JOURNAL OF BACTERIOLOGY, Oct. 2011, p. 5817–5823 Vol. 193, No. 200021-9193/11/$12.00 doi:10.1128/JB.05525-11Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Identification of the Regulator Gene Responsible for theAcetone-Responsive Expression of the Binuclear Iron

Monooxygenase Gene Cluster in Mycobacteria�

Toshiki Furuya,1 Satomi Hirose,1 Hisashi Semba,2 and Kuniki Kino1*Department of Applied Chemistry, Faculty of Science and Engineering, Waseda University, 3-4-1 Ohkubo,

Shinjuku-ku, Tokyo 169-8555, Japan,1 and GSC Catalyst Technology Research Center,Nippon Shokubai Co. Ltd., Tsukuba, Ibaraki 305-0856, Japan2

Received 12 June 2011/Accepted 11 August 2011

The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol inMycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression ofthe mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsiblefor this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCDgene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysisrevealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, includingAcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, manyhomologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carryinga transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless greenfluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using aGFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product isthe positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptionalactivators of the NtrC family generally control transcription using the �54 factor, a gene encoding the �54

factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest thepresence of a novel regulatory system in actinomycetes, including mycobacteria.

Mycobacterium smegmatis strain MC2 155 and Mycobacte-rium goodii strain 12523 are able to grow on propane andacetone as sources of carbon and energy (10). We previouslyidentified the gene cluster designated mimABCD that playsessential roles in propane and acetone metabolism in thesemycobacteria and that belongs to the binuclear iron mono-oxygenase family (10, 18). Deletion and complementation ana-lyses of the mimA gene suggested that the mimABCD genecluster was involved in the oxidation of propane and acetone(10). This gene cluster is also responsible for the regioselectiveoxidation of phenol to hydroquinone (10, 26, 27). Interestingly,expression of the mimABCD gene cluster is induced by acetone(10).

Gene expression is controlled by specific regulators thatinteract with �70- or �54-dependent RNA polymerases. A ma-jor form of RNA polymerase that utilizes the �70 factor rec-ognizes a �35, �10 promoter. Transcription from this type ofpromoter is controlled by regulators that bind to DNA adja-cent to the promoter. In contrast to the �70-dependent RNApolymerases, a minor form of RNA polymerase that utilizesthe �54 factor recognizes a �24, �12 promoter (6, 11). Thistype of RNA polymerase requires the NtrC family of transcrip-tional activators to convert the closed RNA polymerase-�54

factor complex to a transcriptionally active open complex.These activators are known to bind to an upstream bindingsequence (UAS) that is further than 100 bp away from thepromoter. The activator on the UAS subsequently interactswith the RNA polymerase-�54 factor complex on the promotervia DNA looping. Interestingly, some �70-dependent RNApolymerases have been also shown to utilize NtrC-like regula-tors to control transcription (5, 9, 23). It is conceivable thatindividual microorganisms have evolved their own sophisti-cated regulatory systems to adapt to variable habitats.

In this study, we identified a gene designated mimR that liesimmediately upstream of the mimABCD gene cluster and isdivergently transcribed. We confirmed by deletion and com-plementation analyses that the mimR gene product is the pos-itive regulator of the mimABCD gene cluster expression that isresponsive to acetone and related compounds. Sequence anal-ysis revealed that MimR belongs to the NtrC family of tran-scriptional activators. The NtrC family of transcriptional acti-vators contains many members, which regulate the expressionof genes that are involved in a variety of physiological pro-cesses (32, 36). For example, NtrC and NifA are involved innitrogen metabolism (17, 19), and DmpR and XylR are in-volved in degradation of aromatic compounds (1, 29). Al-though members of the NtrC family have been found mainly inGram-negative bacteria and Gram-positive Bacillus subtilis, nomembers of this family have been reported in actinomycetes(31, 32). Sequence and function analyses of MimR in theactinomycetous Mycobacterium strains reported here suggestedthat this novel transcriptional activator controls a regulatory

* Corresponding author. Mailing address: Department of AppliedChemistry, Faculty of Science and Engineering, Waseda University,3-4-1 Ohkubo, Shinjuku-ku, Tokyo 169-8555, Japan. Phone: 81 3 52863211. Fax: 81 3 3232 3889. E-mail: kkino@waseda.jp.

� Published ahead of print on 19 August 2011.

5817

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

16

Oct

ober

202

1 by

1.2

44.4

5.14

3.

system that differs in some respects from the general NtrCsystem previously reported. Furthermore, analysis of publishedbacterial genome sequences revealed that MimR-like regula-tory systems are widespread in actinomycetes.

MATERIALS AND METHODS

Bacterial strains, plasmids, and cultivation media. The bacterial strains andplasmids that were used or constructed in this study are listed in Table 1. Thebacteria were grown in Luria-Bertani (LB) medium, which contained (per liter)Bacto tryptone (10 g), Bacto yeast extract (5 g), and NaCl (10 g), pH 7.0.

Construction of transcriptional fusion plasmids. A plasmid carrying a tran-scriptional fusion of the intergenic region between the mimR and mimA geneswith a promoterless green fluorescent protein (GFP) gene was constructed toassess transcriptional activity using a GFP reporter system (7, 14). Two oligonu-cleotide primers, gfp-F and gfp-R (Table 2), were designed to amplify the gfpgene and its ribosome binding site. The region between the two oligonucleotideprimers was amplified from the pQBI63 plasmid (Table 1) using PCR. Theseamplified DNA fragments were digested with XbaI and EcoRI and were insertedinto the pRHK1 vector (13) (Table 1) to construct pRHKgfp. Two other oligo-nucleotide primers, int-F and int-R (Table 2; see also Fig. 2), were designed toamplify the intergenic region between the mimR (Msmeg_1970) and mimA(Msmeg_1971) genes, based on the terminal sequences of the mimR and mimAgenes in the genome sequence of M. smegmatis strain MC2 155 (GenBankaccession number NC_008596). The region between the two oligonucleotideprimers was amplified from the genomic DNAs of M. smegmatis strain MC2 155and M. goodii strain 12523 using PCR. These amplified DNA fragments weredigested with SalI and XbaI and were subsequently inserted into the pRHKgfp

vector. The resulting plasmids, pRHKintSM-gfp for M. smegmatis strain MC2155 and pRHKintGO-gfp for M. goodii strain 12523, were amplified in Esche-richia coli JM109 cells.

The region including the mimR gene and the intergenic nucleotide sequencebetween the mimR and mimA genes was also cloned for complementation anal-ysis of the mimR gene. Another oligonucleotide primer, mimR-F (Table 2), wasdesigned based on the 3�-terminal sequence of the mimR gene in the genomesequence of M. smegmatis strain MC2 155. The region between the two oligonu-cleotide primers, mimR-F and int-R, was amplified from the genomic DNAs ofM. smegmatis strain MC2 155 and M. goodii strain 12523 using PCR. Theseamplified DNA fragments were digested with NsiI and XbaI and were subse-quently inserted into the pRHKgfp vector that was digested with PstI and XbaI.The resulting plasmids, pRHKmimRsmintSM-gfp for M. smegmatis strain MC2155 and pRHKmimRgointGO-gfp for M. goodii strain 12523, were amplified in E.coli JM109 cells.

These constructed plasmids were sequenced using an ABI Prism 3130xl ge-netic analyzer (Applied Biosystems, Foster City, CA) and were introduced intocells of M. smegmatis strain MC2 155 or of the MC2 155 �mimR deletion mutant(see below) by electroporation.

Deletion of the mimR gene in M. smegmatis strain MC2 155. The mimR genein M. smegmatis strain MC2 155 was deleted in frame using the pK18mobsacBvector (25) (Table 1). Two oligonucleotide primers, mimR5�-F and mimR5�-R(Table 2), were designed to amplify the 5�-terminal region of the mimR genebased on the genome sequence of M. smegmatis strain MC2 155. The regionbetween the two oligonucleotide primers was amplified from the genomic DNAof M. smegmatis strain MC2 155 using PCR. These amplified DNA fragmentswere digested with HindIII and XbaI and were inserted into the pK18mobsacBvector. Two other oligonucleotide primers, mimR3�-F and mimR3�-R (Table 2),

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Characteristic(s) Reference(s) or source

StrainsM. smegmatis MC2 155 Wild type, ATCC 700084 ATCCM. goodii 12523 Wild type 10, 26M. smegmatis MC2 155

�mimR mutantM. smegmatis MC2 155 with mimR deletion This study

E. coli JM109 Host used for cloning Takara Bio

PlasmidspRHK1 Rhodococcus (Mycobacterium)-E. coli shuttle vector, Kanr 13pQBI63 Vector containing the gfp gene Takara BiopRHKgfp pRHK1 containing the gfp gene This studypRHKintSM-gfp pRHKgfp containing the intergenic region between the mimRsm and mimAsm

genes upstream of the gfp geneThis study

pRHKintGO-gfp pRHKgfp containing the intergenic region between the mimRgo and mimAgogenes upstream of the gfp gene

This study

pRHKmimRsmintSM-gfp pRHKgfp containing the mimRsm gene and the intergenic region betweenthe mimRsm and mimAsm genes upstream of the gfp gene

This study

pRHKmimRgointGO-gfp pRHKgfp containing the mimRgo gene and the intergenic region between themimRgo and mimAgo genes upstream of the gfp gene

This study

pK18mobsacB Vector used for deletion mutagenesis, aph sacB NBRP (NIG, Japan)pK�mimR mutant pK18mobsacB containing a deleted mimR gene of M. smegmatis MC2 155 This study

TABLE 2. Oligonucleotide primers used in this study

Primer Sequence (5�33�)a Restriction site

gfp-F GCTCTAGAAATAATTTTGTTTAACTTTAAG XbaIgfp-R CGGAATTCCAGCCGGATCCTCAGTTGTACA EcoRIint-F GCGTCGACGCGTGTCGGCATGTCTGACCAT SalIint-R GCTCTAGATGGTCAGGCTTTGTCTGCTCAA XbaImimR-F CCAATGCATTCACGCGATCCCGAAGTCCTTGAT NsiImimR5�-F CCCAAGCTTCAGTGGTTGTTCCACCAGGCGTAG HindIIImimR5�-R GCTCTAGAGGTGGAGAGGAACTGCTCCCGGGC XbaImimR3�-F GCTCTAGAGCCGCTCTGGGGATGTCACGAGCG XbaImimR3�-R TCCCCCGGGATGTCAATGCCGTCCAGCATGTCG SmaI

a Restriction sites are underlined and identified in the column at the right.

5818 FURUYA ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

16

Oct

ober

202

1 by

1.2

44.4

5.14

3.

were designed to amplify the 3�-terminal region of the mimR gene. These am-plified DNA fragments were digested with XbaI and SmaI and were subsequentlyinserted into the pK18mobsacB vector containing the 5�-terminal region of themimR gene. The resulting plasmid, pK�mimR, contained a deleted mimR geneencoding a 43-amino-acid protein instead of a full-length mimR gene encoding a583-amino-acid protein.

A two-step recombination was performed to delete the mimR gene fromthe chromosome of M. smegmatis strain MC2 155 as described previously (10,20, 28, 34). The pK�mimR plasmid was introduced into M. smegmatis strainMC2 155 cells by electroporation. Single crossover mutants, into which theplasmid was integrated, were selected on an LB plate containing kanamycin(50 �g/ml). Kanamycin-resistant strains were then subjected to repeatedcultivation in LB medium without kanamycin. Finally, double crossover mu-tants, which had lost the vector backbone and were sensitive to kanamycin,were selected on LB plates with or without kanamycin. Deletion of the mimAgene was confirmed by PCR using the two oligonucleotide primers, mimR5�-Fand mimR3�-R (Table 2). This procedure resulted in the M. smegmatis MC2155 �mimR deletion mutant (Table 1).

Assays of transcriptional activity using a GFP reporter system. The recom-binant mycobacterial strains carrying the transcriptional fusion plasmids thatinclude the gfp reporter gene were cultivated for 3 days in LB medium (2 ml)containing Tween 80 (0.05%, vol/vol) and kanamycin (50 �g/ml) in glass vials (14ml) at 37°C with reciprocal shaking at a speed of 180 strokes per min. Aftercentrifugation at 10,000 � g for 10 min at 4°C, the cells were suspended in KGmedium (10 ml) (10) containing Tween 80 (0.05%, vol/vol) and kanamycin (50�g/ml). One millimolar of acetone (with a purity exceeding 99.7%), 2-propanol(99.7%), 1-propanal (90%), 1-propanol (99.5%), acetol (hydroxyacetone; 90%),2-butanone (methylethylketone; 99%), 2-butanol (99%), acetoin (3-hydroxy-2-butanone; 95%), ethanol (99.5%), phenol (99%), or hydroquinone (99%) wasadded to the cell suspension (2 ml) in glass vials (14 ml) sealed with screw capsto examine effector specificity. These chemicals were purchased from Wako PureChemicals (Osaka, Japan). When propane (99.5%; GL Sciences, Tokyo, Japan)was used as a potential effector, this compound was added to the headspace at aconcentration of 20% (vol/vol). After incubation for 24 h at 30°C with reciprocalshaking at a speed of 180 strokes per minute, the cells were harvested bycentrifugation and were suspended in distilled water at an optical density at 660nm (OD660) of 0.1. The level of GFP expression was measured using a spectro-fluorometer (Chameleon; Hidex, Turku, Finland). Excitation and emission wave-lengths were 485 nm and 535 nm, respectively. The relative fluorescence unit(RFU) was defined as the culture fluorescence relative to the culture biomassat OD660.

Sequence analysis. Sequence similarity was analyzed using the BLASTprogram (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple sequences werealigned using Genetyx-win version 5.0.2 (Genetyx Corporation, Tokyo, Ja-pan). Promoter sequence was examined by manual inspection or by using theBDGP Neutral Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter.html).

Nucleotide sequence accession number. The nucleotide sequence of the mimRgene of M. goodii strain 12523 has been submitted to GenBank, and the assignedaccession number is AB627360.

RESULTS

Cloning and sequence analysis of the regulatory region ofthe mimABCD gene cluster. Our analysis of the genome se-quence of M. smegmatis strain MC2 155 indicated that themimABCD gene cluster is preceded by the open reading frame(ORF) Msmeg_1970 (accession number YP_886335), which isdivergently transcribed. We designated this gene mimR andcloned the region that included the mimR gene and the inter-genic nucleotide sequence between the mimR and mimA genesfrom M. smegmatis strain MC2 155 as well as its homologousregion from M. goodii strain 12523. Two oligonucleotide prim-ers were designed based on the terminal sequences of themimR and mimA genes in the genome sequence of M. smeg-matis strain MC2 155. The region between the two oligonu-cleotide primers was amplified from the genomic DNAs of M.smegmatis strain MC2 155 and M. goodii strain 12523 usingPCR and was cloned into the pRHKgfp vector. Sequence anal-

ysis revealed that the nucleotide sequence of this region fromM. smegmatis strain MC2 155 corresponded with that deter-mined by the genome sequencing project (GenBank accessionno. NC_008596). The homologous region from M. goodii strain12523 was also successfully cloned. For convenience, we namedthe gene from M. smegmatis strain MC2 155 mimRsm and thatfrom M. goodii strain 12523 mimRgo. The mimRsm and mimRgo

genes each encode 583-amino-acid proteins. The MimRgo pro-tein shares 92% amino acid identity with MimRsm based on aBLAST search.

The MimRsm and MimRgo proteins exhibit appreciable aminoacid similarities with the NtrC family of transcriptional activators.For example, MimRsm shares 26% amino acid identity withAcxR, which regulates expression of the acetone carboxylase genein Xanthobacter autotrophicus strain Py2 (30) (Fig. 1). In addition,MimRsm shares 21% amino acid identity with AcoR, which reg-ulates expression of the acetoin dehydrogenase gene in B. subtilisstrain 168 (2) (Fig. 1). Unexpectedly, many homologs of themimR gene were found in the sequenced genomes of actinomy-cetes, including Rhodococcus, Gordonia, and Streptomyces strainsin addition to Mycobacterium strains. For example, MimRsm

shares 49, 48, and 34% amino acid identities with theRHA1_ro00452 ORF of Rhodococcus jostii strain RHA1,Gbro_3559 ORF of Gordonia bronchialis strain DSM 43247, andSAV_1392 ORF of Streptomyces avermitilis strain MA-4680, re-spectively (Fig. 1). The genome sequence of M. smegmatis strainMC2 155 contains one additional MimR-like sequence(Msmeg_3008) that shares 29% amino acid identity withMimRsm, whereas that of R. jostii strain RHA1 contains, in ad-dition to RHA1_ro00452, seven homologs that share more than30% amino acid identity with MimRsm (data not shown). Theseresults indicate that NtrC- or MimR-like sequences are wide-spread in actinomycetes.

Transcriptional activators of the NtrC family each consist ofthree functional domains: an amino-terminal domain that recog-nizes a specific effector, a carboxy-terminal domain that recog-nizes the UAS, and a central domain that is responsible for ATPhydrolysis and transcriptional activation (21, 36). The amino-ter-minal domains of MimRsm and MimRgo contain a GAF domain,which also exists in AcxR and AcoR (Fig. 1). This GAF domainwas named after the domain that is detected in cGMP-specificand -stimulated phosphodiesterases, Anabaena adenylate cyclases,and Escherichia coli FhlA (3). This FhlA protein belongs to theNtrC family of transcriptional activators (15). The carboxy-terminal domains of MimRsm and MimRgo contain a helix-turn-helix motif sequence (21) (Fig. 1), which probably enablesthese transcriptional activators to bind to specific UASs. Fur-thermore, a Walker A motif sequence is conserved in thecentral domain of MimRsm and MimRgo, whereas Walker Band GAFTGA motif sequences were not detected in theseproteins (Fig. 1). Walker A and Walker B motif sequences areknown to participate in ATP hydrolysis, which produces energyfor conversion of the closed RNA polymerase-�54 factor com-plex to a transcriptionally active open complex (11, 36). AGAFTGA motif sequence is known to participate in interac-tion with the �54 factor (11, 36). Some members of the NtrCfamily were reported to lack these motif sequences (5, 9, 23).The homologs of the mimR gene that were found in the acti-nomycetes also lack the Walker B and GAFTGA motif se-quences (Fig. 1). Furthermore, the sequence that is conserved

VOL. 193, 2011 ACETONE-RESPONSIVE REGULATOR IN MYCOBACTERIA 5819

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

16

Oct

ober

202

1 by

1.2

44.4

5.14

3.

in the C7 region of the NtrC family of transcriptional activatorsis also conserved in MimRsm and MimRgo and in the otherproteins shown in Fig. 1. This region is suggested to participatein binding the base of the nucleotide (36).

The intergenic distance between the mimRsm and mimAsm

genes was 215 bp, and that between the mimRgo and mimAgo

genes was 217 bp. A �24, �12 promoter-like sequence in thedirection of the mimABCD gene cluster was found in theintergenic region from these mycobacteria (4) (Fig. 2). In con-trast, a sequence that exhibits similarity with the �35, �10promoter consensus sequence of mycobacteria (TTGACG-N9�24-TATAAT) (22) or that of E. coli (TTGACA-N17�19-TATAAT) (12) was not detected in this region (Fig. 2). Wealso attempted to detect a �35, �10 promoter-like sequenceusing the BDGP Neutral Network Promoter Prediction pro-gram. However, no sequence common to these two mycobac-teria was retrieved from the intergenic region, even when theminimum promoter score was set to only 0.4. Furthermore,several palindromic sequences were found (Fig. 2), whichmight function as a UAS for the MimR protein, although thesesequences do not exhibit apparent homologies with known �54

UASs.

Deletion and complementation analyses of the mimR gene.To confirm that the mimR gene product functions as a regu-lator of the mimABCD gene cluster expression, deletion andcomplementation analyses of the mimR gene were performed.M. smegmatis strain MC2 155 was used for construction of thedeletion mutant, because this strain can be easily transformed,whereas attempts to introduce heterologous genes into M.goodii strain 12523 cells were unsuccessful, as previously re-ported (10). A plasmid carrying a transcriptional fusion of theintergenic region between the mimRsm and mimAsm genes witha promoterless gfp gene was constructed, and the resultingreporter plasmid, pRHKintSM-gfp, was introduced into M. smegma-tis strain MC2 155. Strain MC2 155 carrying pRHKintSM-gfp ex-hibited high levels of GFP expression only in the presence ofacetone (Fig. 3A). This result indicates that the 215-bp nucleo-tide sequence between the mimRsm and mimAsm genes in-cludes promoter elements for expression of the mimABCDgene cluster. Furthermore, when the mimRsm gene on thechromosome was deleted, the MC2 155 �mimR deletion mu-tant carrying pRHKintSM-gfp lost GFP fluorescence (Fig. 3B).To confirm that the loss of GFP fluorescence was due only todeletion of the mimRsm gene, we determined if complementa-

FIG. 1. Multiple sequence alignment of MimR and related proteins. MimRsm, binuclear iron monooxygenase regulator in M. smegmatis MC2155 (GenBank accession number YP_886335); MimRgo, binuclear iron monooxygenase regulator in M. goodii 12523 (AB627360); AcxR, acetonecarboxylase regulator in X. autotrophicus Py2 (AAL17709); AcoR, acetoin dehydrogenase regulator in B. subtilis 168 (NP_388691);RHA1_ro00452, putative regulator in R. jostii RHA1 (YP_700446); Gbro_3559, putative regulator in G. bronchialis DSM 43247 (YP_003274644);SAV_1392, putative regulator in S. avermitilis MA-4680 (NP_822567). Black shading shows identical residues in more than four regulators. Thelocations of the conserved domain and motifs with their consensus sequences are also shown. “B” in consensus sequences represents hydrophobicamino acids. GAFTGA and Walker B motifs of AcxR and AcoR are boxed.

5820 FURUYA ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

16

Oct

ober

202

1 by

1.2

44.4

5.14

3.

tion of this gene in the deletion mutant would restore transcrip-tional activity. When the MC2 155 �mimR deletion mutant car-rying pRHKintSM-gfp was complemented with the mimRsm

gene, this mutant carrying pRHKmimRsmintSM-gfp exhibited al-

most the same level of GFP expression as that of the wild-typestrain MC2 155 carrying pRHKintSM-gfp in the presence of ac-etone (Fig. 3C). Furthermore, using the wild-type strain MC2 155and the MC2 155 �mimR deletion mutant as hosts, we confirmedthat the mimRgo gene and the intergenic region between themimRgo and mimAgo genes of M. goodii strain 12523 are func-tionally equivalent to those of M. smegmatis strain MC2 155 (Fig.3). These results demonstrate that MimR is the positive regulatorof the mimABCD gene cluster expression that is responsive toacetone.

Effector specificity of the MimR protein. The effector spec-ificity of MimRsm toward a variety of compounds was exam-ined. M. smegmatis strain MC2 155 carrying pRHKintSM-gfpwas used to assess transcriptional activity of MimRsm encodedby the gene on the chromosome. The most efficient transcrip-tional activation by MimRsm occurred in the presence of ace-tone (Fig. 4). Furthermore, MimRsm activated transcription inthe presence of 2-propanol, propane, acetol, 2-butanone, and

FIG. 2. Regulatory region of the mimABCD gene cluster. Intergenic nucleotide sequences between the mimR and mimA genes in M. smegmatisstrain MC2 155 and M. goodii strain 12523 are labeled “M. smegmatis” and “M. goodii,” respectively. Identical residues are boxed. The locationsof the �24, �12 promoter-like sequence and its consensus sequence are shown. Arrows show palindromic sequences. The locations of the startcodons of the mimR and mimA genes and the forward and reverse PCR primers (int-F and int-R, respectively) are also shown.

FIG. 3. Deletion and complementation analyses of the mimRgene. The following cells were incubated in the absence (white bar)or presence (gray bar) of acetone: cells of M. smegmatis MC2 155carrying pRHKgfp [mc2155 (none)], pRHKintSM-gfp [mc2155(intSM)], or pRHKintGO-gfp [mc2155 (intGO)] (A); cells of the MC2155 �mimR deletion mutant carrying pRHKgfp [�mimR (none)],pRHKintSM-gfp [�mimR (intSM)], or pRHKintGO-gfp [�mimR(intGO)] (B); cells of the MC2 155 �mimR deletion mutant carry-ing pRHKgfp [�mimR (none)], pRHKmimRsmintSM-gfp [�mimR(mimRsmintSM)], or pRHKmimRgointGO-gfp [�mimR (mimRgointGO)](C). The level of GFP expression was measured using a spectrofluorom-eter. Bars represent the averages from two independent experiments, anderror bars represent the standard deviations from the means.

FIG. 4. Transcriptional activation by MimRsm in the presence ofdifferent compounds. Cells of M. smegmatis MC2 155 carryingpRHKintSM-gfp were incubated with different compounds, and thelevel of GFP expression was measured using a spectrofluorometer.Bars represent the averages from two independent experiments,and error bars represent the standard deviations from the means.

VOL. 193, 2011 ACETONE-RESPONSIVE REGULATOR IN MYCOBACTERIA 5821

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

16

Oct

ober

202

1 by

1.2

44.4

5.14

3.

2-butanol. In contrast, MimRsm hardly responded to 1-pro-panal, 1-propanol, acetoin, ethanol, phenol, or hydroquinone.

Genome-wide search for a gene encoding the �54 factor inM. smegmatis strain MC2 155 and other actinomycetes. Thegenome sequence of M. smegmatis strain MC2 155 wassearched for the presence of a gene encoding the �54 factor,since transcriptional activators of the NtrC family generallycontrol transcription using the �54 factor. A BLAST search ofthe genome sequence of M. smegmatis strain MC2 155 wasperformed using the sequences of typical �54 factors, NtrA inSalmonella enterica serovar Typhimurium (GenBank accessionno. AAA27224) (24) and SigL in B. subtilis (GenBank acces-sion no. NP_417669) (8). Although several proteins that ex-hibit partial amino acid similarities with NtrA and SigL inlimited regions of these proteins were retrieved from the ge-nome sequence, these mycobacterial proteins contained noRpoN box sequence, which is conserved in �54 factors (11, 33).These results indicate the absence of a gene encoding the �54

factor in the genome sequence of M. smegmatis strain MC2 155and are consistent with previous reports concerning this strainand other mycobacterial strains (31, 32, 35). Using a similartechnique, we confirmed the absence of a gene encoding the�54 factor in the genome sequences of the actinomycetes: R.jostii strain RHA1, G. bronchialis strain DSM 43247, and S.avermitilis strain MA-4680.

DISCUSSION

In this report, we describe identification of the mimR genewhose product is essential for expression of the binuclear ironmonooxygenase gene cluster, mimABCD, in M. smegmatisstrain MC2 155 and M. goodii strain 12523. We demonstratedby deletion and complementation analyses that MimR is thepositive regulator of this gene cluster expression that is respon-sive to acetone (Fig. 3). Sequence analysis revealed that MimRbelongs to the NtrC family of transcriptional activators, al-though the MimR regulatory system seems to differ in somerespects from the general NtrC system as described below. Toour knowledge, MimR is the first member of the NtrC familyin actinomycetes whose function has been experimentally de-termined.

We have previously demonstrated that the mimABCD genecluster plays essential roles in propane and acetone metabo-lism (10). When the mimA gene of M. smegmatis strain MC2155 was deleted, the mutant lost the ability to grow on propaneand acetone as a source of carbon and energy but not onacetol. MimA (Msmeg_1971) and Msmeg_1977 exhibit signif-icant amino acid similarities (95% and 74%) with the mono-oxygenase (PrmA) converting propane to 2-propanol and thedehydrogenase (Adh1) converting 2-propanol to acetone,respectively, in Gordonia sp. TY-5 (16). Although we havenot enzymologically identified the functions of MimA andMsmeg_1977, these findings suggested that propane might bemetabolized via 2-propanol, acetone, and acetol in M. smeg-matis strain MC2 155 (10). The mimABCD gene cluster is alsoresponsible for the regioselective oxidation of phenol to hy-droquinone (10). In this study, MimR was activated in thepresence of acetone but not of phenol and hydroquinone (Fig.3 and 4). These results provide strong support for the idea thatMimR-controlled MimABCD plays physiological roles in the

metabolism of propane and acetone and fortuitously has theability to oxidize aromatic phenol (10). MimR was also acti-vated in the presence of 2-propanol, propane, acetol, 2-bu-tanone, and 2-butanol (Fig. 4), although in the in vivo experi-ments described here we cannot formally rule out thepossibility that these compounds are converted to other com-pounds, which might activate MimR. In particular, hydropho-bic propane might be converted to 2-propanol and/or acetone,leading to the induction. The amino-terminal domain of MimRcontains a GAF domain. A GAF domain is also found inAcxR, AcoR, FhlA, and NifA of the NtrC family (2, 30). FhlAand NifA are activated by formate and 2-oxoglutarate, respec-tively (15, 19). The sequences of the GAF domains might haveevolved so that they can sense specific small-molecule environ-mental signals to activate the regulons.

Unexpectedly, the central domain of MimR contains noGAFTGA motif sequence, which is known to participate ininteraction with the �54 factor (Fig. 1). In accordance with thisfinding, M. smegmatis strain MC2 155 lacks a gene encodingthe �54 factor in the genome. This characteristic of MimR isreminiscent of those of TyrR and RcNtrC of the NtrC family(5, 9, 23). The TyrR and RcNtrC proteins control expression ofthe genes involved in metabolism of aromatic amino acids in E.coli and nitrogen metabolism in Rhodobacter capsulatus, re-spectively. These proteins contain no GAFTGA motif se-quence and activate the �70-dependent regulatory system in-stead of the �54-dependent one. The nucleotide sequencebetween the mimR and mimA genes includes promoter ele-ments for expression of the mimABCD gene cluster (Fig. 3).However, a �35, �10 promoter sequence that is recognized bythe �70-dependent RNA polymerase was not detected in thisintergenic region, whereas a �24, �12 promoter-like sequencein the direction of the mimABCD gene cluster does exist in thisregion (Fig. 2). The most highly conserved GG and GC ele-ments of a �24, �12 promoter are replaced by GA and GG,respectively, in the sequence of M. smegmatis strain MC2 155and M. goodii strain 12523, whereas the overall consensussequence (TGGCACG-N4-TTGC) determined by Barrios andcoworkers (4) exhibits appreciable similarity with the sequence(TGAGACG-CATG-TGGG) of these mycobacterial strains.Although we have not yet succeeded in identifying the genuinepromoter, these observations suggest the presence of a novelregulatory system in mycobacteria.

Finally, many homologs of the mimR gene were found inthe sequenced genomes of actinomycetes, including Rhodo-coccus, Gordonia, and Streptomyces strains in addition toMycobacterium strains, which all lack a gene encoding the�54 factor in the genome. These findings indicate thatMimR-like regulatory systems are widespread in actinomy-cetes. The unambiguous identification of MimR as the tran-scriptional activator presented here will provide impetus forfurther detailed characterization of the MimR-like regula-tory systems in actinomycetes.

ACKNOWLEDGMENT

We thank Yoshikazu Izumi (Tottori University) for the gift ofpRHK1.

REFERENCES

1. Abril, M. A., C. Michan, K. N. Timmis, and J. L. Ramos. 1989. Regulatorand enzyme specificities of the TOL plasmid-encoded upper pathway for

5822 FURUYA ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

16

Oct

ober

202

1 by

1.2

44.4

5.14

3.

degradation of aromatic hydrocarbons and expansion of the substrate rangeof the pathway. J. Bacteriol. 171:6782–6790.

2. Ali, N. O., J. Bignon, G. Rapoport, and M. Debarbouille. 2001. Regulation ofthe acetoin catabolic pathway is controlled by sigma L in Bacillus subtilis. J.Bacteriol. 183:2497–2504.

3. Aravind, L., and C. P. Ponting. 1997. The GAF domain: an evolutionary linkbetween diverse phototransducing proteins. Trends Biochem. Sci. 22:458–459.

4. Barrios, H., B. Valderrama, and E. Morett. 1999. Compilation and analysisof �54-dependent promoter sequences. Nucleic Acids Res. 27:4305–4313.

5. Bowman, W. C., and R. G. Kranz. 1998. A bacterial ATP-dependent, en-hancer binding protein that activates the housekeeping RNA polymerase.Genes Dev. 12:1884–1893.

6. Buck, M., M. T. Gallegos, D. J. Studholme, Y. Guo, and J. D. Gralla. 2000.The bacterial enhancer-dependent �54 (�N) transcription factor. J. Bacteriol.182:4129–4136.

7. Chauhan, S., and J. S. Tyagi. 2008. Cooperative binding of phosphorylatedDevR to upstream sites is necessary and sufficient for activation of theRv3134c-devRS operon in Mycobacterium tuberculosis: implication in theinduction of DevR target genes. J. Bacteriol. 190:4301–4312.

8. Debarbouille, M., I. Martin-Verstraete, F. Kunst, and G. Rapoport. 1991.The Bacillus subtilis sigL gene encodes an equivalent of �54 from Gram-negative bacteria. Proc. Natl. Acad. Sci. U. S. A. 88:9092–9096.

9. Foster-Hartnett, D., P. J. Cullen, E. M. Monika, and R. G. Kranz. 1994. Anew type of NtrC transcriptional activator. J. Bacteriol. 176:6175–6187.

10. Furuya, T., S. Hirose, H. Osanai, H. Semba, and K. Kino. 2011. Identifica-tion of the monooxygenase gene clusters responsible for the regioselectiveoxidation of phenol to hydroquinone in mycobacteria. Appl. Environ. Mi-crobiol. 77:1214–1220.

11. Ghosh, T., D. Bose, and X. Zhang. 2010. Mechanisms for activating bacterialRNA polymerase. FEMS Microbiol. Rev. 34:611–627.

12. Harley, C. B., and R. P. Reynolds. 1987. Analysis of E. coli promoter se-quences. Nucleic Acids Res. 15:2343–2361.

13. Hirasawa, K., Y. Ishii, M. Kobayashi, K. Koizumi, and K. Maruhashi. 2001.Improvement of desulfurization activity in Rhodococcus erythropolis KA2-5-1by genetic engineering. Biosci. Biotechnol. Biochem. 65:239–246.

14. Jeong, J. J., J. H. Kim, C. K. Kim, I. Hwang, and K. Lee. 2003. 3- and4-alkylphenol degradation pathway in Pseudomonas sp. strain KL28: geneticorganization of the lap gene cluster and substrate specificities of phenolhydroxylase and catechol 2,3-dioxygenase. Microbiology 149:3265–3277.

15. Korsa, I., and A. Bock. 1997. Characterization of fhlA mutations resulting inligand-independent transcriptional activation and ATP hydrolysis. J. Bacte-riol. 179:41–45.

16. Kotani, T., T. Yamamoto, H. Yurimoto, Y. Sakai, and N. Kato. 2003. Propanemonooxygenase and NAD�-dependent secondary alcohol dehydrogenase inpropane metabolism by Gordonia sp. strain TY-5. J. Bacteriol. 185:7120–7128.

17. Kustu, S., A. K. North, and D. S. Weiss. 1991. Prokaryotic transcriptionalenhancers and enhancer-binding proteins. Trends Biochem. Sci. 16:397–402.

18. Leahy, J. G., P. J. Batchelor, and S. M. Morcomb. 2003. Evolution of thesoluble diiron monooxygenases. FEMS Microbiol. Rev. 27:449–479.

19. Little, R., and R. Dixon. 2003. The amino-terminal GAF domain of Azoto-

bacter vinelandii NifA binds 2-oxoglutarate to resist inhibition by NifL undernitrogen-limiting conditions. J. Biol. Chem. 278:28711–28718.

20. Miyamoto, Y., et al. 2004. Aggregation of mycobacteria caused by disruptionof fibronectin-attachment protein-encoding gene. FEMS Microbiol. Lett.236:227–234.

21. Morett, E., and L. Segovia. 1993. The �54 bacterial enhancer-binding proteinfamily: mechanism of action and phylogenetic relationship of their functionaldomains. J. Bacteriol. 175:6067–6074.

22. Mulder, M. A., H. Zappe, and L. M. Steyn. 1997. Mycobacterial promoters.Tuber. Lung. Dis. 78:211–223.

23. Pittard, A. J., and B. E. Davidson. 1991. TyrR protein of Escherichia coli andits role as repressor and activator. Mol. Microbiol. 5:1585–1592.

24. Popham, D., J. Keener, and S. Kustu. 1991. Purification of the alternative �factor, �54, from Salmonella typhimurium and characterization of �54-ho-loenzyme. J. Biol. Chem. 266:19510–19518.

25. Schafer, A., et al. 1994. Small mobilizable multi-purpose cloning vectorsderived from the Escherichia coli plasmids pK18 and pK19: selection ofdefined deletions in the chromosome of Corynebacterium glutamicum. Gene145:69–73.

26. Semba, H., M. Mukouyama, and K. Sakano. 1996. A para-site-specific hy-droxylation of various aromatic compounds by Mycobacterium sp. strain12523. Appl. Microbiol. Biotechnol. 46:432–437.

27. Semba, H., and K. Sakano. 1997. A para-site-specific hydroxylation of aro-matic compounds by Mycobacterium sp. strain 12523: stabilization of thehydroxylation activity. Appl. Microbiol. Biotechnol. 48:256–260.

28. Sharp, J. O., et al. 2007. An inducible propane monooxygenase is responsiblefor N-nitrosodimethylamine degradation by Rhodococcus sp. strain RHA1.Appl. Environ. Microbiol. 73:6930–6938.

29. Shingler, V., M. Bartilson, and T. Moore. 1993. Cloning and nucleotidesequence of the gene encoding the positive regulator (DmpR) of the phenolcatabolic pathway encoded by pVI150 and identification of DmpR as amember of the NtrC family of transcriptional activators. J. Bacteriol. 175:1596–1604.

30. Sluis, M. K., et al. 2002. Biochemical, molecular, and genetic analyses of theacetone carboxylases from Xanthobacter autotrophicus strain Py2 and Rho-dobacter capsulatus strain B10. J. Bacteriol. 184:2969–2977.

31. Studholme, D. J., and M. Buck. 2000. The biology of enhancer-dependenttranscriptional regulation in bacteria: insights from genome sequences.FEMS Microbiol. Lett. 186:1–9.

32. Studholme, D. J., and R. Dixon. 2003. Domain architectures of �54-depen-dent transcriptional activators. J. Bacteriol. 185:1757–1767.

33. Taylor, M., et al. 1996. The RpoN-box motif of the RNA polymerase � factor�N plays a role in promoter recognition. Mol. Microbiol. 22:1045–1054.

34. van der Geize, R., G. I. Hessels, R. van Gerwen, P. van der Meijden, and L.Dijkhuizen. 2001. Unmarked gene deletion mutagenesis of kstD, encoding3-ketosteroid �1-dehydrogenase, in Rhodococcus erythropolis SQ1 using sacBas counter-selectable marker. FEMS Microbiol. Lett. 205:197–202.

35. Waagmeester, A., J. Thompson, and J. M. Reyrat. 2005. Identifying sigmafactors in Mycobacterium smegmatis by comparative genomic analysis. TrendsMicrobiol. 13:505–509.

36. Xu, H., and T. R. Hoover. 2001. Transcriptional regulation at a distance inbacteria. Curr. Opin. Microbiol. 4:138–144.

VOL. 193, 2011 ACETONE-RESPONSIVE REGULATOR IN MYCOBACTERIA 5823

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

16

Oct

ober

202

1 by

1.2

44.4

5.14

3.