaemia. News Physiol Sci 15:225-229..
Martin-Villalba A, Hahne, M, Kleber, S, Vogel, J, Falk, W, Schenkel, J and Krammer,
PH (2001). Therapeutic neutralization of CD95-ligand and TNF attenuates
brain damage in stroke. Cell Death Differ 8(7): 679-86.
Masson N and Ratcliffe, PJ (2003). HIF prolyl and asparaginyl hydroxylases in the
biological response to intracellular O(2) levels. J Cell Sci 116(Pt 15): 3041-9.
Masuda S, Chikuma, M and Sasaki, R (1997). Insulin-like growth factors and insulin
stimulate erythropoietin production in primary cultured astrocytes. Brain Res
746(1-2): 63-70.
Masuda S, Nagao, M, Takahata, K, Konishi, Y, Gallyas, F, Jr., Tabira, T and Sasaki, R
(1993). Functional erythropoietin receptor of the cells with neural
characteristics. Comparison with receptor properties of erythroid cells. J Biol
Chem 268(15): 11208-16.
Masuda S, Okano, M, Yamagishi, K, Nagao, M, Ueda, M and Sasaki, R (1994). A
novel site of erythropoietin production. Oxygen-dependent production in
cultured rat astrocytes. J Biol Chem 269(30): 19488-93.
Mehta SL, Manhas, N and Raghubir, R (2007). Molecular targets in cerebral ischemia
for developing novel therapeutics. Brain Res Rev 54(1): 34-66.
Meijer AJ and Codogno, P (2004). Regulation and role of autophagy in mammalian
cells. Int J Biochem Cell Biol 36(12): 2445-62.
Meller R, Minami, M, Cameron, JA, Impey, S, Chen, D, Lan, JQ, Henshall, DC and
Simon, RP (2005). CREB-mediated Bcl-2 protein expression after ischemic
preconditioning. J Cereb Blood Flow Metab 25(2): 234-46.
126
Meloni BP, Tilbrook, PA, Boulos, S, Arthur, PG and Knuckey, NW (2006).
Erythropoietin preconditioning in neuronal cultures: signaling, protection from
in vitro ischemia, and proteomic analysis. J Neurosci Res 83(4): 584-93.
Mi Z, Oliver, T, Guo, H, Gao, C and Kuo, PC (2007). Thrombin-cleaved COOH(-)
terminal osteopontin peptide binds with cyclophilin C to CD147 in murine
breast cancer cells. Cancer Res 67(9): 4088-97.
Miao B, Yin, XH, Pei, DS, Zhang, QG and Zhang, GY (2005). Neuroprotective effects
of preconditioning ischemia on ischemic brain injury through down-regulating
activation of JNK1/2 via N-methyl-D-aspartate receptor-mediated Akt1
activation. J Biol Chem 280(23): 21693-9.
Mizushima N, Ohsumi, Y and Yoshimori, T (2002). Autophagosome formation in
mammalian cells. Cell Struct Funct 27(6): 421-9.
Montague JW, Hughes, FM, Jr. and Cidlowski, JA (1997). Native recombinant
cyclophilins A, B, and C degrade DNA independently of peptidylprolyl cis-
trans-isomerase activity. Potential roles of cyclophilins in apoptosis. J Biol
Chem 272(10): 6677-84.
Morishita E, Masuda, S, Nagao, M, Yasuda, Y and Sasaki, R (1997). Erythropoietin
receptor is expressed in rat hippocampal and cerebral cortical neurons, and
erythropoietin prevents in vitro glutamate-induced neuronal death.
Neuroscience 76(1): 105-16.
Muchmore SW, Sattler, M, Liang, H, Meadows, RP, Harlan, JE, Yoon, HS,
Nettesheim, D, Chang, BS, Thompson, CB, Wong, SL, Ng, SL and Fesik, SW
(1996). X-ray and NMR structure of human Bcl-xL, an inhibitor of
programmed cell death. Nature 381(6580): 335-41.
Nagai A, Nakagawa, E, Choi, HB, Hatori, K, Kobayashi, S and Kim, SU (2001).
Erythropoietin and erythropoietin receptors in human CNS neurons, astrocytes,
microglia, and oligodendrocytes grown in culture. J Neuropathol Exp Neurol
60(4): 386-92.
Nakagomi T, Kirino, T, Kanemitsu, H, Tsujita, Y and Tamura, A (1993). Early
recovery of protein synthesis following ischemia in hippocampal neurons with
induced tolerance in the gerbil. Acta Neuropathol (Berl) 86(1): 10-5.
Namura S, Zhu, J, Fink, K, Endres, M, Srinivasan, A, Tomaselli, KJ, Yuan, J and
Moskowitz, MA (1998). Activation and cleavage of caspase-3 in apoptosis
induced by experimental cerebral ischemia. J Neurosci 18(10): 3659-68.
Naruhashi K, Kadomatsu, K, Igakura, T, Fan, QW, Kuno, N, Muramatsu, H,
Miyauchi, T, Hasegawa, T, Itoh, A, Muramatsu, T and Nabeshima, T (1997).
Abnormalities of sensory and memory functions in mice lacking Bsg gene.
127
Biochem Biophys Res Commun 236(3): 733-7.
Nath R, Raser, KJ, Stafford, D, Hajimohammadreza, I, Posner, A, Allen, H, Talanian,
RV, Yuen, P, Gilbertsen, RB and Wang, KK (1996). Non-erythroid alpha-
spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like
protease(s) in apoptotic cells: contributory roles of both protease families in
neuronal apoptosis. Biochem J 319 ( Pt 3): 683-90.
Noguchi CT, Asavaritikrai, P, Teng, R and Jia, Y (2007). Role of erythropoietin in the
brain. Crit Rev Oncol Hematol ((Epub).
Nozaki K, Nishimura, M and Hashimoto, N (2001). Mitogen-activated protein kinases
and cerebral ischemia. Mol Neurobiol 23(1): 1-19.
Palmer C, Vannucci, RC and Towfighi, J (1990). Reduction of perinatal hypoxic-
ischemic brain damage with allopurinol. Pediatr Res 27(4): 332-6.
Park MH, Lee, SM, Lee, JW, Son, DJ, Moon, DC, Yoon, DY and Hong, JT (2006).
ERK-mediated production of neurotrophic factors by astrocytes promotes
neuronal stem cell differentiation by erythropoietin. Biochem Biophys Res
Commun 339(4): 1021-8.
Pera J, Zawadzka, M, Kaminska, B and Szczudlik, A (2004). Influence of chemical
and ischemic preconditioning on cytokine expression after focal brain
ischemia. J Neurosci Res 78(1): 132-40.
Peskin AV, Low, FM, Paton, LN, Maghzal, GJ, Hampton, MB and Winterbourn, CC
(2007). The high reactivity of peroxiredoxin 2 with H(2)O(2) is not reflected in
its reaction with other oxidants and thiol reagents. J Biol Chem 282(16):
11885-92.
Plaisant F, Clippe, A, Vander Stricht, D, Knoops, B and Gressens, P (2003).
Recombinant peroxiredoxin 5 protects against excitotoxic brain lesions in
newborn mice. Free Radic Biol Med 34(7): 862-72.
Prass K, Scharff, A, Ruscher, K, Lowl, D, Muselmann, C, Victorov, I, Kapinya, K,
Dirnagl, U and Meisel, A (2003). Hypoxia-induced stroke tolerance in the
mouse is mediated by erythropoietin. Stroke 34(8): 1981-6.
Pringle AK (2004). In, out, shake it all about: elevation of [Ca2+]i during acute
cerebral ischaemia. Cell Calcium 36(3-4): 235-45.
Qi S, Zhan, RZ, Wu, C, Fujihara, H, Yamakura, T, Baba, H, Taga, K and Shimoji, K
(2001). Sublethal cerebral ischemia inhibits caspase-3 activation induced by
subsequent prolonged ischemia in the C57Black/Crj6 strain mouse. Neurosci
Lett 315(3): 133-6.
128
Qu D, Rashidian, J, Mount, MP, Aleyasin, H, Parsanejad, M, Lira, A, Haque, E,
Zhang, Y, Callaghan, S, Daigle, M, Rousseaux, MW, Slack, RS, Albert, PR,
Vincent, I, Woulfe, JM and Park, DS (2007). Role of Cdk5-mediated
phosphorylation of Prx2 in MPTP toxicity and Parkinson's disease. Neuron
55(1): 37-52.
Rahamimoff H, Elbaz, B, Alperovich, A, Kimchi-Sarfaty, C, Gottesman, MM,
Lichtenstein, Y, Eskin-Shwartz, M and Kasir, J (2007). Cyclosporin A-
dependent downregulation of the Na+/Ca2+ exchanger expression. Ann N Y
Acad Sci 1099: 204-14.
Redell JB, Zhao, J and Dash, PK (2007). Acutely increased cyclophilin a expression
after brain injury: a role in blood-brain barrier function and tissue preservation.
J Neurosci Res 85(9): 1980-8.
Robertson JD, Orrenius, S and Zhivotovsky, B (2000). Review: nuclear events in
apoptosis. J Struct Biol 129(2-3): 346-58.
Rosenzweig HL, Lessov, NS, Henshall, DC, Minami, M, Simon, RP and Stenzel-
Poore, MP (2004). Endotoxin preconditioning prevents cellular inflammatory
response during ischemic neuroprotection in mice. Stroke 35(11): 2576-81.
Rosenzweig HL, Minami, M, Lessov, NS, Coste, SC, Stevens, SL, Henshall, DC,
Meller, R, Simon, RP and Stenzel-Poore, MP (2007). Endotoxin
preconditioning protects against the cytotoxic effects of TNFalpha after stroke:
a novel role for TNFalpha in LPS-ischemic tolerance. J Cereb Blood Flow
Metab. (Epub).
Rubinsztein DC, DiFiglia, M, Heintz, N, Nixon, RA, Qin, ZH, Ravikumar, B, Stefanis,
L and Tolkovsky, A (2005). Autophagy and its possible roles in nervous
system diseases, damage and repair. Autophagy 1(1): 11-22.
Ruscher K, Freyer, D, Karsch, M, Isaev, N, Megow, D, Sawitzki, B, Priller, J, Dirnagl,
U and Meisel, A (2002). Erythropoietin is a paracrine mediator of ischemic
tolerance in the brain: evidence from an in vitro model. J Neurosci 22(23):
10291-301.
Sadamoto Y, Igase, K, Sakanaka, M, Sato, K, Otsuka, H, Sakaki, S, Masuda, S and
Sasaki, R (1998). Erythropoietin prevents place navigation disability and
cortical infarction in rats with permanent occlusion of the middle cerebral
artery. Biochem Biophys Res Commun 253(1): 26-32.
Sahin M, Saxena, A, Joost, P, Lewerenz, J and Methner, A (2006). Induction of Bcl-2
by functional regulation of G-protein coupled receptors protects from oxidative
glutamate toxicity by increasing glutathione. Free Radic Res 40(11): 1113-23.
Sakaki T, Yamada, K, Otsuki, H, Yuguchi, T, Kohmura, E and Hayakawa, T (1995).
Brief exposure to hypoxia induces bFGF mRNA and protein and protects rat
129
cortical neurons from prolonged hypoxic stress. Neurosci Res 23(3): 289-96.
Sakanaka M, Wen, TC, Matsuda, S, Masuda, S, Morishita, E, Nagao, M and Sasaki, R
(1998). In vivo evidence that erythropoietin protects neurons from ischemic
damage. Proc Natl Acad Sci U S A 95(8): 4635-40.
Saver JL, Kidwell, C, Eckstein, M and Starkman, S (2004). Prehospital
neuroprotective therapy for acute stroke: results of the Field Administration of
Stroke Therapy-Magnesium (FAST-MAG) pilot trial. Stroke 35(5): e106-8.
Schabitz WR, Kollmar, R, Schwaninger, M, Juettler, E, Bardutzky, J, Scholzke, MN,
Sommer, C and Schwab, S (2003). Neuroprotective effect of granulocyte
colony-stimulating factor after focal cerebral ischemia. Stroke 34(3): 745-51.
Schipper HM (2007). Oxysterols, cholesterol homeostasis, and Alzheimer disease. J
Neurochem 102(6): 1727-37.
Schlesinger PH and Saito, M (2006). The Bax pore in liposomes, Biophysics. Cell
Death Differ 13(8): 1403-8.
Schweichel JU and Merker, HJ (1973). The morphology of various types of cell death
in prenatal tissues. Teratology 7(3): 253-66.
Seko Y, Fujimura, T, Taka, H, Mineki, R, Murayama, K and Nagai, R (2004).
Hypoxia followed by reoxygenation induces secretion of cyclophilin A from
cultured rat cardiac myocytes. Biochem Biophys Res Commun 317(1): 162-8.
Shen J, Person, MD, Zhu, J, Abbruzzese, JL and Li, D (2004). Protein expression
profiles in pancreatic adenocarcinoma compared with normal pancreatic tissue
and tissue affected by pancreatitis as detected by two-dimensional gel
electrophoresis and mass spectrometry. Cancer Res 64(24): 9018-26.
Sherry B, Yarlett, N, Strupp, A and Cerami, A (1992). Identification of cyclophilin as
a proinflammatory secretory product of lipopolysaccharide-activated
macrophages. Proc Natl Acad Sci U S A 89(8): 3511-5.
Shi Y (2004). Caspase activation, inhibition, and reactivation: a mechanistic view.
Protein Sci 13(8): 1979-87.
Shieh PB, Hu, SC, Bobb, K, Timmusk, T and Ghosh, A (1998). Identification of a
signaling pathway involved in calcium regulation of BDNF expression. Neuron
20(4): 727-40.
Siesjo BK (1992)a. Pathophysiology and treatment of focal cerebral ischemia. Part I:
Pathophysiology. J Neurosurg 77(2): 169-84.
Siesjo BK (1992)b. Pathophysiology and treatment of focal cerebral ischemia. Part II:
Mechanisms of damage and treatment. J Neurosurg 77(3): 337-54.
130
Simon R and Xiong, Z (2006). Acidotoxicity in brain ischaemia. Biochem Soc Trans
34(Pt 6): 1356-61.
Sorimachi H, Ishiura, S and Suzuki, K (1997). Structure and physiological function of
calpains. Biochem J 328 ( Pt 3): 721-32.
Stenzel-Poore MP, Stevens, SL, King, JS and Simon, RP (2007). Preconditioning
reprograms the response to ischemic injury and primes the emergence of
unique endogenous neuroprotective phenotypes: a speculative synthesis. Stroke
38(2 Suppl): 680-5.
Stenzel-Poore MP, Stevens, SL, Xiong, Z, Lessov, NS, Harrington, CA, Mori, M,
Meller, R, Rosenzweig, HL, Tobar, E, Shaw, TE, Chu, X and Simon, RP
(2003). Effect of ischaemic preconditioning on genomic response to cerebral
ischaemia: similarity to neuroprotective strategies in hibernation and hypoxia-
tolerant states. Lancet 362(9389): 1028-37.
Stroke-National Goals Targets and Strategies (1995). www.stroke.org.au
National Insitute of Neurological Disorders and Stroke (NINDS) rt-PA Stroke Study
(1995). Tissue plasminogen activator for acute ischemic stroke. New England
Journal of Medicine 333: 1581-1587.
Sugawara T, Noshita, N, Lewen, A, Kim, GW and Chan, PH (2001). Neuronal
expression of the DNA repair protein Ku 70 after ischemic preconditioning
corresponds to tolerance to global cerebral ischemia. Stroke 32(10): 2388-93.
Sugino T, Nozaki, K, Takagi, Y, Hattori, I, Hashimoto, N, Moriguchi, T and Nishida,
E (2000). Activation of mitogen-activated protein kinases after transient
forebrain ischemia in gerbil hippocampus. J Neurosci 20(12): 4506-14.
Takagi K, Ginsberg, MD, Globus, MY, Dietrich, WD, Martinez, E, Kraydieh, S and
Busto, R (1993). Changes in amino acid neurotransmitters and cerebral blood
flow in the ischemic penumbral region following middle cerebral artery
occlusion in the rat: correlation with histopathology. J Cereb Blood Flow
Metab 13(4): 575-85.
Tanaka M, Kikuchi, H, Ishizu, T, Minohara, M, Osoegawa, M, Motomura, K, Tateishi,
T, Ohyagi, Y and Kira, J (2006). Intrathecal upregulation of granulocyte
colony stimulating factor and its neuroprotective actions on motor neurons in
amyotrophic lateral sclerosis. J Neuropathol Exp Neurol 65(8): 816-25.
Trendelenburg G and Dirnagl, U (2005). Neuroprotective role of astrocytes in cerebral
ischemia: focus on ischemic preconditioning. Glia 50(4): 307-20.
Truettner J, Busto, R, Zhao, W, Ginsberg, MD and Perez-Pinzon, MA (2002). Effect
of ischemic preconditioning on the expression of putative neuroprotective
131
genes in the rat brain. Brain Res Mol Brain Res 103(1-2): 106-15.
Tsai PT, Ohab, JJ, Kertesz, N, Groszer, M, Matter, C, Gao, J, Liu, X, Wu, H and
Carmichael, ST (2006). A critical role of erythropoietin receptor in
neurogenesis and post-stroke recovery. J Neurosci 26(4): 1269-74.
Um M and Lodish, HF (2006). Antiapoptotic effects of erythropoietin in differentiated
neuroblastoma SH-SY5Y cells require activation of both the STAT5 and AKT
signaling pathways. J Biol Chem 281(9): 5648-56.
Um M, Gross, AW and Lodish, HF (2007). A "classical" homodimeric erythropoietin
receptor is essential for the antiapoptotic effects of erythropoietin on
differentiated neuroblastoma SH-SY5Y and pheochromocytoma PC-12 cells.
Cell Signal 19(3): 634-45.
Unal-Cevik I, Kilinc, M, Can, A, Gursoy-Ozdemir, Y and Dalkara, T (2004).
Apoptotic and necrotic death mechanisms are concomitantly activated in the
same cell after cerebral ischemia. Stroke 35(9): 2189-94.
Vaux DL, Cory, S and Adams, JM (1988). Bcl-2 gene promotes haemopoietic cell
survival and cooperates with c-myc to immortalize pre-B cells. Nature
335(6189): 440-2.
Villa P, van Beek, J, Larsen, AK, Gerwien, J, Christensen, S, Cerami, A, Brines, M,
Leist, M, Ghezzi, P and Torup, L (2007). Reduced functional deficits,
neuroinflammation, and secondary tissue damage after treatment of stroke by
nonerythropoietic erythropoietin derivatives. J Cereb Blood Flow Metab 27(3):
552-63.
Wang GL, Jiang, BH, Rue, EA and Semenza, GL (1995). Hypoxia-inducible factor 1
is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension.
Proc Natl Acad Sci U S A 92(12): 5510-4.
Wang GL and Semenza, GL (1995). Purification and characterization of hypoxia-
inducible factor 1. J Biol Chem 270(3): 1230-7.
Wang L, Zhang, Z, Wang, Y, Zhang, R and Chopp, M (2004). Treatment of stroke
with erythropoietin enhances neurogenesis and angiogenesis and improves
neurological function in rats. Stroke 35(7): 1732-7.
Wang Q, Tang, XN and Yenari, MA (2007). The inflammatory response in stroke.
Journal of Neuroimmunology 184(1-2): 53-68.
Wang X, Deng, J, Boyle, DW, Zhong, J and Lee, WH (2004). Potential role of IGF-I
in hypoxia tolerance using a rat hypoxic-ischemic model: activation of
hypoxia-inducible factor 1alpha. Pediatr Res 55(3): 385-94.
132
Won SJ, Kim, DY and Gwag, BJ (2002). Cellular and molecular pathways of ischemic
neuronal death. J Biochem Mol Biol 35(1): 67-86.
Xiong ZG, Chu, XP and Simon, RP (2006). Ca2+ -permeable acid-sensing ion
channels and ischemic brain injury. J Membr Biol 209(1): 59-68.
Xu J, Zhang, QG, Li, C and Zhang, GY (2007). Subtoxic N-methyl-D-aspartate
delayed neuronal death in ischemic brain injury through TrkB receptor- and
calmodulin-mediated PI-3K/Akt pathway activation. Hippocampus 17(7): 525-
37.
Xu M, Meng, W and Ma, X (1995). PDI-, PPI- and chaperone-catalyzed refolding of
recombinant human IL-2 and GM-CSF. Sci China B 38(4): 429-37.
Xu YZ, Ji, Y, Zipser, B, Jellies, J, Johansen, KM and Johansen, J (2003). Proteolytic
cleavage of the ectodomain of the L1 CAM family member Tractin. J Biol
Chem 278(6): 4322-30.
Yanamoto H, Xue, JH, Miyamoto, S, Nagata, I, Nakano, Y, Murao, K and Kikuchi, H
(2004). Spreading depression induces long-lasting brain protection against
infarcted lesion development via BDNF gene-dependent mechanism. Brain Res
1019(1-2): 178-88.
Yang H, Chen, J, Yang, J, Qiao, S, Zhao, S and Yu, L (2007). Cyclophilin A is
upregulated in small cell lung cancer and activates ERK1/2 signal. Biochem
Biophys Res Commun 361(3): 763-7.
Yao J, Taylor, M, Davey, F, Ren, Y, Aiton, J, Coote, P, Fang, F, Chen, JX, Yan, SD
and Gunn-Moore, FJ (2007). Interaction of amyloid binding alcohol
dehydrogenase/Abeta mediates up-regulation of peroxiredoxin II in the brains
of Alzheimer's disease patients and a transgenic Alzheimer's disease mouse
model. Mol Cell Neurosci 35(2): 377-82.
Ye B, Sugo, N, Hurn, PD and Huganir, RL (2002). Physiological and pathological
caspase cleavage of the neuronal RasGEF GRASP-1 as detected using a
cleavage site-specific antibody. Neuroscience 114(1): 217-27.
Yin XH, Zhang, QG, Miao, B and Zhang, GY (2005). Neuroprotective effects of
preconditioning ischaemia on ischaemic brain injury through inhibition of
mixed-lineage kinase 3 via NMDA receptor-mediated Akt1 activation. J
Neurochem 93(4): 1021-9.
Yuan J, Lipinski, M and Degterev, A (2003). Diversity in the mechanisms of neuronal
cell death. Neuron 40(2): 401-13.
133
Zaid H, Abu-Hamad, S, Israelson, A, Nathan, I and Shoshan-Barmatz, V (2005). The
voltage-dependent anion channel-1 modulates apoptotic cell death. Cell Death
Differ 12(7): 751-60.
Zaks-Zilberman M, Zaks, TZ and Vogel, SN (2001). Induction of proinflammatory
and chemokine genes by lipopolysaccharide and paclitaxel (Taxol) in murine
and human breast cancer cell lines. Cytokine 15(3): 156-65.
Zha J, Harada, H, Yang, E, Jockel, J and Korsmeyer, SJ (1996). Serine
phosphorylation of death agonist BAD in response to survival factor results in
binding to 14-3-3 not BCL-X(L). Cell 87(4): 619-28.
Zhan R, Wu, C, Fujihara, H, Taga, K, Qi, S, Naito, M and Shimoji, K (2001). Both
caspase-dependent and caspase-independent pathways may be involved in
hippocampal CA1 neuronal death because of loss of cytochrome c From
mitochondria in a rat forebrain ischemia model. J Cereb Blood Flow Metab
21(5):529-40
Zhan RZ, Fujihara, H, Baba, H, Yamakura, T and Shimoji, K (2002). Ischemic
preconditioning is capable of inducing mitochondrial tolerance in the rat brain.
Anesthesiology 97(4): 896-901.
Zhang F, Wang, S, Cao, G, Gao, Y and Chen, J (2007). Signal transducers and
activators of transcription 5 contributes to erythropoietin-mediated
neuroprotection against hippocampal neuronal death after transient global
cerebral ischemia. Neurobiol Dis 25(1): 45-53.
Zhang HX, Du, GH and Zhang, JT (2003). Ischemic pre-conditioning preserves brain
mitochondrial functions during the middle cerebral artery occlusion in rat.
Neurol Res 25(5): 471-6.
Zhao X, Bausano, B, Pike, BR, Newcomb-Fernandez, JK, Wang, KK, Shohami, E,
Ringger, NC, DeFord, SM, Anderson, DK and Hayes, RL (2001). TNF-alpha
stimulates caspase-3 activation and apoptotic cell death in primary septo-
hippocampal cultures. J Neurosci Res 64(2): 121-31.
Zhou S, Zhou, H, Walian, PJ and Jap, BK (2005). CD147 is a regulatory subunit of the
gamma-secretase complex in Alzheimer's disease amyloid beta-peptide
production. Proc Natl Acad Sci U S A 102(21): 7499-504.
Zhu C, Wang, X, Deinum, J, Huang, Z, Gao, J, Modjtahedi, N, Neagu, MR, Nilsson,
M, Eriksson, PS, Hagberg, H, Luban, J, Kroemer, G and Blomgren, K (2007).
Cyclophilin A participates in the nuclear translocation of apoptosis-inducing
factor in neurons after cerebral hypoxia-ischemia. J Exp Med 204(8): 1741-8.
Zipser BD, Johanson, CE, Gonzalez, L, Berzin, TM, Tavares, R, Hulette, CM, Vitek,
MP, Hovanesian, V and Stopa, EG (2007). Microvascular injury and blood-
brain barrier leakage in Alzheimer's disease. Neurobiol Aging 28(7): 977-86.