identification of cellular components interacting with the ... · this project: andrew, melissa,...
TRANSCRIPT
1
Identification of Cellular Components Interacting with the Shiga-like Toxin 1 A1 Chain (SLT-1 A1)
By
Wei Wei
A thesis submitted in conformity with the requirements for the degree of Master’s of Science Graduate Department of Pharmaceutical Sciences,
University of Toronto
©Copyright by Wei Wei, 2012
ii
Identification of Cellular Components Interacting with the Shiga-like Toxin 1 A1 chain (SLT-1 A1)
Wei Wei Master’s of Science
Department of Pharmaceutical Sciences University of Toronto
Abstract
Shiga-like toxin 1 (SLT-1) is produced by Escherichia coli strains like the
pathogenic strain O157:H7. These bacterial strains are responsible for worldwide cases
of food poisoning and water contamination, and the toxin is a major cause of
hemorrhagic colitis and the hemolytic uremia syndrome. SLT-1 is defined as a type II
ribosome-inactivating protein (RIP) and belongs to a family of plant and bacterial AB
toxins. The A1 chain blocks protein synthesis in eukaryotic cells by depurinating a single
adenine base in 28S rRNA. The mechanisms by which the A chain of SLT-1 interacts
with the host components to route itself to the cytosol remains largely unknown. This
thesis project identified a list of putative cellular proteins that interact with the SLT-1 A1
chain by the use of yeast-2-hybrid (Y2H) screens and HeLa lysate pull down/mass
spectrometry analyses. Further assessment of the top 8 host interactors did not yield
true interactions.
iii
Acknowledgements
First and foremost, I would like to give my extended thanks to my supervisor and
mentor Dr. Jean Gariépy for providing me a great opportunity to work in his laboratory
for the past 2 and half years. I thank him for his patience, direction and expertise that
has guided me throughout my research project. I appreciate his assistance, advice,
patients and knowledge in both my experiments and the process of writing this thesis.
I would also like to thank both of my advisory committee members Dr. Ian
Crandall and Dr. Walid. A Houry for keeping me on track and provide integral advice
with respect to the best path for my research to follow. I am also very appreciative of
their time and support.
Many present and past members of the Gariépy lab have greatly contributed to
this project: Andrew, Melissa, Eric, Nenad, Nick, Arshiya and Caitlin. I would like to give
special thanks to Dr. Andrew McCluskey, who has helped me initiate the project. His
wise knowledge, technical advice and support has guided me through my graduate
studies.
Last but certainly not least, I would like to extend great thanks to my family for
supporting me throughout my time as a graduate student and not let me forget who I
am.
iv
Table of Contents
Chapter 1: Introduction .................................................................................................... 1
1.1 Protein toxins ......................................................................................................... 1
1.1.1 Single-chain protein toxins versus multi-subunit protein toxins ....................... 1
1.1.2 Receptor specificity and mode of entry of important catalytically active protein toxins into cells ......................................................................................................... 2
1.2 Enzymatic activity and their host targets ................................................................ 4
1.3 Ribosome-inactivating proteins (RIPs) ................................................................... 5
1.4 Shiga-like Toxin 1 and its clinical impact ............................................................. 10
1.5 Structure and function of Shiga-Like Toxin 1 ....................................................... 10
1.6 Intracellular routing of Shiga-like Toxin I .............................................................. 15
1.6.1 Receptor binding ........................................................................................... 15
1.6.2 Internalization ................................................................................................ 15
1.6.3 Retrograde transport ..................................................................................... 15
1.6.4 Retrotranslocation from the ER lumen to the cytosol .................................... 16
1.6.5 Ribosome docking and inactivation ............................................................... 17
1.7 Project goal .......................................................................................................... 18
Chapter 2: Methods and Materials ................................................................................ 21
2.1. Yeast-2-Hybrid .................................................................................................... 21
2.1.1 Introduction ................................................................................................... 21
2.1.2 Construction of an SLT-1 A1 bait plasmid ...................................................... 23
2.1.3 Transformation of the bait plasmid into the yeast strain AH109 .................... 23
2.1.4 Y2H screen to identify cellular proteins that interact with SLT-1 CIA1 ........... 24
2.2 expression and purification of recombinant proteins ............................................ 25
2.2.1 Expression of His-tagged SLT-1 and isolation of the His-tagged A1 chain .... 25
2.2.2 Expression of a recombinant His-tagged eGFP ............................................ 26
2.3 HeLa cell lysate pull down of putative cell protein interaction .............................. 27
2.4 Mass spectrometry and analysis of putative protein interactions ......................... 28
2.5 Analyzing possible protein interactions identified by Y2H screens ...................... 29
2.6 Analysis of putative hits identified in the HeLa cell lysate pull down/MS experiment................................................................................................................................... 30
Chapter 3: Results......................................................................................................... 36
3.1 Identification of eukaryotic cellular components that interact with SLT-1 A1 by Y2H screen ........................................................................................................................ 36
3.1.1 Construction and expression of GAL4 DNA-BD CIA1 fusion protein in yeast 36
3.1.2 Testing for autonomous activation ................................................................ 37
3.1.3 Potential interactors identified by Y2H screen ............................................... 37
3.2 Confirming catalytic activity of wild-type SLT-1 A1 ............................................... 43
3.3 Mass spectrometry identification of eukaryotic cellular components interacts with SLT-1 A1 .................................................................................................................... 43
3.3.1 Purification of His-tagged recombinant SLT-1 and eGFP ............................. 43
3.3.2 List of putative proteins determined by HeLa cell lysate pull down ............... 47
Chapter 4: Conclusion, Discussion and Future Directions ............................................ 54
4.1 Summary of Y2H results ...................................................................................... 54
4.2 Discussion of Y2H Results .................................................................................. 54
4.2.1 False positives .............................................................................................. 54
v
4.2.2 False negatives ............................................................................................. 56
4.3 Summary of HeLa cell lysate pull down/MS ......................................................... 57
4.4 HeLa cell lysate pull down/MS Discussion ........................................................... 57
4.5 Future directions .................................................................................................. 58
4.5.1 Enrichment of non-ribosomal binding partners .............................................. 58
4.5.2 Utilizing a dual-tag purification approach to generate more sensitive and specific results........................................................................................................ 59
4.5.3 Performing a lentiviral RNAi screen .............................................................. 59
5.0 References .............................................................................................................. 62
vi
Abbreviations ALA Alanine
ARG Arginine
CaM Calmodulin
cAMP 3’,5’-cyclic AMP
CARB Carbenicillin
CIA1 Catalytically-inactive SLT-1 A1 chain
CID Collision-induced dissociation
CT Cholera Toxin
DT Diphtheria Toxin
E.coli Escherichia coli
EDTA Ethylenediaminetetraacetic acid
EF Elongation factor
eGFP Green fluorescent protein
ER Endoplasmic reticulum
ERAD Endoplasmic reticulum-associated degradation
FBS Fetal bovine serum
GAL Galactose
GAL4 AD GAL4 Activation domain
GAL4 DNA-BD GAL4 DNA-binding domain
HiCam 6xHis-calmodulin tandem-purification tag
HIS Histidine
vii
His-tag Polyhistidine purification tag
HPLC High performance liquid chromatography
HUS Haemolytic uremic syndrome
IPTG Isoprpyl-beta-D-thiogalactopyranoside
LiAC lithium acetate
LC-MS/MS Liquid chromatography-tandem mass spectrometry
LEU leucine
LT Heat-labile enterotoxin
MS Mass spectrometry
Ni-NTA Nickel-nitrilotriacetic acid
PBS Phosphate-buffered saline
PCR Polymerase chain reaction
RPLP1 Ribosomal protein P1
PT Pertussis toxin
RIP Ribosome-inactivating protein
RNA Ribonucleic acid
rRNA Ribosomal RNA
SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis
SLT-1 Shiga-like toxin 1
SRL Sarcin-ricin loop
STxs Shiga toxins
TCEP 1,2,3-tris(2-cyanoethoxy)propane
TnT Transcription and translation
viii
TRP Trypthophan
Y2H Yeast-2-hybrid
ix
List of Tables Table1.1 Summary of common structural and functional features of enzyme-based protein toxins ……………………………………………………………………………..……..7 Table 2.1 Sense and anti-sense primers used to clone the full-length gene of positive hits from both Y2H and HeLa lysate pull-down into pGADT7 vector…………………….35 Table 3.1 Yeast-two-hybrid screen identified protein fragments extracted from human kidney cells associated with the A1 chain of SLT-1……………………………………......41 Table 3.2 Proteins that were selected for further analysis from the Y2H screen. Table 3.3 List of proteins deduced from the MS sequencing data……………………….51
x
Table of Figures Figure 1.1 General mechanism of ADP-ribosylation of proteins.......................................7 Figure 1.2 Amino acid sequence alignments of three common RIPs……………………..8 Figure 1.3 The catalytically active chains of 3 types of N-glycosidase RIPs presented as ribbon structures………………………………………………………………………………...9 Figure 1.4 Linear representation of SLT-1 subunits…………………………………….....12 Figure 1.5 Surface overlays of SLT-1 A1 domain highlighting residues associated with specific functions………………………………………………………………………………13 Figure 1.6 Ribbon structure of Shiga toxin………………………………………………….14 Figure 1.7 Routing of SLT-1 into eukaryotic cells expressing Gb3………………….……19 Figure 1.8 Surface overlay of the dog 60S ribosome subunit highlighting the sarcin-ricin loop………………………………………………………………………………………….......20 Figure 2.1 Yeast-2-hybrid Methodology………………………………………………….….22 Figure 2.2 pGBKT7 bait vector with restriction map and multiple cloning site (MCS)....32 Figure 2.3 Reporter constructs in the AH109 yeast strain………………………………...33 Figure 2.4 HeLa cell Lysate pull-down assay………………………………………………33 Figure 2.5 pGADT7 prey vector with restriction map and MCS……………………….....34 Figure 3.1 Expression of the SLT-1 CIA1 GAL4 DNA-BD fusion in the yeast strain AH109………………………………………………………………………………………..…39 Figure 3.2 SLT-1 CIA1 does not autonomously activate reporter genes in yeast………39 Figure 3.3 Yeast-2-Hybrid library transformation and screening…………………………40 Figure 3.4 Validation of interactions between SLT-1 CIA1 and five potential binding partners………………………………………………………………………………………....44 Figure 3.5 In vitro catalytic activity assay indicating the wild-type SLT-1 A1 chain blocks protein synthesis………………………………………………………………………….……45 Figure 3.6 An SDS-PAGE of His-tagged eGFP and His-tagged SLT-1 A1 proteins purified using Ni-NTA beads as described in Chapter 2.2.1………………………………46 Figure 3.7 HeLa lysate pull-down/MS results………………………………………………49 Figure 3.8: HeLa lysate pull-down/MS analysis of HeLa cell proteins that associated with the A1 chain of SLT-1……………………………………………………………...…….50 Figure 3.9 Ni-NTA pull-down showed no interaction between SLT-1 A1 and eEF1A1, AHA1, MRCL3, HSPB1 and ACTC1………………………………………………...………52 Figure 3.10 Confirmation of results generated by the Hela lysate pull down using Y2H………………………………………………………………………………...……………52 Figure 4.1 Methodology for the Lentiviral RNAi screen……………………………………61
xi
List of Appendix Appendix A: Sequences encode for protein interactors identified in initial Y2H screen …………………………………………………………………………………………………71 Appendix B: List of protein interactors identified in the HeLa cell lysate pull down/mass spectrometry screen…………………………………………………………………………77
1
Chapter 1: Introduction
1.1 Protein toxins
Protein toxins are naturally produced by a wide range of animal and plant
species. They vary in structure, function, intracellular targets, as well as, their
mechanism of intracellular routing (direct deposit in the cytosol or retrograde transport)
giving rise to a broad number of pathologies and symptoms in both humans and
animals [Zhou, et al., 1994; Savion et al., 2000]. A large group of protein toxins, termed
type II ribosome-inactivating proteins (RIPs), cause cell death by catalytically
inactivating or altering a cellular component involved in protein synthesis [Endo et al.,
1988]. Their mode of cellular intoxication requires three cellular events;(I) their
internalization into a host cell typically following their binding to a surface marker, (II)
their intracellular routing to the cytosol exploiting cellular pathways and host
components, and (III) their catalytic activity leading to the inactivation of protein
synthesis. The focus of my thesis project was to study how Shiga-like toxin 1 (SLT-1), a
type II ribosome-inactivating protein toxin, is able to route itself to the cytosol of
eukaryotic cells near ribosomes.
1.1.1 Single-chain protein toxins versus multi-subunit protein toxins
Catalytically-active protein toxins are either composed of a single polypeptide or
assembled from typically 2 distinct subunits, specifically an enzyme-containing domain
physically linked or non-covalently attached to a receptor-binding domain. These toxins
also code for other functional motifs that are essential for their internalization, routing
2
and processing in eukaryotic cells. Diphtheria toxin (DT) produced by Corynebacterium
diphtheriae and Pseudomonas aeruginosa Exotoxin A (ETA) are examples of single
chain protein toxins, where their catalytic domain is covalently bound to the receptor-
binding domain [Collier et al., 1975; Pappenheimer et al., 1993].
Many Bacterial toxins are multi-subunit proteins composed of two separate
protein subunits, where the catalytically-active A chain is bound to a single receptor
binding B subunit (AB) or multiple receptor-binding B subunits (AB5). The Heat-labile
enterotoxins (ET) as well as Cholera toxin (CT), Shiga and Shiga-like toxins are
examples of AB5 toxins that carry five identical B subunits [Merritt and Hol., 1995].
1.1.2 Receptor specificity and mode of entry of important catalytically active protein toxins into cells
The receptor binding subunit of protein toxins generally recognizes specific
markers located on the surface of susceptible cells, and the resulting toxin-receptor
complexes are internalized and routed through vesicular compartments. For example,
the receptor-binding domain of ETA recognizes the α2-macroglobulin receptor (A2MR)
also known as low density lipoprotein receptor-related protein (LRP) [Kounnas et al.,
1992]. The receptor-binding subunit of DT interacts with a membrane-achored form of
the heparin-binding, EGF-like growth factor leading to receptor-mediated endocytosis
[Naglich et al., 1992; Iwamoto et al., 1994]. The lectin-like, pentameric receptor-binding
B subunit of Cholera toxin (CT) binds to the ganglioside GM1 [Heyningen et al 1974],
while the pentamer of B subunits of Shiga and Shiga-like toxin 1 [SLT-1] recognize the
glycolipid globotriaosylceramide (CD77, Gb3) [Jacewicz et al., 1986; Lindberg et al.,
1987; Lingwood et al., 1987].
3
Endocytosed toxin-receptor complexes reach their substrates by at least two
mechanisms. The first mechanism deposits their catalytic domain into the cytosol via
endosomal escape. This is the case for DT, endocytosed DT/receptor complex induces
the formation of pores in the endosomal membrane due to conformational change in DT
triggered by the acidic pH of the endosome. Its catalytic A chain can pass through
membrane pores into the cytosol where it can act on their targets [London, 1992; Ren et
al., 1999].
A second more common mechanism of routing catalytically-active protein
toxins is retrograde transport from endosomes to Golgi apparatus, endoplasmic
reticulum before reaching their cytosolic targets [Sandvig and Van Deurs., 1994;
Sandvig and Van Deurs., 2002]. This mechanism of retrograde transport was proposed
following experiments making use of organelle trafficking inhibitors such as brefeldin A
(BFA), a molecule that blocks intracellular protein trafficking between the ER and the
Golgi apparatus by disrupting the functional structure of the Golgi apparatus [Sandvig et
al., 1994]. BFA-treated cells were less sensitive to the action of such toxins, suggesting
that they were less able to undergo retrograde routing from the Golgi apparatus to the
ER which limited their eventual access to the cytosol from the ER lumen [Sandvig et al.,
1991]. A number of protein toxins including Shiga toxin, ricin, CT and ETA appear to
function via this routing mechanism [Hudson and Grillo., 1991; Yoshida et al., 1991;
Orlandi et al., 1993; Donta et al., 1995]. Some of these protein toxins such as ETA and
CT also contain a C-terminal KDEL sequence at the C-terminus of their catalytic domain
that binds to the KDEL receptor located in the Golgi apparatus and allows for the
retrieval on the catalytic domain to the ER lumen [Jackson et al., 1999; Lencer et al.,
4
1995;]. It has been shown that the cytotoxicity of ricin can be significantly increased by
adding a KDEL sequence to the C-terminus of its A subunit [Wale et al.,1992].
1.2 Enzymatic activity and their host targets
The cellular targets of enzyme-based protein toxins have been shown to range
from G-proteins to elongation factors and ribosomal RNA, based on the structures of
different classes of enzymes-based toxins (Table 1.1). ADP-ribosyltransferases function
by modifying a specific amino acid within their target (Figure 1.1). For example, cholera
toxin, produced by Vibrio cholera as does the E.coli heat-labile enterotoxin, modifies a
conserved arginine residue at position 123 on the Gαs subunit of the heterotrimeric G
protein, leading to an increase in the levels of intracellular cAMP. This signaling event
promotes the secretion of fluid and electrolytes into the intestinal lumen causing watery
diarrhea [spangler et al., 1992; Zhu et al., 1995]. Pertussis toxin produced by Bordetella
pertussis, however, ADP ribosylates a specific cysteine at position 347 of the αi subunit
of a heterotrimeric G protein complex, which blocks its interaction with G-protein
coupled receptor, resulting in the uncontrolled activation of adenyl cyclase. This
modification leads to an increased level of cAMP within the cell, which in turn increases
the secretion of insulin that causes the symptoms associated with whooping cough
[Katada et al., 1983; Moss et al., 1983; West et al., 1985]. ETA, a bacterial toxin
expressed by Pseudomonas aeruginosa, ADP-ribosylates the elongation factor 2 (EF-2)
through a modification of a unique diphthamide residue at position 715. This
modification blocks protein synthesis, resulting in cell death [Allured et al., 1986;
5
Taupiac et al., 1999; Webb et al., 2008].Cytotoxic ribonucleases, such as α-sarcin
produced by Aspergillus giganteus, are nucleases that catalyze the degradation of RNA
into smaller components. For instance, α-sarcin cleaves naked 28SrRNA at the specific
sequence (UAGUACGAGAGGAAC) therefore the ribosome split into small fragment (α-
fragment) from the large RNA of 60S ribosomal subunit by hydrolysis a single
phosphodiester between G4325 and A4326 within the sarcin-ricin loop of 28S ribosomal
RNAs. This selective RNA cleavage event inhibits the binding of elongation factor
ternary complex, namely elongation factor 1(EF-1) GTP aminoacyl-tRNA to ribosomes,
as well as the binding of EF-2.GTP to such modified ribosomes, therefore blocking
protein synthesis [Endo and Wool., 1982; Brigotti et al., 1989].
Shiga toxins, including SLT-1and the plant toxin ricin, are examples of
ribosome-inactivating proteins (RIPs) that function as N-glycosidases. These enzymes
depurinate an adenine base at position 4324 in the 28S rRNA within the sarcin-ricin
loop, leading to the blockage of protein synthesis [Montanaro et al., 1975; Brigotti et al.,
1989]. SLT-1 represents the focus of my thesis work and the following section will
further discuss the mechanism of action of RIPs.
1.3 Ribosome-inactivating proteins (RIPs)
Ribosome-inactivating proteins (RIPs) are toxins secreted by plants or
pathogenic strains of bacteria that block protein synthesis and eventually lead to cell
death. The focus of this thesis is on RIPs that function as N-glycosidases. They are part
of a large number of proteins displaying a similar catalytic fold (referred to as A or
6
A1chains). Based on their three dimensional structure, RIPs can be further divided into
three different classes: Type I, II and III. Saporins, produced by Saponaria officinalis,
are an example of type I RIPs, comprising a single enzymatic polypeptide chain with the
folding motif common to all N-glycosidase A chains [Montfort et al., 1987; Savino et al.,
2000; Sikriwal et al., 2008] but lack a receptor-binding subunit. Type II N-glycosidase
RIPs usually consist of a catalytic A chain associated with a receptor-binding B subunit
such as Shiga toxin, SLT-1 and ricin [LaPointe et al., 2005; Sandvig and Van Deurs.,
1994]. Type III RIPs exemplified by ribosome-inactivating proteins (MODs) are
synthesized as inactive precursors that require the proteolytic removal of an internal
fragment in order to be active [Hey et al., 1995]. More importantly, RIP N-glycosidases
display a low level of amino acid homology. However, the essential catalytic residues
(From SLT-1: Tyr-77, Tyr-114, Glu-167, Arg-170, and Trp-203) involved in the
depuration event are highly conserved for all three classes of RIPs (Figure 1.2).
Importantly, the tertiary structures of their common catalytic domain are superimposable
(Figure 1.3).This common mode of action and structure suggest that an understanding
of the routing mechanism of one such N-glycosidase may provide insight into other
family members of this class of RIPs.
7
Figure 1.1: General mechanism of ADP-ribosylation of proteins. The ADP-ribosyltransferase transfers the ADP-ribose group from nicotinamide adenine dinucleotide (NAD+) onto an on acceptor protein (specific residues are indicated in Table 1.1) yielding an ADP-ribosylated protein.
Table1.1Summary of common structural and functional features of enzyme-based protein toxins.
8
Figure 1.2: Amino acid sequence alignments of RIPs from three different classes. The primary amino acid sequence of the type I RIP saporin (Genbank accession no., GI:21321) is compared to that of type II RIP SLT-1 A chain ( Genbank accession no., GI:49258644), and type III Maize RIP ( Genbank accession no., GI:162461916). The conserved catalytic residues are highlighted in red [Adopted from McCluskey PhD thesis, 2010].
9
Figure1.3 The catalytically active chains of 3 types of N-glycosidaseRIPs presented as ribbon structures. Saporin, aType I RIP, is presented in magenta (PDB# 1QI7), while the A chain of the Type II RIP SLT-1 is colored green (PDB# 1DMQ). The Type III RIP Maize is depicted in blue (PDB# 2K6H). The merged image of all three RIP ribbon structures (lower image) emphasizes the common fold adopted by these N-glycosidases. The amino acid alignment of the toxin’s A chains is presented in Figure 1.2.
10
1.4 Shiga-like Toxin 1 and its clinical impact
SLT-1 is produced by enterohemorrhagic Escherichia coli strains such as
O157:H7 [Ling et al., 1998].These bacterial strains are responsible for world-wide cases
of food poisoning and water contamination [Karch et al., 1993]. Studies have reported
that 100,000 estimated cases of O157:H7 infections occur in North America annually.
Such infections can progress to hemorrhagic colitis, which is type of gastroenteritis
leads to bloody diarrhea and abdominal cramps and approximately 10% of cases leads
to hemolytic uremic syndrome (HUS), which is a disorder in the digestive system
produce toxic substance that destroy red blood cell and cause kidney failure [O’Brien et
al., 1984; Karmali et al., 1985; Marques et al., 1986; Kovacs et al., 1990; Scheiring et
al., 2008]. In addition, 2.7-5.7% of children with HUS die from this syndrome and about
25% of them with HUS will suffer long-term renal damage and failure [Riley et al., 1987;
Karmali et al., 1989; Rowe et al., 1991]. The long-term treatment and care of HUS
patients is thus costly. Although inhibitors of SLT-1 such as antibiotics and
oligosaccharide conjugates have been developed, they have not proven useful in
clinical trials [Scheiring et al., 2008]. The recent use of manganese to protect against
SLT-1 toxicity appears promising [Mukhopadhyay, S and Linstedt. A.D, 2012]. However,
there is an urgent need to develop new effective therapies able to treat patients infected
with Shiga toxin-producing bacteria. [Cimolai et al., 1990; Walterspielet al.,1992].
1.5 Structure and function of Shiga-Like Toxin 1
Shiga toxin and SLT-1 are identical in their structure with the exception of one
amino acid (Ser45 vs Thr45) within the catalytic A chain [Strockbine et al., 1988]. As
11
stated in section 1.3, SLT-1 is defined as a type II RIP and is a member of the ABfamily
of protein toxins. It is comprised of two functional domains: a cytotoxic A chain (32kDa;
293 amino acids) non-covalently associated with a pentamer of B subunits (each of 7.7
kDa; 69 amino acids). The A chain is processed by furin into an A1 (27 kDa; 251amino
acids) and an A2 fragment (4.6 kDa; 42 amino acids) (Figure 1.4). [O’Brien et al., 1992;
Kozlov et al., 1993; Fraser et al., 1994; Garred et al., 1995]. The A1 chain is an N-
glycosidase that cleaves a specific adenine base in the 28SrRNA of the 60S ribosomal
subunit. As mentioned earlier, the Key residues Tyr-77, Tyr-114, Glu-167, Arg-170 and
Trp-203of the A1 chain are essential for its catalytic function. Others residues (Ile-239,
Leu-240, Asn-241 and Cys-242) [Lapointe et al., 2005; McCluskey et al., 2008] are
involved in retrotranslocation of A1 chain from the ER lumen to the cytosol. In addition,
its Arg-179, Arg-172, Arg-176, Arg-188, Tyr-190, Tyr-191 and Leu-233 are associated
with ribosome docking [McCluskey et al., 2012] (Figure 1.5). The A2 chain is inserted
into the central pore created by the pentameric arrangement of B subunits (Figure 1.6)
[Austin et al., 1994]. Each B subunit consists of antiparallel β sheets and α helices. A
cleft is created by adjacent β strands on the horizontal plane of the pentamer opposite
to the A2 chain insertion plane. This cleft represents a carbohydrate-binding motif that
is recognized by the glycolipid receptor, globotriaosylceramide (Gb3, CD77) present on
susceptible cells. Toxin-glycolipid complexes are internalized by intoxicated cells
(Figure 1.7) [Jacewicz et al., 1986; O’Brien et al 1992].
12
Figure 1.4 Linearrepresentation of SLT-1 subunits. The A chain of SLT-1 is composed of a catalytic A1 chain (amino acids 1-251) highlighted in grey and an A2 chain (amino acids 252-293; in orange) linked non-covalently to a pentamer of B-subunits (69 residues, in yellow).The A1 and A2 fragments are generated by the furin cleavage of the A chain between residues 251 and 252. The toxin’s A1 and A2 fragments subunits remain linked together through a single disulfide bond in the A chain involving cysteine 242 and 261[Garred et al., 1995]
13
Figure 1.5 Surface overlays of SLT-1 A1 domain highlighting residues associated with specific functions. The catalytic residues are colored in red (Tyr-77, Glu-114, Glu-167, Arg-170 and Trp-203) [Hovde et al., 1988; Yamasaki et al., 1991;Deresiewicz et al., 1992; Deresiewicz et al., 1993] while residues critical for retrotranslocation from the ER lumen to the cytosol are in green (Ile-239, leu- 240, Asn- 241 and Cys242). Residues in blue (Arg-179, Arg-172, Arg-176, Arg-188, Tyr-190, Tyr-191, Leu-233) have been associated with docking of the A1 chain to the ribosomal stalk [McCluskey et al.,2012].
14
Figure 1.6 Ribbon structure of Shiga toxin. Shiga toxin (ShT, from Shigella dysenteriae) and Shiga-like Toxin 1 (SLT-1) (from enterohemorrhagic E. coli) haveidentical A and B subunits. Panel A illustrates the catalytic A domain (in blue grey) of ShT/SLT-1 non-covalently associated with a pentamer of identical B-subunits (yellow β-sheet,green and red). The ribbon structure of the B subunit pentamer alone [Panel B] emphasizes the presence of a central pore, where the A2 chain of ShT/SLT-1 is normally inserted to link the A domain to its B pentamer [Fraser et al., 1994].
15
1.6 Intracellular routing of Shiga-like Toxin I
1.6.1 Receptor binding
The B-subunit of SLT-1 recognizes and binds to globotriaosylceramide [Gb3,
CD77] molecules located on the surface of susceptible cells (Figure 1.7). Receptor
studies have indicated that the terminal Galα (1-4) Galβ disaccharide of Gb3 is a key
determinant recognized by the B subunit pentamer. The crystal structure of a B subunit
in a complex with a Gb3 analog have identified 3 potential binding sites for the sugar
analog per monomer of B subunit [Bast et al., 1999]. However, an NMR study of the
complex has revealed that only one of these three putative sites has proven relevant
[Thompson et al., 2000].
1.6.2 Internalization
The toxin-receptor complex has been shown to be endocytosed (Figure 1.7)
[Jacewicz et al., 1986; Lindberg et al., 1987; Lingwood et al., 1987] along a clathrin-
dependent pathway [Torgersen et al., 2005]. A more recent study has shown that SLT-1
can also undergo clathrin-independent endocytosis. This later study revealed that the B-
subunit of SLT-1 can induce lipid reorganization that facilitates tubular membrane
invagination through reconstitution of tubular formation on giant unilamellar vesicles
(GUVs) for its uptake into cells [Romer et al., 2007]
16
1.6.3 Retrograde transport
The internalized toxin-receptor complex has been shown to undergo retrograde
transport through the Golgi apparatus and subsequently to the endoplasmic reticulum
(ER) lumen. As previously mentioned, the retrograde transport step was postulated from
the use of Brefeldin A and electron microscopy [Sandvig et al., 1994]. In the Golgi
compartments, SLT-1 undergoes limited proteolysis by furin, generating A1 and A2
chains that remain linked together by a single disulfide bridge between cysteine 242 and
261 [Garred et al., 1995; Lea et al., 1999]. The processed toxin subsequently reaches
the reductive environment in the ER lumen where the disulfide bridge is reduced and
the catalytic A1 fragment dissociates from the A2B5 complex (Figure 1.7) [Saleh et al.,
1996; LaPointe et al., 2005].
1.6.4 Retrotranslocation from the ER lumen to the cytosol
The exact mechanism by which the A chain of this RIP toxin escapes from the
ER lumen remains unclear. Since N-glycosidase RIP toxins do not have an intrinsic
ability to cross membranes, it was initially suggested that retrotranslocation of their
catalytic domain from the ER lumen to the cytosol required interactions with host
components [Vembar and Brodsky, 2008]. Earlier studies on other protein toxins such
as ricin and cholera toxin suggested that they underwent retrograde transport to the
cytosol by displaying their catalytic domains as misfolded proteins in the ER lumen. The
proposed relocation mechanism involved interactions with molecular chaperones such
as BiP as well as the translocon Sec61 and HEDJ (ER-residence molecule recruits
misfolded protein to Sec61) [Linnik et al., 1998; Meunier et al., 2002; Yu and Haslam,
2005]. It is believed that the retrotranslocation event is the result of A and A1 toxin
17
chains exploiting the endoplasmic reticulum-associated degradation (ERAD) pathway
through the discovery of ER degradation enhancing α-mannosidase I-like protein
(EDEM).This mechanism is normally used to export misfolded proteins out of the ER
lumen to the cytosol, leading to protein degradation by the 26S proteasome [Brodsky
and McCracken, 1999; Perlmutter., 1999; Romisch., 1999; Teter and Holmes., 2002]. It
is postulated that SLT-1 and most other RIPs have an ability to mimic the structure of
misfolded proteins and use the ERAD pathway for retrotranslocation. In the case of
SLT-1, residues 240-251 are essential for the ER-to-cytosol retrotranslocation event
[LaPointe et al., 2005].
However, in the cytosol, the A1 chain has to be catalytically active with an
intracellular half-life that is sufficiently long to inactivate a large portion of eukaryotic
ribosomes leading to the blockage of protein synthesis. In other words, the A1 chain
cannot be readily cleaved by the proteasome. The A chains of ER-routed toxins
including SLT-1 have thus evolved their primary sequence to contain a low number of
lysines which limit their ubiquitination and thus to avoid degradation by the proteasome
[Hazes and Read, 1997; Deeks et al., 2002; Worthington and Carbonetti., 2007].
1.6.5 Ribosome docking and inactivation
After the A1 chain enters the cytosol, it docks onto the ribosome and
depurinates a single adenine base (A4324) in the sarcin-ricin loop (SRL) of 28S rRNA
[Endo et al., 1987; Endo et al., 1988; Brigotti et al., 1997; McCluskeyet al., 2008]. These
events result in the inhibition of protein synthesis and eventually cell death. A model of
how the 28S rRNA sarcin-ricin loop interacts with other ribosomal components is
presented in Figure 1.8. A detailed mechanism leading up to the depurination event
18
remains unclear/undefined, but is known to involve the docking of the SLT-1 A1 chain to
the ribosomal stalk via a conserved C-terminal peptide present in all 3 stalk proteins
(RPLP0, PRLP1 and RPLP2) [McCluskey et al., 2008]. The docking event may re-
orient the A1 chain to present its catalytic site to the sarcin-ricin loop (Figure 1.8).
1.7 Project goal
The overall goal of my thesis project was to identify non-ribosomal host
components involved in the cellular routing of SLT-1 that interact with the A1 chain of
SLT-1. In order to achieve this, I utilized two techniques: yeast-2 hybrids (Y2H)
screening strategy, as well as a HeLa cell lysate pull down approach followed by mass
spectrometry. Y2H screens were performed with a catalytically inactive A1 chain variant
of SLT-1 (CIA1) to ensure its non-lethal expression in yeast. The HeLa cell lysate pull
down/MS approach utilized a catalytically-active, His-tagged form of the SLT-1 A1 chain
coupled to Ni-NTA beads to retrieve intracellular host proteins that interacted with SLT-1
A1.
19
Figure 1.7 Routing of SLT-1 into eukaryotic cells expressing Gb3.The B pentamer of SLT-1 binds to surface Gb3 molecules, leading to the internalization of the toxin-receptor complex by endocytosis. The toxin then undergoes retrograde transport through the Golgi apparatus to the endoplasmic reticulum (ER) lumen. In the Golgi apparatus, the protease-sensitive loop located in the A domain of SLT-1 is cleaved by furin generating A1 and A2 chains, which remain linked together by a single disulfide bridge between cysteine 242 and 261 [Garred et al., 1995; Lea et al., 1999]. When the toxin reaches the ER lumen, the disulfide bond of the catalytic A1 fragment is reduced, releasing it from the A2B5 complex. The A1 chain relocated to the cytosol.
20
Figure 1.8 Surface overlay of the dog 60S ribosome subunit highlighting the sarcin-ricin loop. (A) A low resolution structure of the dog 60S ribosomal subunit was generated from electron micrographs. Ribosomal proteins are colored in dark grey while rRNA components are depicted in light grey. The RNA phosphodiester backbone of the 28S rRNA sarcin-ricin loop is shown in orange with their respective bases highlighted in green (B) The GAGA tetraloop [N-glycosidase recognition site] is illustrated in magenta with the cleaved adenine base is shown in light blue.
A B
21
Chapter 2: Methods and Materials
2.1. Yeast-2-Hybrid
2.1.1 Introduction
The term Yeast-2-Hybrid (Y2H) refers to an in vivo technique used to study pair-
wise interactions between proteins expressed as fusion constructs in yeast. This
approach has proven helpful for identifying a large number of protein interactions and
generating systematic genome-wide protein interaction maps. For example, analyses of
proteomes of human pathogen Helicobactor pylori and yeast Saccharomyces cerevisiae
were carried out by Y2H [Shayantani et al., 2001]. Y2H is based on the binding of a
yeast transcription factor to the upstream activation sequence (UAS) leading to the
activation of downstream reporter or survival gene(s). Specifically, Y2H is a technique
that takes advantage of the fact that the GAL4 transcription factor can be separated into
2 complementary fragments: a DNA binding domain (DNA-BD) and a transcription
activation domain (AD). DNA-BD binds to its UAS while AD is responsible for
transcription activation [Fields and Song, 1989]. The protein for which one wishes to
identify its host interactors (yeast or higher eukaryotic host proteins) is termed the bait
and is fused to the C-terminal of GAL4-BD. Potential host binding partners or Prey are
expressed as individual GAL4-AD fusion proteins (Figure 2.1). In the present study, the
Y2H approach was employed to identify intracellular host proteins that bind to the A1
chain of SLT-1 (acting as the bait) and to generate an interaction map among these
proteins.
22
Figure 2.1 Yeast-2-hybrid Methodology. When a bait protein fused to GAL4 DNA-BD interacts with a prey protein fused to the GLA4-AD in yeast cells, the GAL4-DB and GAL4-AD components assemble together to form an active GAL4 transcription factor, which lead to the transcription activation of one or more downstream reporter/survival genes. The three reporter/survival genes are under control of 3 completely distinct UAS were used to eliminate false positive. A catalytically inactive form of SLT-1 A1termed SLT-1 CIA1represented our bait construct when fused to the GAL4 DNA-BD. Protein X linked to the GAL4-AD represents a prey protein recognized by SLT-1 CIA1.
23
2.1.2 Construction of an SLT-1 A1bait plasmid
Protocols and MatchmakerTM plasmids used for our Y2H screens were
obtained from Clontech (Mountain View, CA). In order to carry out Y2H screen, a
catalytically-inactive form of the A1 chain was first generated in the laboratory since
SLT-1 A1 rapidly inactivates yeast ribosomes. Two point mutations were introduced in
the catalytic region, namely E167A and R170A. Past studies suggested that both point
mutations decrease the toxicity of the A1 domain by 10,000 fold, therefore enabling the
yeast to grow while expressing this mutated form of the SLT-1 A chain [Yamasaki et al.,
1991]. This SLT-1 A1 variant termed CIA1 (Catalytically-Inactive A1chain), was
subsequently cloned into a pGBKT7 Y2H vector (Clontech, Mountain View, CA) and
expressed as a fusion protein to the C-terminus of the GAL4 DNA-binding domain
(Figure 2.2). This vector carries a tryptophan (trp) marker for nutritional selection in
yeast. This construct acted as a bait plasmid of our Y2H screen.
2.1.3 Transformation of the bait plasmid into the yeast strain AH109
The bait plasmid was transformed into AH109 yeast strain [MATa, trp1-901,
leu2-3, 112, ura3-52, his3-200, gal4∆, gal80∆, LYS2::GALUAS-GAL1TATA-HIS3,
GAL2UAS-GAL2TATA-ADE2, URA3::MEL1UAS-MEL1TATA-lacZ, MEL1] ) (Clontech,
Mountain View, CA) by the lithium acetate (LiAc) method [Ito et al., 1983]. The
expression of SLT-1 CIA1 was confirmed by isolating the yeast lysate expressing SLT-1
CIA1 and yeast lysate without SLT-1 CIA1 expression as a negative control. Both lysate
were run on an SDS-PAGE gel. Western blotting was subsequently performed using
rabbit anti-serum raised against the A chain. The GAL4 DNA-BD CIA1 was spot diluted
24
on an SD-agar lacking tryptophan, leucine and histidine (SD-trp-leu-his) selective media
in order to confirm that the expression of SLT-1 CIA1 alone did not autonomously
activate the reporter genes in the absence of binding partners (see Figure 3.1 and 3.2).
2.1.4 Y2H screen to identify cellular proteins that interact with SLT-1 CIA1
Since human kidney cells are very sensitive to the action of SLT-1 [i.e. express
Gb3], a human kidney cell prey library was purchased from Clontech (Mountain View,
CA). This library was expected to express host protein fragments as prey GAL4-AD
fusion proteins rather than full length proteins. The library was titered, amplified and
transformed by the LiAc method into the yeast strain AH109 expressing the SLT-1 CIA1
GAL4 DNA-BD fusion constructs. The first step was to ensure that both bait and prey
plasmids were expressed in the AH109 yeast strain. This issue was addressed by
growing the resulting yeast strain on the SD-agar plate lacking both tryptophan and
leucine selection markers (SD-trp-leu) following an incubation period at 30°C for 5 days.
The transformation efficiency was calculated on the same plate to be greater than 1 X
106 cfu/µg DNA. Protein-protein interactions were observed by initially selecting on a
nutritionally-deprived medium lacking tryptophan, leucine and histidine (low stringency;
SD-trp-leu-his) that activated only one reporter gene followed by incubation at 30°C for
5 days. The colonies were then re-streaked on a higher stringency SD-agar plate
lacking tryptophan, leucine, histidine and adenine selection markers but with X-gal (SD-
trp-leu-his-ade+X-gal), which activated all three reporter genes. All three reporter genes
are under control of distinct GAL4 UAS and TATA box in the AH 109 yeast strain
leading to yeast survival (Figure 2.3). All yeast colonies were isolated using a yeast
25
isolation protocol [Harju et al., 2004] and transformed into E. coli TOP10 competent
cells. The DNA was isolated by standard miniprep procedure (Qiagen, Toronto, ON)
and sequenced.
2.2 expression and purification of recombinant proteins
2.2.1 Expression of His-tagged SLT-1 and isolation of the His-tagged A1 chain
Wild-type SLT-1 was cloned into a vector termed pECHE10a as an N-terminal
His-tagged fusion construct (Molecular Templates Inc., Austin, TX). The holotoxin was
expressed in E. coli JM101 strain (Stratagene, La Jolla, CA) in 2 L of LB broth
containing 100 µg/ml of ampicillin at 37°C for 16 h. Cells were lysed in lysis buffer (10x
QIAphosphate buffer pH 8.0, 300 mM NaCI and 12 mM imidazole) with protease
inhibitors (complete EDTA-free; Roche, Mannheim, Germany) and a non-specific
nuclease (Benzonase Nuclease, 2.5 kU; Novagen) followed by sonication. Cell debris
was removed by centrifugation. The lysate was loaded on a column packed with 5 ml of
nickel-NTA resin (HIS-Select Nickel Affinity Gel, Sigma-Aldrich, St. Louis, MO) and
washed with the lysis buffer. The AB5 complex was then eluted with the lysis buffer
containing 250 mM imidazole. The A1 chain was isolated by first treating the purified
AB5 complex with 20 (10 µl) units of the protease furin (New England Biolabs, Ipswich,
MA) at 30°C for 3 days. At this stage the A1 and A2 chain remain linked by a single
disulfide bond, which was reduced using 20 mM TCEP (1,2,3-tris (2-cyanoethoxy)
propane; Sigma-Aldrich, St. Louis, MO) at room temperature for 2 h. This treatment
separates the A1 chain from the A2 chain, which remains associated with the B-
pentamer. The His-tagged containing A1 chain was then recovered on nickel-NTA resin
26
in the presence of 6 M guanidine-HCl to remove the untagged A2 chain and B subunit.
The re-folding of the A1 chain was accomplished with a 6M guanidine-HCl gradient
(80% - 20%), followed by the addition of lysis buffer (10x QIAphosphate buffer pH 8.0,
300 mM NaCI and 12 mM imidazole ). Following the purification of recombinant SLT-1
A1 chain, its catalytic activity was tested in an in vitro TnT assay. The control protein
eGFP was transcribed and translated (TnT) invitro using a T7-coupled rabbit
reticulocyte lysate system in the presence of [35S]-methionine to generate its
radiolabeled version. Eight 10-fold serial dilutions of SLT-1 A1 were prepared in PBS at
a starting concentration of 1 µM of SLT-1 A1. Each of these SLT-1 A1 dilutions was
added to the TnT assay to test its ability to block protein synthesis ( 35S-labelled eGFP)
at 30°C for 90 min. Twenty (20) µl of each sample was loaded on a 4-12% gradient
SDS PAGE gel and the gel later placed in a Storm® PhosphorImager (GE Healthcare)
to detect radiolabeled bands. The experiment and purity of the recovered His-tagged
SLT-1 A1 is presented in Figure 3.6.
2.2.2 Expression of a recombinant His-tagged eGFP
eGFP was cloned into a pET15b vector (Novagen, San Diego , CA) and
expressed in the E. coli BL21(DE3) star strain in 1 L of LB broth containing 100 µg/ml of
ampicillin at 37°C for 16 h. The cell culture was then induced with 1 mM IPTG
(Invitrogen, Carlsbad, CA). The cells were lysed in PBS, pH 8.0 supplemented with
protease inhibitor (complete Mini EDTA-free; Roche, Mannheim, Germany) and a non-
specific nuclease (Benzonase Nuclease, 2.5 kU; Novagen) by mixing them with 10 g of
acid washed glass beads (150-212 µm Sigma-Aldrich, St. Louis, MI). Cell debris were
27
removed by centrifugation and the lysate was loaded onto a 2 ml column bed of Ni-NTA
resin (HIS-select Nickel affinity Gel; Sigma-Aldrich, St. Louis, MO) pre-equilibrated in
the above lysis buffer. The resin was washed with 20 ml of the same buffer before
eluting the His-tagged eGFP with 10 ml of lysis buffer containing 200 mM imidazole.
The experiment and purity of the recovered His-tagged eGFP is presented in Figure 3.6.
2.3 HeLa cell lysate pull down of putative cell protein interaction
The procedures involved in retrieving and analyzing cellular components
interacting with the His-tagged SLT-1 A1 chain are illustrated in Figure 2.4. HeLa cells
were cultured in RPMI 1640 medium containing 10% (v/v) fetal bovine serum (FBS) at
37° C. Confluent cells were harvested and centrifuged at 10,000 g for 5 min.
Approximately 3 X 109 cells were re-suspended in 12 ml of PBS containing protease
inhibitors (Complete EDTA-free, Roche, Mannheim, Germany) and non-specific
nuclease (Benzonase Nuclease, 2.5 kU; Novagen). The cells were lysed by freezing
the suspension in an ethanol/dry ice bath for 10 min followed by thawing at room
temperature for 20 min. This procedure was repeated 5 times. The lysate was isolated
from cell debris by centrifugation at 20,000 g for 15 min and the host proteins that non-
specifically adhered to Ni- NTA resin were first removed by passing the lysate through a
10 ml bed volume of Ni-NTA resin (Sigma-Aldrich, St.-Louis. MI). Ni-NTA magnetic
beads (600 µl; Promega, Madison, WI) were pre-equilibrated in PBS and washed 5
times with PBS containing 10 mM imidazole. The purified recombinant SLT-1 A1 (150
µg) and the negative control eGFP (150 µg), both carrying an N-terminal His-tag, were
28
bound to 600µl of pre-equilibrated Ni-NTA magnetic beads. The cell lysate (4 ml) was
then added to each bead preparation, incubated at room temperature for 4 h and
washed with PBS containing 10 mM imidazole five times. Potential interaction partners
for both SLT-1 A1 and eGFP were eluted from the column with 100 µl of 8 M urea to
ensure that the bait protein remained bound to the column (Figure 2.4).
2.4 Mass spectrometry and analysis of putative protein interactions
After the elution of protein from the Ni-NTA column, thiols present in the
captured protein complexes were reduced with 25 mM dithiothreitol (DTT) and the
proteins were heated at 50°C for 20 min. The free sulfhydryl groups were alkylated with
100 mM of freshly prepared iodoacetamide (Sigma-Aldrich; St Louis, MI) in the
presence of 1 mM CaCl2 and the samples were incubated in the dark for 20 min. The
alkylated proteins were then digested into peptides overnight at 37°C using sequencing-
grade trypsin (Promega, Madison, WI) [Ahmed et al., 2010].
The resulting peptide mixtures were subjected to liquid chromatography-tandem
mass spectrometry incorporating a LTQ-XL liner Ion Trap Mass spectrometer (Thermo
Scientific) linked to an Agilent 1100 nano-HPLC system. The analytical column was
made of 75 µM inner diameter fused silica (30 ml in volume) (Sutter Instruments,
Novato, CA). The column was packed with 20 cm of in-house C18 beads (Jupiter 4µ
Proteo 90A; Phenomenex, Inc., Torrance, CA) using a pressure valve. Samples (50µl)
were loaded on the column and the peptides eluted using a 2 h gradient going from
aqueous buffer A [95 % (v/v) water, 5% (v/v) acetonitrile and 0.1% (v/v) formic acid] to
29
organic buffer B [ 20% (v/v) water, 80% (v/v) acetonitrile and 0.1% (v/v) formic acid].The
mass spectrometer was operated based on data-dependent acquisition. The MS scan
was performed first and the five most intense ions from each mass spectrum (MS) were
then selected for fragmentation (MS/MS) [Ahmed et al., 2010; Gatlin et al., 1998].
The spectra of peptide sequences were analyzed using a computer algorithm
termed SEQUEST (Sage-N Research) and compared against FASTA files which
contains the human NCBI sequences. The peptides identified from SEQUEST were
then filtered and assembled to predict proteins using a peptide and protein prophets
(Institute for Systems Biology, Seattle) [MacCoss et al., 2002].
2.5 Analyzing possible protein interactions identified by Y2H screens
Plasmids coding for the full-length gene sequence of candidate interactors were
purchased from Open Biosystems (Huntsville, AL). The resulting gene cassettes were
amplified by PCR with primers (listed in Table 2.1), cut with specific restriction enzymes
within the multiple cloning site of the vector (MCS) (Table 2.1), and cloned into a
pGADT7 vector at the C-terminus of the GAL4 transcription activation domain (GAL4-
AD) (Figure 2.5). This vector contains a leucine (leu) marker and was used as our prey
plasmid in our Y2H full-length protein interaction screen.
As previously mentioned, the catalytically-inactive version of SLT-1 A1 was
cloned at the C-terminus of a GAL4 DNA-BD in a pGBKT7 vector carrying a tryptophan
(trp) selection marker. This vector serves as our bait plasmid (Figure 2.2). The Y2H
screen was then performed by co-expressing the prey and bait plasmids in the AH109
30
yeast strain. If the SLT-1 A1 bait is able to interact with a specific full-length prey protein,
the complex will allow the assembly of the GAL4 DNA-BD and GLA4-AD modules
resulting in the transcription of one or more survival/reporter genes (HIS3, ADE2, and
LacZ). Protein-protein interactions were observed by selecting for survival on a
nutritionally deprived medium, going from low stringency (SD-trp-leu-his) that activated
only one reporter gene to high stringency (SD-trp-leu-his-ade+X-gal) which activated all
three reporter genes
2.6 Analysis of putative hits identified in the HeLa cell lysate pull down/MS experiment
Plasmids encoding gene sequences for full-length eEF1A1, AHA1, MRCL3,
HSPB1 and ACTC1 were purchased from Open Biosystems (Huntsville, AL). As
previously described in chapter 2.5, the resulting gene cassettes were amplified by PCR
and cloned into a pGADT7 vector containing a T7 promoter and the details of primer
and restriction enzymes are indicated in Table 2.1. To verify the interaction between the
wild type SLT-1 A1 and full-length eEF1A1, AHA1, MRCL3, HSPB1 and ACTC1, these
proteins were expressed in vitro in a transcription and translation (TnT) assay, including
a positive control (ribosomal protein 1, RPLP1) and negative control (P1 lacking C-
terminus 17 amino acids, RPLP1-17aa). The TnT assay was performed in vitro using a
T7-coupled rabbit reticulocyte lysate system (Promega, Madison, WI) in the presence of
[35S]-methionine to generate radiolabeled versions of these proteins. Aliquots (10 µl) of
the radiolabelled proteins were added to 4 µg of the His-tagged SLT-1 A1 and incubated
at room temperature for 1 h. The mix was then incubated with 10 µl of magnetic His Ni-
31
particles (Promega, Masison, WI) for one additional hour. The beads were washed with
1 ml of PBS containing 10 mM imidazole for 5 times to eliminate any non-specific
bindings. 30 µl of SDS-PAGE loading dye was added to each sample followed by
boiling for 5 min. As a control, the radiolabeled eEF1A1, AHA1, MRCL3, HSPB1 and
ACTC1 were incubated at room temperature with 10 µl of magnetic His Ni-particles in
the absence of SLT-1 A1 for 1 h. A 15 µl sample and all the controls were loaded on an
SDS-PAGE gel, which was dehydrated in the gel dye overnight the gel scanned on a
storm® PhosphorImager (GE Healthecare).
32
Figure 2.2 pGBKT7 bait vector with restriction map and multiple cloning site (MCS). The pGBKT7 plasmid was designed to express a protein fused to amino acids 1-147 of the GAL4 DNA-BD. While fusion proteins are expressed under the constitutive ADH1 promoter, the transcription termination is under the control of a T7 promoter and an ADH1 terminator. The pGBKT7 plasmid also contains a T7 promoter, a c-Myc epitope tag as well as a unique MCS. pUC is the replication origin for E.coli whereas 2µis the replication origin for yeast. In addition, this particular vector carries a Kan antibiotic resistant marker for selection in E. coli and TRP1 nutritional marker for selection in yeast.
33
Figure 2.3 Reporter constructs in the AH109 yeast strain. The AH 109 yeast strain is a derivative of the PJ69-2A yeast strain which contains the HIS3 and ADE2 markers. MEL1/lacZ is an endogenous gene found in AH109 yeast stain and is also defined as a GAL4-responsive gene. The three reporter/survival genesare under control of 3 completely heterogenous GAL4-responsive UAS as well as TATA box. The ADE2 reporter along provides a strong nutritional selection. HIS3 is used to reduce the occurrence of false positive and increase the stringency of selection. MEL1 encodes α-galactosidase, which can be easily detected on X-α-gal indicator plate.
Figure 2.4 HeLa cell Lysate pull down assay. The pull down assay is described in the text. His-tagged SLT-1 A1 and His-tagged eGFP were bound to Ni-NTA magnetic affinity beads. Aliquots of the HeLa cell lysate were incubated with either the target or control protein bound to Ni-NTA beads. The beads were then washed to eliminate any non-specifically bound proteins. Complexes of host proteins bound to the immobilized His-tagged SLT-1 A1 were eluted off the magnetic beads and the complexes were sent for liquid chromatography-tandem mass spectrometry (LC-MS/MS).
34
Figure 2.5 pGADT7 prey vector with restriction map and MCS. The pGADT7 vector expresses a protein fused to amino acids 768-881 of the GAL4- AD. The transcription in yeast is controlled by the constitutive ADH1 promoter, and the transcription termination is driven by the ADH1 termination signal. The pGADT7 vector also contains a T7 promoter, an HA epitope tag, a unique MCS as well as a SV40 nuclear localization signal that specifically targets the yeast nucleus. pUC is the origin of replication for E.coli whereas 2µ is the replication origin for yeast. In addition, this particular vector carries an Amp antibiotic resistant marker for selection in E. coli and a LEU2 nutritional marker for selection in yeast.
35
Table 2.1 Sense and anti-sense primers used to clone the full-length gene of positive hits from both Y2H and HeLa cell lysate pull down into pGADT7 vector. The restriction enzyme sequences are highlighted in red.
Sense primers
EEF1A1 5’-CGCGCGCGCCATATGGGAAAGGAAGGAACTCAT-3’ NdeI
AHA1 5'-CGCGCGTATCATATGATGGCCAAGTGGGGTGAG-3' NdeI
UBE2I 5'-CGCGCGTATCATATGATGTCGGGGATCGCCCTC-3' NdeI
DEPDC6 5’-CGCGCGTATCATATGATGGAGGAGGGCGGCAGC-3’ NdeI
MRCL3 5’-CGCGCGCGCCATATGATGTCGAGCAAAAGAACAAAG -3’ NdeI
HSPB1 5’-CGCACTATTCATATGATGACCGAGCGCCGCGTCCCC-3’ NdeI
ACTC1 5’-CGCACGCGCCATATGATGTGTGACGACGAGGAGACC-3’ NdeI Anti-sense primer EEF1A1 5’-CGCGCGCGCGAATTCTCATTAGCCTTCTGAGCT-3’ EcoRI AHA1 5'-CGCGCGTGCGGATCCCTAAAATAAGCGTGCGCCATA-3' BamHI UBE2I 5’-CGCGCGCGCGAA TTCTTATGAGGGCGCAAACTTCTT-3’ EcoRI DEPDC6 5’-CGCGCGTATGGATCCTCAGCGCTCTAACTCCTCCAT-3’ BamHI MRCL3 5’-CGCGCGCGCGGATCCTCAGTCATCTTTGTCTTTGGC-3’ BamHI HSPB1 5’-CGCACTCGCGGATCCTTACTTGGCGGCAGTCTCATC-3’ BamHI ACTC1 5’-CGCGCGCGCGGATCCTTAGAAGCATTTGCGGTG-3’ BamHI
36
Chapter 3: Results
SLT-1 is defined as a type II RIP. It enters the host cell by undergoing
retrograde transport from the Golgi apparatus to the endoplasmic reticulum (ER) before
reaching its cytosolic target. However, the mechanism by which the catalytic domain of
SLT-1 escapes from the ER to the cytosol remains unclear. We hypothesized that there
must be some cellular components involved in its routing mechanism. Previous studies
in our laboratory had revealed 3 ribosomal proteins as binding partners for SLT-1 A1
[McCluskey et al., 2008] In my thesis, Y2H and HeLa cell lysate pull down/MS
approaches were employed to identify non-ribosomal cellular interactors of SLT-1.
3.1 Identification of eukaryotic cellular components that interact with SLT-1 A1 by Y2H screen
3.1.1 Construction and expression of GAL4 DNA-BD CIA1 fusion protein in yeast
A gene coding for the catalytically-inactive SLT-1 A1 chain was cloned into the
pGBKT7 Y2H bait vector and expressed as a fusion construct to the C-terminus of a
GAL4 DNA-BD (amino acids 1-147). Expression of the GAL4 DNA-BD CIA1 fusion
protein in AH109 yeast was validated prior to the Y2H screen. Proteins were isolated
from the CIA1-expressing AH109 yeast strain and resolved on an SDS-PAGE gel
(Figure 3.1). A western blot was subsequently performed by transferring the isolated
proteins onto a PVDF membrane and the expression of GAL4 DNA-BD CIA1 was
detected using an anti-A1 antiserum antibody (Figure 3.1) as described in chapter 2.1.3.
Two bands were observed by western blot: a ~55 kDa band representing CIA1
expressed as a fusion protein to the GAL4 DNA-BD and a ~35kDa representing
37
CIA1expressed alone. It was projected that the untagged CIA1 would not affect the
screen result since the expression of CIA1 without the GAL4 DNA-BD did not yield
cellular partners in the Y2H screen because both the GAL4-AD and the GAL4 DNA-BD
are required to drive the transcription of reporter genes (Figure 3.1).
3.1.2 Testing for autonomous activation
AH109 yeast expressing the SLT-1 CIA1 chain was serially-diluted and spotted
(10µl) on SD agar lacking tryptophan, leucine and histidine (SD-Trp-Leu-His). It was
determined through this nutritional selection that CIA1 expression did not activate
reporter genes (Figure 3.2). This finding ensures that the CIA1 GAL4 DNA-BD fusion did
not autonomously activate any of the reporter genes required for the verification of
positive clones.
3.1.3 Potential interactors identified by Y2H screen
The pACT2 yeast library was purchased from Clontech (Mountain View, CA)
was transformed into the AH109 yeast strain expressing the CIA1 GAL4 DNA-BD. This
prey vector contains truncated genes coding for human kidney cell proteins fused to the
C-terminus of the GAL4-AD (amino acid 768-881) as described in chapter 2.5.
Following nutritional selection on SD-Trp-Leu, 600 colonies were detected and re-
streaked on SD-Trp-Leu-His (low stringency) yielding 405 colonies. A higher stringency
nutritional selection (SD-Trp-Leu-His-Ade) was applied leading to the recovery of 225
colonies. The yeast plasmids were isolated for these colonies, transformed into E. coli
and subsequently sent for sequencing. The 137 colonies recovered yielded sequences
38
which coded for 67 proteins. However, only 23 proteins observed from 53 colonies had
their in frame sequences, while the rest were out of frame (Figure 3.3) and sequences
encode for these proteins are illustrated in Appendix A.
After studying the functional significance of the identified proteins, calculating
their percent coverage (greater than15%), and ranking the number of colonies that
appeared in the Y2H screen, 5 putative binding partners were selected for further
analysis. Since these putative interacting proteins were generated from a library of
truncated proteins, the respective full-length proteins were cloned into prey vectors and
tested to validate their interaction with SLT-1 CIA1 (Table 3.2).
Genes coding for the full-length proteins of ATP1B1, eEF1A1, DEPDC6, AHA1,
UBE2I, along with RPLP1 as a positive control, were cloned into the pGADT7 yeast
prey vector and expressed as fusions constructs with the GAL4-AD. The sequence
coding for SLT-1 CIA1 was cloned into the pGBKT7 yeast bait vector and expressed as
a fusion construct to the C-terminus of the GAL4 DNA-BD. Interactions were tested by
co-expressing the prey vector carrying the full-length gene of a putative interactor and
the bait vector carrying CIA1 in the AH109 yeast strain. Following nutritional selection on
SD-Trp-Leu-His, no interaction was observed between SLT-1 CIA1 and any of the
potential interactors. However, an interaction was observed between SLT-1 CIA1 and
the positive control (RPLP1) [SLT-1 A1 docks onto the ribosome stalk protein PPLP1]
(Figure 3.4).
39
Figure 3.1 Expression of the SLT-1 CIA1 GAL4 DNA-BD fusion in the yeast strain AH109. Left Panel: SDS-PAGE gel of the whole yeast cell lysate from AH109 yeast cells transformed with a bait vector along (control vector) or the bait vector expression CIA1
DNA-BD construct. Right Panel: Western blot probed with an anti-SLT-1 A1 chain antisera. The black arrow indicates the band corresponding to CIA1 fused to the GAL4 DNA-BD, while a grey arrow indicates the band corresponding to the CIA1 protein lacking the GAL4 DNA-BD [Taken from McCluskey PhD thesis, 2010].
Figure 3.2 SLT-1 CIA1 does not autonomously activate reporter genes in yeast. SLT-1 CIA1 was expressed as a fusion to the C-terminus of the GAL4 DNA-BD and transformed into the AH109 yeast strain. The yeast strain was then inoculated in the SD media lacking tryptophan and grown overnight at 30°C. The O.D. (600nm) of the resulting yeast cell culture was adjusted to 1.0, serially diluted 10-fold in PBS, and spotted on the SD-Trp plate to select for the presence of the bait plasmid as well as on SD-Trp-Leu-His to test for autonomous activation.
40
Figure 3.3 Yeast-2-Hybrid library transformation and screening. Selecting positive yeast colonies from low stringency to high stringency eliminated false positives. Low stringency was used to test the presence of the bait and prey plasmids as well as transformation efficiency. Medium stringency was used to test interactions that lead to survival of yeast cells. High stringency was used to test interactions activating three distinct reporter genes. As a result, 225 colonies were selected, of which 137 colonies coded for 67 proteins. Of these 67 proteins, only 23 proteins were coded by nucleotide sequences that were in frame.
41
Table 3.1 Yeast-two-hybrid screen identified protein fragments extracted from human kidney cells associated with the A1 chain of SLT-1.
Protein # of amino acids
# of positive colonies
% Coverage
ATP1B1 303 9 220-303(5), 27%
181-303 (1), 40%
119-303 (1), 61%
236-303 (1), 22%
72-303 (1), 76%
NPHP4 1425 8 1365-1425 (8), 4%
RPLP0 317 4 63-317 (2), 80%
56-297 (2), 76%
EEF1A1 462 4 263-462 (4), 43%
UBE2I 158 3 1-158 (3), 100%
UMOD 640 3 297-397 (2), 16%
358-444 (1), 13%
DEPDC6 409 3 347-409 (3), 15%
RPLP1 114 2 1-114 (2), 100%
NDUFA4 81 2 1-81 (2), 100%
FEZ2 380 2 34-278 (2), 64%
RPL34 117 1 1-117 (1), 100%
MAT2A 161 1 19-161 (1), 88%
AHA1 338 1 86-338 (1), 74%
DNAJA1 397 1 141-397 (1), 64%
IGSF21 497 1 188-467 (1), 60%
ATP1B3 279 1 151-279 (1), 46%
MRI1 369 1 256-369 (1), 31%
RSL24DI 163 1 124-163 (1), 24%
HPD 393 1 304-393 (1), 23%
DXY1C1 420 1 371-420 (1), 12%
ASXL1 1541 1 1254-1404(1),10%
NPHP3 1330 1 125-224 (1), 7%
COL1A2 1366 1 1293-1366 (1), 5%
42
Table 3.2 Proteins that were selected for further analysis from the Y2H screen. Proteins highlighted in green were identified as interactors for SLT-1 A1 in both previous studies and the HeLa cell lysate pull down/MS preformed in this thesis project. The protein highlighted in red was identified in both the initial Y2H screen and HeLa cell lysate pull down/MS in this thesis project.
43
3.2 Confirming catalytic activity of wild-type SLT-1 A1
It was essential to confirm that purified SLT-1 A1 isolated fromE. coli that
expressesthewild-typeSLT-1 AB5complex is catalytically active and properly folded prior
to preforming pull down experiment with HeLa cell lysate. The catalytic activity of SLT-1
A1 was measured by its ability to block protein synthesis in vitro. In a rabbit reticulocyte
transcription and translation (TnT) assay described in chapter 2.6. The activity of SLT-1
A1 was monitored by adding eight 10-fold serial dilutions of SLT-1 A1 to TnT reactions
generating [35S]-methionine radiolabeled eGFP. As indicated in Figure 3.5, there was
eGFP expression at concentrations lower than 1 µM of SLT-1 A1.As the concentration of
SLT-1 A1 decreases, the expression of the radiolabeled eGFP protein increases. Thus,
we concluded that the prepared SLT-1 A1 chain is active and properly folded.
3.3 Mass spectrometry identification of eukaryotic cellular components interacts with SLT-1 A1
3.3.1 Purification of His-tagged recombinant SLT-1 and eGFP
The recombinant SLT-1 A1 and negative control eGFP protein were successfully
created, expressed and purified as described in Chapter 2.2.1 (Figure 3.6).
44
Figure 3.4 Validation of interactions between SLT-1 CIA1 and five potential binding partners. Interactions betweenSLT-1 CIA1 expressed in a bait plasmid as a fusion to the GAL4 DNA-BD and full-length proteins, eEF1A1, AHA1, UBE2I, DEPDC6, ATP1b1, and RPLP1 (positive control), expressed in a prey plasmid as a fusion to the C-terminus of the GAL4 AD, were confirmed in AH109 yeast cells. Colonies were inoculated overnight and spotted as 10-fold serial dilutions on an SD-Trp-Leu plate to test for the presence of both bait and prey plasmids, followed by spot dilutions on an SD-Trp-Leu-His plate to detect possible interacting partners indicated by colony growth. Only the interaction between RPLP1 and SLT-1 A1 was confirmed in this assay.
45
Figure 3.5 In vitro catalytic activity assay indicating the wild-type SLT-1 A1 chain blocks protein synthesis. Eight ten-fold serial dilutions of the wild-type SLT-1 A1 chain were added to rabbit reticulocyte lysate [TnT] assay expressing 35S-labeled eGFP to test its ability to block protein synthesis in vitro. PBS was used as a negative control. Samples containing the radiolabeled eGFP were run on an SDS-PAGE and the 35S-eGFP band visualized using a phosphorimager. The wild-type A1 chain blocks protein synthesis at a concentration of 10-10M.
SLT-1 A1 Molarity
46
Figure 3.6 An SDS-PAGE of His-tagged eGFP and His-tagged SLT-1 A1 proteins purified using Ni-NTA beads as described in Chapter 2.2.1. The band at ~35kDa (arrow, panel A) represents His-tagged eGFP (MW=32kDa), while the band ~30kDa (arrow, Panel B) is that of purified His-tagged SLT-1 A1 (MW=27kDa).
47
3.3.2 List of putative proteins determined by HeLa cell lysate pulldown
The recombinant SLT-1 A1 domain harboring an N-terminal His-tag was
incubated with a HeLa cell lysate to identify cellular host protein binding partners.
Protein complexes containing the A1 chain were then recovered on Ni-NTA resin and
binding partners were dissociated from the A1 chain by with 8 M urea. Protein bands
were resolved by SDS-PAGE. Coomassie blue staining revealed several protein bands
not observed in the control eGFP pull down sample (Figure 3.7). The elution samples of
both negative control eGFP and SLT-1 A1 were then analyzed by mass spectrometry
without further purification. As a result, putative proteins were identified including
eEF1A1, which was also identified by Y2H (Figure 3.8). A more comprehensive List of
putative SLT-1 A1 protein patterns identified in this screen is presented in appendix B.
Based on the number of total peptides and unique peptides, as well as the
percentage coverage and functional significance, 4 of these proteins were selected to
test their one to one interaction with SLT-1 A1 (Table 3.3). The full-length proteins of
eEF1A1 (eukaryotic translation elongation factor 1 alpha 1), MRCL3 (Myosin regulatory
light chain 12A), HSPB1 (Heat shock 27KDa protein 1) and ACTC1 (Actin, alpha
cardiac muscle 1), along with positive control (RPLP1) and negative control (RPLP1
lacking last 17 amino acids), were cloned into a pGADT7 vector containing a T7
promoter. In addition, the Hsp90 cofactor AHA1 detected in the Y2H screen was also
cloned into a pGADT7 vector to confirm its interaction with SLT-1 A1 due to its
involvement in the ER to the Golgi trafficking. Radiolabeled versions of these proteins
were generated using a T7-coupled rabbit reticulocyte lysate system TnT assay
(Promega, Madison, WI) in the presence of [35S]-methionine. interactions between these
48
35S labeled proteins and the toxin A1 chain were detected by a pull down with His-
tagged SLT-1 A1 followed by SDS PAGE and gel exposure on a storm® phosphorimage
(GE Healthecare) (Figure 3.9). From this experiment, an interaction was detected
between SLT-1 A1 and the positive control (RPPL1). No interaction was observed
between SLT-1 A1, MRCL3, HSPB1, ACTC1, AHA1 or the negative control (RPLP1
lacking its C-terminal 17 amino acids).
In order to confirm the results above, the full-length genes coding for MRCL3,
HSPB1 and ACTC1, along with the positive control (RPLP1), were also cloned into the
pGADT7 yeast prey vector and expressed as fusion constructs to GAL4-AD. SLT-1 CIA1
was cloned into the pGBKT7 yeast bait vector and expressed as fusion construct to the
C-terminus of the GAL4 DNA-BD. Interactions were tested by co-transforming the prey
vector carrying the full-length gene coding for these 3 proteins and the bait vector
carrying CIA1 in the AH109 yeast strain. Following nutritional selection on SD-Trp-Leu-
His, no interactions were observed between SLT-1 CIA1 and any of the potential
interactors, except the positive control, RPLP1 (Figure 3.10).
49
Figure 3.7 HeLa cell lysate pull down/MS results. HeLa cells lysate were mixed with His-tagged SLT-1 A1 or His-tagged eGFP (negative control), respectively. The complexes were recovered on Ni-NTA beads. Recovered proteins from the Ni-NTA step were sent for LC-MS/MS). Several proteins were pulled down by SLT-1 A1 that did not pulled down by negative control eGFP.
50
Figure 3.8: HeLa lysate pull down/MS analysis of HeLa cell proteins that associated with the A1 chain of SLT-1. A Selected set of HeLa cell proteins identified by Mass Spectrometry (MS). The blue circles indicate proteins that only bind to SLT-1 A1, the red and green circles show proteins that interact with SLT-A1 as well as with each other. In addition, RPLP0 and RPLP2 (green) are known ribosomal binding partners of SLT-1 A1, whereas eEF1A1 appears to be a non-ribosomal binding partner of SLT-1 A1.
51
Table 3.3 List of proteins deduced from the MS sequencing data. Proteins highlighted in green were identified as interactors for SLT-1 A1in both previous studies and the HeLa cell lysate pull down/MS preformed in this thesis project. The protein highlighted in red was identified in both the initialY2H screen and HeLa cell lysate pull down/MS in this thesis project.
52
Figure 3.9 Ni-NTA pull down showed no interaction between SLT-1 A1 and eEF1A1, AHA1, MRCL3, HSPB1 and ACTC1. The proteins in question, along with positive (RPLP1) indicated in black arrow and negative controls (RPLP1-17aa), were individually expressed as [35S]-labeled proteins and incubated with 4µg of A1 chain bound to 15µl of magnetic Ni-NTA beads. The resulting pull downs were separated by SDS-PAGE and the bands corresponding to radiolabeled binding partners were detected on a phosphorimager.
53
Figure 3.10 Confirmation of results generated by the Hela cell lysate pull down using Y2H. SLT-1 CIA1 was expressed in a bait plasmid as a fusion construct to the GAL4 DNA-BD in the AH109 yeast strain with a prey plasmid expressing the full-length genes of MRCL3, HSPB1, ACTC1, or RPLP1 (positive control) fused to the C-terminus of the GAL4 AD. The yeast colonies were inoculated overnight and spotted as 10-fold serial dilutions on an SD-Trp-Leu plate to test for the presence of both bait and prey plasmids. Ten-fold serial dilutions of these yeast colonies were then spotted on an SD-Trp-Leu-His plate to select for possible interacting partners as indicated by colony growth.
54
Chapter 4: Conclusion, Discussion and Future Directions
4.1 Summary of Y2H results
The goal of this thesis project was to use an Y2H screen and HeLa-lysate pull
down assay to identify non-ribosomal binding partners of SLT-1 A1. These two
techniques were employed to work in conjunction, with the aim to narrow the list of hits
found from both types screen and increase the confidence of our results. The Y2H
screen and HeLa-lysate pull down assay revealed one common putative binding partner
(eEF1A1). The full-length gene of eEF1A1 was subsequently cloned into a prey vector
(pGADT7) to validate its interaction with SLT-1 A1 using an Y2H system. In addition, an
in vitro TNT assay was performed to test whether SLT-1 A1 binds to eEF1A1 directly or
to a complex that associates with eEF1A1. The results from the TNT assay showed that
eEF1A1 is not a true binding partner (Figure 3.4 and 3.9). Other potential interactors
from the Y2H screen were then tested individually to validate their interaction with SLT-1
A1 via an independent Y2H assay and/or an in vitro 35S-labeled experiment in a TNT
assay followed by a pull down with His-tagged SLT-1 A1 magnetic Ni-NTA beads.
Unfortunately, none of the putative interactors displayed a real interaction with SLT-1 A1.
4.2 Discussion of Y2H Results
4.2.1 False positives
The Y2H screen is a very popular and powerful tool that has been extensively
used to study large scale protein interactions. The Y2H strategy is advantageous
because it is an in vivo assay that can detect relatively weak and transient protein
interactions. In addition, this technique is inexpensive and very easy to implement
55
[Estojak et al., 1995; Guarente, L., 1993; Field and song., 1989]. However, Y2H screen
also have some disadvantages such as false positives that need to be taken into
consideration. Specifically, false positives generated in Y2H screen are physical
interactions detected in the screen that cannot be reproduced in an independent system
[Brϋckner et al., 2009]. We did reveal levels of stringency to avoid false positives
(Figure 3.3). A common explanation for false positive is that some bait proteins may
have had intrinsic transcriptional activating properties. This means that the reporter
genes could have activated upon interaction with the prey protein. In these studies,
SLT-1 A1 does not cause autonomous activation. Alternatively, during the initial
screening process, the prey proteins may also cause autonomous activation of reporter
genes by bound to the reporter proteins fused to the bait to generate false positive
results. Another possible source of false positives could be a high expression level of
bait and prey proteins. Their localization in the yeast cell compartment may not reflect
to their native cellular environment. In addition, the overexpression of certain prey
proteins may allow yeast to overcome nutritional selection and present as a false
positive. Furthermore, proteins that are not folded properly can also give false positive
interactions. Finally, in a classic Y2H screen, the prey library contains many fragments
of cDNA of human proteins instead of their corresponding full-length proteins.
Therefore, the library can largely cover the transcriptome to reduce rates of false
negatives; however, this strategy can also increase the occurrence of protein fragments
that give rise to false positives.
56
4.2.2 False negatives
Although Y2H is designed to reduce the rate of false negatives, they cannot be
avoided completely. The classic Y2H screen requires the translocation of the interactor
into the yeast nucleus. This makes membrane associated proteins, integral membrane
proteins, as well as numerous soluble cytosolic proteins and proteins located in other
subcellular compartments, very difficult to detect [Niethammer et al., 1996; Sugita et al.,
1996]. To overcome this problem, truncated versions of proteins are used for the prey
library during the screening process. However, this fragments library can lead to
misfolded proteins that do not interact with SLT-1 A1 and thus false negatives. Other
false negative results may occur because the bait and prey constructs used in the Y2H
assay are not usually symmetric. Specifically, the fused yeast reporter protein can
cause steric hindrance that may block the interaction between prey and bait proteins. In
addition, differences in post-translational protein modification systems between yeast
and other higher eukaryotes, protein may lead to loss of interactions that are dependent
on post-translational modifications and thus false negative. Despite the fact that Y2H is
a very sensitive method to detect protein interactions, very transient interactions often
still escape detection, which is another reason for false negatives. Studies have
indicated that false negatives can cause major problems in the reproducibility of Y2H
screens. For example, study was shown that using the same procedure for two
individual Y2H screens produces less than 30% overlap of hits identified between the
two screens. Furthermore, only about 12.5% of known protein interactions were
determined from each screen [Ito et al., 2001]. This finding demonstrates that false
57
negatives are a major limitation of the Y2H screen in terms of describing a complete
protein interaction network.
4.3 Summary of HeLa cell lysate pull down/MS
The initial HeLa cell lysate pull down assay was able to provide a list of potential
binding partners, including eEF1A1 which was also identified by the Y2H screen. The
top hits from the pull-down approach were then cloned into the pGADT7 vector which
carries a T7 promoter. The 35S radiolabeled version of these proteins were then
generated using an in vitro TNT assay followed by magnetic Ni-NTA pull down to test
their individual interaction with SLT-1 A1. These results were then confirmed with
independent Y2H assays. These subsequent analyses revealed that none of the top hits
showed interaction with SLT-1 A1 (Figure 3.9 and 3.10).
4.4 HeLa cell lysate pull down/MS Discussion
The Affinity purification of SLT-1 A1 interactions followed mass spectrometry is a
very powerful technique used for large-scale interactome research. It is often used in
combination with Y2H screen to complement and cross-reference results. It is more
expensive and less accessible then Y2H, but it allows for the identification of proteolytic
fragments of protein and the detection of entire proteins, as well as protein complexes
[Nazabal et al., 2006]. However, there are some drawbacks of this technique as well.
For example, the proteins in the complex it “pulls down” may not necessarily be involved
58
in direct interaction with the bait. Therefore, each interaction has to been tested
individually. This process can be very time-consuming. In addition, the HeLa cell lysate
pull down assay is biased towards highly abundant proteins. The non-ribosomal
interaction partners were the focus of this thesis. However, the ribosome component of
the cell lysate was not removed during the pull down process. Ribosomes are very
abundant in the cell lysate and make up a high percentage of the dry weight of the cell.
Non-ribosomal proteins of low abundance can thus be overlooked because of their
small quantity and size compared to abundant ribosomal proteins. Therefore, it is more
likely that non-ribosomal proteins will not be detected by mass spectrometry due to high
abundance of ribosomal proteins outcompeting them for binding to SLT-1 A1.
Consequently, false negatives do occur. Furthermore, in a standard pull down
assay/MS, a dual tagged recombinant protein is typically used to generate more
specific, effective and sensitive results and reduce false positives [Collins and
Choudhary., 2008; Puig et al., 2001]. However, a single His-tagged SLT-1 A1 was used
in our HeLa cell lysate pull down assay. The lack of a dual purified tag may have
generated numerous non-specific binding partners and, thus, false positives.
4.5 Future directions
4.5.1 Enrichment of non-ribosomal binding partners
Since the non-ribosomal interaction partners represented the focus of this
thesis, the first step is to improve the HeLa cell lysate pull down step by enriching it for
non-ribosomal binding partners. To achieve this, the ribosomal component of the cell
lysate to be used will be removed by ultracentrifugation at 30, 000 rpm for 2 h.
59
4.5.2 Utilizing a dual-tag purification approach to generate more sensitive and specific results
In order to eliminate non-specific interaction partners, a Strep-His-Tev dual
tagged SLT-1 A1, as well as a negative control (Strep-His-Tev dual tagged eGFP), will
need to be conducted instead of the single His-tagged version of the protein of interest.
In addition, before the elution with imidazole, TEV protease will be used to cleave off the
dual tagged SLT-1 A1 and any bound protein complex(es). Furthermore, an excess
amount of un-tagged SLT-1 A1 can be used as an additional control to compete for
binding with the dual-tagged SLT-1 A1 to its targets further eliminate non-specific
interactions.
4.5.3 Performing a lentiviral RNAi screen
The Y2H and HeLa cell lysate pull down assays only identify physical binding
partners. However, the function of any interactor is required in order to determine its
relationship with SLT-1 in nature. A lentiviral RNA interference (RNAi) screening assay
can provide such functional insight and may reveal more detailed information regarding
the intracellular routing pathway of SLT-1. However, the downside of this approach is
that genes required for cell survival cannot be investigated. Some positive or negative
controls may have to be considered carefully in order to achieve optimal results from
this experiment.
The lentiviral RNAi screen uses a lentiviral short hairpin RNA (shRNA) library
consisting of 80 000 shRNAs that can silence 16 000 human genes (5 hairpins per
60
gene) upon infection with RNAi. This screen is defined as a loss-of-function assay. The
description of the screen is presented in Figure 4.1 [Moffat et al., 2006].
In this case, a human cell line that is susceptible to SLT-1 will be infected with
the pool of shRNAs and treated with wild-type SLT-1. The cells that become resistant to
the toxin due to the silencing of a specific gene will then be selected and the genomic
DNA isolated to identify their shRNA responsible for its SLT-1 resistance.
Preceding the lentiviral RNAi screen, a toxicity curve of wild-type SLT-1 will
need to be generated to determine the concentration required to achieve greater than
90% of killing (CD90). The susceptible human cell line will then be treated with SLT-1
using double the concentration of its CD90 vaule. A dose response curve will also need
to be generated to determine the protamine sulphate, polybrene and puromycin
sensitivity of the cell line to be used in the screen. Protamine sulphate or polybrene will
be used during the experiment to improve lentiviral infection efficiency and puromycin
will be used to select cells infected with a shRNAs. In addition, the multiplicity of
infection (MOI) of the desired cell line will be measured prior to the screen to help
determine the amount of virus required to treat the cells for the experiment.
61
Figure 4.1 Methodology for the Lentiviral RNAi screen. Step 1: Infect susceptible human cells with shRNA lentivirus library. Step 2: Treat the infected cells with WT-SLT-1. Step 3: Select cells that show resistance to the cytotoxicity. Step 4: Isolate the genomic DNA and identify shRNAs responsible for cell survival.
62
5.0 References Adelaide, J.; Margolis, B.; Birnbaum, D. ERBIN (2000) A basolateral PDZ protein that interacts with themammalian ERBB2/HER2 receptor. Nat. Cell Biol2, 407-414. Ahmed, S. M., Daulat, A. M., Meunier, A. and Anger, S. (2010) G protein betagamma subunits regulate cell adhesion through Rap1a and its effector Radi.l J Biol Chem285, 6538-6551.
Allured, V.S., Collier, R.J., Carroll, S.F. & McKay, D.B (1986). Structure of exotoxin A of Pseudomonas aeruginosa at 3.0-Angstrom resolution. Proc Natl Acad Sci U S A 83, 1320-1324. Andrew Jeffery McCluskey (2010). Shiga-like Toxin 1: Molecular Mechanism of Toxicity and Discovery of Inhibitors. Austin, P.R., Jablonski, P.E., Bohach, G.A., Dunker, A.K and Hovde, C.J(1994). Evidence that the A2 fragment of shiga-like toxin type 1 is required for holotoxin assembly. Infect, Immun. 62, 1768-1775. Bast, D.J., Banerjee, L., Clark, C., Read, R.J., and Brunton, J.L. (1999). The identification of three biologically relevant globotriaosyl ceramide receptor binding sites on the Verotoxin 1 B subunit. Mol Microbiol 32, 953-960. Bell, CE, Eisenberg, D. (1996). Crystal structure of diphtheria toxin bound to nicotinamide adenine dinucleotide. Biochemistry 35 (4), 1137–49. Bennett, MJ and Eisenberg, D. (1994). Refined structure of monomeric diphtheria toxin at 2.3 A resolution.Protein Sci3 (9), 1464–75. Brigotti, M., Rambelli, F., Zamboni, M., Montanaro, L., and Sperti, S. (1989). Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes. Biochem J 257, 723-727. Brodsky, J. L., and A. A. McCracken. (1999). ER protein quality control and proteasome-mediated protein degradation. Semin. Cell Dev. Biol. 10,507– 513. Brϋckner, A., Polge, A., Lentze, N., Auerbach, D and Schlattner, U. (2009). Yeast Two-Hybrid, a Powerful Tool for Systems Biology. Int. J. Mol. Sci. 2009 (10), 2763-2788. Collins, M.O.; Choudhary, J.S.(2008). Mapping multiprotein complexes by affinity purification and mass spectrometry. Curr. Opin. Biotechnol., 19, 324-330.
63
Cimolai, N., Carter, J. E., Morrison, B. J., and Anderson, J.D. (1990). Risk factors for the progression of Escherichia coli O157:H7 enteritis to hemolytic-uremic syndrome.J. Pediatr. 116, 589-592. Choe, S., Bennett, MJ., Fujii, G., Curmi, PM., Kantardjieff, KA., Collier, RJ., and Eisenberg, D. (1992). The crystal structure of diphtheria toxin. Nature 357 (6375), 216–22. Collier, R. J (1975) Diphtheria toxin: mode of action and structure. Bacteriol Rev39, 54–85. Deeks, E.D., Cook, J.P., Day, P.J., Smith, D.C., Roberts, L.M., and Lord, J.M.(2002). The low lysine content of ricin A chain reduces the risk of proteolytic degradation after translocation from the endoplasmic reticulum to the cytosol. Biochemistry 41, 3405-3413. Donta, S.T., Tomicic, T.K., and Donohue-Rolfe, A. (1995). Inhibition of Shiga-like toxins by brefeldin A. J Infect Dis 171, 721-724. Endo, Y., Mitsui, K., Motizuki, M., and Tsurugi, K. (1987). The mechanism of action of ricin and related toxic lectins on eukaryotic ribosomes. The site and the characteristics of the modification in 28 S ribosomal RNA caused by the toxins. J Biol Chem262, 5908-5912. Endo, Y., and Tsurugi, K. (1988b). The RNA N-glycosidase activity of ricin A-chain. The characteristics of the enzymatic activity of ricin A-chain with ribosomes and with rRNA. J Biol Chem 263, 8735-8739. Estojak, J., Brent, R and Golemis, E. A. (1995) Correlation of two-hybrid affinity data with in vitro measurements. Molecular and Cellular Biology 15:5820–5829. Guarente, L. (1993) Strategies for the identification of interacting proteins. Proc. Natl. Acad. Sci. USA 90:1639–1641. Fields, S., and Song, O. (1989). A novel genetic system to detect protein-protein interactions. Nature340, 245-246.
Fraser, M.E., Chernaia, M.M., Kozlov, Y.V., and James, M.N. (1994). Crystal structure of the holotoxin from Shigella dysenteriae at 2.5 A resolution. Nat Struct Biol 1, 59-64. Garred, O., van Deurs, B., and Sandvig, K. (1995). Furin-induced cleavage and activation of Shiga toxin. J Biol Chem 270, 10817-10821. Gatlin, C. L., Kleemann, G. R., Hays, L. G., Link, A. J and Yates, J. R., 3rd (1998). Proteinidentification at the low femtomole level from silver-stained gels using a new
64
fritlesselectrospray interface for liquid chromatography-microspray and nanospray mass spectrometry. Anal. Biochem 263, 93–101. Hazes, B., and Read, R.J. (1997). Accumulating evidence suggests that several AB-toxins subvert the endoplasmic reticulum-associated protein degradation pathway to enter target cells. Biochemistry 36, 11051-11054. Hey, T.D., Hartley, M., and Walsh, T.A. (1995). Maize ribosome-inactivating protein (b-32). Homologs in related species, effects on maize ribosomes, and modulation of activity by pro-peptide deletions. Plant Physiol 107, 1323-1332. Heyningen, S.V. (1974). Cholera toxin: interaction of subunits with ganglioside GM1. Science183, 656-657. Hudson, T.H., and Grillo, F.G. (1991). Brefeldin-A enhancement of ricin A-chain immunotoxins and blockade of intact ricin, modeccin, and abrin. J Biol Chem 266, 18586-18592. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983). Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153, 163-168. Ito, T.; Chiba, T.; Ozawa, R.; Yoshida, M.; Hattori, M.; Sakaki, Y(2001). A comprehensive two-hybridanalysis to explore the yeast protein interactome. Proc. Natl. Acad. Sci. USA98, 4569-4574. Iwamoto, R., Higashiyama, S.,Mitamura, T., Taniguch,i N., KlagsbrunM, et al. (1994) Heparin-binding EGF-like growth factor, which acts as the diphtheria toxin receptor, forms a complex with membrane protein DRAP27/CD9, which up-regulates functional receptors and diphtheria toxin sensitivity. EMBO J 13: 2322–30. Jacewicz, M., Clausen, H., Nudelman, E., Donohue-Rolfe, A., and Keusch, G.T. (1986). Pathogenesis of shigella diarrhea. XI. Isolation of a shigella toxin-binding glycolipid from rabbit jejunum and HeLa cells and its identification as globotriaosylceramide. J Exp Med163, 1391-1404. Jackson, M.E., Simpson, J.C., Girod, A., Pepperkok, R., Roberts, L.M., and Lord, J.M. (1999). The KDEL retrieval system is exploited by Pseudomonas exotoxin A, but not by Shiga-like toxin-1, during retrograde transport from the Golgi complex to the endoplasmic reticulum. J Cell Sci112 (4), 467-475. Jiang, J.X. & London, E (1990).. Involvement of denaturation-like changes in Pseudomonas exotoxin a hydrophobicity and membrane penetration determined by characterization of pH and thermal transitions. Roles of two distinct conformationally altered states. J Biol Chem 265, 8636-8641.
65
Karmali, M.A. (1989). Infection by verocytotoxin-producing Escherichia coli. Clin Microbiol Rev 2, 15-38. Karmali, M. A., Petric, M., Lim, C., Fleming, P. C., Arbus,G. S., and Lior, H. (1985). The association between idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli.J. Infect. Dis. 151, 775-782. Katada, T., Tamura, M., and Ui, M. (1983). The A protomer of islet-activating protein, pertussis toxin, as an active peptide catalyzing ADP-ribosylation of a membrane protein. Arch Biochem Biophys224, 290-298. Kounnas, M.Z., et al (1992). The alpha 2-macroglobulin receptor/low density lipoprotein receptor-related protein binds and internalizes Pseudomonas exotoxin A. J Biol Chem 267, 12420-12423. Kovacs, M. J., Roddy, J., Gregoire, S., Cameron, W., Eidus,L., and Drouin, J. (1990). Thrombotic thrombocytopenic purpura following hemorrhagic colitis due to Escherichia coli O157:H7. Am. J. Med. 88, 177-179. Kozlov, Y.V., Chernaia, M.M., Fraser, M.E., and James, M.N. (1993). Purification and crystallization of Shiga toxin from Shigella dysenteriae. J Mol Biol 232, 704- 706. LaPointe, P., Wei, X., and Gariepy, J. (2005). A role for the protease-sensitive loop region of Shiga-like toxin 1 in the retrotranslocation of its A1 domain from the endoplasmic reticulum lumen. J Biol Chem 280, 23310-23318. Lea, N., Lord, J.M., and Roberts, L.M. (1999). Proteolytic cleavage of the A subunit is essential for maximal cytotoxicity of Escherichia coli O157:H7 Shiga like toxin-1. Microbiology 145 ( 5), 999-1004. Lencer, W.I., Constable, C., Moe, S., Jobling, M.G., Webb, H.M., Ruston, S., Madara, J.L., Hirst, T.R., and Holmes, R.K. (1995). Targeting of cholera toxin and Escherichia coli heat labile toxin in polarized epithelia: role of COOH-terminal KDEL. J Cell Biol 131, 951-962. Lindberg, A.A., Brown, J.E., Stromberg, N., Westling-Ryd, M., Schultz, J.E., and Karlsson, K.A. (1987). Identification of the carbohydrate receptor for Shiga toxin produced by Shigella dysenteriae type 1. J Biol Chem 262, 1779-1785. Lingwood, C.A., Law, H., Richardson, S., Petric, M., Brunton, J.L., De Grandis, S., and Karmali, M. (1987). Glycolipid binding of purified and recombinant Escherichia coli produced verotoxin in vitro. J Biol Chem 262, 8834-8839. Linnik, K. M., and H. Herscovitz. (1998). Multiple molecular chaperones interact with apolipoprotein B during its maturation. J. Biol. Chem. 273,
66
21368–21373 MacCoss, M. J., Wu, C. C and Yates, J. R., 3rd. (2002) Probability-based validation of protein identifications using a modified SEQUEST algorithm. Anal. Chem74, 5593–5599. Madshus, I. H., Stenmark, H (1992). Entry of ADP-ribosylating toxins into cells. Curr Top Microbiol Immunol 175, 1–26 Marques, L. R., Moore, M. A., Wells, J. G., Wachsmuth, I.K., and O’Brien, A. D. (1986). Production of Shiga-like toxin by Escherichia coli.J. Infect. Dis. 154, 338-341. McCluskey, A.J., Poon, G.M., and Gariepy, J. (2007). A rapid and universal tandem-purification strategy for recombinant proteins. Protein Sci 16, 2726-2732. Mere, J., Morlon-Guyot, J., Bonhoure, A., Chiche, L. & Beaumelle, B (2005).. Acid triggeredmembrane insertion of Pseudomonas exotoxin A involves an original mechanism based on pH-regulated tryptophan exposure. J Biol Chem280, 21194-21201. Merritt, E and Hol, W. (1995). AB5 toxins. Curr Opin Struct Biol 5 (2), 165–71. Meunier, L., Y.-K. Usherwood, K. Chung, and L. Hendershot. (2002). A subset of chaperones and folding enzymes form multiprotein complexes in endoplasmic reticulum to bind nascent proteins. Mol. Biol. Cell13, 4456–4469. Moffat, J., Grueneberg, D.A., Yang, X., Kim, S.Y., Kloepfer, A.M., Hinkle, G., Piqani, B., Eisenhaure, T.M., Luo, B., Grenier, J.K., Carpenter, A.E., Foo, S.Y., Stewart, S.A., Stockwell, b.R., Hacohen, N., Hahn, W.C., Lander, E.S., Sabatini, DM and Root, D. E. (2006). A lentiviral RNAi library for human and mouse gene applied to an arrayed viral Hign-content Screen. Cell 124, 1283-1298. Montanaro, L., Sperti, S., Mattioli, A., Testoni, G., and Stirpe, F. (1975). Inhibition by ricin of protein synthesis in vitro. Inhibition of the binding of elongation factor 2 and of adenosine diphosphate-ribosylated elongation factor 2 to ribosomes. Biochem J146, 127-131. Montfort, W., Villafranca, J.E., Monzingo, A.F., Ernst, S.R., Katzin, B., Rutenber, E., Xuong, N.H., Hamlin, R., and Robertus, J.D. (1987). The three-dimensional structure of ricin at 2.8 A. J Biol Chem 262, 5398-5403. Moss, J., Stanley, S.J., Burns, D.L., Hsia, J.A., Yost, D.A., Myers, G.A., and Hewlett, E.L. (1983). Activation by thiol of the latent NAD glycohydrolase and 131 ADP-ribosyltransferase activities of Bordetella pertussis toxin (islet-activating protein). J Biol Chem258, 11879-11882.
67
Naglich, J. G., Metherall, J.E., Russell, D. W and Eidels, L (1992.) Expression cloning of adiphtheria toxin receptor: identity with a heparin-binding EGF-like growth factor precursor. Cell 69, 1051–61. Nazabal, A.; Wenzel, R.J.; Zenobi, R.(2006). Immunoassays with direct mass spectrometric detection.Anal. Chem.78, 3562-3570. Niethammer, M.; Kim, E.; Sheng, M.(1996). Interaction between the C terminus of NMDA receptor subunits and multiple members of the PSD-95 family of membrane-associated guanylate kinases. J. Neurosci 16, 2157-2163. O’Brien, A. D., Newland, J., Miller, S. F., Holmes, R. K.,Smith, H. W., and Formal, S. F. (1984). Shiga-like toxin-converting phages from Escherichia coli strains that cause hemorrhagic colitis or infantile diarrhea.Science226, 694-696. O’Brien. A.D., Tesh, V. L., Donohue-Rolfe, A., Jackson, M.P., Olsnes. S., Sandvig, K., Lindberg, A. A and Keusche, G. T (1992). Shiga toxin: biochemistry, genetics, mode of action and role in pathogenesis. Curr. Top. Microbiol. Immunol. 180, 65-94. Orlandi, P.A., Curran, P.K., and Fishman, P.H. (1993). Brefeldin A blocks the response of cultured cells to cholera toxin. Implications for intracellular trafficking in toxin action. J Biol Chem268, 12010-12016. Pappenheimer, A. M (1993).The story of a toxic protein. Protein Sci 2: 292–8,1888-1992. Perlmutter, D. H. (1999). Misfolded proteins in the endoplasmic reticulum. Lab. Investig 79, 623–638. Puig, O.; Caspary, F.; Rigaut, G.; Rutz, B.; Bouveret, E.; Bragado-Nilsson, E.; Wilm, M.; Seraphin, B(2001). The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods, 24, 218-229. Riley, L.W. (1987). The epidemiologic, clinical, and microbiologic features ofhemorrhagic colitis. Annu Rev Microbiol41, 383-407. Romer, W., Berland, L., Chambon, V., Gaus, K., Windschiegl, B., Tenza, D., Aly, M.R., Fraisier, V., Florent, J.C., Perrais, D., Lamaze, C., Raposo, G., Steinem, C., Sens, P., Bassereau, P., and Johannes, L. (2007). Shiga toxin induces tubular membrane invaginations for its uptake into cells. Nature 450, 670-675. Romisch, K. (1999). Surfing the Sec61 channel: bidirectional protein translocation across the ER membrane. J. Cell Sci 112, 4185–4191.
68
Rowe, P. C., Orrbine, E., Wells, D. A., and McLaine, P. N.(1991). Epidemiology of hemolytic-uremic syndrome in Canadian children from 1986 to 1988. The Canadian Pediatric Kidney Disease Reference Centre. J. Pediatr. 119, 218-224. Saleh, M.T., Ferguson, J., Boggs, J.M., and Gariepy, J. (1996). Insertion and orientation of a synthetic peptide representing the C-terminus of the A1 domain of Shiga toxin into phospholipid membranes. Biochemistry 35, 9325-9334. Sandvig, K., and van Deurs, B. (1994). Endocytosis and intracellular sorting of ricin and Shiga toxin. FEBS Lett346, 99-102. Sandvig, K., and van Deurs, B. (1994). Transport of protein toxins into cells: pathways used by ricin, cholera toxin and shiga toxin. FEBS let 529, 49-53 Sandvig, K., Ryd, A., Garred,Ø., Schweda, E and Holm, P. K. (1994). Retrograde transport form the Golgi complex to the ER of both shiga toxin and the nontoxic shiga-B-fragment is regulated by butyric acid and cAMP. The J. cell bio126, 53-64. Sandvig, K., Prydz, K., Hansen, S. H and van Deur, B (1991). Ricin transport in brefeldin A-treated cells: correlation between Golgi structure and toxin effect. J. Cell Biol.115,971-981 Savino, C., Federici, L., Ippoliti, R., Lendaro, E., and Tsernoglou, D. (2000). The crystal structure of saporin SO6 from Saponaria officinalis and its interaction with the ribosome. FEBS Lett470, 239-243. Scheiring, J., Andreoli, S.P., and Zimmerhackl, L.B. (2008). Treatment and outcome of Shiga-toxin-associated hemolytic uremic syndrome (HUS). Pediatr Nephrol 23, 1749-1760. Shayantani, M., Sampali, B and Partha, S. (2001). Protein interation maps using yeast two-hybrid assay. Current science 8, 458-464. Sikriwal, D., Ghosh, P., and Batra, J.K. (2008). Ribosome inactivating protein saporin induces apoptosis through mitochondrial cascade, independent of translation inhibition. Int J Biochem Cell Biol40, 2880-2888. Spangler, B.D. (1992). Structure and function of cholera toxin and the related Escherichia coli heat-labile enterotoxin. Microbiol Rev 56, 622-647. Stewart, S.A., Stockwell, B.R., Hacohen, N., Hahn, W.C., Lander, E.S., Sabatini, D.M., and Root, D.E (2006).. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124, 1283-1298
69
Strockbine, N. A., Jackson, M. P., Sung, L. M., Holmes, R.K., and O’Brien, A. D. (1988). Cloning and sequencing of the genes for Shiga toxin from Shigella dysenteriae type 1.J. Bacteriol. 170, 1116-1122. Sugita, S.; Hata, Y.; Sudhof, T.C.(1996). Distinct Ca(2+)-dependent properties of the first and second C2-domains of synaptotagmin I. J. Biol. Chem. 271, 1262-1265. Taupiac, M.P., Bebien, M., Alami, M. & Beaumelle, B (1999). A deletion within the translocation domain of Pseudomonas exotoxin A enhances translocation efficiency and cytotoxicity concomitantly.Mol Microbiol 31 (5), 13 85-1393. Teter, K and Holmes, K. (2002). Inhibition of endoplasmic reticulum-associated degradation in CHO cells resistant to choler toxin, pseudomonas aeruginosa exotoxin A, and ricin. Infection and immunity 70, 6172-6179. Thompson, G.S., Shimizu, H., Homans, S.W and Donohue-Rolfe, A (2000). Localization of the binding site for the oligosaccharide moiety of Gb3 on verotoxin 1 using NMR dipolar coupling measurements. Biochemistry 39, 13153-13156. Torgersen, M.L., Silje, U., Lauvrak and Sandvig, K (2005). The A-subuint of surface-bound shiga toxin stimulates clathrin-dependent uptake of the toxin. The FEBS Journal. 272, 4103-4113. Wales, R., Chaddock, J. A., Roberts, L. M and Lord, J. M. (1992) Addition of the an ER retention signal to the ricin A chain increase the cytotoxicity of the holotoxin. Exp. Cell Res. 203, 1-4. Walterspiel, J. N., Ashkenazi, S., Morrow, A. L., and Cleary,T. G. (1992). Effect of subinhibitory concentrations of antibiotics on extracellular Shiga-like toxin I.Infection 20, 25-29. Webb, T. R., Cross, S. H., McKie, L., Edgar, R., Visor, L., Harrison, J., Peters, J and Jackson,I.J. (2008). Diphthamide modification of eEF2 requires a J-domain protein and is essential for normal development. Journal of Cell Science 121, 3140-3145. Vembar, S.S., and Brodsky, J.L. (2008). One step at a time: endoplasmic reticulum-associated degradation. Nat Rev Mol Cell Biol9, 944-957. West, R.E., Moss, J. Jr., Vaughan, M., Liu, T and Liu, T.Y.(1985). Pertussis toxin catalyzed ADP-ribosylation of transducin. Cysteine 347 is the ADP-ribose acceptor site. The Journal of Biological Chemistry, 260, 14428-14430. Windschiegl, B., Orth, A., Romer, W., Berland, L., Stechmann, B., Bassereau, P., Johannes, L., and Steinem, C. (2009). Lipid reorganization induced by Shiga toxin clustering on planar membranes. PLoS One4, e6238.
70
Worthington, Z.E., and Carbonetti, N.H. (2007). Evading the proteasome:absence of lysine residues contributes to pertussis toxin activity by evasion of proteasome degradation. Infect Immun 75, 2946-2953. Yamasaki, S., Furutani, M., Ito, K., Igarashi, K., Nishibuchi, M., and Takeda, Y. (1991). Importance of arginine at position 170 of the A subunit of Vero toxin 1 produced by enterohemorrhagic Escherichia coli for toxin activity. Microb Pathog 11, 1-9. Yoshida, T., Chen, C.C., Zhang, M.S., and Wu, H.C. (1991). Disruption of the Golgi apparatus by brefeldin A inhibits the cytotoxicity of ricin, modeccin, and Pseudomonas toxin. Exp Cell Res 192, 389-395. Yu, M and Haslam. (2005) Shiga toxin is transported from the endoplasmic reticulum following interaction with the luminal chaperone HEDJ/ERdj3. Inf and Immun. 73, 2524-2532. Zhang, Y., Schulte, W., Pink, D., Phipps, K., Zijlstra, A., Lewis, J.D and Waisman, D.M (2010). Sensitivity of cancer cell to truncated diphteria toxin. Plos one 5, e10498. Zhu, S. Z., Wang, S. Z., Hu, J and EI-Fakahany, E, E. (1995). An arginine residue conserved in most G protein-coupled receptors is essential for the function of the m1 muscarinic receptor. Mol Pharmcol, 45(3), 517-523
71
Appendix A: Sequences encode for protein interactors identified in initial Y2H screen
The initial Y2H screen identified 23 proteins that putatively interact with SLT-1 A1
as indicated in Table 3.1. The nucleotide sequences derived from prey plasmid DNA
recovered below are ranked for each putative protein to reflect sequences derived from
the highest number of colonies. If the positive colony numbers were identical among the
potential binding partners, the % coverage was taken into consideration. In from 53
yeast colonies encoded 23 unique protein sequences. The nucleotide sequences the
case of ATP1b1, 9 colonies were observed that encode nucleotide sequences
associated with this specific protein, 5 of which had identical nucleotide sequences and
thus the same coverage (27%). The other 4 colonies had slight differences in their
sequences and therefore varied in coverage.
ATP1b1
Function:Na+/K
+ ATPases
# of Amino acid: 303 # of Positive colonies: 9 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccggctgcgggccgaactgcaggcacttcaaaaaacgta
tcaraagatacttcgagaaaaagaaagtgctttagaagcgaaataccaagcaatggagagagcagcaacatttgaacatgacagagataaagttaaaaggcaattcaagatttttagggagaccaaagaaaatgaaattcaggacttactgagggccaagagggagttggagagcaaacttcagaggctacaggctcagggtatccaagtatttgatcctggggagtctgattcaratgacaactgtacagatgtcactggtaagtgtatatcctat
ttatattttgagctttcaacatggctgtaatgacatgtagagccaactttgaattctgctagatttcttttacttatctatattaggttattgctttaactactgttgcaaatagtgtcgtgtgttctctctgtcagctgctaagacacct
cttctccacgaagtgtatgaatttggggactgaagttccttctaccttgtcactctgccaaccctaacccataacttttactctctagtctaagatatctaccccagctcccaccagcacatctgcattttagccaagggaaagaaggaaggggagaacacgttcctttcccagaaggtacaacctaagatcacttctcaaatcccattagtcagaactataactgggaagactggatagtgtaatcagcagccaggcagacatgtgtccaactaaaatgta
gtgttctgttactgaagaaagaagaggagaatggatattggagttactagtctctg3’220-303(5 colonies), 27% coverage 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaagttggaaatgtggagtattttggactgggcaactcccctgg
ttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaattcgcatagagtgtaaggcgtacggtgagaacattgg
gtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatctatatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgtagcaatagcaacaaaatatttattctactgtaaatgaaaaaaaaaaaaaaaaaaaaa
aaaacctcgagagatctatgaatcgtagatactgaaaaaccccgcaagttcacttcaactgtgcatcgtgcaccatctcaatttctttcatttatacatcgttttgccttcttttatgtaactatactcctctaagtttcaatctt3’
181-303 (1 colony), 40% coverage
5’ctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacagggatgacatgatttttgaagattgtggcgatgtgcccagt
gaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaag
ttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactga
aattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatctatatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgtagcaatagcaacaaaat
atttattctactgtaaatgacaaaagaaaaagaaaaattgagccttgggacgtgcccatttttactgtaaattatgattccgtaa3’
119-303 (1 colony), 61% coverage
5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgccccgccaggattaacacagattcctcagatccagaag
actgaaatttcctttcgtcctaatgatcccaagagctatgaggcatatgtactgaacatagttaggttcctggaaaagtacaaagattcagcccagagggatgacatgatttttgaagattgtggcgatgtgcccagtgaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataa
agctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaagttgg
72
aaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaatt
cgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatctatatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgta3’72-303 (1), 76%
5’gtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgataaggataaagttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaa
ctcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatct
atatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgtagcaatagcaacaaaatatttattctactgtaaatgac3’236-303 (1 colony), 22% coverage
NPHP4
Function:involved in the organization of apical junctions in kidney cells # of Amino acid: 1425 # of Positive colonies: 8 5’ctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacagggatgacatgatttttgaagattgtggcgatgtgcccagt
gaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaag
ttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactga
aattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctgatcacaagcacaaatctttcccactagccatttaataagttaaaaaaagatacaaaaacaaaaacctactagtcttgaacaaactgtcatacgtatgggacctacacttaatctatatgctttacactagctttctgcatttaataggttagaatgtaaattaaagtgtagcaatagcaacaaaat
atttattctactgtaaatgacaaaagaaaaagaaaaattgagccttgggacgtgcccatttttactgtaaattatgattccgtaa3’1365-1425 (8 colonies), 4% coverage
RPLP0
Function: protein synthesis
# of Amino acid: 317 # of Positive colonies: 4 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgccatccgagggcacctggaaaacaacccagctctgga
gaaactgctgcctcatatccgggggaatgtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcac
tgtgccagcccagaacactggtctcgggcccgagaagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatgctcaacatctcccccttcccctttgggctggtcatccagcaggtgttcgacaatggcagcatctacaaccctgaagtgcttgatatcacagaggaaactctgcattctcgc
ttcctggagggtgtccgcaatgttgccagtgtctgtctgcagattggctacccaactgttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttg
ctgaaaaggtcaaggccttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggttgaagccaaggaagagtcggaggagtcggacgaggatatgggatttggtctctttgactaatcaccaaaaagcaaccaacttagccagttttatttgcaaaac3’63-317 (2 colonies), 80% coverage
5’Gccccggggatccgaattcgcggccgcgtcgacggcaagaacaccatgatgcgcaaggccatccgagggcacctggaaaacaacccagctctggagaaactgctgcctcatatccgggggaatgtgggctt
tgtgttcmccaaggaggacctcactgagatcagggacatgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaacactggtctcgggcccgaraagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatgctcaac
atctcccccttctcctttgggctggtcatccagcaggtgttcgacaatggcagcatctacaaccctgaagtgcttgatatcacagaggaaactctgcattctcgcttcctggagggtgtccgcaatgttgccagtgtctgtc
tgcagattggctacccaactgttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttgctgaaaaggtcaaggccttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggt3’56-297 (2 colonies), 76% coverage
EEF1A1
Function: translation elongation
# of Amino acid: 462 # of Positive colonies: 4 5’ctctatggcttacccatacgatgttccarattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcscggccgcgtcgacacggaagtaaaatctgtcgaaatgcaccatgaagctttga
gtgaagctcttcctggggacaatgtgggcttcaatgtcaagaatgtgtctgtcaaggatgttcgtcgtggcaacgttgctggtgacagcaaaaatgacccaccaatggaagcagctggcttcactgctcaggtgattatc
ctgaaccatccaggccaaataagcgccggctatgcccctgtattggattgccacacggctcacattgcatgcaagtttgctgagctgaaggaaaagattgatcgccgttctggtaaaaagctggaagatggccctaaattcttgaagtctggtgatgctgccattgttgatatggttcctggcaagcccatgtgtgttgagagcttctcagactatccacctttgggtcgctttgctgttcgtgatatgagacagacagttgcggtgggtgtcatcaaagca
gtggacaagaaggctgctggagctggcaaggtcaccaagtctgcccagaaagctcagaaggctaaatgaatattatccctaatacctgccaccccactcttaatcagtggtggaagaacggtctcagaactgtttgttt
caattggccatttaagtttagtagtaaaagactggttaatgataacaatgcatcgtaaaaccttcagaaggaaaggagaatgttttgtggaccactttggttttcttttttgcgtgtggcagttttaagttattagtttttaaaatcagtactttttaatggaaacaacttgaccaaaaatttgtcacagaattttgagacccattaaaaaagttaaatgaaaaaaaaaaaaaaaaaactcgagagatctatgaatcgtagatactgaaaaccccgcaagttcacttcaa
ctgtgcatcgtgcmccatctcaatttctttcatttatacatcgtttgccttcttttatgtaactatactcctctagtttcatctgccatgtacctctgatctataraatttttaatgactagatakgccatcttttttgactaatctcatgaa
atwattacgaaggctattmgagcttgactctcgctrgttgtcagtctcawcagttgtcactgtctact3’263-462 (4 colonies), 43% coverage
UBE2I
Function: ubiquitination/sumo conjunction
# of Amino acid: 158 # of Positive colonies: 3 5’acaaaaaaatargtctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgggaagcgccgccgccgccgccc
cgctcggtcctccacctgtccgctacgctcgccggggctgcggccgcccgagggactttgaacatgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaaactacggatgcttttcaaagatgattatccatctt
cgccaccaaaatgtaaattcgaaccaccattatttcacccgaatgtgtacccttcggggacagtgtgcctgtccatcttagaggaggacaaggactggaggccagccatcacaatcaaacagatcctattaggaatac
aggaacttctaaatgaaccaaatatccaagacccagctcaagcagaggcctacacgatttactgccaaaacagagtggagtacgagaaaagggtccgagcacaagccaagaagtttgcgccctcataagctyrsaccttgtggcatcgtcagaaggaagggattggtttggcaagaacttgtttacaacatttttgcaaatctaaagttgctccatacaatgactagtcacctggggggggttggggcgggcgccatcttccattgccgccgcggg
73
tgtgcggtctcgattcgctgaattgcccgtttccatacagggtctcttccttcggtcttttgtatttttgattgttatgtaaaactcgcttttattttaatattgatgtcagtatttcaactgctgtaaaattataacttttatacttgggta
agtccccaggggcgagttctcgctctggatgcagcatgcttctcmccgtgcagagctgcactgctcagctgctgtatggaaatgcayctctctgcgctctctctagacttctagacctggctgtgctgctttgarctcgaccagcagcaytcgatctgcccatct3’1-158 (3 colonies), 100% coverage
UMOD
Function:facilitatesneutrophil migration across renal epithelial
# of Amino acid: 640 # of Positive colonies: 3 5’atggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgaggagtgcagtatagacgaggactgcaaatcgaataatggcagatggcactgccagtgcaaacaggacttcaacatcactgatatctccctcctggagcacaggctggaatgtggggccaatgacatgaaggtgtcgctgggcaagtgccagctgaagagtctgggcttcgacaag
gtcttcatgtacctgagtgacagccggtgctcgggcttcaatgacagagacaaccgggactgggtgtctgtagtgaccccagcccgggatggcccctgtgggacagtgttgacgaggaatgaaacccatgccactt
acagcaacaccctctacctggcagatgagatcatcatccgtgacctcaacatcaaaatcaactttgcatgctcctaccccctggacatgaaagtcagcctgaagaccgccctacagccaatggtcaggtgtggccagagagggtccctagggcccctagatggttctaaccccaaaccccttaaccatgagcttccctgtcaactgccacccacagggagctgggagtgagggctgggaatcagggttgcccaatggaagagccaggaattctg
gagcccaggttcaaatctagactttgtcataaatgatggttatgccctggccagtgggggacagagtcaaagcactgcctggttcaagccccagctctgtcacttactagttgtatgagcttgagtgagttattaagcctg
gctttgggaaattgatagtccctctctaggtgtcaatattttcatctgtgaaatgggtttaatagtactctaagaattaaatgatatgggaggatcgcttgagcccaggaatttgaggctgcttagagctatgattgtgatgtgaatcagattcaaccattaactgatgtagatgattcagatgtgaatcaaatattaaagtctctacttttcaagagcagggtggttgtgccagagagcaggaatggtctcagtcagactgctatggatgctggcaatcatattcat
attggactcacttctttccttcctgtgatgagtatttgaatacrgattccactcagaaaacgatagamyatat3’297-397 (2 colonies), 16%coverage
5’ctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacatgtacctgagtgacagccggtgctcgggcttcaatgacag
agacaaccgggactgggtgtctgtagtgaccccagcccgggatggcccctgtgggacagtgttgacgaggaatgaaacccatgccacttacagcaacaccctctacctggcagatgagatcatcatccgtgacctc
aacatcaaaatcaactttgcatgctcctaccccctggacatgaaagtcagcctgaagaccgccctacagccaatggtcaggtgtggccagagagggtccctagggcccctagatggttctaaccccaaaccccttaaccatgagcttccctgtcaactgccacccacagggagctgggagtgagggctgggaatcagggttgcccaatggaagagccaggaattctggagcccaggttcaaatctagactttgtcataaatgatggttatgccct
ggccagtgggggacagagtcaaagcactgcctggttcaagccccagctctgtcacttactagttgtatgagcttgagtgagttattaagcctggctttgggaaattgatagtccctctctaggtgtcaatattttcatctgtg
aaatgggtttaatagtactctaagaattaaatgatatgggaggatcgcttgagcccaggaatttgaggctgcttagagctatgattgtgatgtgaatcagattcaaccattaaactgatgtagatgattcagatgtgaatcaatattaaagtctctacttttcaaagaggcagggtggttgtgcc3’358-444 (1 colony), 13% coverage
DEPDC6
Function: mTOR interactor
# of Amino acid: 409 # of Positive colonies: 3 5’catatggccatggaggccccggggatccgaattcgcggccgcgtcgacggaaataagccatgccacatccaggctgtagaccccagtggccctgcagccgcagcaggaatgaaggtctgtcagtttgtcgtctctgtcaacgggctcaatgtcctgcatgtagactaccggaccgtgagcaatctgattctgacgggcccacggacgattgtcatggaagtcatggaggagttagagtgctgagctcctgggcctcccagccctccagtg
gcctgtgggtgagggaagccagaatgacacaaagcaatgcaaagacaagattgccatgcaaatggatggttttggacatacgagtcttctccgcacatacatgtctaaagttgagttttatacactgaatgtggaagaa
ccgggtatcatatctttcttaaaaaatgtcagtgtagaaaacatttgggaaaccattttcctacatgatagaactgccttactagatttctatttgtagctctcattcattgttttttatcttagtttgcagaaaggtgttgaaatgcttctctagcccaaacagcgacatgctaaagtccccttcttcagagtcaatagagtagttgttaaaggttttaaattgtactttctccaaaattagcatgcagctatttaatagggaatctagatttcaccaagattcaaatcaaag
caacatttaaaggaataagacctgttcactagcattttcaagggggttctaaagcattcaagtgcttaaaagccataaaaaatgacttcttaattcctgcctttagtgtcaacttttaagttaatacaggtttcaattgtggcatta
ggaaaaaaaaaaaccttgtgatgctatggttgggggtargttagggarag3’347-409 (3 colonies), 15% coverage
RPLP1
Function: protein synthesis
# of Amino acid: 114 # of Positive colonies: 3 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgtgaggccctcacttcatccggcgactagcaccgcgtcc
ggcagcgccagccctacactcgcccgcgccatggcctctgtctccgagctcgcctgcatctactcggccctcattctgcacgacgatgaggtgacagtcacggaggataagatcaatgccctcattaaagcagccggtgtaaatgttgagcctttttggcctggcttgtttgcaaaggccctggccaacgtcaacattgggagcctcatctgcaatgtaggggccggtggacctgctccagcagctggtgctgcaccagcaggaggtcctgccc
cctccactgctgctgctccagctgaggagaagaaagtggaagcaaagaaagaagaatccgaggagtctgatgatgacatgggctttggtctttttgactaaacctcttttataacatgttcaataaaaagctgaactt3’1-114 (2 colonies), 100% coverage
NDUFA4
Function: NADH dehydrogenase transfers electrons from NADH to the respiratory chain
# of Amino acid: 81 # of Positive colonies: 2 5’tccgagcttgatccccctctttgtatttattggaactggagctactggagcaacactgtatctcttgcgtctggcattgttcaatccagatgtttgttgggacagaaataacccagagccctggaacaaactgggtcccaatgatcaatacaagttctactcagtgaatgtggattacagcaagctgaagaaggaacgtccagatttctaaatgaaatgtttcactataacgctgctttagaatgaaggtcttccagaagccacatccgcacaattttccact
taaccaggaaatatttctcctctaaatgcatgaaatcatgttggagatctctattgtaatctctattggagattacaatgattaaatcaataaataactgaaacttg3’34-81 (2 colonies), 45% coverage
FEZ2
Function: involved in axonal outgrowth and fasciculation
# of Amino acid: 380 # of Positive colonies: 2
74
5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgcggaggcgggggccgaggcgggtgggggcgccga
cggtttcccggccccggcctgcagcttggaggagaagctgagcctgtgcttccgcccctcggatccgggcgccgagcccccgaggacggccgtgcggcccatcacggagcgcagcctcctgcagggggacgagatttggaatgccctgacagataattatgggaatgtgatgcctgtagactggaagtcatcgcatactaggaccttgcacttgcttactctgaacctctcagaaaaaggggtaagtgacagtttgctctttgatacatcagat
gatgaagagctgagagaacagctggatatgcactcaatcatcgtctcctgtgttaatgatgaacccctcttcacggcagaccaggttattgaagaaattgaagaaatgatgcaggaatcaccggacccagaagatgat
gaaacccctacacagtcagatcggctttcaatgctttcccaggaaattcaaactctcaagaggtctagtaccggcagttatgaagagagagtgaaaaggctctcagtgtctgagttaaatgaaatcctggaagaaattgagactgccattaaggagtactctgaggagctggtgcagcagttggctttacgagatgaactggagtttgaaaaggaagtgaaaaacagctttatttctgttcttattgaagtgcaaaacaaacagaaagagcacaaagaa
acagcaaaaaaaaaaaaaaaaaactcgagagatctatgaatcgtagatactgaaaaaccccgcaagttcacttcaactgtgcatcgtgcaccatctcaatttctttcatttatacatcgttttgccttcttttatgtaactatact
cctctaagtttcaatcttggccatgtaacctctgatct3’34-278 (2 colonies), 64% coverage
PRL34
Function: protein synthesis
# of Amino acid: 1 # of Positive colonies: 117 5’ctacgattcatagatctctcgagttttttttttttttttttacagcgtcttttcatttttattactcaaaaaagtttcatttttttatttagctttctgactctgtgcttgtgccttcaacactttcacaacgattttctgctcctcgataagga
aagcacgcttgatcctgtcacgaacacatttagcacacatggaaccaccataggccctgctgacatgtttctttgttttggacaatctcataaraactttaggtcttacagcacgaacccctcgaagtctgcctgggcacacaccacatgcarattttggtgctttcccaaccttcttggtataaaggtaaacaattctattaccaggggttcgggacagcctarttttgttaraggctgtattgtargaaagcctacgtcggtatgtcaaacgctggaccattctg
agtgcctgc3’1-117 (1 colony), 100% coverage
MAT2A
Function: catalyzes the formation of S-adenosylmethionine from methionine and ATP
# of Amino acid: 161 # of Positive colonies: 1 gtctctatggcttacccatacgatgttccarattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgtcccagcgaacccgcgtgcaacctgtcccgactctagc
cgcctcttcagctcgccatggatcccaactgctcctgcgccgccggtgactcctgcacctgcgccggctcctgcaaatgcaaagagtgcaaatgcacctcctgcaaraaaagctgctgctcctgctgccctgtgggct
gtgccaagtgtgcccagggctgcatctgcaaaggggcgtcggacaagtgcagctgctgcgcctgatgctgggacagccccgctcccagatgtaaagaacgcgacttccacaaacctggattttttatgtacaaccctgaccgtgaccgtttgctatattcctttttctatgaaataatgtgaatgataataaaacagctttgacttg3’19-161 (1 colony), 88% coverage
AHA1
Function: Hsp90 cofactor (chaperon)
# of Amino acid: 338 # of Positive colonies: 1 5’cggccgcgtcgacctaaactggacaggtacttctaagtcaggagtacaatacaaaggacatgtggagatccccaatttgtctgatgaaaacagcgtggatgaagtggagattagtgtgagccttgccaaagatgagcctgacacaaatctcgtggccttaatgaaggaagaaggggtgaaacttctaagagaagcaatgggaatttacatcagcaccctcaaaacagagttcacccagggcatgatcttacctacaatgaatggagagtcagt
agacccagtggggcagccagcactgaaaactgaggagcgcaaggctaagcctgctccttcaaaaacccaggccagacctgttggagtcaaaatccccacttgtaagatcactcttaaggaaaccttcctgacgtca
ccagaggagctctatagagtgtttaccacccaagagctggtgcaggcctttacccatgctcctgcaacattagaagcagacagaggtggaaagttccacatggtagatggcaacgtctctggggaatttactgatctggtccctgagaaacatattgtgatgaagtggaggtttaaatcttggccagagggacactttgccaccatcaccttgaccttcatcgacaagaacggagagactgagctgtgcatggaaggtcgaggcatccctgctcct
gaggaagagcggacgcgacagggctggcagcggtactactttgagggcattaaacagacctttggctatggcgcacgcttattttagggccagcggcaggggactccagcctgctggacacttcagtccagctctc
tcctgactggggcttgcgactcacaggattgcatcgtcccagctgctaacttggggccggggcccctcccttccacatataccttgggttgtgcatgtttctgctgggtgggtcagagggcaatttctcttttatgtgtacatatgctaaataaacataatttaaaaaata3’86-338 (1 colony), 74% coverage
DNAJA1
Function: co-chaperone of Hsc70 that plays a role in protein import into mitochondria
# of Amino acid: 397 # of Positive colonies: 1 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgacgaagctttgagtgaagctcttcctggggacaatgtgggct
tcaatgtcaagaatgtgtctgtcaaggatgttcgtcgtggcaacgttgctggtgacagcaaaaatgacccaccaatggaagcagctggcttcactgctcaggtgattatcctgaaccatccaggccaaataagcgccggctatgcccctgtattggattgccacacggctcacattgcatgcaagtttgctgagctgaaggaaaagattgatcgccgttctggtaaaaagctggaagatggccctaaattcttgaagtctggtgatgctgccattgttg
atatggttcctggcaagcccatgtgtgttgagagcttctcagactatccacctttgggtcgctttgctgttcgtgatatgagacagacagttgcggtgggtgtcatcaaagcagtggacaagaaggctgctggagctggcaaggtcaccaagtctgcccagaaagctcagaaggctaaatgaatattatccctaatacctgccaccccactcttaatcagtggtggaagaacggtctcagaactgtttgtttcaattggccatttaagtttagtagtaaaag
actggttaatgataacaatgcatcgtaaaaccttcagaaggaaaggagaatgttttgtggaccactttggttttcttttttgcgtgtggcagttttaagttattagtttttaaaatcagtactttttaatggaaacaacttgaccaaa
aatttgtcacagaattttgagacccattaaaaaagttaaa3’141-397 (1 colony), 64% coverage
IGSF21
Function: immunoglobin superfamily, member 21
# of Amino acid: 497 # of Positive colonies: 1 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccttgaatctcccatcaaagccttttcattaaaaatacaatttc
atctactccctactgtacctttcactgatgtcaagtggctatcaattcatatagctgaaaattagtgatagtttgggtctcatttatgcataaattaattgaaaatcagtaatggccaggaagaaatatgaatattcaaaccacttttttcttttttttttttttttttggsaaatggkgktwwattgsctgggsaggkctcgaaatcctgggctcaagctatccycctgccyctgcctctgkaarartgkgarccmccmtgccccmcccaaaccatttttcatatcag
ttatagcaaaacaaracaaaccagttcttaataatgktcaaagttggacccatararacatgstaagcactacatcmtgstaaraaraacagttattactcmgctgccatacttcagccmttctacttttacaccaagaaca
aaatggctagagatttttttaaaaatacaaatgscagtaccttgccgaracttgttcactgatttgccccaaccccaaggkaatggtcatctactttgcaacctatggagatcctgatagctcccatacaaagtgaggtacac
75
tgttgccaatttggaggcaggaagccatcaaactaaacgtagtttaattcagatgaacacctatcgatattcaaaaggcaaaacaaaaaaactaattccagggacattagaccttggtgaaatgccaaatgaaaaatggt
gctttaaaaggtagtctcttaccatataaggaataagtaaaacattagcttgtgattctcattattcacgtcaatgttttagacacgactaacaagggacagttcaaactattaaagagaacaaatttttacttaagcactttgagtatccact3’188-467 (1 colony), 60% coverage
ATP1B3
Function: Na+/K
+ ATPase
# of Amino acid: 279 # of Positive colonies: 1 5’ctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccttcaagcatgcagtggtatgaatgatcctgattttggctattctcaaggaaacccttgtattcttgtgaaaatgaacagaataattggattaaagcctgaaggagtgccaaggatagattgtgtttcaaagaatgaagatataccaaatgtagcagtttatcctcataatggaatgatagactta
aaatatttcccatattatgggaaaaaactgcatgttgggtatctacagccattggttgctgttcaggtcagctttgctcctaacaacactgggaaagaagtaacagttgagtgcaagattgatggatcagccaacctaaaaa
gtcaggatgatcgtgacaagtttttgggacgagttatgttcaaaatcacagcacgtgcatagtatgagtaggatatctccacagagtaaatgttgtgttgtctgtcttcattttgtaacagctggaccttccattctagaattatgagaccaccttggagaaaggtgtgtggtacatgacattgggttacatcataacgtgcttccagatcatagtgttcagtgtcctctgaagtaactgcctgttgcctctgctgccctttgaaccagtgtacagtcgccagatag
ggaccggtgaacacctgattccaaacatgtaggatgggggtcttgtcctctttttatgtggtttaattgccaagtgtctaaagcttaatatgccgtgctatgtaaatattttatggatataacaactgtcatattttgatgtcaaca
gagttttagggataaatggtacccggccaacatc3’151-279 (1 colony), 46% coverage
MRI1
Function: catalyzes the interconversion of methylthioribose-1-phosphate (MTR-1-P) into
methylthioribulose-1-phosphate # of Amino acid: 369 # of Positive colonies: 1 5’cggccgcgtcgacaacaaggtgggcacctaccagctggccattgtcgccaagcaccatggcattcccttctacgtggctgcccccagctcttcatgtgacctccgtctggagaccggcaaggagatcattattgaagagcgaccgggccaggagctgaccgatgttaatggggtccggattgcagcacctgggattggagtttggaatcctgccttcgatgtcaccccccacgacctcatcactggtggcatcatcacagaactgggggtct
ttgcccctgaggagctccggacagccctaaccatcaccatctcttccagggatggaaccctagatggaccccagatgtaaccaactcagctctccctagcctgcctctctaggtttttcaatacatttcttgaatggctac
ccaaaagctgaccgtccagcccctgaccacacttgttcctagtgcagggagctcagacagggccttccatctagagcccagcacctagagccaggctgcccagattcaaatcctgactccgccacttttcccactgtatgatcttgggcaagtcacttcacctctctgtgccttggtttcctcatttataaaatgtggataacaggccggg3’256-369 (1 colony), 31% coverage
RSL24D1
Function: involved in the biogenesis of the 60S ribosomal subunit
# of Amino acid: 163 # of Positive colonies: 1 5’cggccgcgtcgacggatatcaaagaagtcaagcaaaacatccatcttatccgagcccctcttgcaggcaaagggaaacagttggaagagaaaatggtacagcagttacaagaggatgtggacatggaagatgctccttaaaaatctctgtaaccatttcttttatgtacatttgaaaatgccctttggatacttggaactgctaaattattttattttttacataaggtcacttaaatgaaaagcgattaaaagacatctttcctgcattgccatctacataatatcagatattacggatgttagattgcatctcagtgttaaatctttactgatagatgtacttaagtaaatcatgaaaattctacttgtaactatagaagtgaattgtggacgtaaaatggttgtgctatttggataatggcactaggcagcatttgtatagtaactaatggcaaaaattcatggctagtgatgtataaaataaaatattctttgcagtaaaatattccctttgttaatgttatagaaggggggatacaaaaaggaactaacaatttgtatggcagtgtcagatatttttattttagtatttcctgttttggtttatttgcatcttagaagagcataatgacattgtttgatgaagcctaattatgctggactgttttgacctggtttaacccttctgataggtagttgtggatgctggggatgagaactgaataatctttgcctggagtgacactacactctagaatttccactttggagaatactcagttccaacttgtgattcctgatagaacagactttacttttctag3’124-163 (1 colony), 24% coverage
HPD
Function: key enzyme in the degradation of tyrosine
# of Amino acid: 393 # of Positive colonies: 1 5’cggccgcgtcgacctgaagacggccaagatcaaggtgaaggagaacattgatgccctggaggagctgaaaatcctggtggactacgacgagaaaggctacctcctgcagatcttcaccaaaccggtgcag
gaccggcccacgctcttcctggaagtcatccagcgccacaaccaccagggttttggagccggcaacttcaactcactgttcaaggctttcgaggaggagcagaacctgcggggtaacctcaccaacatggagaccaatggggtggtgcccggcatgtaagccccgcccaccccacggaggccacagccacacagccacgccccctgattctggaactcgcccaacttccctactggctgctccccttgggtcccgcccaccagcggactcggcccccaaggctccgcccacactgaccacgcccctcggcggggccgccctctgctccagccctcccgattaaagcgtgccccggtcca3’304-393 (1 colony), 23% coverage
DYX1C1
Function:involved in neuronal migration during development of the cerebral neocortex
# of Amino acid: 420 # of Positive colonies: 1 5’gtctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccgacgtggaacagcattctgtcaactagaattgtatgta
gaaggcctacaggattatgaagcggcacttaagattgatccatccaacaaaattgtacaaattgatgctgagaagattcggaatgtaattcaaggaacagaactaaaatcttaatgactattaraagtaactaagtattgttataagttttttaaaaacaactggaggcatctttgtacatattatggccagttgtacagaatcgctttctgtttagtactttagttctgttgagggcaaaatattataaatctatagaaaataaactgtttgacttgaatcatttctgaa
taagtaaatctaaataagaatctattttaattccttatttcttcatattaatacatatgtatacttttttgtgttactgaattaagcttgcccttgtaacaaaatatgttttggtatagttaccaggacacttactgattaatttttaacaag
gtagaattttaaaataaaagatttataaataaaaaaaaaaaaaaaaaaaaaaaaaaaawytcragarwtctakrawtcgwaratmktgaaaamccccgcargttcacttcaactgtgcatcgkgcaccayctcawttyctttcattwatacaycgtttkgccttcttttatgtaactatactcct3’371-420 (1 colony), 12% coverage
76
ASXL1
Function: polycomb group (PcG) protein
# of Amino acid: 1541 # of Positive colonies: 1 5’cggccgcgtcgactcaaatgctgctccaggaaagascccaggagatcttactacctcgagaacacctcgtttctcatctccaaatgtgatctcctttggtccagagcagacaggtcgggccctgggtgatcagagcaatgttacaggccaagggaagaagctttttggctctgggaatgtggctgcaacccttcascgccccaggcctgcggacccsatgcctcttcctgctgagatccctccagtttttcccagtgggaagttgggaccaagcmcaaactccatgtckggkggggtacaractccaagggaagackgggctccaaagccacatgcctttgttggcascgtcaagaatgaraaracttttgtggggggtcctcttaaggyaaatgccgagaacakgaaagctactgggcatagtcccckggaactggtgggtcacttgraagggatgccctttgt3’1254-1404(1 colony),10% coverage
NPHP3
Function: required for normal ciliary development and function
# of Amino acid: 1330 # of Positive colonies: 1 5’ctctatggcttacccatacgatgttccagattacgctagcttgggtggtcatatggccatggaggccccggggatccgaattcgcggccgcgtcgaccggctgcgggccgaactgcaggcacttcaaaaaacgta
tcaraagatacttcgagaaaaagaaagtgctttagaagcgaaataccaagcaatggagagagcagcaacatttgaacatgacagagataaagttaaaaggcaattcaagatttttagggagaccaaagaaaatgaaa
ttcaggacttactgagggccaagagggagttggagagcaaacttcagaggctacaggctcagggtatccaagtatttgatcctggggagtctgattcaratgacaactgtacagatgtcactggtaagtgtatatcctatttatattttgagctttcaacatggctgtaatgacatgtagagccaactttgaattctgctagatttcttttacttatctatattaggttattgctttaactactgttgcaaatagtgtcgtgtgttctctctgtcagctgctaagacacct
cttctccacgaagtgtatgaatttggggactgaagttccttctaccttgtcactctgccaaccctaacccataacttttactctctagtctaagatatctaccccagctcccaccagcacatctgcattttagccaagggaaag
aaggaaggggagaacacgttcctttcccagaaggtacaacctaagatcacttctcaaatcccattagtcagaactataactgggaagactggatagtgtaatcagcagccaggcagacatgtgtccaactaaaatgtagtgttctgttactgaagaaagaagaggagaatggatattggagttactagtctctg3’125-224 (1 colony), 7% coverage
COL1A2
Funciton: type I collagen is a member of group I collagen
# of Amino acid: 1366 # of Positive colonies: 1 5’cggccgcgtcgacctacagggctctaatgatgttgaacttgttgctgagggcaacagcaggttcacttacactgttcttgtagatggctgctctaaaaagacaaatgaatggggaaagacaatcattgaatacaaaacaaataagccatcacgcctgcccttccttgatattgcacctttggacatcggtggtgctgaccaggaattctttgtggacattggcccagtctgtttcaaataaatgaactcaatctaaattaaaaaagaaagaaatttgaaa
aaactttctctttgccatttcttcttcttcttttttaactgaaagctgaatccttccatttcttctgcacatctacttgcttaaattgtgggcaaaagagaaaaagaaggattgatcagagcattgtgcaatacagtttcattaactcct
tcccccgctcccccaaaaatttgaatttttttttcaacactcttacacctgttatggaaaatgtcaacctttgtaagaaaaccaaaataaaaattgaaaaataaaaaccataaacattt3’
1293-1366 (1 colony), 5% coverage
77
Appendix B: List of protein interactors identified in the HeLa cell lysate pull down/mass spectrometry screen
The HeLa cell lysate pull down/mass spectrometry approachusedin this thesis
identified over 200 potential proteininteractors wthSLT-1 A1. The table below lists
putative binding partners of SLT-1 A1 that had greater than 15% coverage.
Furthermore, the list is ranked starting with protein interactors displaying the highest
number of identified peptides with a short description of the known function of the
interactor itself.
78
Protein Gene Name
Peptide Number
Unique Peptide Number Coverage Function
MYH10 134 85 45.2 plays a role in cytokinesis
RPLP0 119 23 51.1 protein synthesis
EEF1A1 99 18 34.6 translation elongation
SPTAN1 94 82 39.8 calcium-dependent movement of the cytoskeleton
CCT6A 72 26 46.3 molecular chaperone
CCT5 61 21 46.4 molecular chaperone
PFKP 56 24 29.7 phosphofructokinase
TCP1 55 21 46.6 molecular chaperone
CCT8 28 16 33 molecular chaperone
MRCL3 21 13 69 movement of smooth muscles
CCT7 21 11 33.9 molecular chaperone
HSPB1 14 10 61 involved in stress resistance and actin organization
ACTC1 14 6 47.5 cell motility
EFTUD2 12 11 23 required for pre-mRNA splicing
VCP 8 6 11.5 translocation from ER to golgi
TPM4 6 4 29.4 regulates muscle contraction
TMOD3 6 4 23.6 blocks actin elongation
RPL6 5 5 22.9 protein synthesis
IGBP1 5 4 16.2 involved in signal transduction
RPL4 5 5 15 protein synthesis
RPL12 4 3 24.2 protein synthesis
YBX1 4 4 20.1 mediates pre-mRNA alternative splicing regulation
PPP2CA 4 3 16.5 modulate the activity of MAP-2 kinase
TUBB2B 3 2 44.9 major constituent of microtubules
RSU1 3 1 26.8 involved in the Ras signal transduction pathway
TXNDC9 3 3 20.8 diminishes the chaperonin ATPase activity
TUBB3 2 2 32.9 major constituent of microtubules
RPLP2 2 2 30.4 protein synthesis
USP7 2 2 16.8 hydrolase that deubiquitinates target proteins
HSPA2 1 1 20.7 Molecular chaperone
DPY30 1 1 20.2 involved in methylation and dimethylation
EEF1A2 1 1 18.4 translation elongation
ENY2 1 1 16.8 mediates histone acetylation and deubiquitination
CNO 1 1 15.2 intracellular vesicle trafficking
YWHAZ 1 1 15.1 regulation in signal pathways
RPLP1 1 1 14 protein synthesis