1

Identification of Cellular Components Interacting with the Shiga-like Toxin 1 A1 Chain (SLT-1 A1)

By

Wei Wei

A thesis submitted in conformity with the requirements for the degree of Master’s of Science Graduate Department of Pharmaceutical Sciences,

University of Toronto

©Copyright by Wei Wei, 2012

ii

Identification of Cellular Components Interacting with the Shiga-like Toxin 1 A1 chain (SLT-1 A1)

Wei Wei Master’s of Science

Department of Pharmaceutical Sciences University of Toronto

Abstract

Shiga-like toxin 1 (SLT-1) is produced by Escherichia coli strains like the

pathogenic strain O157:H7. These bacterial strains are responsible for worldwide cases

of food poisoning and water contamination, and the toxin is a major cause of

hemorrhagic colitis and the hemolytic uremia syndrome. SLT-1 is defined as a type II

ribosome-inactivating protein (RIP) and belongs to a family of plant and bacterial AB

toxins. The A1 chain blocks protein synthesis in eukaryotic cells by depurinating a single

adenine base in 28S rRNA. The mechanisms by which the A chain of SLT-1 interacts

with the host components to route itself to the cytosol remains largely unknown. This

thesis project identified a list of putative cellular proteins that interact with the SLT-1 A1

chain by the use of yeast-2-hybrid (Y2H) screens and HeLa lysate pull down/mass

spectrometry analyses. Further assessment of the top 8 host interactors did not yield

true interactions.

iii

Acknowledgements

First and foremost, I would like to give my extended thanks to my supervisor and

mentor Dr. Jean Gariépy for providing me a great opportunity to work in his laboratory

for the past 2 and half years. I thank him for his patience, direction and expertise that

has guided me throughout my research project. I appreciate his assistance, advice,

patients and knowledge in both my experiments and the process of writing this thesis.

I would also like to thank both of my advisory committee members Dr. Ian

Crandall and Dr. Walid. A Houry for keeping me on track and provide integral advice

with respect to the best path for my research to follow. I am also very appreciative of

their time and support.

Many present and past members of the Gariépy lab have greatly contributed to

this project: Andrew, Melissa, Eric, Nenad, Nick, Arshiya and Caitlin. I would like to give

special thanks to Dr. Andrew McCluskey, who has helped me initiate the project. His

wise knowledge, technical advice and support has guided me through my graduate

studies.

Last but certainly not least, I would like to extend great thanks to my family for

supporting me throughout my time as a graduate student and not let me forget who I

am.

iv

Table of Contents

Chapter 1: Introduction .................................................................................................... 1

1.1 Protein toxins ......................................................................................................... 1

1.1.1 Single-chain protein toxins versus multi-subunit protein toxins ....................... 1

1.1.2 Receptor specificity and mode of entry of important catalytically active protein toxins into cells ......................................................................................................... 2

1.2 Enzymatic activity and their host targets ................................................................ 4

1.3 Ribosome-inactivating proteins (RIPs) ................................................................... 5

1.4 Shiga-like Toxin 1 and its clinical impact ............................................................. 10

1.5 Structure and function of Shiga-Like Toxin 1 ....................................................... 10

1.6 Intracellular routing of Shiga-like Toxin I .............................................................. 15

1.6.1 Receptor binding ........................................................................................... 15

1.6.2 Internalization ................................................................................................ 15

1.6.3 Retrograde transport ..................................................................................... 15

1.6.4 Retrotranslocation from the ER lumen to the cytosol .................................... 16

1.6.5 Ribosome docking and inactivation ............................................................... 17

1.7 Project goal .......................................................................................................... 18

Chapter 2: Methods and Materials ................................................................................ 21

2.1. Yeast-2-Hybrid .................................................................................................... 21

2.1.1 Introduction ................................................................................................... 21

2.1.2 Construction of an SLT-1 A1 bait plasmid ...................................................... 23

2.1.3 Transformation of the bait plasmid into the yeast strain AH109 .................... 23

2.1.4 Y2H screen to identify cellular proteins that interact with SLT-1 CIA1 ........... 24

2.2 expression and purification of recombinant proteins ............................................ 25

2.2.1 Expression of His-tagged SLT-1 and isolation of the His-tagged A1 chain .... 25

2.2.2 Expression of a recombinant His-tagged eGFP ............................................ 26

2.3 HeLa cell lysate pull down of putative cell protein interaction .............................. 27

2.4 Mass spectrometry and analysis of putative protein interactions ......................... 28

2.5 Analyzing possible protein interactions identified by Y2H screens ...................... 29

2.6 Analysis of putative hits identified in the HeLa cell lysate pull down/MS experiment................................................................................................................................... 30

Chapter 3: Results......................................................................................................... 36

3.1 Identification of eukaryotic cellular components that interact with SLT-1 A1 by Y2H screen ........................................................................................................................ 36

3.1.1 Construction and expression of GAL4 DNA-BD CIA1 fusion protein in yeast 36

3.1.2 Testing for autonomous activation ................................................................ 37

3.1.3 Potential interactors identified by Y2H screen ............................................... 37

3.2 Confirming catalytic activity of wild-type SLT-1 A1 ............................................... 43

3.3 Mass spectrometry identification of eukaryotic cellular components interacts with SLT-1 A1 .................................................................................................................... 43

3.3.1 Purification of His-tagged recombinant SLT-1 and eGFP ............................. 43

3.3.2 List of putative proteins determined by HeLa cell lysate pull down ............... 47

Chapter 4: Conclusion, Discussion and Future Directions ............................................ 54

4.1 Summary of Y2H results ...................................................................................... 54

4.2 Discussion of Y2H Results .................................................................................. 54

4.2.1 False positives .............................................................................................. 54

v

4.2.2 False negatives ............................................................................................. 56

4.3 Summary of HeLa cell lysate pull down/MS ......................................................... 57

4.4 HeLa cell lysate pull down/MS Discussion ........................................................... 57

4.5 Future directions .................................................................................................. 58

4.5.1 Enrichment of non-ribosomal binding partners .............................................. 58

4.5.2 Utilizing a dual-tag purification approach to generate more sensitive and specific results........................................................................................................ 59

4.5.3 Performing a lentiviral RNAi screen .............................................................. 59

5.0 References .............................................................................................................. 62

vi

Abbreviations ALA Alanine

ARG Arginine

CaM Calmodulin

cAMP 3’,5’-cyclic AMP

CARB Carbenicillin

CIA1 Catalytically-inactive SLT-1 A1 chain

CID Collision-induced dissociation

CT Cholera Toxin

DT Diphtheria Toxin

E.coli Escherichia coli

EDTA Ethylenediaminetetraacetic acid

EF Elongation factor

eGFP Green fluorescent protein

ER Endoplasmic reticulum

ERAD Endoplasmic reticulum-associated degradation

FBS Fetal bovine serum

GAL Galactose

GAL4 AD GAL4 Activation domain

GAL4 DNA-BD GAL4 DNA-binding domain

HiCam 6xHis-calmodulin tandem-purification tag

HIS Histidine

vii

His-tag Polyhistidine purification tag

HPLC High performance liquid chromatography

HUS Haemolytic uremic syndrome

IPTG Isoprpyl-beta-D-thiogalactopyranoside

LiAC lithium acetate

LC-MS/MS Liquid chromatography-tandem mass spectrometry

LEU leucine

LT Heat-labile enterotoxin

MS Mass spectrometry

Ni-NTA Nickel-nitrilotriacetic acid

PBS Phosphate-buffered saline

PCR Polymerase chain reaction

RPLP1 Ribosomal protein P1

PT Pertussis toxin

RIP Ribosome-inactivating protein

RNA Ribonucleic acid

rRNA Ribosomal RNA

SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis

SLT-1 Shiga-like toxin 1

SRL Sarcin-ricin loop

STxs Shiga toxins

TCEP 1,2,3-tris(2-cyanoethoxy)propane

TnT Transcription and translation

viii

TRP Trypthophan

Y2H Yeast-2-hybrid

ix

List of Tables Table1.1 Summary of common structural and functional features of enzyme-based protein toxins ……………………………………………………………………………..……..7 Table 2.1 Sense and anti-sense primers used to clone the full-length gene of positive hits from both Y2H and HeLa lysate pull-down into pGADT7 vector…………………….35 Table 3.1 Yeast-two-hybrid screen identified protein fragments extracted from human kidney cells associated with the A1 chain of SLT-1……………………………………......41 Table 3.2 Proteins that were selected for further analysis from the Y2H screen. Table 3.3 List of proteins deduced from the MS sequencing data……………………….51

x

Table of Figures Figure 1.1 General mechanism of ADP-ribosylation of proteins.......................................7 Figure 1.2 Amino acid sequence alignments of three common RIPs……………………..8 Figure 1.3 The catalytically active chains of 3 types of N-glycosidase RIPs presented as ribbon structures………………………………………………………………………………...9 Figure 1.4 Linear representation of SLT-1 subunits…………………………………….....12 Figure 1.5 Surface overlays of SLT-1 A1 domain highlighting residues associated with specific functions………………………………………………………………………………13 Figure 1.6 Ribbon structure of Shiga toxin………………………………………………….14 Figure 1.7 Routing of SLT-1 into eukaryotic cells expressing Gb3………………….……19 Figure 1.8 Surface overlay of the dog 60S ribosome subunit highlighting the sarcin-ricin loop………………………………………………………………………………………….......20 Figure 2.1 Yeast-2-hybrid Methodology………………………………………………….….22 Figure 2.2 pGBKT7 bait vector with restriction map and multiple cloning site (MCS)....32 Figure 2.3 Reporter constructs in the AH109 yeast strain………………………………...33 Figure 2.4 HeLa cell Lysate pull-down assay………………………………………………33 Figure 2.5 pGADT7 prey vector with restriction map and MCS……………………….....34 Figure 3.1 Expression of the SLT-1 CIA1 GAL4 DNA-BD fusion in the yeast strain AH109………………………………………………………………………………………..…39 Figure 3.2 SLT-1 CIA1 does not autonomously activate reporter genes in yeast………39 Figure 3.3 Yeast-2-Hybrid library transformation and screening…………………………40 Figure 3.4 Validation of interactions between SLT-1 CIA1 and five potential binding partners………………………………………………………………………………………....44 Figure 3.5 In vitro catalytic activity assay indicating the wild-type SLT-1 A1 chain blocks protein synthesis………………………………………………………………………….……45 Figure 3.6 An SDS-PAGE of His-tagged eGFP and His-tagged SLT-1 A1 proteins purified using Ni-NTA beads as described in Chapter 2.2.1………………………………46 Figure 3.7 HeLa lysate pull-down/MS results………………………………………………49 Figure 3.8: HeLa lysate pull-down/MS analysis of HeLa cell proteins that associated with the A1 chain of SLT-1……………………………………………………………...…….50 Figure 3.9 Ni-NTA pull-down showed no interaction between SLT-1 A1 and eEF1A1, AHA1, MRCL3, HSPB1 and ACTC1………………………………………………...………52 Figure 3.10 Confirmation of results generated by the Hela lysate pull down using Y2H………………………………………………………………………………...……………52 Figure 4.1 Methodology for the Lentiviral RNAi screen……………………………………61

xi

List of Appendix Appendix A: Sequences encode for protein interactors identified in initial Y2H screen …………………………………………………………………………………………………71 Appendix B: List of protein interactors identified in the HeLa cell lysate pull down/mass spectrometry screen…………………………………………………………………………77

1

Chapter 1: Introduction

1.1 Protein toxins

Protein toxins are naturally produced by a wide range of animal and plant

species. They vary in structure, function, intracellular targets, as well as, their

mechanism of intracellular routing (direct deposit in the cytosol or retrograde transport)

giving rise to a broad number of pathologies and symptoms in both humans and

animals [Zhou, et al., 1994; Savion et al., 2000]. A large group of protein toxins, termed

type II ribosome-inactivating proteins (RIPs), cause cell death by catalytically

inactivating or altering a cellular component involved in protein synthesis [Endo et al.,

1988]. Their mode of cellular intoxication requires three cellular events;(I) their

internalization into a host cell typically following their binding to a surface marker, (II)

their intracellular routing to the cytosol exploiting cellular pathways and host

components, and (III) their catalytic activity leading to the inactivation of protein

synthesis. The focus of my thesis project was to study how Shiga-like toxin 1 (SLT-1), a

type II ribosome-inactivating protein toxin, is able to route itself to the cytosol of

eukaryotic cells near ribosomes.

1.1.1 Single-chain protein toxins versus multi-subunit protein toxins

Catalytically-active protein toxins are either composed of a single polypeptide or

assembled from typically 2 distinct subunits, specifically an enzyme-containing domain

physically linked or non-covalently attached to a receptor-binding domain. These toxins

also code for other functional motifs that are essential for their internalization, routing

2

and processing in eukaryotic cells. Diphtheria toxin (DT) produced by Corynebacterium

diphtheriae and Pseudomonas aeruginosa Exotoxin A (ETA) are examples of single

chain protein toxins, where their catalytic domain is covalently bound to the receptor-

binding domain [Collier et al., 1975; Pappenheimer et al., 1993].

Many Bacterial toxins are multi-subunit proteins composed of two separate

protein subunits, where the catalytically-active A chain is bound to a single receptor

binding B subunit (AB) or multiple receptor-binding B subunits (AB5). The Heat-labile

enterotoxins (ET) as well as Cholera toxin (CT), Shiga and Shiga-like toxins are

examples of AB5 toxins that carry five identical B subunits [Merritt and Hol., 1995].

1.1.2 Receptor specificity and mode of entry of important catalytically active protein toxins into cells

The receptor binding subunit of protein toxins generally recognizes specific

markers located on the surface of susceptible cells, and the resulting toxin-receptor

complexes are internalized and routed through vesicular compartments. For example,

the receptor-binding domain of ETA recognizes the α2-macroglobulin receptor (A2MR)

also known as low density lipoprotein receptor-related protein (LRP) [Kounnas et al.,

1992]. The receptor-binding subunit of DT interacts with a membrane-achored form of

the heparin-binding, EGF-like growth factor leading to receptor-mediated endocytosis

[Naglich et al., 1992; Iwamoto et al., 1994]. The lectin-like, pentameric receptor-binding

B subunit of Cholera toxin (CT) binds to the ganglioside GM1 [Heyningen et al 1974],

while the pentamer of B subunits of Shiga and Shiga-like toxin 1 [SLT-1] recognize the

glycolipid globotriaosylceramide (CD77, Gb3) [Jacewicz et al., 1986; Lindberg et al.,

1987; Lingwood et al., 1987].

3

Endocytosed toxin-receptor complexes reach their substrates by at least two

mechanisms. The first mechanism deposits their catalytic domain into the cytosol via

endosomal escape. This is the case for DT, endocytosed DT/receptor complex induces

the formation of pores in the endosomal membrane due to conformational change in DT

triggered by the acidic pH of the endosome. Its catalytic A chain can pass through

membrane pores into the cytosol where it can act on their targets [London, 1992; Ren et

al., 1999].

A second more common mechanism of routing catalytically-active protein

toxins is retrograde transport from endosomes to Golgi apparatus, endoplasmic

reticulum before reaching their cytosolic targets [Sandvig and Van Deurs., 1994;

Sandvig and Van Deurs., 2002]. This mechanism of retrograde transport was proposed

following experiments making use of organelle trafficking inhibitors such as brefeldin A

(BFA), a molecule that blocks intracellular protein trafficking between the ER and the

Golgi apparatus by disrupting the functional structure of the Golgi apparatus [Sandvig et

al., 1994]. BFA-treated cells were less sensitive to the action of such toxins, suggesting

that they were less able to undergo retrograde routing from the Golgi apparatus to the

ER which limited their eventual access to the cytosol from the ER lumen [Sandvig et al.,

1991]. A number of protein toxins including Shiga toxin, ricin, CT and ETA appear to

function via this routing mechanism [Hudson and Grillo., 1991; Yoshida et al., 1991;

Orlandi et al., 1993; Donta et al., 1995]. Some of these protein toxins such as ETA and

CT also contain a C-terminal KDEL sequence at the C-terminus of their catalytic domain

that binds to the KDEL receptor located in the Golgi apparatus and allows for the

retrieval on the catalytic domain to the ER lumen [Jackson et al., 1999; Lencer et al.,

4

1995;]. It has been shown that the cytotoxicity of ricin can be significantly increased by

adding a KDEL sequence to the C-terminus of its A subunit [Wale et al.,1992].

1.2 Enzymatic activity and their host targets

The cellular targets of enzyme-based protein toxins have been shown to range

from G-proteins to elongation factors and ribosomal RNA, based on the structures of

different classes of enzymes-based toxins (Table 1.1). ADP-ribosyltransferases function

by modifying a specific amino acid within their target (Figure 1.1). For example, cholera

toxin, produced by Vibrio cholera as does the E.coli heat-labile enterotoxin, modifies a

conserved arginine residue at position 123 on the Gαs subunit of the heterotrimeric G

protein, leading to an increase in the levels of intracellular cAMP. This signaling event

promotes the secretion of fluid and electrolytes into the intestinal lumen causing watery

diarrhea [spangler et al., 1992; Zhu et al., 1995]. Pertussis toxin produced by Bordetella

pertussis, however, ADP ribosylates a specific cysteine at position 347 of the αi subunit

of a heterotrimeric G protein complex, which blocks its interaction with G-protein

coupled receptor, resulting in the uncontrolled activation of adenyl cyclase. This

modification leads to an increased level of cAMP within the cell, which in turn increases

the secretion of insulin that causes the symptoms associated with whooping cough

[Katada et al., 1983; Moss et al., 1983; West et al., 1985]. ETA, a bacterial toxin

expressed by Pseudomonas aeruginosa, ADP-ribosylates the elongation factor 2 (EF-2)

through a modification of a unique diphthamide residue at position 715. This

modification blocks protein synthesis, resulting in cell death [Allured et al., 1986;

5

Taupiac et al., 1999; Webb et al., 2008].Cytotoxic ribonucleases, such as α-sarcin

produced by Aspergillus giganteus, are nucleases that catalyze the degradation of RNA

into smaller components. For instance, α-sarcin cleaves naked 28SrRNA at the specific

sequence (UAGUACGAGAGGAAC) therefore the ribosome split into small fragment (α-

fragment) from the large RNA of 60S ribosomal subunit by hydrolysis a single

phosphodiester between G4325 and A4326 within the sarcin-ricin loop of 28S ribosomal

RNAs. This selective RNA cleavage event inhibits the binding of elongation factor

ternary complex, namely elongation factor 1(EF-1) GTP aminoacyl-tRNA to ribosomes,

as well as the binding of EF-2.GTP to such modified ribosomes, therefore blocking

protein synthesis [Endo and Wool., 1982; Brigotti et al., 1989].

Shiga toxins, including SLT-1and the plant toxin ricin, are examples of

ribosome-inactivating proteins (RIPs) that function as N-glycosidases. These enzymes

depurinate an adenine base at position 4324 in the 28S rRNA within the sarcin-ricin

loop, leading to the blockage of protein synthesis [Montanaro et al., 1975; Brigotti et al.,

1989]. SLT-1 represents the focus of my thesis work and the following section will

further discuss the mechanism of action of RIPs.

1.3 Ribosome-inactivating proteins (RIPs)

Ribosome-inactivating proteins (RIPs) are toxins secreted by plants or

pathogenic strains of bacteria that block protein synthesis and eventually lead to cell

death. The focus of this thesis is on RIPs that function as N-glycosidases. They are part

of a large number of proteins displaying a similar catalytic fold (referred to as A or

6

A1chains). Based on their three dimensional structure, RIPs can be further divided into

three different classes: Type I, II and III. Saporins, produced by Saponaria officinalis,

are an example of type I RIPs, comprising a single enzymatic polypeptide chain with the

folding motif common to all N-glycosidase A chains [Montfort et al., 1987; Savino et al.,

2000; Sikriwal et al., 2008] but lack a receptor-binding subunit. Type II N-glycosidase

RIPs usually consist of a catalytic A chain associated with a receptor-binding B subunit

such as Shiga toxin, SLT-1 and ricin [LaPointe et al., 2005; Sandvig and Van Deurs.,

1994]. Type III RIPs exemplified by ribosome-inactivating proteins (MODs) are

synthesized as inactive precursors that require the proteolytic removal of an internal

fragment in order to be active [Hey et al., 1995]. More importantly, RIP N-glycosidases

display a low level of amino acid homology. However, the essential catalytic residues

(From SLT-1: Tyr-77, Tyr-114, Glu-167, Arg-170, and Trp-203) involved in the

depuration event are highly conserved for all three classes of RIPs (Figure 1.2).

Importantly, the tertiary structures of their common catalytic domain are superimposable

(Figure 1.3).This common mode of action and structure suggest that an understanding

of the routing mechanism of one such N-glycosidase may provide insight into other

family members of this class of RIPs.

7

Figure 1.1: General mechanism of ADP-ribosylation of proteins. The ADP-ribosyltransferase transfers the ADP-ribose group from nicotinamide adenine dinucleotide (NAD+) onto an on acceptor protein (specific residues are indicated in Table 1.1) yielding an ADP-ribosylated protein.

Table1.1Summary of common structural and functional features of enzyme-based protein toxins.

8

Figure 1.2: Amino acid sequence alignments of RIPs from three different classes. The primary amino acid sequence of the type I RIP saporin (Genbank accession no., GI:21321) is compared to that of type II RIP SLT-1 A chain ( Genbank accession no., GI:49258644), and type III Maize RIP ( Genbank accession no., GI:162461916). The conserved catalytic residues are highlighted in red [Adopted from McCluskey PhD thesis, 2010].

9

Figure1.3 The catalytically active chains of 3 types of N-glycosidaseRIPs presented as ribbon structures. Saporin, aType I RIP, is presented in magenta (PDB# 1QI7), while the A chain of the Type II RIP SLT-1 is colored green (PDB# 1DMQ). The Type III RIP Maize is depicted in blue (PDB# 2K6H). The merged image of all three RIP ribbon structures (lower image) emphasizes the common fold adopted by these N-glycosidases. The amino acid alignment of the toxin’s A chains is presented in Figure 1.2.

10

1.4 Shiga-like Toxin 1 and its clinical impact

SLT-1 is produced by enterohemorrhagic Escherichia coli strains such as

O157:H7 [Ling et al., 1998].These bacterial strains are responsible for world-wide cases

of food poisoning and water contamination [Karch et al., 1993]. Studies have reported

that 100,000 estimated cases of O157:H7 infections occur in North America annually.

Such infections can progress to hemorrhagic colitis, which is type of gastroenteritis

leads to bloody diarrhea and abdominal cramps and approximately 10% of cases leads

to hemolytic uremic syndrome (HUS), which is a disorder in the digestive system

produce toxic substance that destroy red blood cell and cause kidney failure [O’Brien et

al., 1984; Karmali et al., 1985; Marques et al., 1986; Kovacs et al., 1990; Scheiring et

al., 2008]. In addition, 2.7-5.7% of children with HUS die from this syndrome and about

25% of them with HUS will suffer long-term renal damage and failure [Riley et al., 1987;

Karmali et al., 1989; Rowe et al., 1991]. The long-term treatment and care of HUS

patients is thus costly. Although inhibitors of SLT-1 such as antibiotics and

oligosaccharide conjugates have been developed, they have not proven useful in

clinical trials [Scheiring et al., 2008]. The recent use of manganese to protect against

SLT-1 toxicity appears promising [Mukhopadhyay, S and Linstedt. A.D, 2012]. However,

there is an urgent need to develop new effective therapies able to treat patients infected

with Shiga toxin-producing bacteria. [Cimolai et al., 1990; Walterspielet al.,1992].

1.5 Structure and function of Shiga-Like Toxin 1

Shiga toxin and SLT-1 are identical in their structure with the exception of one

amino acid (Ser45 vs Thr45) within the catalytic A chain [Strockbine et al., 1988]. As

11

stated in section 1.3, SLT-1 is defined as a type II RIP and is a member of the ABfamily

of protein toxins. It is comprised of two functional domains: a cytotoxic A chain (32kDa;

293 amino acids) non-covalently associated with a pentamer of B subunits (each of 7.7

kDa; 69 amino acids). The A chain is processed by furin into an A1 (27 kDa; 251amino

acids) and an A2 fragment (4.6 kDa; 42 amino acids) (Figure 1.4). [O’Brien et al., 1992;

Kozlov et al., 1993; Fraser et al., 1994; Garred et al., 1995]. The A1 chain is an N-

glycosidase that cleaves a specific adenine base in the 28SrRNA of the 60S ribosomal

subunit. As mentioned earlier, the Key residues Tyr-77, Tyr-114, Glu-167, Arg-170 and

Trp-203of the A1 chain are essential for its catalytic function. Others residues (Ile-239,

Leu-240, Asn-241 and Cys-242) [Lapointe et al., 2005; McCluskey et al., 2008] are

involved in retrotranslocation of A1 chain from the ER lumen to the cytosol. In addition,

its Arg-179, Arg-172, Arg-176, Arg-188, Tyr-190, Tyr-191 and Leu-233 are associated

with ribosome docking [McCluskey et al., 2012] (Figure 1.5). The A2 chain is inserted

into the central pore created by the pentameric arrangement of B subunits (Figure 1.6)

[Austin et al., 1994]. Each B subunit consists of antiparallel β sheets and α helices. A

cleft is created by adjacent β strands on the horizontal plane of the pentamer opposite

to the A2 chain insertion plane. This cleft represents a carbohydrate-binding motif that

is recognized by the glycolipid receptor, globotriaosylceramide (Gb3, CD77) present on

susceptible cells. Toxin-glycolipid complexes are internalized by intoxicated cells

(Figure 1.7) [Jacewicz et al., 1986; O’Brien et al 1992].

12

Figure 1.4 Linearrepresentation of SLT-1 subunits. The A chain of SLT-1 is composed of a catalytic A1 chain (amino acids 1-251) highlighted in grey and an A2 chain (amino acids 252-293; in orange) linked non-covalently to a pentamer of B-subunits (69 residues, in yellow).The A1 and A2 fragments are generated by the furin cleavage of the A chain between residues 251 and 252. The toxin’s A1 and A2 fragments subunits remain linked together through a single disulfide bond in the A chain involving cysteine 242 and 261[Garred et al., 1995]

13

Figure 1.5 Surface overlays of SLT-1 A1 domain highlighting residues associated with specific functions. The catalytic residues are colored in red (Tyr-77, Glu-114, Glu-167, Arg-170 and Trp-203) [Hovde et al., 1988; Yamasaki et al., 1991;Deresiewicz et al., 1992; Deresiewicz et al., 1993] while residues critical for retrotranslocation from the ER lumen to the cytosol are in green (Ile-239, leu- 240, Asn- 241 and Cys242). Residues in blue (Arg-179, Arg-172, Arg-176, Arg-188, Tyr-190, Tyr-191, Leu-233) have been associated with docking of the A1 chain to the ribosomal stalk [McCluskey et al.,2012].

14

Figure 1.6 Ribbon structure of Shiga toxin. Shiga toxin (ShT, from Shigella dysenteriae) and Shiga-like Toxin 1 (SLT-1) (from enterohemorrhagic E. coli) haveidentical A and B subunits. Panel A illustrates the catalytic A domain (in blue grey) of ShT/SLT-1 non-covalently associated with a pentamer of identical B-subunits (yellow β-sheet,green and red). The ribbon structure of the B subunit pentamer alone [Panel B] emphasizes the presence of a central pore, where the A2 chain of ShT/SLT-1 is normally inserted to link the A domain to its B pentamer [Fraser et al., 1994].

15

1.6 Intracellular routing of Shiga-like Toxin I

1.6.1 Receptor binding

The B-subunit of SLT-1 recognizes and binds to globotriaosylceramide [Gb3,

CD77] molecules located on the surface of susceptible cells (Figure 1.7). Receptor

studies have indicated that the terminal Galα (1-4) Galβ disaccharide of Gb3 is a key

determinant recognized by the B subunit pentamer. The crystal structure of a B subunit

in a complex with a Gb3 analog have identified 3 potential binding sites for the sugar

analog per monomer of B subunit [Bast et al., 1999]. However, an NMR study of the

complex has revealed that only one of these three putative sites has proven relevant

[Thompson et al., 2000].

1.6.2 Internalization

The toxin-receptor complex has been shown to be endocytosed (Figure 1.7)

[Jacewicz et al., 1986; Lindberg et al., 1987; Lingwood et al., 1987] along a clathrin-

dependent pathway [Torgersen et al., 2005]. A more recent study has shown that SLT-1

can also undergo clathrin-independent endocytosis. This later study revealed that the B-

subunit of SLT-1 can induce lipid reorganization that facilitates tubular membrane

invagination through reconstitution of tubular formation on giant unilamellar vesicles

(GUVs) for its uptake into cells [Romer et al., 2007]

16

1.6.3 Retrograde transport

The internalized toxin-receptor complex has been shown to undergo retrograde

transport through the Golgi apparatus and subsequently to the endoplasmic reticulum

(ER) lumen. As previously mentioned, the retrograde transport step was postulated from

the use of Brefeldin A and electron microscopy [Sandvig et al., 1994]. In the Golgi

compartments, SLT-1 undergoes limited proteolysis by furin, generating A1 and A2

chains that remain linked together by a single disulfide bridge between cysteine 242 and

261 [Garred et al., 1995; Lea et al., 1999]. The processed toxin subsequently reaches

the reductive environment in the ER lumen where the disulfide bridge is reduced and

the catalytic A1 fragment dissociates from the A2B5 complex (Figure 1.7) [Saleh et al.,

1996; LaPointe et al., 2005].

1.6.4 Retrotranslocation from the ER lumen to the cytosol

The exact mechanism by which the A chain of this RIP toxin escapes from the

ER lumen remains unclear. Since N-glycosidase RIP toxins do not have an intrinsic

ability to cross membranes, it was initially suggested that retrotranslocation of their

catalytic domain from the ER lumen to the cytosol required interactions with host

components [Vembar and Brodsky, 2008]. Earlier studies on other protein toxins such

as ricin and cholera toxin suggested that they underwent retrograde transport to the

cytosol by displaying their catalytic domains as misfolded proteins in the ER lumen. The

proposed relocation mechanism involved interactions with molecular chaperones such

as BiP as well as the translocon Sec61 and HEDJ (ER-residence molecule recruits

misfolded protein to Sec61) [Linnik et al., 1998; Meunier et al., 2002; Yu and Haslam,

2005]. It is believed that the retrotranslocation event is the result of A and A1 toxin

17

chains exploiting the endoplasmic reticulum-associated degradation (ERAD) pathway

through the discovery of ER degradation enhancing α-mannosidase I-like protein

(EDEM).This mechanism is normally used to export misfolded proteins out of the ER

lumen to the cytosol, leading to protein degradation by the 26S proteasome [Brodsky

and McCracken, 1999; Perlmutter., 1999; Romisch., 1999; Teter and Holmes., 2002]. It

is postulated that SLT-1 and most other RIPs have an ability to mimic the structure of

misfolded proteins and use the ERAD pathway for retrotranslocation. In the case of

SLT-1, residues 240-251 are essential for the ER-to-cytosol retrotranslocation event

[LaPointe et al., 2005].

However, in the cytosol, the A1 chain has to be catalytically active with an

intracellular half-life that is sufficiently long to inactivate a large portion of eukaryotic

ribosomes leading to the blockage of protein synthesis. In other words, the A1 chain

cannot be readily cleaved by the proteasome. The A chains of ER-routed toxins

including SLT-1 have thus evolved their primary sequence to contain a low number of

lysines which limit their ubiquitination and thus to avoid degradation by the proteasome

[Hazes and Read, 1997; Deeks et al., 2002; Worthington and Carbonetti., 2007].

1.6.5 Ribosome docking and inactivation

After the A1 chain enters the cytosol, it docks onto the ribosome and

depurinates a single adenine base (A4324) in the sarcin-ricin loop (SRL) of 28S rRNA

[Endo et al., 1987; Endo et al., 1988; Brigotti et al., 1997; McCluskeyet al., 2008]. These

events result in the inhibition of protein synthesis and eventually cell death. A model of

how the 28S rRNA sarcin-ricin loop interacts with other ribosomal components is

presented in Figure 1.8. A detailed mechanism leading up to the depurination event

18

remains unclear/undefined, but is known to involve the docking of the SLT-1 A1 chain to

the ribosomal stalk via a conserved C-terminal peptide present in all 3 stalk proteins

(RPLP0, PRLP1 and RPLP2) [McCluskey et al., 2008]. The docking event may re-

orient the A1 chain to present its catalytic site to the sarcin-ricin loop (Figure 1.8).

1.7 Project goal

The overall goal of my thesis project was to identify non-ribosomal host

components involved in the cellular routing of SLT-1 that interact with the A1 chain of

SLT-1. In order to achieve this, I utilized two techniques: yeast-2 hybrids (Y2H)

screening strategy, as well as a HeLa cell lysate pull down approach followed by mass

spectrometry. Y2H screens were performed with a catalytically inactive A1 chain variant

of SLT-1 (CIA1) to ensure its non-lethal expression in yeast. The HeLa cell lysate pull

down/MS approach utilized a catalytically-active, His-tagged form of the SLT-1 A1 chain

coupled to Ni-NTA beads to retrieve intracellular host proteins that interacted with SLT-1

A1.

19

Figure 1.7 Routing of SLT-1 into eukaryotic cells expressing Gb3.The B pentamer of SLT-1 binds to surface Gb3 molecules, leading to the internalization of the toxin-receptor complex by endocytosis. The toxin then undergoes retrograde transport through the Golgi apparatus to the endoplasmic reticulum (ER) lumen. In the Golgi apparatus, the protease-sensitive loop located in the A domain of SLT-1 is cleaved by furin generating A1 and A2 chains, which remain linked together by a single disulfide bridge between cysteine 242 and 261 [Garred et al., 1995; Lea et al., 1999]. When the toxin reaches the ER lumen, the disulfide bond of the catalytic A1 fragment is reduced, releasing it from the A2B5 complex. The A1 chain relocated to the cytosol.

20

Figure 1.8 Surface overlay of the dog 60S ribosome subunit highlighting the sarcin-ricin loop. (A) A low resolution structure of the dog 60S ribosomal subunit was generated from electron micrographs. Ribosomal proteins are colored in dark grey while rRNA components are depicted in light grey. The RNA phosphodiester backbone of the 28S rRNA sarcin-ricin loop is shown in orange with their respective bases highlighted in green (B) The GAGA tetraloop [N-glycosidase recognition site] is illustrated in magenta with the cleaved adenine base is shown in light blue.

A B

21

Chapter 2: Methods and Materials

2.1. Yeast-2-Hybrid

2.1.1 Introduction

The term Yeast-2-Hybrid (Y2H) refers to an in vivo technique used to study pair-

wise interactions between proteins expressed as fusion constructs in yeast. This

approach has proven helpful for identifying a large number of protein interactions and

generating systematic genome-wide protein interaction maps. For example, analyses of

proteomes of human pathogen Helicobactor pylori and yeast Saccharomyces cerevisiae

were carried out by Y2H [Shayantani et al., 2001]. Y2H is based on the binding of a

yeast transcription factor to the upstream activation sequence (UAS) leading to the

activation of downstream reporter or survival gene(s). Specifically, Y2H is a technique

that takes advantage of the fact that the GAL4 transcription factor can be separated into

2 complementary fragments: a DNA binding domain (DNA-BD) and a transcription

activation domain (AD). DNA-BD binds to its UAS while AD is responsible for

transcription activation [Fields and Song, 1989]. The protein for which one wishes to

identify its host interactors (yeast or higher eukaryotic host proteins) is termed the bait

and is fused to the C-terminal of GAL4-BD. Potential host binding partners or Prey are

expressed as individual GAL4-AD fusion proteins (Figure 2.1). In the present study, the

Y2H approach was employed to identify intracellular host proteins that bind to the A1

chain of SLT-1 (acting as the bait) and to generate an interaction map among these

proteins.

22

Figure 2.1 Yeast-2-hybrid Methodology. When a bait protein fused to GAL4 DNA-BD interacts with a prey protein fused to the GLA4-AD in yeast cells, the GAL4-DB and GAL4-AD components assemble together to form an active GAL4 transcription factor, which lead to the transcription activation of one or more downstream reporter/survival genes. The three reporter/survival genes are under control of 3 completely distinct UAS were used to eliminate false positive. A catalytically inactive form of SLT-1 A1termed SLT-1 CIA1represented our bait construct when fused to the GAL4 DNA-BD. Protein X linked to the GAL4-AD represents a prey protein recognized by SLT-1 CIA1.

23

2.1.2 Construction of an SLT-1 A1bait plasmid

Protocols and MatchmakerTM plasmids used for our Y2H screens were

obtained from Clontech (Mountain View, CA). In order to carry out Y2H screen, a

catalytically-inactive form of the A1 chain was first generated in the laboratory since

SLT-1 A1 rapidly inactivates yeast ribosomes. Two point mutations were introduced in

the catalytic region, namely E167A and R170A. Past studies suggested that both point

mutations decrease the toxicity of the A1 domain by 10,000 fold, therefore enabling the

yeast to grow while expressing this mutated form of the SLT-1 A chain [Yamasaki et al.,

1991]. This SLT-1 A1 variant termed CIA1 (Catalytically-Inactive A1chain), was

subsequently cloned into a pGBKT7 Y2H vector (Clontech, Mountain View, CA) and

expressed as a fusion protein to the C-terminus of the GAL4 DNA-binding domain

(Figure 2.2). This vector carries a tryptophan (trp) marker for nutritional selection in

yeast. This construct acted as a bait plasmid of our Y2H screen.

2.1.3 Transformation of the bait plasmid into the yeast strain AH109

The bait plasmid was transformed into AH109 yeast strain [MATa, trp1-901,

leu2-3, 112, ura3-52, his3-200, gal4∆, gal80∆, LYS2::GALUAS-GAL1TATA-HIS3,

GAL2UAS-GAL2TATA-ADE2, URA3::MEL1UAS-MEL1TATA-lacZ, MEL1] ) (Clontech,

Mountain View, CA) by the lithium acetate (LiAc) method [Ito et al., 1983]. The

expression of SLT-1 CIA1 was confirmed by isolating the yeast lysate expressing SLT-1

CIA1 and yeast lysate without SLT-1 CIA1 expression as a negative control. Both lysate

were run on an SDS-PAGE gel. Western blotting was subsequently performed using

rabbit anti-serum raised against the A chain. The GAL4 DNA-BD CIA1 was spot diluted

24

on an SD-agar lacking tryptophan, leucine and histidine (SD-trp-leu-his) selective media

in order to confirm that the expression of SLT-1 CIA1 alone did not autonomously

activate the reporter genes in the absence of binding partners (see Figure 3.1 and 3.2).

2.1.4 Y2H screen to identify cellular proteins that interact with SLT-1 CIA1

Since human kidney cells are very sensitive to the action of SLT-1 [i.e. express

Gb3], a human kidney cell prey library was purchased from Clontech (Mountain View,

CA). This library was expected to express host protein fragments as prey GAL4-AD

fusion proteins rather than full length proteins. The library was titered, amplified and

transformed by the LiAc method into the yeast strain AH109 expressing the SLT-1 CIA1

GAL4 DNA-BD fusion constructs. The first step was to ensure that both bait and prey

plasmids were expressed in the AH109 yeast strain. This issue was addressed by

growing the resulting yeast strain on the SD-agar plate lacking both tryptophan and

leucine selection markers (SD-trp-leu) following an incubation period at 30°C for 5 days.

The transformation efficiency was calculated on the same plate to be greater than 1 X

106 cfu/µg DNA. Protein-protein interactions were observed by initially selecting on a

nutritionally-deprived medium lacking tryptophan, leucine and histidine (low stringency;

SD-trp-leu-his) that activated only one reporter gene followed by incubation at 30°C for

5 days. The colonies were then re-streaked on a higher stringency SD-agar plate

lacking tryptophan, leucine, histidine and adenine selection markers but with X-gal (SD-

trp-leu-his-ade+X-gal), which activated all three reporter genes. All three reporter genes

are under control of distinct GAL4 UAS and TATA box in the AH 109 yeast strain

leading to yeast survival (Figure 2.3). All yeast colonies were isolated using a yeast

25

isolation protocol [Harju et al., 2004] and transformed into E. coli TOP10 competent

cells. The DNA was isolated by standard miniprep procedure (Qiagen, Toronto, ON)

and sequenced.

2.2 expression and purification of recombinant proteins

2.2.1 Expression of His-tagged SLT-1 and isolation of the His-tagged A1 chain

Wild-type SLT-1 was cloned into a vector termed pECHE10a as an N-terminal

His-tagged fusion construct (Molecular Templates Inc., Austin, TX). The holotoxin was

expressed in E. coli JM101 strain (Stratagene, La Jolla, CA) in 2 L of LB broth

containing 100 µg/ml of ampicillin at 37°C for 16 h. Cells were lysed in lysis buffer (10x

QIAphosphate buffer pH 8.0, 300 mM NaCI and 12 mM imidazole) with protease

inhibitors (complete EDTA-free; Roche, Mannheim, Germany) and a non-specific

nuclease (Benzonase Nuclease, 2.5 kU; Novagen) followed by sonication. Cell debris

was removed by centrifugation. The lysate was loaded on a column packed with 5 ml of

nickel-NTA resin (HIS-Select Nickel Affinity Gel, Sigma-Aldrich, St. Louis, MO) and

washed with the lysis buffer. The AB5 complex was then eluted with the lysis buffer

containing 250 mM imidazole. The A1 chain was isolated by first treating the purified

AB5 complex with 20 (10 µl) units of the protease furin (New England Biolabs, Ipswich,

MA) at 30°C for 3 days. At this stage the A1 and A2 chain remain linked by a single

disulfide bond, which was reduced using 20 mM TCEP (1,2,3-tris (2-cyanoethoxy)

propane; Sigma-Aldrich, St. Louis, MO) at room temperature for 2 h. This treatment

separates the A1 chain from the A2 chain, which remains associated with the B-

pentamer. The His-tagged containing A1 chain was then recovered on nickel-NTA resin

26

in the presence of 6 M guanidine-HCl to remove the untagged A2 chain and B subunit.

The re-folding of the A1 chain was accomplished with a 6M guanidine-HCl gradient

(80% - 20%), followed by the addition of lysis buffer (10x QIAphosphate buffer pH 8.0,

300 mM NaCI and 12 mM imidazole ). Following the purification of recombinant SLT-1

A1 chain, its catalytic activity was tested in an in vitro TnT assay. The control protein

eGFP was transcribed and translated (TnT) invitro using a T7-coupled rabbit

reticulocyte lysate system in the presence of [35S]-methionine to generate its

radiolabeled version. Eight 10-fold serial dilutions of SLT-1 A1 were prepared in PBS at

a starting concentration of 1 µM of SLT-1 A1. Each of these SLT-1 A1 dilutions was

added to the TnT assay to test its ability to block protein synthesis ( 35S-labelled eGFP)

at 30°C for 90 min. Twenty (20) µl of each sample was loaded on a 4-12% gradient

SDS PAGE gel and the gel later placed in a Storm® PhosphorImager (GE Healthcare)

to detect radiolabeled bands. The experiment and purity of the recovered His-tagged

SLT-1 A1 is presented in Figure 3.6.

2.2.2 Expression of a recombinant His-tagged eGFP

eGFP was cloned into a pET15b vector (Novagen, San Diego , CA) and

expressed in the E. coli BL21(DE3) star strain in 1 L of LB broth containing 100 µg/ml of

ampicillin at 37°C for 16 h. The cell culture was then induced with 1 mM IPTG

(Invitrogen, Carlsbad, CA). The cells were lysed in PBS, pH 8.0 supplemented with

protease inhibitor (complete Mini EDTA-free; Roche, Mannheim, Germany) and a non-

specific nuclease (Benzonase Nuclease, 2.5 kU; Novagen) by mixing them with 10 g of

acid washed glass beads (150-212 µm Sigma-Aldrich, St. Louis, MI). Cell debris were

27

removed by centrifugation and the lysate was loaded onto a 2 ml column bed of Ni-NTA

resin (HIS-select Nickel affinity Gel; Sigma-Aldrich, St. Louis, MO) pre-equilibrated in

the above lysis buffer. The resin was washed with 20 ml of the same buffer before

eluting the His-tagged eGFP with 10 ml of lysis buffer containing 200 mM imidazole.

The experiment and purity of the recovered His-tagged eGFP is presented in Figure 3.6.

2.3 HeLa cell lysate pull down of putative cell protein interaction

The procedures involved in retrieving and analyzing cellular components

interacting with the His-tagged SLT-1 A1 chain are illustrated in Figure 2.4. HeLa cells

were cultured in RPMI 1640 medium containing 10% (v/v) fetal bovine serum (FBS) at

37° C. Confluent cells were harvested and centrifuged at 10,000 g for 5 min.

Approximately 3 X 109 cells were re-suspended in 12 ml of PBS containing protease

inhibitors (Complete EDTA-free, Roche, Mannheim, Germany) and non-specific

nuclease (Benzonase Nuclease, 2.5 kU; Novagen). The cells were lysed by freezing

the suspension in an ethanol/dry ice bath for 10 min followed by thawing at room

temperature for 20 min. This procedure was repeated 5 times. The lysate was isolated

from cell debris by centrifugation at 20,000 g for 15 min and the host proteins that non-

specifically adhered to Ni- NTA resin were first removed by passing the lysate through a

10 ml bed volume of Ni-NTA resin (Sigma-Aldrich, St.-Louis. MI). Ni-NTA magnetic

beads (600 µl; Promega, Madison, WI) were pre-equilibrated in PBS and washed 5

times with PBS containing 10 mM imidazole. The purified recombinant SLT-1 A1 (150

µg) and the negative control eGFP (150 µg), both carrying an N-terminal His-tag, were

28

bound to 600µl of pre-equilibrated Ni-NTA magnetic beads. The cell lysate (4 ml) was

then added to each bead preparation, incubated at room temperature for 4 h and

washed with PBS containing 10 mM imidazole five times. Potential interaction partners

for both SLT-1 A1 and eGFP were eluted from the column with 100 µl of 8 M urea to

ensure that the bait protein remained bound to the column (Figure 2.4).

2.4 Mass spectrometry and analysis of putative protein interactions

After the elution of protein from the Ni-NTA column, thiols present in the

captured protein complexes were reduced with 25 mM dithiothreitol (DTT) and the

proteins were heated at 50°C for 20 min. The free sulfhydryl groups were alkylated with

100 mM of freshly prepared iodoacetamide (Sigma-Aldrich; St Louis, MI) in the

presence of 1 mM CaCl2 and the samples were incubated in the dark for 20 min. The

alkylated proteins were then digested into peptides overnight at 37°C using sequencing-

grade trypsin (Promega, Madison, WI) [Ahmed et al., 2010].

The resulting peptide mixtures were subjected to liquid chromatography-tandem

mass spectrometry incorporating a LTQ-XL liner Ion Trap Mass spectrometer (Thermo

Scientific) linked to an Agilent 1100 nano-HPLC system. The analytical column was

made of 75 µM inner diameter fused silica (30 ml in volume) (Sutter Instruments,

Novato, CA). The column was packed with 20 cm of in-house C18 beads (Jupiter 4µ

Proteo 90A; Phenomenex, Inc., Torrance, CA) using a pressure valve. Samples (50µl)

were loaded on the column and the peptides eluted using a 2 h gradient going from

aqueous buffer A [95 % (v/v) water, 5% (v/v) acetonitrile and 0.1% (v/v) formic acid] to

29

organic buffer B [ 20% (v/v) water, 80% (v/v) acetonitrile and 0.1% (v/v) formic acid].The

mass spectrometer was operated based on data-dependent acquisition. The MS scan

was performed first and the five most intense ions from each mass spectrum (MS) were

then selected for fragmentation (MS/MS) [Ahmed et al., 2010; Gatlin et al., 1998].

The spectra of peptide sequences were analyzed using a computer algorithm

termed SEQUEST (Sage-N Research) and compared against FASTA files which

contains the human NCBI sequences. The peptides identified from SEQUEST were

then filtered and assembled to predict proteins using a peptide and protein prophets

(Institute for Systems Biology, Seattle) [MacCoss et al., 2002].

2.5 Analyzing possible protein interactions identified by Y2H screens

Plasmids coding for the full-length gene sequence of candidate interactors were

purchased from Open Biosystems (Huntsville, AL). The resulting gene cassettes were

amplified by PCR with primers (listed in Table 2.1), cut with specific restriction enzymes

within the multiple cloning site of the vector (MCS) (Table 2.1), and cloned into a

pGADT7 vector at the C-terminus of the GAL4 transcription activation domain (GAL4-

AD) (Figure 2.5). This vector contains a leucine (leu) marker and was used as our prey

plasmid in our Y2H full-length protein interaction screen.

As previously mentioned, the catalytically-inactive version of SLT-1 A1 was

cloned at the C-terminus of a GAL4 DNA-BD in a pGBKT7 vector carrying a tryptophan

(trp) selection marker. This vector serves as our bait plasmid (Figure 2.2). The Y2H

screen was then performed by co-expressing the prey and bait plasmids in the AH109

30

yeast strain. If the SLT-1 A1 bait is able to interact with a specific full-length prey protein,

the complex will allow the assembly of the GAL4 DNA-BD and GLA4-AD modules

resulting in the transcription of one or more survival/reporter genes (HIS3, ADE2, and

LacZ). Protein-protein interactions were observed by selecting for survival on a

nutritionally deprived medium, going from low stringency (SD-trp-leu-his) that activated

only one reporter gene to high stringency (SD-trp-leu-his-ade+X-gal) which activated all

three reporter genes

2.6 Analysis of putative hits identified in the HeLa cell lysate pull down/MS experiment

Plasmids encoding gene sequences for full-length eEF1A1, AHA1, MRCL3,

HSPB1 and ACTC1 were purchased from Open Biosystems (Huntsville, AL). As

previously described in chapter 2.5, the resulting gene cassettes were amplified by PCR

and cloned into a pGADT7 vector containing a T7 promoter and the details of primer

and restriction enzymes are indicated in Table 2.1. To verify the interaction between the

wild type SLT-1 A1 and full-length eEF1A1, AHA1, MRCL3, HSPB1 and ACTC1, these

proteins were expressed in vitro in a transcription and translation (TnT) assay, including

a positive control (ribosomal protein 1, RPLP1) and negative control (P1 lacking C-

terminus 17 amino acids, RPLP1-17aa). The TnT assay was performed in vitro using a

T7-coupled rabbit reticulocyte lysate system (Promega, Madison, WI) in the presence of

[35S]-methionine to generate radiolabeled versions of these proteins. Aliquots (10 µl) of

the radiolabelled proteins were added to 4 µg of the His-tagged SLT-1 A1 and incubated

at room temperature for 1 h. The mix was then incubated with 10 µl of magnetic His Ni-

31

particles (Promega, Masison, WI) for one additional hour. The beads were washed with

1 ml of PBS containing 10 mM imidazole for 5 times to eliminate any non-specific

bindings. 30 µl of SDS-PAGE loading dye was added to each sample followed by

boiling for 5 min. As a control, the radiolabeled eEF1A1, AHA1, MRCL3, HSPB1 and

ACTC1 were incubated at room temperature with 10 µl of magnetic His Ni-particles in

the absence of SLT-1 A1 for 1 h. A 15 µl sample and all the controls were loaded on an

SDS-PAGE gel, which was dehydrated in the gel dye overnight the gel scanned on a

storm® PhosphorImager (GE Healthecare).

32

Figure 2.2 pGBKT7 bait vector with restriction map and multiple cloning site (MCS). The pGBKT7 plasmid was designed to express a protein fused to amino acids 1-147 of the GAL4 DNA-BD. While fusion proteins are expressed under the constitutive ADH1 promoter, the transcription termination is under the control of a T7 promoter and an ADH1 terminator. The pGBKT7 plasmid also contains a T7 promoter, a c-Myc epitope tag as well as a unique MCS. pUC is the replication origin for E.coli whereas 2µis the replication origin for yeast. In addition, this particular vector carries a Kan antibiotic resistant marker for selection in E. coli and TRP1 nutritional marker for selection in yeast.

33

Figure 2.3 Reporter constructs in the AH109 yeast strain. The AH 109 yeast strain is a derivative of the PJ69-2A yeast strain which contains the HIS3 and ADE2 markers. MEL1/lacZ is an endogenous gene found in AH109 yeast stain and is also defined as a GAL4-responsive gene. The three reporter/survival genesare under control of 3 completely heterogenous GAL4-responsive UAS as well as TATA box. The ADE2 reporter along provides a strong nutritional selection. HIS3 is used to reduce the occurrence of false positive and increase the stringency of selection. MEL1 encodes α-galactosidase, which can be easily detected on X-α-gal indicator plate.

Figure 2.4 HeLa cell Lysate pull down assay. The pull down assay is described in the text. His-tagged SLT-1 A1 and His-tagged eGFP were bound to Ni-NTA magnetic affinity beads. Aliquots of the HeLa cell lysate were incubated with either the target or control protein bound to Ni-NTA beads. The beads were then washed to eliminate any non-specifically bound proteins. Complexes of host proteins bound to the immobilized His-tagged SLT-1 A1 were eluted off the magnetic beads and the complexes were sent for liquid chromatography-tandem mass spectrometry (LC-MS/MS).

34

Figure 2.5 pGADT7 prey vector with restriction map and MCS. The pGADT7 vector expresses a protein fused to amino acids 768-881 of the GAL4- AD. The transcription in yeast is controlled by the constitutive ADH1 promoter, and the transcription termination is driven by the ADH1 termination signal. The pGADT7 vector also contains a T7 promoter, an HA epitope tag, a unique MCS as well as a SV40 nuclear localization signal that specifically targets the yeast nucleus. pUC is the origin of replication for E.coli whereas 2µ is the replication origin for yeast. In addition, this particular vector carries an Amp antibiotic resistant marker for selection in E. coli and a LEU2 nutritional marker for selection in yeast.

35

Table 2.1 Sense and anti-sense primers used to clone the full-length gene of positive hits from both Y2H and HeLa cell lysate pull down into pGADT7 vector. The restriction enzyme sequences are highlighted in red.

Sense primers

EEF1A1 5’-CGCGCGCGCCATATGGGAAAGGAAGGAACTCAT-3’ NdeI

AHA1 5'-CGCGCGTATCATATGATGGCCAAGTGGGGTGAG-3' NdeI

UBE2I 5'-CGCGCGTATCATATGATGTCGGGGATCGCCCTC-3' NdeI

DEPDC6 5’-CGCGCGTATCATATGATGGAGGAGGGCGGCAGC-3’ NdeI

MRCL3 5’-CGCGCGCGCCATATGATGTCGAGCAAAAGAACAAAG -3’ NdeI

HSPB1 5’-CGCACTATTCATATGATGACCGAGCGCCGCGTCCCC-3’ NdeI

ACTC1 5’-CGCACGCGCCATATGATGTGTGACGACGAGGAGACC-3’ NdeI Anti-sense primer EEF1A1 5’-CGCGCGCGCGAATTCTCATTAGCCTTCTGAGCT-3’ EcoRI AHA1 5'-CGCGCGTGCGGATCCCTAAAATAAGCGTGCGCCATA-3' BamHI UBE2I 5’-CGCGCGCGCGAA TTCTTATGAGGGCGCAAACTTCTT-3’ EcoRI DEPDC6 5’-CGCGCGTATGGATCCTCAGCGCTCTAACTCCTCCAT-3’ BamHI MRCL3 5’-CGCGCGCGCGGATCCTCAGTCATCTTTGTCTTTGGC-3’ BamHI HSPB1 5’-CGCACTCGCGGATCCTTACTTGGCGGCAGTCTCATC-3’ BamHI ACTC1 5’-CGCGCGCGCGGATCCTTAGAAGCATTTGCGGTG-3’ BamHI

36

Chapter 3: Results

SLT-1 is defined as a type II RIP. It enters the host cell by undergoing

retrograde transport from the Golgi apparatus to the endoplasmic reticulum (ER) before

reaching its cytosolic target. However, the mechanism by which the catalytic domain of

SLT-1 escapes from the ER to the cytosol remains unclear. We hypothesized that there

must be some cellular components involved in its routing mechanism. Previous studies

in our laboratory had revealed 3 ribosomal proteins as binding partners for SLT-1 A1

[McCluskey et al., 2008] In my thesis, Y2H and HeLa cell lysate pull down/MS

approaches were employed to identify non-ribosomal cellular interactors of SLT-1.

3.1 Identification of eukaryotic cellular components that interact with SLT-1 A1 by Y2H screen

3.1.1 Construction and expression of GAL4 DNA-BD CIA1 fusion protein in yeast

A gene coding for the catalytically-inactive SLT-1 A1 chain was cloned into the

pGBKT7 Y2H bait vector and expressed as a fusion construct to the C-terminus of a

GAL4 DNA-BD (amino acids 1-147). Expression of the GAL4 DNA-BD CIA1 fusion

protein in AH109 yeast was validated prior to the Y2H screen. Proteins were isolated

from the CIA1-expressing AH109 yeast strain and resolved on an SDS-PAGE gel

(Figure 3.1). A western blot was subsequently performed by transferring the isolated

proteins onto a PVDF membrane and the expression of GAL4 DNA-BD CIA1 was

detected using an anti-A1 antiserum antibody (Figure 3.1) as described in chapter 2.1.3.

Two bands were observed by western blot: a ~55 kDa band representing CIA1

expressed as a fusion protein to the GAL4 DNA-BD and a ~35kDa representing

37

CIA1expressed alone. It was projected that the untagged CIA1 would not affect the

screen result since the expression of CIA1 without the GAL4 DNA-BD did not yield

cellular partners in the Y2H screen because both the GAL4-AD and the GAL4 DNA-BD

are required to drive the transcription of reporter genes (Figure 3.1).

3.1.2 Testing for autonomous activation

AH109 yeast expressing the SLT-1 CIA1 chain was serially-diluted and spotted

(10µl) on SD agar lacking tryptophan, leucine and histidine (SD-Trp-Leu-His). It was

determined through this nutritional selection that CIA1 expression did not activate

reporter genes (Figure 3.2). This finding ensures that the CIA1 GAL4 DNA-BD fusion did

not autonomously activate any of the reporter genes required for the verification of

positive clones.

3.1.3 Potential interactors identified by Y2H screen

The pACT2 yeast library was purchased from Clontech (Mountain View, CA)

was transformed into the AH109 yeast strain expressing the CIA1 GAL4 DNA-BD. This

prey vector contains truncated genes coding for human kidney cell proteins fused to the

C-terminus of the GAL4-AD (amino acid 768-881) as described in chapter 2.5.

Following nutritional selection on SD-Trp-Leu, 600 colonies were detected and re-

streaked on SD-Trp-Leu-His (low stringency) yielding 405 colonies. A higher stringency

nutritional selection (SD-Trp-Leu-His-Ade) was applied leading to the recovery of 225

colonies. The yeast plasmids were isolated for these colonies, transformed into E. coli

and subsequently sent for sequencing. The 137 colonies recovered yielded sequences

38

which coded for 67 proteins. However, only 23 proteins observed from 53 colonies had

their in frame sequences, while the rest were out of frame (Figure 3.3) and sequences

encode for these proteins are illustrated in Appendix A.

After studying the functional significance of the identified proteins, calculating

their percent coverage (greater than15%), and ranking the number of colonies that

appeared in the Y2H screen, 5 putative binding partners were selected for further

analysis. Since these putative interacting proteins were generated from a library of

truncated proteins, the respective full-length proteins were cloned into prey vectors and

tested to validate their interaction with SLT-1 CIA1 (Table 3.2).

Genes coding for the full-length proteins of ATP1B1, eEF1A1, DEPDC6, AHA1,

UBE2I, along with RPLP1 as a positive control, were cloned into the pGADT7 yeast

prey vector and expressed as fusions constructs with the GAL4-AD. The sequence

coding for SLT-1 CIA1 was cloned into the pGBKT7 yeast bait vector and expressed as

a fusion construct to the C-terminus of the GAL4 DNA-BD. Interactions were tested by

co-expressing the prey vector carrying the full-length gene of a putative interactor and

the bait vector carrying CIA1 in the AH109 yeast strain. Following nutritional selection on

SD-Trp-Leu-His, no interaction was observed between SLT-1 CIA1 and any of the

potential interactors. However, an interaction was observed between SLT-1 CIA1 and

the positive control (RPLP1) [SLT-1 A1 docks onto the ribosome stalk protein PPLP1]

(Figure 3.4).

39

Figure 3.1 Expression of the SLT-1 CIA1 GAL4 DNA-BD fusion in the yeast strain AH109. Left Panel: SDS-PAGE gel of the whole yeast cell lysate from AH109 yeast cells transformed with a bait vector along (control vector) or the bait vector expression CIA1

DNA-BD construct. Right Panel: Western blot probed with an anti-SLT-1 A1 chain antisera. The black arrow indicates the band corresponding to CIA1 fused to the GAL4 DNA-BD, while a grey arrow indicates the band corresponding to the CIA1 protein lacking the GAL4 DNA-BD [Taken from McCluskey PhD thesis, 2010].

Figure 3.2 SLT-1 CIA1 does not autonomously activate reporter genes in yeast. SLT-1 CIA1 was expressed as a fusion to the C-terminus of the GAL4 DNA-BD and transformed into the AH109 yeast strain. The yeast strain was then inoculated in the SD media lacking tryptophan and grown overnight at 30°C. The O.D. (600nm) of the resulting yeast cell culture was adjusted to 1.0, serially diluted 10-fold in PBS, and spotted on the SD-Trp plate to select for the presence of the bait plasmid as well as on SD-Trp-Leu-His to test for autonomous activation.

40

Figure 3.3 Yeast-2-Hybrid library transformation and screening. Selecting positive yeast colonies from low stringency to high stringency eliminated false positives. Low stringency was used to test the presence of the bait and prey plasmids as well as transformation efficiency. Medium stringency was used to test interactions that lead to survival of yeast cells. High stringency was used to test interactions activating three distinct reporter genes. As a result, 225 colonies were selected, of which 137 colonies coded for 67 proteins. Of these 67 proteins, only 23 proteins were coded by nucleotide sequences that were in frame.

41

Table 3.1 Yeast-two-hybrid screen identified protein fragments extracted from human kidney cells associated with the A1 chain of SLT-1.

Protein # of amino acids

# of positive colonies

% Coverage

ATP1B1 303 9 220-303(5), 27%

181-303 (1), 40%

119-303 (1), 61%

236-303 (1), 22%

72-303 (1), 76%

NPHP4 1425 8 1365-1425 (8), 4%

RPLP0 317 4 63-317 (2), 80%

56-297 (2), 76%

EEF1A1 462 4 263-462 (4), 43%

UBE2I 158 3 1-158 (3), 100%

UMOD 640 3 297-397 (2), 16%

358-444 (1), 13%

DEPDC6 409 3 347-409 (3), 15%

RPLP1 114 2 1-114 (2), 100%

NDUFA4 81 2 1-81 (2), 100%

FEZ2 380 2 34-278 (2), 64%

RPL34 117 1 1-117 (1), 100%

MAT2A 161 1 19-161 (1), 88%

AHA1 338 1 86-338 (1), 74%

DNAJA1 397 1 141-397 (1), 64%

IGSF21 497 1 188-467 (1), 60%

ATP1B3 279 1 151-279 (1), 46%

MRI1 369 1 256-369 (1), 31%

RSL24DI 163 1 124-163 (1), 24%

HPD 393 1 304-393 (1), 23%

DXY1C1 420 1 371-420 (1), 12%

ASXL1 1541 1 1254-1404(1),10%

NPHP3 1330 1 125-224 (1), 7%

COL1A2 1366 1 1293-1366 (1), 5%

42

Table 3.2 Proteins that were selected for further analysis from the Y2H screen. Proteins highlighted in green were identified as interactors for SLT-1 A1 in both previous studies and the HeLa cell lysate pull down/MS preformed in this thesis project. The protein highlighted in red was identified in both the initial Y2H screen and HeLa cell lysate pull down/MS in this thesis project.

43

3.2 Confirming catalytic activity of wild-type SLT-1 A1

It was essential to confirm that purified SLT-1 A1 isolated fromE. coli that

expressesthewild-typeSLT-1 AB5complex is catalytically active and properly folded prior

to preforming pull down experiment with HeLa cell lysate. The catalytic activity of SLT-1

A1 was measured by its ability to block protein synthesis in vitro. In a rabbit reticulocyte

transcription and translation (TnT) assay described in chapter 2.6. The activity of SLT-1

A1 was monitored by adding eight 10-fold serial dilutions of SLT-1 A1 to TnT reactions

generating [35S]-methionine radiolabeled eGFP. As indicated in Figure 3.5, there was

eGFP expression at concentrations lower than 1 µM of SLT-1 A1.As the concentration of

SLT-1 A1 decreases, the expression of the radiolabeled eGFP protein increases. Thus,

we concluded that the prepared SLT-1 A1 chain is active and properly folded.

3.3 Mass spectrometry identification of eukaryotic cellular components interacts with SLT-1 A1

3.3.1 Purification of His-tagged recombinant SLT-1 and eGFP

The recombinant SLT-1 A1 and negative control eGFP protein were successfully

created, expressed and purified as described in Chapter 2.2.1 (Figure 3.6).

44

Figure 3.4 Validation of interactions between SLT-1 CIA1 and five potential binding partners. Interactions betweenSLT-1 CIA1 expressed in a bait plasmid as a fusion to the GAL4 DNA-BD and full-length proteins, eEF1A1, AHA1, UBE2I, DEPDC6, ATP1b1, and RPLP1 (positive control), expressed in a prey plasmid as a fusion to the C-terminus of the GAL4 AD, were confirmed in AH109 yeast cells. Colonies were inoculated overnight and spotted as 10-fold serial dilutions on an SD-Trp-Leu plate to test for the presence of both bait and prey plasmids, followed by spot dilutions on an SD-Trp-Leu-His plate to detect possible interacting partners indicated by colony growth. Only the interaction between RPLP1 and SLT-1 A1 was confirmed in this assay.

45

Figure 3.5 In vitro catalytic activity assay indicating the wild-type SLT-1 A1 chain blocks protein synthesis. Eight ten-fold serial dilutions of the wild-type SLT-1 A1 chain were added to rabbit reticulocyte lysate [TnT] assay expressing 35S-labeled eGFP to test its ability to block protein synthesis in vitro. PBS was used as a negative control. Samples containing the radiolabeled eGFP were run on an SDS-PAGE and the 35S-eGFP band visualized using a phosphorimager. The wild-type A1 chain blocks protein synthesis at a concentration of 10-10M.

SLT-1 A1 Molarity

46

Figure 3.6 An SDS-PAGE of His-tagged eGFP and His-tagged SLT-1 A1 proteins purified using Ni-NTA beads as described in Chapter 2.2.1. The band at ~35kDa (arrow, panel A) represents His-tagged eGFP (MW=32kDa), while the band ~30kDa (arrow, Panel B) is that of purified His-tagged SLT-1 A1 (MW=27kDa).

47

3.3.2 List of putative proteins determined by HeLa cell lysate pulldown

The recombinant SLT-1 A1 domain harboring an N-terminal His-tag was

incubated with a HeLa cell lysate to identify cellular host protein binding partners.

Protein complexes containing the A1 chain were then recovered on Ni-NTA resin and

binding partners were dissociated from the A1 chain by with 8 M urea. Protein bands

were resolved by SDS-PAGE. Coomassie blue staining revealed several protein bands

not observed in the control eGFP pull down sample (Figure 3.7). The elution samples of

both negative control eGFP and SLT-1 A1 were then analyzed by mass spectrometry

without further purification. As a result, putative proteins were identified including

eEF1A1, which was also identified by Y2H (Figure 3.8). A more comprehensive List of

putative SLT-1 A1 protein patterns identified in this screen is presented in appendix B.

Based on the number of total peptides and unique peptides, as well as the

percentage coverage and functional significance, 4 of these proteins were selected to

test their one to one interaction with SLT-1 A1 (Table 3.3). The full-length proteins of

eEF1A1 (eukaryotic translation elongation factor 1 alpha 1), MRCL3 (Myosin regulatory

light chain 12A), HSPB1 (Heat shock 27KDa protein 1) and ACTC1 (Actin, alpha

cardiac muscle 1), along with positive control (RPLP1) and negative control (RPLP1

lacking last 17 amino acids), were cloned into a pGADT7 vector containing a T7

promoter. In addition, the Hsp90 cofactor AHA1 detected in the Y2H screen was also

cloned into a pGADT7 vector to confirm its interaction with SLT-1 A1 due to its

involvement in the ER to the Golgi trafficking. Radiolabeled versions of these proteins

were generated using a T7-coupled rabbit reticulocyte lysate system TnT assay

(Promega, Madison, WI) in the presence of [35S]-methionine. interactions between these

48

35S labeled proteins and the toxin A1 chain were detected by a pull down with His-

tagged SLT-1 A1 followed by SDS PAGE and gel exposure on a storm® phosphorimage

(GE Healthecare) (Figure 3.9). From this experiment, an interaction was detected

between SLT-1 A1 and the positive control (RPPL1). No interaction was observed

between SLT-1 A1, MRCL3, HSPB1, ACTC1, AHA1 or the negative control (RPLP1

lacking its C-terminal 17 amino acids).

In order to confirm the results above, the full-length genes coding for MRCL3,

HSPB1 and ACTC1, along with the positive control (RPLP1), were also cloned into the

pGADT7 yeast prey vector and expressed as fusion constructs to GAL4-AD. SLT-1 CIA1

was cloned into the pGBKT7 yeast bait vector and expressed as fusion construct to the

C-terminus of the GAL4 DNA-BD. Interactions were tested by co-transforming the prey

vector carrying the full-length gene coding for these 3 proteins and the bait vector

carrying CIA1 in the AH109 yeast strain. Following nutritional selection on SD-Trp-Leu-

His, no interactions were observed between SLT-1 CIA1 and any of the potential

interactors, except the positive control, RPLP1 (Figure 3.10).

49

Figure 3.7 HeLa cell lysate pull down/MS results. HeLa cells lysate were mixed with His-tagged SLT-1 A1 or His-tagged eGFP (negative control), respectively. The complexes were recovered on Ni-NTA beads. Recovered proteins from the Ni-NTA step were sent for LC-MS/MS). Several proteins were pulled down by SLT-1 A1 that did not pulled down by negative control eGFP.

50

Figure 3.8: HeLa lysate pull down/MS analysis of HeLa cell proteins that associated with the A1 chain of SLT-1. A Selected set of HeLa cell proteins identified by Mass Spectrometry (MS). The blue circles indicate proteins that only bind to SLT-1 A1, the red and green circles show proteins that interact with SLT-A1 as well as with each other. In addition, RPLP0 and RPLP2 (green) are known ribosomal binding partners of SLT-1 A1, whereas eEF1A1 appears to be a non-ribosomal binding partner of SLT-1 A1.

51

Table 3.3 List of proteins deduced from the MS sequencing data. Proteins highlighted in green were identified as interactors for SLT-1 A1in both previous studies and the HeLa cell lysate pull down/MS preformed in this thesis project. The protein highlighted in red was identified in both the initialY2H screen and HeLa cell lysate pull down/MS in this thesis project.

52

Figure 3.9 Ni-NTA pull down showed no interaction between SLT-1 A1 and eEF1A1, AHA1, MRCL3, HSPB1 and ACTC1. The proteins in question, along with positive (RPLP1) indicated in black arrow and negative controls (RPLP1-17aa), were individually expressed as [35S]-labeled proteins and incubated with 4µg of A1 chain bound to 15µl of magnetic Ni-NTA beads. The resulting pull downs were separated by SDS-PAGE and the bands corresponding to radiolabeled binding partners were detected on a phosphorimager.

53

Figure 3.10 Confirmation of results generated by the Hela cell lysate pull down using Y2H. SLT-1 CIA1 was expressed in a bait plasmid as a fusion construct to the GAL4 DNA-BD in the AH109 yeast strain with a prey plasmid expressing the full-length genes of MRCL3, HSPB1, ACTC1, or RPLP1 (positive control) fused to the C-terminus of the GAL4 AD. The yeast colonies were inoculated overnight and spotted as 10-fold serial dilutions on an SD-Trp-Leu plate to test for the presence of both bait and prey plasmids. Ten-fold serial dilutions of these yeast colonies were then spotted on an SD-Trp-Leu-His plate to select for possible interacting partners as indicated by colony growth.

54

Chapter 4: Conclusion, Discussion and Future Directions

4.1 Summary of Y2H results

The goal of this thesis project was to use an Y2H screen and HeLa-lysate pull

down assay to identify non-ribosomal binding partners of SLT-1 A1. These two

techniques were employed to work in conjunction, with the aim to narrow the list of hits

found from both types screen and increase the confidence of our results. The Y2H

screen and HeLa-lysate pull down assay revealed one common putative binding partner

(eEF1A1). The full-length gene of eEF1A1 was subsequently cloned into a prey vector

(pGADT7) to validate its interaction with SLT-1 A1 using an Y2H system. In addition, an

in vitro TNT assay was performed to test whether SLT-1 A1 binds to eEF1A1 directly or

to a complex that associates with eEF1A1. The results from the TNT assay showed that

eEF1A1 is not a true binding partner (Figure 3.4 and 3.9). Other potential interactors

from the Y2H screen were then tested individually to validate their interaction with SLT-1

A1 via an independent Y2H assay and/or an in vitro 35S-labeled experiment in a TNT

assay followed by a pull down with His-tagged SLT-1 A1 magnetic Ni-NTA beads.

Unfortunately, none of the putative interactors displayed a real interaction with SLT-1 A1.

4.2 Discussion of Y2H Results

4.2.1 False positives

The Y2H screen is a very popular and powerful tool that has been extensively

used to study large scale protein interactions. The Y2H strategy is advantageous

because it is an in vivo assay that can detect relatively weak and transient protein

interactions. In addition, this technique is inexpensive and very easy to implement

55

[Estojak et al., 1995; Guarente, L., 1993; Field and song., 1989]. However, Y2H screen

also have some disadvantages such as false positives that need to be taken into

consideration. Specifically, false positives generated in Y2H screen are physical

interactions detected in the screen that cannot be reproduced in an independent system

[Brϋckner et al., 2009]. We did reveal levels of stringency to avoid false positives

(Figure 3.3). A common explanation for false positive is that some bait proteins may

have had intrinsic transcriptional activating properties. This means that the reporter

genes could have activated upon interaction with the prey protein. In these studies,

SLT-1 A1 does not cause autonomous activation. Alternatively, during the initial

screening process, the prey proteins may also cause autonomous activation of reporter

genes by bound to the reporter proteins fused to the bait to generate false positive

results. Another possible source of false positives could be a high expression level of

bait and prey proteins. Their localization in the yeast cell compartment may not reflect

to their native cellular environment. In addition, the overexpression of certain prey

proteins may allow yeast to overcome nutritional selection and present as a false

positive. Furthermore, proteins that are not folded properly can also give false positive

interactions. Finally, in a classic Y2H screen, the prey library contains many fragments

of cDNA of human proteins instead of their corresponding full-length proteins.

Therefore, the library can largely cover the transcriptome to reduce rates of false

negatives; however, this strategy can also increase the occurrence of protein fragments

that give rise to false positives.

56

4.2.2 False negatives

Although Y2H is designed to reduce the rate of false negatives, they cannot be

avoided completely. The classic Y2H screen requires the translocation of the interactor

into the yeast nucleus. This makes membrane associated proteins, integral membrane

proteins, as well as numerous soluble cytosolic proteins and proteins located in other

subcellular compartments, very difficult to detect [Niethammer et al., 1996; Sugita et al.,

1996]. To overcome this problem, truncated versions of proteins are used for the prey

library during the screening process. However, this fragments library can lead to

misfolded proteins that do not interact with SLT-1 A1 and thus false negatives. Other

false negative results may occur because the bait and prey constructs used in the Y2H

assay are not usually symmetric. Specifically, the fused yeast reporter protein can

cause steric hindrance that may block the interaction between prey and bait proteins. In

addition, differences in post-translational protein modification systems between yeast

and other higher eukaryotes, protein may lead to loss of interactions that are dependent

on post-translational modifications and thus false negative. Despite the fact that Y2H is

a very sensitive method to detect protein interactions, very transient interactions often

still escape detection, which is another reason for false negatives. Studies have

indicated that false negatives can cause major problems in the reproducibility of Y2H

screens. For example, study was shown that using the same procedure for two

individual Y2H screens produces less than 30% overlap of hits identified between the

two screens. Furthermore, only about 12.5% of known protein interactions were

determined from each screen [Ito et al., 2001]. This finding demonstrates that false

57

negatives are a major limitation of the Y2H screen in terms of describing a complete

protein interaction network.

4.3 Summary of HeLa cell lysate pull down/MS

The initial HeLa cell lysate pull down assay was able to provide a list of potential

binding partners, including eEF1A1 which was also identified by the Y2H screen. The

top hits from the pull-down approach were then cloned into the pGADT7 vector which

carries a T7 promoter. The 35S radiolabeled version of these proteins were then

generated using an in vitro TNT assay followed by magnetic Ni-NTA pull down to test

their individual interaction with SLT-1 A1. These results were then confirmed with

independent Y2H assays. These subsequent analyses revealed that none of the top hits

showed interaction with SLT-1 A1 (Figure 3.9 and 3.10).

4.4 HeLa cell lysate pull down/MS Discussion

The Affinity purification of SLT-1 A1 interactions followed mass spectrometry is a

very powerful technique used for large-scale interactome research. It is often used in

combination with Y2H screen to complement and cross-reference results. It is more

expensive and less accessible then Y2H, but it allows for the identification of proteolytic

fragments of protein and the detection of entire proteins, as well as protein complexes

[Nazabal et al., 2006]. However, there are some drawbacks of this technique as well.

For example, the proteins in the complex it “pulls down” may not necessarily be involved

58

in direct interaction with the bait. Therefore, each interaction has to been tested

individually. This process can be very time-consuming. In addition, the HeLa cell lysate

pull down assay is biased towards highly abundant proteins. The non-ribosomal

interaction partners were the focus of this thesis. However, the ribosome component of

the cell lysate was not removed during the pull down process. Ribosomes are very

abundant in the cell lysate and make up a high percentage of the dry weight of the cell.

Non-ribosomal proteins of low abundance can thus be overlooked because of their

small quantity and size compared to abundant ribosomal proteins. Therefore, it is more

likely that non-ribosomal proteins will not be detected by mass spectrometry due to high

abundance of ribosomal proteins outcompeting them for binding to SLT-1 A1.

Consequently, false negatives do occur. Furthermore, in a standard pull down

assay/MS, a dual tagged recombinant protein is typically used to generate more

specific, effective and sensitive results and reduce false positives [Collins and

Choudhary., 2008; Puig et al., 2001]. However, a single His-tagged SLT-1 A1 was used

in our HeLa cell lysate pull down assay. The lack of a dual purified tag may have

generated numerous non-specific binding partners and, thus, false positives.

4.5 Future directions

4.5.1 Enrichment of non-ribosomal binding partners

Since the non-ribosomal interaction partners represented the focus of this

thesis, the first step is to improve the HeLa cell lysate pull down step by enriching it for

non-ribosomal binding partners. To achieve this, the ribosomal component of the cell

lysate to be used will be removed by ultracentrifugation at 30, 000 rpm for 2 h.

59

4.5.2 Utilizing a dual-tag purification approach to generate more sensitive and specific results

In order to eliminate non-specific interaction partners, a Strep-His-Tev dual

tagged SLT-1 A1, as well as a negative control (Strep-His-Tev dual tagged eGFP), will

need to be conducted instead of the single His-tagged version of the protein of interest.

In addition, before the elution with imidazole, TEV protease will be used to cleave off the

dual tagged SLT-1 A1 and any bound protein complex(es). Furthermore, an excess

amount of un-tagged SLT-1 A1 can be used as an additional control to compete for

binding with the dual-tagged SLT-1 A1 to its targets further eliminate non-specific

interactions.

4.5.3 Performing a lentiviral RNAi screen

The Y2H and HeLa cell lysate pull down assays only identify physical binding

partners. However, the function of any interactor is required in order to determine its

relationship with SLT-1 in nature. A lentiviral RNA interference (RNAi) screening assay

can provide such functional insight and may reveal more detailed information regarding

the intracellular routing pathway of SLT-1. However, the downside of this approach is

that genes required for cell survival cannot be investigated. Some positive or negative

controls may have to be considered carefully in order to achieve optimal results from

this experiment.

The lentiviral RNAi screen uses a lentiviral short hairpin RNA (shRNA) library

consisting of 80 000 shRNAs that can silence 16 000 human genes (5 hairpins per

60

gene) upon infection with RNAi. This screen is defined as a loss-of-function assay. The

description of the screen is presented in Figure 4.1 [Moffat et al., 2006].

In this case, a human cell line that is susceptible to SLT-1 will be infected with

the pool of shRNAs and treated with wild-type SLT-1. The cells that become resistant to

the toxin due to the silencing of a specific gene will then be selected and the genomic

DNA isolated to identify their shRNA responsible for its SLT-1 resistance.

Preceding the lentiviral RNAi screen, a toxicity curve of wild-type SLT-1 will

need to be generated to determine the concentration required to achieve greater than

90% of killing (CD90). The susceptible human cell line will then be treated with SLT-1

using double the concentration of its CD90 vaule. A dose response curve will also need

to be generated to determine the protamine sulphate, polybrene and puromycin

sensitivity of the cell line to be used in the screen. Protamine sulphate or polybrene will

be used during the experiment to improve lentiviral infection efficiency and puromycin

will be used to select cells infected with a shRNAs. In addition, the multiplicity of

infection (MOI) of the desired cell line will be measured prior to the screen to help

determine the amount of virus required to treat the cells for the experiment.

61

Figure 4.1 Methodology for the Lentiviral RNAi screen. Step 1: Infect susceptible human cells with shRNA lentivirus library. Step 2: Treat the infected cells with WT-SLT-1. Step 3: Select cells that show resistance to the cytotoxicity. Step 4: Isolate the genomic DNA and identify shRNAs responsible for cell survival.

62

5.0 References Adelaide, J.; Margolis, B.; Birnbaum, D. ERBIN (2000) A basolateral PDZ protein that interacts with themammalian ERBB2/HER2 receptor. Nat. Cell Biol2, 407-414. Ahmed, S. M., Daulat, A. M., Meunier, A. and Anger, S. (2010) G protein betagamma subunits regulate cell adhesion through Rap1a and its effector Radi.l J Biol Chem285, 6538-6551.

Allured, V.S., Collier, R.J., Carroll, S.F. & McKay, D.B (1986). Structure of exotoxin A of Pseudomonas aeruginosa at 3.0-Angstrom resolution. Proc Natl Acad Sci U S A 83, 1320-1324. Andrew Jeffery McCluskey (2010). Shiga-like Toxin 1: Molecular Mechanism of Toxicity and Discovery of Inhibitors. Austin, P.R., Jablonski, P.E., Bohach, G.A., Dunker, A.K and Hovde, C.J(1994). Evidence that the A2 fragment of shiga-like toxin type 1 is required for holotoxin assembly. Infect, Immun. 62, 1768-1775. Bast, D.J., Banerjee, L., Clark, C., Read, R.J., and Brunton, J.L. (1999). The identification of three biologically relevant globotriaosyl ceramide receptor binding sites on the Verotoxin 1 B subunit. Mol Microbiol 32, 953-960. Bell, CE, Eisenberg, D. (1996). Crystal structure of diphtheria toxin bound to nicotinamide adenine dinucleotide. Biochemistry 35 (4), 1137–49. Bennett, MJ and Eisenberg, D. (1994). Refined structure of monomeric diphtheria toxin at 2.3 A resolution.Protein Sci3 (9), 1464–75. Brigotti, M., Rambelli, F., Zamboni, M., Montanaro, L., and Sperti, S. (1989). Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes. Biochem J 257, 723-727. Brodsky, J. L., and A. A. McCracken. (1999). ER protein quality control and proteasome-mediated protein degradation. Semin. Cell Dev. Biol. 10,507– 513. Brϋckner, A., Polge, A., Lentze, N., Auerbach, D and Schlattner, U. (2009). Yeast Two-Hybrid, a Powerful Tool for Systems Biology. Int. J. Mol. Sci. 2009 (10), 2763-2788. Collins, M.O.; Choudhary, J.S.(2008). Mapping multiprotein complexes by affinity purification and mass spectrometry. Curr. Opin. Biotechnol., 19, 324-330.

63

Cimolai, N., Carter, J. E., Morrison, B. J., and Anderson, J.D. (1990). Risk factors for the progression of Escherichia coli O157:H7 enteritis to hemolytic-uremic syndrome.J. Pediatr. 116, 589-592. Choe, S., Bennett, MJ., Fujii, G., Curmi, PM., Kantardjieff, KA., Collier, RJ., and Eisenberg, D. (1992). The crystal structure of diphtheria toxin. Nature 357 (6375), 216–22. Collier, R. J (1975) Diphtheria toxin: mode of action and structure. Bacteriol Rev39, 54–85. Deeks, E.D., Cook, J.P., Day, P.J., Smith, D.C., Roberts, L.M., and Lord, J.M.(2002). The low lysine content of ricin A chain reduces the risk of proteolytic degradation after translocation from the endoplasmic reticulum to the cytosol. Biochemistry 41, 3405-3413. Donta, S.T., Tomicic, T.K., and Donohue-Rolfe, A. (1995). Inhibition of Shiga-like toxins by brefeldin A. J Infect Dis 171, 721-724. Endo, Y., Mitsui, K., Motizuki, M., and Tsurugi, K. (1987). The mechanism of action of ricin and related toxic lectins on eukaryotic ribosomes. The site and the characteristics of the modification in 28 S ribosomal RNA caused by the toxins. J Biol Chem262, 5908-5912. Endo, Y., and Tsurugi, K. (1988b). The RNA N-glycosidase activity of ricin A-chain. The characteristics of the enzymatic activity of ricin A-chain with ribosomes and with rRNA. J Biol Chem 263, 8735-8739. Estojak, J., Brent, R and Golemis, E. A. (1995) Correlation of two-hybrid affinity data with in vitro measurements. Molecular and Cellular Biology 15:5820–5829. Guarente, L. (1993) Strategies for the identification of interacting proteins. Proc. Natl. Acad. Sci. USA 90:1639–1641. Fields, S., and Song, O. (1989). A novel genetic system to detect protein-protein interactions. Nature340, 245-246.

Fraser, M.E., Chernaia, M.M., Kozlov, Y.V., and James, M.N. (1994). Crystal structure of the holotoxin from Shigella dysenteriae at 2.5 A resolution. Nat Struct Biol 1, 59-64. Garred, O., van Deurs, B., and Sandvig, K. (1995). Furin-induced cleavage and activation of Shiga toxin. J Biol Chem 270, 10817-10821. Gatlin, C. L., Kleemann, G. R., Hays, L. G., Link, A. J and Yates, J. R., 3rd (1998). Proteinidentification at the low femtomole level from silver-stained gels using a new

64

fritlesselectrospray interface for liquid chromatography-microspray and nanospray mass spectrometry. Anal. Biochem 263, 93–101. Hazes, B., and Read, R.J. (1997). Accumulating evidence suggests that several AB-toxins subvert the endoplasmic reticulum-associated protein degradation pathway to enter target cells. Biochemistry 36, 11051-11054. Hey, T.D., Hartley, M., and Walsh, T.A. (1995). Maize ribosome-inactivating protein (b-32). Homologs in related species, effects on maize ribosomes, and modulation of activity by pro-peptide deletions. Plant Physiol 107, 1323-1332. Heyningen, S.V. (1974). Cholera toxin: interaction of subunits with ganglioside GM1. Science183, 656-657. Hudson, T.H., and Grillo, F.G. (1991). Brefeldin-A enhancement of ricin A-chain immunotoxins and blockade of intact ricin, modeccin, and abrin. J Biol Chem 266, 18586-18592. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983). Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153, 163-168. Ito, T.; Chiba, T.; Ozawa, R.; Yoshida, M.; Hattori, M.; Sakaki, Y(2001). A comprehensive two-hybridanalysis to explore the yeast protein interactome. Proc. Natl. Acad. Sci. USA98, 4569-4574. Iwamoto, R., Higashiyama, S.,Mitamura, T., Taniguch,i N., KlagsbrunM, et al. (1994) Heparin-binding EGF-like growth factor, which acts as the diphtheria toxin receptor, forms a complex with membrane protein DRAP27/CD9, which up-regulates functional receptors and diphtheria toxin sensitivity. EMBO J 13: 2322–30. Jacewicz, M., Clausen, H., Nudelman, E., Donohue-Rolfe, A., and Keusch, G.T. (1986). Pathogenesis of shigella diarrhea. XI. Isolation of a shigella toxin-binding glycolipid from rabbit jejunum and HeLa cells and its identification as globotriaosylceramide. J Exp Med163, 1391-1404. Jackson, M.E., Simpson, J.C., Girod, A., Pepperkok, R., Roberts, L.M., and Lord, J.M. (1999). The KDEL retrieval system is exploited by Pseudomonas exotoxin A, but not by Shiga-like toxin-1, during retrograde transport from the Golgi complex to the endoplasmic reticulum. J Cell Sci112 (4), 467-475. Jiang, J.X. & London, E (1990).. Involvement of denaturation-like changes in Pseudomonas exotoxin a hydrophobicity and membrane penetration determined by characterization of pH and thermal transitions. Roles of two distinct conformationally altered states. J Biol Chem 265, 8636-8641.

65

Karmali, M.A. (1989). Infection by verocytotoxin-producing Escherichia coli. Clin Microbiol Rev 2, 15-38. Karmali, M. A., Petric, M., Lim, C., Fleming, P. C., Arbus,G. S., and Lior, H. (1985). The association between idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli.J. Infect. Dis. 151, 775-782. Katada, T., Tamura, M., and Ui, M. (1983). The A protomer of islet-activating protein, pertussis toxin, as an active peptide catalyzing ADP-ribosylation of a membrane protein. Arch Biochem Biophys224, 290-298. Kounnas, M.Z., et al (1992). The alpha 2-macroglobulin receptor/low density lipoprotein receptor-related protein binds and internalizes Pseudomonas exotoxin A. J Biol Chem 267, 12420-12423. Kovacs, M. J., Roddy, J., Gregoire, S., Cameron, W., Eidus,L., and Drouin, J. (1990). Thrombotic thrombocytopenic purpura following hemorrhagic colitis due to Escherichia coli O157:H7. Am. J. Med. 88, 177-179. Kozlov, Y.V., Chernaia, M.M., Fraser, M.E., and James, M.N. (1993). Purification and crystallization of Shiga toxin from Shigella dysenteriae. J Mol Biol 232, 704- 706. LaPointe, P., Wei, X., and Gariepy, J. (2005). A role for the protease-sensitive loop region of Shiga-like toxin 1 in the retrotranslocation of its A1 domain from the endoplasmic reticulum lumen. J Biol Chem 280, 23310-23318. Lea, N., Lord, J.M., and Roberts, L.M. (1999). Proteolytic cleavage of the A subunit is essential for maximal cytotoxicity of Escherichia coli O157:H7 Shiga like toxin-1. Microbiology 145 ( 5), 999-1004. Lencer, W.I., Constable, C., Moe, S., Jobling, M.G., Webb, H.M., Ruston, S., Madara, J.L., Hirst, T.R., and Holmes, R.K. (1995). Targeting of cholera toxin and Escherichia coli heat labile toxin in polarized epithelia: role of COOH-terminal KDEL. J Cell Biol 131, 951-962. Lindberg, A.A., Brown, J.E., Stromberg, N., Westling-Ryd, M., Schultz, J.E., and Karlsson, K.A. (1987). Identification of the carbohydrate receptor for Shiga toxin produced by Shigella dysenteriae type 1. J Biol Chem 262, 1779-1785. Lingwood, C.A., Law, H., Richardson, S., Petric, M., Brunton, J.L., De Grandis, S., and Karmali, M. (1987). Glycolipid binding of purified and recombinant Escherichia coli produced verotoxin in vitro. J Biol Chem 262, 8834-8839. Linnik, K. M., and H. Herscovitz. (1998). Multiple molecular chaperones interact with apolipoprotein B during its maturation. J. Biol. Chem. 273,

66

21368–21373 MacCoss, M. J., Wu, C. C and Yates, J. R., 3rd. (2002) Probability-based validation of protein identifications using a modified SEQUEST algorithm. Anal. Chem74, 5593–5599. Madshus, I. H., Stenmark, H (1992). Entry of ADP-ribosylating toxins into cells. Curr Top Microbiol Immunol 175, 1–26 Marques, L. R., Moore, M. A., Wells, J. G., Wachsmuth, I.K., and O’Brien, A. D. (1986). Production of Shiga-like toxin by Escherichia coli.J. Infect. Dis. 154, 338-341. McCluskey, A.J., Poon, G.M., and Gariepy, J. (2007). A rapid and universal tandem-purification strategy for recombinant proteins. Protein Sci 16, 2726-2732. Mere, J., Morlon-Guyot, J., Bonhoure, A., Chiche, L. & Beaumelle, B (2005).. Acid triggeredmembrane insertion of Pseudomonas exotoxin A involves an original mechanism based on pH-regulated tryptophan exposure. J Biol Chem280, 21194-21201. Merritt, E and Hol, W. (1995). AB5 toxins. Curr Opin Struct Biol 5 (2), 165–71. Meunier, L., Y.-K. Usherwood, K. Chung, and L. Hendershot. (2002). A subset of chaperones and folding enzymes form multiprotein complexes in endoplasmic reticulum to bind nascent proteins. Mol. Biol. Cell13, 4456–4469. Moffat, J., Grueneberg, D.A., Yang, X., Kim, S.Y., Kloepfer, A.M., Hinkle, G., Piqani, B., Eisenhaure, T.M., Luo, B., Grenier, J.K., Carpenter, A.E., Foo, S.Y., Stewart, S.A., Stockwell, b.R., Hacohen, N., Hahn, W.C., Lander, E.S., Sabatini, DM and Root, D. E. (2006). A lentiviral RNAi library for human and mouse gene applied to an arrayed viral Hign-content Screen. Cell 124, 1283-1298. Montanaro, L., Sperti, S., Mattioli, A., Testoni, G., and Stirpe, F. (1975). Inhibition by ricin of protein synthesis in vitro. Inhibition of the binding of elongation factor 2 and of adenosine diphosphate-ribosylated elongation factor 2 to ribosomes. Biochem J146, 127-131. Montfort, W., Villafranca, J.E., Monzingo, A.F., Ernst, S.R., Katzin, B., Rutenber, E., Xuong, N.H., Hamlin, R., and Robertus, J.D. (1987). The three-dimensional structure of ricin at 2.8 A. J Biol Chem 262, 5398-5403. Moss, J., Stanley, S.J., Burns, D.L., Hsia, J.A., Yost, D.A., Myers, G.A., and Hewlett, E.L. (1983). Activation by thiol of the latent NAD glycohydrolase and 131 ADP-ribosyltransferase activities of Bordetella pertussis toxin (islet-activating protein). J Biol Chem258, 11879-11882.

67

Naglich, J. G., Metherall, J.E., Russell, D. W and Eidels, L (1992.) Expression cloning of adiphtheria toxin receptor: identity with a heparin-binding EGF-like growth factor precursor. Cell 69, 1051–61. Nazabal, A.; Wenzel, R.J.; Zenobi, R.(2006). Immunoassays with direct mass spectrometric detection.Anal. Chem.78, 3562-3570. Niethammer, M.; Kim, E.; Sheng, M.(1996). Interaction between the C terminus of NMDA receptor subunits and multiple members of the PSD-95 family of membrane-associated guanylate kinases. J. Neurosci 16, 2157-2163. O’Brien, A. D., Newland, J., Miller, S. F., Holmes, R. K.,Smith, H. W., and Formal, S. F. (1984). Shiga-like toxin-converting phages from Escherichia coli strains that cause hemorrhagic colitis or infantile diarrhea.Science226, 694-696. O’Brien. A.D., Tesh, V. L., Donohue-Rolfe, A., Jackson, M.P., Olsnes. S., Sandvig, K., Lindberg, A. A and Keusche, G. T (1992). Shiga toxin: biochemistry, genetics, mode of action and role in pathogenesis. Curr. Top. Microbiol. Immunol. 180, 65-94. Orlandi, P.A., Curran, P.K., and Fishman, P.H. (1993). Brefeldin A blocks the response of cultured cells to cholera toxin. Implications for intracellular trafficking in toxin action. J Biol Chem268, 12010-12016. Pappenheimer, A. M (1993).The story of a toxic protein. Protein Sci 2: 292–8,1888-1992. Perlmutter, D. H. (1999). Misfolded proteins in the endoplasmic reticulum. Lab. Investig 79, 623–638. Puig, O.; Caspary, F.; Rigaut, G.; Rutz, B.; Bouveret, E.; Bragado-Nilsson, E.; Wilm, M.; Seraphin, B(2001). The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods, 24, 218-229. Riley, L.W. (1987). The epidemiologic, clinical, and microbiologic features ofhemorrhagic colitis. Annu Rev Microbiol41, 383-407. Romer, W., Berland, L., Chambon, V., Gaus, K., Windschiegl, B., Tenza, D., Aly, M.R., Fraisier, V., Florent, J.C., Perrais, D., Lamaze, C., Raposo, G., Steinem, C., Sens, P., Bassereau, P., and Johannes, L. (2007). Shiga toxin induces tubular membrane invaginations for its uptake into cells. Nature 450, 670-675. Romisch, K. (1999). Surfing the Sec61 channel: bidirectional protein translocation across the ER membrane. J. Cell Sci 112, 4185–4191.

68

Rowe, P. C., Orrbine, E., Wells, D. A., and McLaine, P. N.(1991). Epidemiology of hemolytic-uremic syndrome in Canadian children from 1986 to 1988. The Canadian Pediatric Kidney Disease Reference Centre. J. Pediatr. 119, 218-224. Saleh, M.T., Ferguson, J., Boggs, J.M., and Gariepy, J. (1996). Insertion and orientation of a synthetic peptide representing the C-terminus of the A1 domain of Shiga toxin into phospholipid membranes. Biochemistry 35, 9325-9334. Sandvig, K., and van Deurs, B. (1994). Endocytosis and intracellular sorting of ricin and Shiga toxin. FEBS Lett346, 99-102. Sandvig, K., and van Deurs, B. (1994). Transport of protein toxins into cells: pathways used by ricin, cholera toxin and shiga toxin. FEBS let 529, 49-53 Sandvig, K., Ryd, A., Garred,Ø., Schweda, E and Holm, P. K. (1994). Retrograde transport form the Golgi complex to the ER of both shiga toxin and the nontoxic shiga-B-fragment is regulated by butyric acid and cAMP. The J. cell bio126, 53-64. Sandvig, K., Prydz, K., Hansen, S. H and van Deur, B (1991). Ricin transport in brefeldin A-treated cells: correlation between Golgi structure and toxin effect. J. Cell Biol.115,971-981 Savino, C., Federici, L., Ippoliti, R., Lendaro, E., and Tsernoglou, D. (2000). The crystal structure of saporin SO6 from Saponaria officinalis and its interaction with the ribosome. FEBS Lett470, 239-243. Scheiring, J., Andreoli, S.P., and Zimmerhackl, L.B. (2008). Treatment and outcome of Shiga-toxin-associated hemolytic uremic syndrome (HUS). Pediatr Nephrol 23, 1749-1760. Shayantani, M., Sampali, B and Partha, S. (2001). Protein interation maps using yeast two-hybrid assay. Current science 8, 458-464. Sikriwal, D., Ghosh, P., and Batra, J.K. (2008). Ribosome inactivating protein saporin induces apoptosis through mitochondrial cascade, independent of translation inhibition. Int J Biochem Cell Biol40, 2880-2888. Spangler, B.D. (1992). Structure and function of cholera toxin and the related Escherichia coli heat-labile enterotoxin. Microbiol Rev 56, 622-647. Stewart, S.A., Stockwell, B.R., Hacohen, N., Hahn, W.C., Lander, E.S., Sabatini, D.M., and Root, D.E (2006).. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124, 1283-1298

69

Strockbine, N. A., Jackson, M. P., Sung, L. M., Holmes, R.K., and O’Brien, A. D. (1988). Cloning and sequencing of the genes for Shiga toxin from Shigella dysenteriae type 1.J. Bacteriol. 170, 1116-1122. Sugita, S.; Hata, Y.; Sudhof, T.C.(1996). Distinct Ca(2+)-dependent properties of the first and second C2-domains of synaptotagmin I. J. Biol. Chem. 271, 1262-1265. Taupiac, M.P., Bebien, M., Alami, M. & Beaumelle, B (1999). A deletion within the translocation domain of Pseudomonas exotoxin A enhances translocation efficiency and cytotoxicity concomitantly.Mol Microbiol 31 (5), 13 85-1393. Teter, K and Holmes, K. (2002). Inhibition of endoplasmic reticulum-associated degradation in CHO cells resistant to choler toxin, pseudomonas aeruginosa exotoxin A, and ricin. Infection and immunity 70, 6172-6179. Thompson, G.S., Shimizu, H., Homans, S.W and Donohue-Rolfe, A (2000). Localization of the binding site for the oligosaccharide moiety of Gb3 on verotoxin 1 using NMR dipolar coupling measurements. Biochemistry 39, 13153-13156. Torgersen, M.L., Silje, U., Lauvrak and Sandvig, K (2005). The A-subuint of surface-bound shiga toxin stimulates clathrin-dependent uptake of the toxin. The FEBS Journal. 272, 4103-4113. Wales, R., Chaddock, J. A., Roberts, L. M and Lord, J. M. (1992) Addition of the an ER retention signal to the ricin A chain increase the cytotoxicity of the holotoxin. Exp. Cell Res. 203, 1-4. Walterspiel, J. N., Ashkenazi, S., Morrow, A. L., and Cleary,T. G. (1992). Effect of subinhibitory concentrations of antibiotics on extracellular Shiga-like toxin I.Infection 20, 25-29. Webb, T. R., Cross, S. H., McKie, L., Edgar, R., Visor, L., Harrison, J., Peters, J and Jackson,I.J. (2008). Diphthamide modification of eEF2 requires a J-domain protein and is essential for normal development. Journal of Cell Science 121, 3140-3145. Vembar, S.S., and Brodsky, J.L. (2008). One step at a time: endoplasmic reticulum-associated degradation. Nat Rev Mol Cell Biol9, 944-957. West, R.E., Moss, J. Jr., Vaughan, M., Liu, T and Liu, T.Y.(1985). Pertussis toxin catalyzed ADP-ribosylation of transducin. Cysteine 347 is the ADP-ribose acceptor site. The Journal of Biological Chemistry, 260, 14428-14430. Windschiegl, B., Orth, A., Romer, W., Berland, L., Stechmann, B., Bassereau, P., Johannes, L., and Steinem, C. (2009). Lipid reorganization induced by Shiga toxin clustering on planar membranes. PLoS One4, e6238.

70

Worthington, Z.E., and Carbonetti, N.H. (2007). Evading the proteasome:absence of lysine residues contributes to pertussis toxin activity by evasion of proteasome degradation. Infect Immun 75, 2946-2953. Yamasaki, S., Furutani, M., Ito, K., Igarashi, K., Nishibuchi, M., and Takeda, Y. (1991). Importance of arginine at position 170 of the A subunit of Vero toxin 1 produced by enterohemorrhagic Escherichia coli for toxin activity. Microb Pathog 11, 1-9. Yoshida, T., Chen, C.C., Zhang, M.S., and Wu, H.C. (1991). Disruption of the Golgi apparatus by brefeldin A inhibits the cytotoxicity of ricin, modeccin, and Pseudomonas toxin. Exp Cell Res 192, 389-395. Yu, M and Haslam. (2005) Shiga toxin is transported from the endoplasmic reticulum following interaction with the luminal chaperone HEDJ/ERdj3. Inf and Immun. 73, 2524-2532. Zhang, Y., Schulte, W., Pink, D., Phipps, K., Zijlstra, A., Lewis, J.D and Waisman, D.M (2010). Sensitivity of cancer cell to truncated diphteria toxin. Plos one 5, e10498. Zhu, S. Z., Wang, S. Z., Hu, J and EI-Fakahany, E, E. (1995). An arginine residue conserved in most G protein-coupled receptors is essential for the function of the m1 muscarinic receptor. Mol Pharmcol, 45(3), 517-523

71

Appendix A: Sequences encode for protein interactors identified in initial Y2H screen

The initial Y2H screen identified 23 proteins that putatively interact with SLT-1 A1

as indicated in Table 3.1. The nucleotide sequences derived from prey plasmid DNA

recovered below are ranked for each putative protein to reflect sequences derived from

the highest number of colonies. If the positive colony numbers were identical among the

potential binding partners, the % coverage was taken into consideration. In from 53

yeast colonies encoded 23 unique protein sequences. The nucleotide sequences the

case of ATP1b1, 9 colonies were observed that encode nucleotide sequences

associated with this specific protein, 5 of which had identical nucleotide sequences and

thus the same coverage (27%). The other 4 colonies had slight differences in their

sequences and therefore varied in coverage.

ATP1b1

Function:Na+/K

+ ATPases

# of Amino acid: 303 # of Positive colonies: 9 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccggctgcgggccgaactgcaggcacttcaaaaaacgta

tcaraagatacttcgagaaaaagaaagtgctttagaagcgaaataccaagcaatggagagagcagcaacatttgaacatgacagagataaagttaaaaggcaattcaagatttttagggagaccaaagaaaatgaaattcaggacttactgagggccaagagggagttggagagcaaacttcagaggctacaggctcagggtatccaagtatttgatcctggggagtctgattcaratgacaactgtacagatgtcactggtaagtgtatatcctat

ttatattttgagctttcaacatggctgtaatgacatgtagagccaactttgaattctgctagatttcttttacttatctatattaggttattgctttaactactgttgcaaatagtgtcgtgtgttctctctgtcagctgctaagacacct

cttctccacgaagtgtatgaatttggggactgaagttccttctaccttgtcactctgccaaccctaacccataacttttactctctagtctaagatatctaccccagctcccaccagcacatctgcattttagccaagggaaagaaggaaggggagaacacgttcctttcccagaaggtacaacctaagatcacttctcaaatcccattagtcagaactataactgggaagactggatagtgtaatcagcagccaggcagacatgtgtccaactaaaatgta

gtgttctgttactgaagaaagaagaggagaatggatattggagttactagtctctg3’220-303(5 colonies), 27% coverage 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaagttggaaatgtggagtattttggactgggcaactcccctgg

ttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaattcgcatagagtgtaaggcgtacggtgagaacattgg

gtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatctatatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgtagcaatagcaacaaaatatttattctactgtaaatgaaaaaaaaaaaaaaaaaaaaa

aaaacctcgagagatctatgaatcgtagatactgaaaaaccccgcaagttcacttcaactgtgcatcgtgcaccatctcaatttctttcatttatacatcgttttgccttcttttatgtaactatactcctctaagtttcaatctt3’

181-303 (1 colony), 40% coverage

5’ctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacagggatgacatgatttttgaagattgtggcgatgtgcccagt

gaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaag

ttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactga

aattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatctatatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgtagcaatagcaacaaaat

atttattctactgtaaatgacaaaagaaaaagaaaaattgagccttgggacgtgcccatttttactgtaaattatgattccgtaa3’

119-303 (1 colony), 61% coverage

5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgccccgccaggattaacacagattcctcagatccagaag

actgaaatttcctttcgtcctaatgatcccaagagctatgaggcatatgtactgaacatagttaggttcctggaaaagtacaaagattcagcccagagggatgacatgatttttgaagattgtggcgatgtgcccagtgaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataa

agctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaagttgg

72

aaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaatt

cgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatctatatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgta3’72-303 (1), 76%

5’gtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgataaggataaagttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaa

ctcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatct

atatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgtagcaatagcaacaaaatatttattctactgtaaatgac3’236-303 (1 colony), 22% coverage

NPHP4

Function:involved in the organization of apical junctions in kidney cells # of Amino acid: 1425 # of Positive colonies: 8 5’ctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacagggatgacatgatttttgaagattgtggcgatgtgcccagt

gaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaag

ttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactga

aattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatctatatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgtagcaatagcaacaaaat

atttattctactgtaaatgacaaaagaaaaagaaaaattgagccttgggacgtgcccatttttactgtaaattatgattccgtaa3’1365-1425 (8 colonies), 4% coverage

RPLP0

Function: protein synthesis

# of Amino acid: 317 # of Positive colonies: 4 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgccatccgagggcacctggaaaacaacccagctctgga

gaaactgctgcctcatatccgggggaatgtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcac

tgtgccagcccagaacactggtctcgggcccgagaagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatgctcaacatctcccccttcccctttgggctggtcatccagcaggtgttcgacaatggcagcatctacaaccctgaagtgcttgatatcacagaggaaactctgcattctcgc

ttcctggagggtgtccgcaatgttgccagtgtctgtctgcagattggctacccaactgttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttg

ctgaaaaggtcaaggccttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggttgaagccaaggaagagtcggaggagtcggacgaggatatgggatttggtctctttgactaatcaccaaaaagcaaccaacttagccagttttatttgcaaaac3’63-317 (2 colonies), 80% coverage

5’Gccccggggatccgaattcgcggccgcgtcgacggcaagaacaccatgatgcgcaaggccatccgagggcacctggaaaacaacccagctctggagaaactgctgcctcatatccgggggaatgtgggctt

tgtgttcmccaaggaggacctcactgagatcagggacatgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaacactggtctcgggcccgaraagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatgctcaac

atctcccccttctcctttgggctggtcatccagcaggtgttcgacaatggcagcatctacaaccctgaagtgcttgatatcacagaggaaactctgcattctcgcttcctggagggtgtccgcaatgttgccagtgtctgtc

tgcagattggctacccaactgttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttgctgaaaaggtcaaggccttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggt3’56-297 (2 colonies), 76% coverage

EEF1A1

Function: translation elongation

# of Amino acid: 462 # of Positive colonies: 4 5’ctctatggcttacccatacgatgttccarattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcscggccgcgtcgacacggaagtaaaatctgtcgaaatgcaccatgaagctttga

gtgaagctcttcctggggacaatgtgggcttcaatgtcaagaatgtgtctgtcaaggatgttcgtcgtggcaacgttgctggtgacagcaaaaatgacccaccaatggaagcagctggcttcactgctcaggtgattatc

ctgaaccatccaggccaaataagcgccggctatgcccctgtattggattgccacacggctcacattgcatgcaagtttgctgagctgaaggaaaagattgatcgccgttctggtaaaaagctggaagatggccctaaattcttgaagtctggtgatgctgccattgttgatatggttcctggcaagcccatgtgtgttgagagcttctcagactatccacctttgggtcgctttgctgttcgtgatatgagacagacagttgcggtgggtgtcatcaaagca

gtggacaagaaggctgctggagctggcaaggtcaccaagtctgcccagaaagctcagaaggctaaatgaatattatccctaatacctgccaccccactcttaatcagtggtggaagaacggtctcagaactgtttgttt

caattggccatttaagtttagtagtaaaagactggttaatgataacaatgcatcgtaaaaccttcagaaggaaaggagaatgttttgtggaccactttggttttcttttttgcgtgtggcagttttaagttattagtttttaaaatcagtactttttaatggaaacaacttgaccaaaaatttgtcacagaattttgagacccattaaaaaagttaaatgaaaaaaaaaaaaaaaaaactcgagagatctatgaatcgtagatactgaaaaccccgcaagttcacttcaa

ctgtgcatcgtgcmccatctcaatttctttcatttatacatcgtttgccttcttttatgtaactatactcctctagtttcatctgccatgtacctctgatctataraatttttaatgactagatakgccatcttttttgactaatctcatgaa

atwattacgaaggctattmgagcttgactctcgctrgttgtcagtctcawcagttgtcactgtctact3’263-462 (4 colonies), 43% coverage

UBE2I

Function: ubiquitination/sumo conjunction

# of Amino acid: 158 # of Positive colonies: 3 5’acaaaaaaatargtctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgggaagcgccgccgccgccgccc

cgctcggtcctccacctgtccgctacgctcgccggggctgcggccgcccgagggactttgaacatgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaaactacggatgcttttcaaagatgattatccatctt

cgccaccaaaatgtaaattcgaaccaccattatttcacccgaatgtgtacccttcggggacagtgtgcctgtccatcttagaggaggacaaggactggaggccagccatcacaatcaaacagatcctattaggaatac

aggaacttctaaatgaaccaaatatccaagacccagctcaagcagaggcctacacgatttactgccaaaacagagtggagtacgagaaaagggtccgagcacaagccaagaagtttgcgccctcataagctyrsaccttgtggcatcgtcagaaggaagggattggtttggcaagaacttgtttacaacatttttgcaaatctaaagttgctccatacaatgactagtcacctggggggggttggggcgggcgccatcttccattgccgccgcggg

73

tgtgcggtctcgattcgctgaattgcccgtttccatacagggtctcttccttcggtcttttgtatttttgattgttatgtaaaactcgcttttattttaatattgatgtcagtatttcaactgctgtaaaattataacttttatacttgggta

agtccccaggggcgagttctcgctctggatgcagcatgcttctcmccgtgcagagctgcactgctcagctgctgtatggaaatgcayctctctgcgctctctctagacttctagacctggctgtgctgctttgarctcgaccagcagcaytcgatctgcccatct3’1-158 (3 colonies), 100% coverage

UMOD

Function:facilitatesneutrophil migration across renal epithelial

# of Amino acid: 640 # of Positive colonies: 3 5’atggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgaggagtgcagtatagacgaggactgcaaatcgaataatggcagatggcactgccagtgcaaacaggacttcaacatcactgatatctccctcctggagcacaggctggaatgtggggccaatgacatgaaggtgtcgctgggcaagtgccagctgaagagtctgggcttcgacaag

gtcttcatgtacctgagtgacagccggtgctcgggcttcaatgacagagacaaccgggactgggtgtctgtagtgaccccagcccgggatggcccctgtgggacagtgttgacgaggaatgaaacccatgccactt

acagcaacaccctctacctggcagatgagatcatcatccgtgacctcaacatcaaaatcaactttgcatgctcctaccccctggacatgaaagtcagcctgaagaccgccctacagccaatggtcaggtgtggccagagagggtccctagggcccctagatggttctaaccccaaaccccttaaccatgagcttccctgtcaactgccacccacagggagctgggagtgagggctgggaatcagggttgcccaatggaagagccaggaattctg

gagcccaggttcaaatctagactttgtcataaatgatggttatgccctggccagtgggggacagagtcaaagcactgcctggttcaagccccagctctgtcacttactagttgtatgagcttgagtgagttattaagcctg

gctttgggaaattgatagtccctctctaggtgtcaatattttcatctgtgaaatgggtttaatagtactctaagaattaaatgatatgggaggatcgcttgagcccaggaatttgaggctgcttagagctatgattgtgatgtgaatcagattcaaccattaactgatgtagatgattcagatgtgaatcaaatattaaagtctctacttttcaagagcagggtggttgtgccagagagcaggaatggtctcagtcagactgctatggatgctggcaatcatattcat

attggactcacttctttccttcctgtgatgagtatttgaatacrgattccactcagaaaacgatagamyatat3’297-397 (2 colonies), 16%coverage

5’ctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacatgtacctgagtgacagccggtgctcgggcttcaatgacag

agacaaccgggactgggtgtctgtagtgaccccagcccgggatggcccctgtgggacagtgttgacgaggaatgaaacccatgccacttacagcaacaccctctacctggcagatgagatcatcatccgtgacctc

aacatcaaaatcaactttgcatgctcctaccccctggacatgaaagtcagcctgaagaccgccctacagccaatggtcaggtgtggccagagagggtccctagggcccctagatggttctaaccccaaaccccttaaccatgagcttccctgtcaactgccacccacagggagctgggagtgagggctgggaatcagggttgcccaatggaagagccaggaattctggagcccaggttcaaatctagactttgtcataaatgatggttatgccct

ggccagtgggggacagagtcaaagcactgcctggttcaagccccagctctgtcacttactagttgtatgagcttgagtgagttattaagcctggctttgggaaattgatagtccctctctaggtgtcaatattttcatctgtg

aaatgggtttaatagtactctaagaattaaatgatatgggaggatcgcttgagcccaggaatttgaggctgcttagagctatgattgtgatgtgaatcagattcaaccattaaactgatgtagatgattcagatgtgaatcaatattaaagtctctacttttcaaagaggcagggtggttgtgcc3’358-444 (1 colony), 13% coverage

DEPDC6

Function: mTOR interactor

# of Amino acid: 409 # of Positive colonies: 3 5’catatggccatggaggccccggggatccgaattcgcggccgcgtcgacggaaataagccatgccacatccaggctgtagaccccagtggccctgcagccgcagcaggaatgaaggtctgtcagtttgtcgtctctgtcaacgggctcaatgtcctgcatgtagactaccggaccgtgagcaatctgattctgacgggcccacggacgattgtcatggaagtcatggaggagttagagtgctgagctcctgggcctcccagccctccagtg

gcctgtgggtgagggaagccagaatgacacaaagcaatgcaaagacaagattgccatgcaaatggatggttttggacatacgagtcttctccgcacatacatgtctaaagttgagttttatacactgaatgtggaagaa

ccgggtatcatatctttcttaaaaaatgtcagtgtagaaaacatttgggaaaccattttcctacatgatagaactgccttactagatttctatttgtagctctcattcattgttttttatcttagtttgcagaaaggtgttgaaatgcttctctagcccaaacagcgacatgctaaagtccccttcttcagagtcaatagagtagttgttaaaggttttaaattgtactttctccaaaattagcatgcagctatttaatagggaatctagatttcaccaagattcaaatcaaag

caacatttaaaggaataagacctgttcactagcattttcaagggggttctaaagcattcaagtgcttaaaagccataaaaaatgacttcttaattcctgcctttagtgtcaacttttaagttaatacaggtttcaattgtggcatta

ggaaaaaaaaaaaccttgtgatgctatggttgggggtargttagggarag3’347-409 (3 colonies), 15% coverage

RPLP1

Function: protein synthesis

# of Amino acid: 114 # of Positive colonies: 3 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgtgaggccctcacttcatccggcgactagcaccgcgtcc

ggcagcgccagccctacactcgcccgcgccatggcctctgtctccgagctcgcctgcatctactcggccctcattctgcacgacgatgaggtgacagtcacggaggataagatcaatgccctcattaaagcagccggtgtaaatgttgagcctttttggcctggcttgtttgcaaaggccctggccaacgtcaacattgggagcctcatctgcaatgtaggggccggtggacctgctccagcagctggtgctgcaccagcaggaggtcctgccc

cctccactgctgctgctccagctgaggagaagaaagtggaagcaaagaaagaagaatccgaggagtctgatgatgacatgggctttggtctttttgactaaacctcttttataacatgttcaataaaaagctgaactt3’1-114 (2 colonies), 100% coverage

NDUFA4

Function: NADH dehydrogenase transfers electrons from NADH to the respiratory chain

# of Amino acid: 81 # of Positive colonies: 2 5’tccgagcttgatccccctctttgtatttattggaactggagctactggagcaacactgtatctcttgcgtctggcattgttcaatccagatgtttgttgggacagaaataacccagagccctggaacaaactgggtcccaatgatcaatacaagttctactcagtgaatgtggattacagcaagctgaagaaggaacgtccagatttctaaatgaaatgtttcactataacgctgctttagaatgaaggtcttccagaagccacatccgcacaattttccact

taaccaggaaatatttctcctctaaatgcatgaaatcatgttggagatctctattgtaatctctattggagattacaatgattaaatcaataaataactgaaacttg3’34-81 (2 colonies), 45% coverage

FEZ2

Function: involved in axonal outgrowth and fasciculation

# of Amino acid: 380 # of Positive colonies: 2

74

5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgcggaggcgggggccgaggcgggtgggggcgccga

cggtttcccggccccggcctgcagcttggaggagaagctgagcctgtgcttccgcccctcggatccgggcgccgagcccccgaggacggccgtgcggcccatcacggagcgcagcctcctgcagggggacgagatttggaatgccctgacagataattatgggaatgtgatgcctgtagactggaagtcatcgcatactaggaccttgcacttgcttactctgaacctctcagaaaaaggggtaagtgacagtttgctctttgatacatcagat

gatgaagagctgagagaacagctggatatgcactcaatcatcgtctcctgtgttaatgatgaacccctcttcacggcagaccaggttattgaagaaattgaagaaatgatgcaggaatcaccggacccagaagatgat

gaaacccctacacagtcagatcggctttcaatgctttcccaggaaattcaaactctcaagaggtctagtaccggcagttatgaagagagagtgaaaaggctctcagtgtctgagttaaatgaaatcctggaagaaattgagactgccattaaggagtactctgaggagctggtgcagcagttggctttacgagatgaactggagtttgaaaaggaagtgaaaaacagctttatttctgttcttattgaagtgcaaaacaaacagaaagagcacaaagaa

acagcaaaaaaaaaaaaaaaaaactcgagagatctatgaatcgtagatactgaaaaaccccgcaagttcacttcaactgtgcatcgtgcaccatctcaatttctttcatttatacatcgttttgccttcttttatgtaactatact

cctctaagtttcaatcttggccatgtaacctctgatct3’34-278 (2 colonies), 64% coverage

PRL34

Function: protein synthesis

# of Amino acid: 1 # of Positive colonies: 117 5’ctacgattcatagatctctcgagttttttttttttttttttacagcgtcttttcatttttattactcaaaaaagtttcatttttttatttagctttctgactctgtgcttgtgccttcaacactttcacaacgattttctgctcctcgataagga

aagcacgcttgatcctgtcacgaacacatttagcacacatggaaccaccataggccctgctgacatgtttctttgttttggacaatctcataaraactttaggtcttacagcacgaacccctcgaagtctgcctgggcacacaccacatgcarattttggtgctttcccaaccttcttggtataaaggtaaacaattctattaccaggggttcgggacagcctarttttgttaraggctgtattgtargaaagcctacgtcggtatgtcaaacgctggaccattctg

agtgcctgc3’1-117 (1 colony), 100% coverage

MAT2A

Function: catalyzes the formation of S-adenosylmethionine from methionine and ATP

# of Amino acid: 161 # of Positive colonies: 1 gtctctatggcttacccatacgatgttccarattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgtcccagcgaacccgcgtgcaacctgtcccgactctagc

cgcctcttcagctcgccatggatcccaactgctcctgcgccgccggtgactcctgcacctgcgccggctcctgcaaatgcaaagagtgcaaatgcacctcctgcaaraaaagctgctgctcctgctgccctgtgggct

gtgccaagtgtgcccagggctgcatctgcaaaggggcgtcggacaagtgcagctgctgcgcctgatgctgggacagccccgctcccagatgtaaagaacgcgacttccacaaacctggattttttatgtacaaccctgaccgtgaccgtttgctatattcctttttctatgaaataatgtgaatgataataaaacagctttgacttg3’19-161 (1 colony), 88% coverage

AHA1

Function: Hsp90 cofactor (chaperon)

# of Amino acid: 338 # of Positive colonies: 1 5’cggccgcgtcgacctaaactggacaggtacttctaagtcaggagtacaatacaaaggacatgtggagatccccaatttgtctgatgaaaacagcgtggatgaagtggagattagtgtgagccttgccaaagatgagcctgacacaaatctcgtggccttaatgaaggaagaaggggtgaaacttctaagagaagcaatgggaatttacatcagcaccctcaaaacagagttcacccagggcatgatcttacctacaatgaatggagagtcagt

agacccagtggggcagccagcactgaaaactgaggagcgcaaggctaagcctgctccttcaaaaacccaggccagacctgttggagtcaaaatccccacttgtaagatcactcttaaggaaaccttcctgacgtca

ccagaggagctctatagagtgtttaccacccaagagctggtgcaggcctttacccatgctcctgcaacattagaagcagacagaggtggaaagttccacatggtagatggcaacgtctctggggaatttactgatctggtccctgagaaacatattgtgatgaagtggaggtttaaatcttggccagagggacactttgccaccatcaccttgaccttcatcgacaagaacggagagactgagctgtgcatggaaggtcgaggcatccctgctcct

gaggaagagcggacgcgacagggctggcagcggtactactttgagggcattaaacagacctttggctatggcgcacgcttattttagggccagcggcaggggactccagcctgctggacacttcagtccagctctc

tcctgactggggcttgcgactcacaggattgcatcgtcccagctgctaacttggggccggggcccctcccttccacatataccttgggttgtgcatgtttctgctgggtgggtcagagggcaatttctcttttatgtgtacatatgctaaataaacataatttaaaaaata3’86-338 (1 colony), 74% coverage

DNAJA1

Function: co-chaperone of Hsc70 that plays a role in protein import into mitochondria

# of Amino acid: 397 # of Positive colonies: 1 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgaagctttgagtgaagctcttcctggggacaatgtgggct

tcaatgtcaagaatgtgtctgtcaaggatgttcgtcgtggcaacgttgctggtgacagcaaaaatgacccaccaatggaagcagctggcttcactgctcaggtgattatcctgaaccatccaggccaaataagcgccggctatgcccctgtattggattgccacacggctcacattgcatgcaagtttgctgagctgaaggaaaagattgatcgccgttctggtaaaaagctggaagatggccctaaattcttgaagtctggtgatgctgccattgttg

atatggttcctggcaagcccatgtgtgttgagagcttctcagactatccacctttgggtcgctttgctgttcgtgatatgagacagacagttgcggtgggtgtcatcaaagcagtggacaagaaggctgctggagctggcaaggtcaccaagtctgcccagaaagctcagaaggctaaatgaatattatccctaatacctgccaccccactcttaatcagtggtggaagaacggtctcagaactgtttgtttcaattggccatttaagtttagtagtaaaag

actggttaatgataacaatgcatcgtaaaaccttcagaaggaaaggagaatgttttgtggaccactttggttttcttttttgcgtgtggcagttttaagttattagtttttaaaatcagtactttttaatggaaacaacttgaccaaa

aatttgtcacagaattttgagacccattaaaaaagttaaa3’141-397 (1 colony), 64% coverage

IGSF21

Function: immunoglobin superfamily, member 21

# of Amino acid: 497 # of Positive colonies: 1 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccttgaatctcccatcaaagccttttcattaaaaatacaatttc

atctactccctactgtacctttcactgatgtcaagtggctatcaattcatatagctgaaaattagtgatagtttgggtctcatttatgcataaattaattgaaaatcagtaatggccaggaagaaatatgaatattcaaaccacttttttcttttttttttttttttttggsaaatggkgktwwattgsctgggsaggkctcgaaatcctgggctcaagctatccycctgccyctgcctctgkaarartgkgarccmccmtgccccmcccaaaccatttttcatatcag

ttatagcaaaacaaracaaaccagttcttaataatgktcaaagttggacccatararacatgstaagcactacatcmtgstaaraaraacagttattactcmgctgccatacttcagccmttctacttttacaccaagaaca

aaatggctagagatttttttaaaaatacaaatgscagtaccttgccgaracttgttcactgatttgccccaaccccaaggkaatggtcatctactttgcaacctatggagatcctgatagctcccatacaaagtgaggtacac

75

tgttgccaatttggaggcaggaagccatcaaactaaacgtagtttaattcagatgaacacctatcgatattcaaaaggcaaaacaaaaaaactaattccagggacattagaccttggtgaaatgccaaatgaaaaatggt

gctttaaaaggtagtctcttaccatataaggaataagtaaaacattagcttgtgattctcattattcacgtcaatgttttagacacgactaacaagggacagttcaaactattaaagagaacaaatttttacttaagcactttgagtatccact3’188-467 (1 colony), 60% coverage

ATP1B3

Function: Na+/K

+ ATPase

# of Amino acid: 279 # of Positive colonies: 1 5’ctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccttcaagcatgcagtggtatgaatgatcctgattttggctattctcaaggaaacccttgtattcttgtgaaaatgaacagaataattggattaaagcctgaaggagtgccaaggatagattgtgtttcaaagaatgaagatataccaaatgtagcagtttatcctcataatggaatgatagactta

aaatatttcccatattatgggaaaaaactgcatgttgggtatctacagccattggttgctgttcaggtcagctttgctcctaacaacactgggaaagaagtaacagttgagtgcaagattgatggatcagccaacctaaaaa

gtcaggatgatcgtgacaagtttttgggacgagttatgttcaaaatcacagcacgtgcatagtatgagtaggatatctccacagagtaaatgttgtgttgtctgtcttcattttgtaacagctggaccttccattctagaattatgagaccaccttggagaaaggtgtgtggtacatgacattgggttacatcataacgtgcttccagatcatagtgttcagtgtcctctgaagtaactgcctgttgcctctgctgccctttgaaccagtgtacagtcgccagatag

ggaccggtgaacacctgattccaaacatgtaggatgggggtcttgtcctctttttatgtggtttaattgccaagtgtctaaagcttaatatgccgtgctatgtaaatattttatggatataacaactgtcatattttgatgtcaaca

gagttttagggataaatggtacccggccaacatc3’151-279 (1 colony), 46% coverage

MRI1

Function: catalyzes the interconversion of methylthioribose-1-phosphate (MTR-1-P) into

methylthioribulose-1-phosphate # of Amino acid: 369 # of Positive colonies: 1 5’cggccgcgtcgacaacaaggtgggcacctaccagctggccattgtcgccaagcaccatggcattcccttctacgtggctgcccccagctcttcatgtgacctccgtctggagaccggcaaggagatcattattgaagagcgaccgggccaggagctgaccgatgttaatggggtccggattgcagcacctgggattggagtttggaatcctgccttcgatgtcaccccccacgacctcatcactggtggcatcatcacagaactgggggtct

ttgcccctgaggagctccggacagccctaaccatcaccatctcttccagggatggaaccctagatggaccccagatgtaaccaactcagctctccctagcctgcctctctaggtttttcaatacatttcttgaatggctac

ccaaaagctgaccgtccagcccctgaccacacttgttcctagtgcagggagctcagacagggccttccatctagagcccagcacctagagccaggctgcccagattcaaatcctgactccgccacttttcccactgtatgatcttgggcaagtcacttcacctctctgtgccttggtttcctcatttataaaatgtggataacaggccggg3’256-369 (1 colony), 31% coverage

RSL24D1

Function: involved in the biogenesis of the 60S ribosomal subunit

# of Amino acid: 163 # of Positive colonies: 1 5’cggccgcgtcgacggatatcaaagaagtcaagcaaaacatccatcttatccgagcccctcttgcaggcaaagggaaacagttggaagagaaaatggtacagcagttacaagaggatgtggacatggaagatgctccttaaaaatctctgtaaccatttcttttatgtacatttgaaaatgccctttggatacttggaactgctaaattattttattttttacataaggtcacttaaatgaaaagcgattaaaagacatctttcctgcattgccatctacataatatcagatattacggatgttagattgcatctcagtgttaaatctttactgatagatgtacttaagtaaatcatgaaaattctacttgtaactatagaagtgaattgtggacgtaaaatggttgtgctatttggataatggcactaggcagcatttgtatagtaactaatggcaaaaattcatggctagtgatgtataaaataaaatattctttgcagtaaaatattccctttgttaatgttatagaaggggggatacaaaaaggaactaacaatttgtatggcagtgtcagatatttttattttagtatttcctgttttggtttatttgcatcttagaagagcataatgacattgtttgatgaagcctaattatgctggactgttttgacctggtttaacccttctgataggtagttgtggatgctggggatgagaactgaataatctttgcctggagtgacactacactctagaatttccactttggagaatactcagttccaacttgtgattcctgatagaacagactttacttttctag3’124-163 (1 colony), 24% coverage

HPD

Function: key enzyme in the degradation of tyrosine

# of Amino acid: 393 # of Positive colonies: 1 5’cggccgcgtcgacctgaagacggccaagatcaaggtgaaggagaacattgatgccctggaggagctgaaaatcctggtggactacgacgagaaaggctacctcctgcagatcttcaccaaaccggtgcag

gaccggcccacgctcttcctggaagtcatccagcgccacaaccaccagggttttggagccggcaacttcaactcactgttcaaggctttcgaggaggagcagaacctgcggggtaacctcaccaacatggagaccaatggggtggtgcccggcatgtaagccccgcccaccccacggaggccacagccacacagccacgccccctgattctggaactcgcccaacttccctactggctgctccccttgggtcccgcccaccagcggactcggcccccaaggctccgcccacactgaccacgcccctcggcggggccgccctctgctccagccctcccgattaaagcgtgccccggtcca3’304-393 (1 colony), 23% coverage

DYX1C1

Function:involved in neuronal migration during development of the cerebral neocortex

# of Amino acid: 420 # of Positive colonies: 1 5’gtctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccgacgtggaacagcattctgtcaactagaattgtatgta

gaaggcctacaggattatgaagcggcacttaagattgatccatccaacaaaattgtacaaattgatgctgagaagattcggaatgtaattcaaggaacagaactaaaatcttaatgactattaraagtaactaagtattgttataagttttttaaaaacaactggaggcatctttgtacatattatggccagttgtacagaatcgctttctgtttagtactttagttctgttgagggcaaaatattataaatctatagaaaataaactgtttgacttgaatcatttctgaa

taagtaaatctaaataagaatctattttaattccttatttcttcatattaatacatatgtatacttttttgtgttactgaattaagcttgcccttgtaacaaaatatgttttggtatagttaccaggacacttactgattaatttttaacaag

gtagaattttaaaataaaagatttataaataaaaaaaaaaaaaaaaaaaaaaaaaaaawytcragarwtctakrawtcgwaratmktgaaaamccccgcargttcacttcaactgtgcatcgkgcaccayctcawttyctttcattwatacaycgtttkgccttcttttatgtaactatactcct3’371-420 (1 colony), 12% coverage

76

ASXL1

Function: polycomb group (PcG) protein

# of Amino acid: 1541 # of Positive colonies: 1 5’cggccgcgtcgactcaaatgctgctccaggaaagascccaggagatcttactacctcgagaacacctcgtttctcatctccaaatgtgatctcctttggtccagagcagacaggtcgggccctgggtgatcagagcaatgttacaggccaagggaagaagctttttggctctgggaatgtggctgcaacccttcascgccccaggcctgcggacccsatgcctcttcctgctgagatccctccagtttttcccagtgggaagttgggaccaagcmcaaactccatgtckggkggggtacaractccaagggaagackgggctccaaagccacatgcctttgttggcascgtcaagaatgaraaracttttgtggggggtcctcttaaggyaaatgccgagaacakgaaagctactgggcatagtcccckggaactggtgggtcacttgraagggatgccctttgt3’1254-1404(1 colony),10% coverage

NPHP3

Function: required for normal ciliary development and function

# of Amino acid: 1330 # of Positive colonies: 1 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccggctgcgggccgaactgcaggcacttcaaaaaacgta

tcaraagatacttcgagaaaaagaaagtgctttagaagcgaaataccaagcaatggagagagcagcaacatttgaacatgacagagataaagttaaaaggcaattcaagatttttagggagaccaaagaaaatgaaa

ttcaggacttactgagggccaagagggagttggagagcaaacttcagaggctacaggctcagggtatccaagtatttgatcctggggagtctgattcaratgacaactgtacagatgtcactggtaagtgtatatcctatttatattttgagctttcaacatggctgtaatgacatgtagagccaactttgaattctgctagatttcttttacttatctatattaggttattgctttaactactgttgcaaatagtgtcgtgtgttctctctgtcagctgctaagacacct

cttctccacgaagtgtatgaatttggggactgaagttccttctaccttgtcactctgccaaccctaacccataacttttactctctagtctaagatatctaccccagctcccaccagcacatctgcattttagccaagggaaag

aaggaaggggagaacacgttcctttcccagaaggtacaacctaagatcacttctcaaatcccattagtcagaactataactgggaagactggatagtgtaatcagcagccaggcagacatgtgtccaactaaaatgtagtgttctgttactgaagaaagaagaggagaatggatattggagttactagtctctg3’125-224 (1 colony), 7% coverage

COL1A2

Funciton: type I collagen is a member of group I collagen

# of Amino acid: 1366 # of Positive colonies: 1 5’cggccgcgtcgacctacagggctctaatgatgttgaacttgttgctgagggcaacagcaggttcacttacactgttcttgtagatggctgctctaaaaagacaaatgaatggggaaagacaatcattgaatacaaaacaaataagccatcacgcctgcccttccttgatattgcacctttggacatcggtggtgctgaccaggaattctttgtggacattggcccagtctgtttcaaataaatgaactcaatctaaattaaaaaagaaagaaatttgaaa

aaactttctctttgccatttcttcttcttcttttttaactgaaagctgaatccttccatttcttctgcacatctacttgcttaaattgtgggcaaaagagaaaaagaaggattgatcagagcattgtgcaatacagtttcattaactcct

tcccccgctcccccaaaaatttgaatttttttttcaacactcttacacctgttatggaaaatgtcaacctttgtaagaaaaccaaaataaaaattgaaaaataaaaaccataaacattt3’

1293-1366 (1 colony), 5% coverage

77

Appendix B: List of protein interactors identified in the HeLa cell lysate pull down/mass spectrometry screen

The HeLa cell lysate pull down/mass spectrometry approachusedin this thesis

identified over 200 potential proteininteractors wthSLT-1 A1. The table below lists

putative binding partners of SLT-1 A1 that had greater than 15% coverage.

Furthermore, the list is ranked starting with protein interactors displaying the highest

number of identified peptides with a short description of the known function of the

interactor itself.

78

Protein Gene Name

Peptide Number

Unique Peptide Number Coverage Function

MYH10 134 85 45.2 plays a role in cytokinesis

RPLP0 119 23 51.1 protein synthesis

EEF1A1 99 18 34.6 translation elongation

SPTAN1 94 82 39.8 calcium-dependent movement of the cytoskeleton

CCT6A 72 26 46.3 molecular chaperone

CCT5 61 21 46.4 molecular chaperone

PFKP 56 24 29.7 phosphofructokinase

TCP1 55 21 46.6 molecular chaperone

CCT8 28 16 33 molecular chaperone

MRCL3 21 13 69 movement of smooth muscles

CCT7 21 11 33.9 molecular chaperone

HSPB1 14 10 61 involved in stress resistance and actin organization

ACTC1 14 6 47.5 cell motility

EFTUD2 12 11 23 required for pre-mRNA splicing

VCP 8 6 11.5 translocation from ER to golgi

TPM4 6 4 29.4 regulates muscle contraction

TMOD3 6 4 23.6 blocks actin elongation

RPL6 5 5 22.9 protein synthesis

IGBP1 5 4 16.2 involved in signal transduction

RPL4 5 5 15 protein synthesis

RPL12 4 3 24.2 protein synthesis

YBX1 4 4 20.1 mediates pre-mRNA alternative splicing regulation

PPP2CA 4 3 16.5 modulate the activity of MAP-2 kinase

TUBB2B 3 2 44.9 major constituent of microtubules

RSU1 3 1 26.8 involved in the Ras signal transduction pathway

TXNDC9 3 3 20.8 diminishes the chaperonin ATPase activity

TUBB3 2 2 32.9 major constituent of microtubules

RPLP2 2 2 30.4 protein synthesis

USP7 2 2 16.8 hydrolase that deubiquitinates target proteins

HSPA2 1 1 20.7 Molecular chaperone

DPY30 1 1 20.2 involved in methylation and dimethylation

EEF1A2 1 1 18.4 translation elongation

ENY2 1 1 16.8 mediates histone acetylation and deubiquitination

CNO 1 1 15.2 intracellular vesicle trafficking

YWHAZ 1 1 15.1 regulation in signal pathways

RPLP1 1 1 14 protein synthesis