identification of the female-determining region of the w ...secure site ...translocation...
TRANSCRIPT
![Page 1: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/1.jpg)
Identification of the female-determining regionof the W chromosome in Bombyx mori
H. Abe Æ T. Fujii Æ N. Tanaka Æ T. Yokoyama Æ H. Kakehashi ÆM. Ajimura Æ K. Mita Æ Y. Banno Æ Y. Yasukochi Æ T. Oshiki ÆM. Nenoi Æ T. Ishikawa Æ T. Shimada
Received: 11 April 2007 / Accepted: 8 September 2007 / Published online: 28 September 2007
� Springer Science+Business Media B.V. 2007
Abstract The W chromosome of the silkworm Bombyx
mori is devoid of functional genes, except for the putative
female-determining gene (Fem). To localize Fem, we
investigated the presence of W-specific DNA markers on
strains in which an autosomal fragment containing domi-
nant marker genes was attached to the W chromosome. We
produced new W-chromosomal fragments from the exist-
ing Zebra-W strain (T(W;3)Ze chromosome) by X-
irradiation, and then carried out deletion mapping of these
and sex-limited yellow cocoon strains (T(W;2)Y-Chu, -Abe
and -Ban types) from different Japanese stock centers. Of
12 RAPD markers identified in the normal W chromo-
somes of most silkworm strains in Japan, the newly
irradiated W(B-YL-YS)Ze chromosome contained three,
the T(W;2)Y-Chu chromosome contained six, and the
T(W;2)Y-Abe and -Ban chromosomes contained only one
(W-Rikishi). To investigate the ability of the reduced
W-chromosome translocation fragments to form hetero-
chromatin bodies, which are found in nuclei of normal
adult female sucking stomachs, we examined cells of the
normal type p50 strain and the T(W;2)Y-Chu and -Abe
strains. A single sex heterochromatin body was found in
nuclei of p50 females, whereas we detected only small sex
heterochromatin bodies in the T(W;2)Y-Chu strain and no
sex heterochromatin body in the T(W;2)Y-Abe strain. Since
adult females of all strains were normal and fertile, we
conclude that only extremely limited region, containing
the W-Rikishi RAPD sequence of the W chromosome, is
required to determine femaleness. Based on a comparison
of the normal W-chromosome and 7 translocation and
W-deletion strains we present a map of Fem relative to the
12 W-specific RAPD markers.
Keywords Silkworm � Bombyx mori � W chromosome �Translocation � Deletion-mapping � Sex chromosome �RAPD
Introduction
The sex chromosomes of the silkworm Bombyx mori
(2n = 56), are designated ZW (XY) for the female and ZZ
(XX) for the male (Tanaka 1916). Femaleness is deter-
mined by the presence of a single W chromosome,
irrespective of the number of autosomes or Z chromosomes
(Hashimoto 1933). Therefore, the putative Fem (female
determinant) gene is assumed to occupy a certain region of
the W chromosome. To analyze the mechanism of sex
determination in B. mori, genetic mapping and analysis of
H. Abe (&) � T. Fujii � N. Tanaka � T. Yokoyama �H. Kakehashi � T. Oshiki
Department of Biological Production, Faculty of Agriculture,
Tokyo University of Agriculture and Technology, Saiwai-cho,
3-5-8 Fuchu, Tokyo 183-8509, Japan
e-mail: [email protected]
M. Ajimura � K. Mita � Y. Yasukochi
National Institute of Agrobiological Science, Owashi 1-2,
Tsukuba, Ibaraki 305-8634, Japan
Y. Banno
Kyushu University Graduate School of Bioresource and
Bioenvironmental Science, Hakozaki 6-10-1, Higashi-ku,
Fukuoka 812-8581, Japan
M. Nenoi � T. Ishikawa
National Institute of Radiological Sciences 9-1, Anagawa 4-9-1,
Inage-ku, Tiba 263-8555, Japan
T. Shimada
Department of Agricultural and Environmental Biology,
Graduate school of Agricultural and Life Sciences, The
University of Tokyo, Yayoi 1-1-1, Bunkyo-ku 113-8657, Japan
123
Genetica (2008) 133:269–282
DOI 10.1007/s10709-007-9210-1
![Page 2: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/2.jpg)
the Fem gene on the W chromosome is required. Although
400 or more visible mutations have been placed on linkage
maps in B. mori (Doira 1992; Goldsmith 1995; Goldsmith
et al. 2005) and many genes have been mapped to the Z
chromosome (Fujii et al. 1998; Koike et al. 2003), no gene
for a morphological character has so far been mapped to
the normal W chromosome. Similarly, no W-specific
markers have been found despite construction of extensive
linkage maps in silkworm, including RAPDs (Promboon
et al. 1995; Yasukochi 1998), AFLPs (Tan et al. 2001),
SSRs (Miao et al. 2005) and SNPs (Yamamoto et al.
2006). Recently, a draft sequence of B. mori (p50 strain)
genome using three-fold whole-genome shotgun sequenc-
ing was obtained by Mita et al. (2004), and a Chinese
group obtained a draft sequence of p50 strain using 5.9-fold
whole-genome shotgun sequencing (Xia et al. 2004), but as
these shotgun sequencing efforts were undertaken using
only the male genome, systematic molecular analysis of the
W chromosome of B. mori has not yet been initiated.
Therefore, for the purpose of analyzing the W chromosome
at the molecular level, we have been identifying DNA
sequences specific to the W chromosome. To date, we have
identified 12 W-specific RAPD markers (Abe et al. 1998a,
2005b). However, the genetic mapping of these W-specific
RAPD markers on the W chromosome is impossible by
conventional recombination experiments because crossing-
over is restricted to males in B. mori. Further, Sahara et al
(2003) succeeded in identifying the W chromosome by
fluorescence in situ hybridization (FISH) using four bac-
terial artificial chromosome (BAC) probes derived from the
W chromosome. However, the probes painted uniformly
the whole W chromosome because it is largely composed
of nested retrotransposons (Abe et al. 2002, 2005a).
Therefore, it is very difficult to use FISH for cytogenetic
mapping of W-specific markers.
In several sex-limited B. mori strains the autosomal
fragment containing the dominant genes for visible/mor-
phological traits have been translocated to the W
chromosome using X-ray or gamma-ray irradiation (Taz-
ima 1941, 1944; Tazima et al. 1951; Kimura et al. 1971).
Recently, we used W-translocation strains with W-specific
RAPD markers to analyze the W chromosome region.
Fortunately, the normal W chromosomes of the strains in
Japan are almost identical in type (Japanese-W-Eve type)
(Abe et al. 2005b). Therefore, a deletion of the W chro-
mosome can be detected by the disappearance of W-
specific RAPD markers. In the sex-limited zebra (Zebra-
W) strain, female larvae have a zebra marking due to the
T(W;3)Ze chromosome, whereas male larvae have no
marking (whitish skin) (Hashimoto 1948), and the W
chromosome region lacks two of 12 known RAPD markers
(W-Mikan and W-Samurai) (Abe et al. 2005b). In the sex-
limited black egg strain, the female eggs are black, while
the male eggs are yellowish white due to the T(W;10)+w–2
chromosome (Tazima et al. 1951) in which the W chro-
mosome region lacks one of the 12 RAPD markers (W-
Mikan) (Abe et al. 2005b). Finally, in the ‘‘male’’ of the
Z101 strain the DfZ-DfW chromosome, in which the W
chromosome fragment is attached to the Z chromosome
fragment, contains three W-specific RAPD markers (W-
Mikan, W-Samurai and W-Bonsai) (Fujii et al. 2006).
Therefore, we thought that these modified W chromosomes
are not the result of simple fusion of autosome fragments to
the end of unaltered W chromosome but rather the products
of reciprocal translocations accompanied by partial dele-
tions of the W chromosome (Abe et al. 2005b; Fujii et al.
2006). Recently, by using X-ray irradiation, we obtained
the ZeWZ2 chromosome, in which a fragment of the
T(W;3)Ze chromosome designated as ZeW is attached to
the Z chromosome fragment (Z2), having three of 12 W-
specific RAPD markers (W-Bonsai, W-Yukemuri-L and
W-Yukemuri-S) (Fujii et al. 2007).
We think that if more W chromosome variants could be
developed through breaking by X-ray irradiation, we could
map these W-specific RAPD markers and Fem on the W
chromosome by deletion mapping. Therefore, in this study,
to obtain more W chromosome variants, we attempted to
fragment the T(W;3)Ze chromosome using X-rays, and then
investigated the presence or absence of the W-specific
RAPD markers of the resulting W chromosome variant. We
also investigated the presence or absence of the W-specific
RAPD markers of the T(W;2)Y chromosome in sex-limited
yellow cocoon strains maintained by several different
institutes and research groups. Additionally, we investi-
gated the presence of a sex chromatin body (SB), deduced
to be the condensed W chromosomes (Ennis 1976; Traut
and Marec 1996), in polyploid tissue of the sex-limited
yellow cocoon strain. Here, we determine the order of the
W-specific RAPD markers and putative Fem gene on the W
chromosome. We report that only an extremely limited
region containing the W-Rikishi RAPD marker sequence of
the W chromosome is required to determine femaleness.
Materials and methods
Silkworm strains and X-ray irradiation
We used the p50, C108, SCH, and C125 strains with nor-
mal W chromosomes and sex-limited Zebra-W and sex-
limited yellow-cocoon strains with modified W chromo-
somes. All silkworms were reared on fresh mulberry
leaves.
The p50 and C108 strains are highly inbred and have
been maintained by sister-brother mating, as described by
Promboon et al (1995). For phenotypic marker of the Z
270 Genetica (2008) 133:269–282
123
![Page 3: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/3.jpg)
chromosome, sch (sex-linked chocolate, 1(Z)-21.5) and od
(distinct translucent, 1(Z)-49.6) were used. The SCH strain
has the marker, sch, on the Z chromosome. Newly hatched
female larvae (WZsch) and male larvae (Zsch/Zsch) are
reddish brown. A cross of female (WZ+sch) with male (Zsch/
Zsch) produces female larvae (WZsch) that are reddish
brown when hatched, while male larvae (Zsch/+) are black.
The OD strain has the marker, od, on the Z chromosome.
Both of female (W/Zod) and male (Zod/Zod) larvae are
translucent. The characteristics of these marker genes are
described in Doira (1978).
The sex-limited Zebra-W strain was used for the X-ray
irradiation experiments. This strain is congenic to strain
C108 with respect to the W chromosome. It carries the
T(W;3)Ze chromosome, and has been maintained by
repeated backcrossing of zebra females to white males of
strain C108 (Abe et al. 2005b). Female pupae in mid or late
pupal stages of this strain were rotated on a turn table and
irradiated by a 4,000 R dose of X-ray irradiation produced
by a SOFTEX M-70WE irradiator (SOFTEX Co. Ltd)
applied at a rate of 2.8 Gy/min (total irradiation time
13007@) as described previously (Fujii et al. 2007). Subse-
quently, the emerged female moths were crossed to SCH or
C108 males. Offspring were reared by two different
methods.
In one method (Experiment 1), we crossed the emerged
female moths with males of the SCH strain. To reduce the
labor required for breeding, black larvae (male) were
removed by tweezers. Alternatively, to breed only male
larvae, reddish larvae (female) were removed. When the
larvae reached the fourth instar, we could discriminate the
zebra or white larvae and bred only zebra male and white
female larvae. Thus, although the probability of detecting
breakage of the T(W;3)Ze chromosome was lower because
we eliminated half of the hatched larvae, we were able to
reduce labor. We investigated a total of 15,074 larvae using
this method.
By a second method (Experiment 2), so as not to reduce
the probability of detecting the breakage of the T(W;3)Ze
chromosome, we crossed emerged female moths to males
of the C108 strain (white larvae), reared the resulting lar-
vae to the 5th (final) instar, and distinguished the sexes by
inspecting Ishiwata’s germal discs and Herald’s gland on
the post-ventral surface. We examined a total of 18,793 5th
instar larvae using this method/in this experiment.
The sex-limited yellow cocoon strains have the T(W;2)Y
chromosome (Kimura et al. 1971). The hemolymph of
female larvae is deep yellow from the presence of the Y
gene (Y, 2–25.6), since carotenoids present in mulberry
leaves pass through their digestive organs, and they spin
yellow cocoons, while male larvae have white hemolymph
and spin white cocoons. We used three sex-limited
yellow cocoon strains maintained by three researchers:
T(W;2)Y-Abe and T(W;2)Y-Chu, maintained at the Faculty
of Agriculture, Tokyo University of Agriculture and
Technology by H. Abe and T. Yokoyama, respectively, and
the T(W;2)Y-Ban type maintained at the Silkworm Genetic
Division, Kyusyu University, by Y. Banno.
To investigate the possibility that the T(W;2)Y-Abe and
T(W;2)Y-Chu chromosomes may behave as a chromosome
2 not a W chromosome, we crossed a female having the
T(W;2)Y-Abe (Z+od/T(W;2)Y-Abe) or T(W;2)Y-Chu (Z+od/
T(W;2)Y-Chu) chromosome with a male (od/od) of the OD
strain.
The original W chromosome of the three T(W;2)Y
chromosomes (-Abe, -Chu, and -Ban types) was the normal
W chromosome of the C125 strain (Kimura et al. 1971).
The C125 strain used in this study was purchased from
Gunma Sericultural Experiment Station.
DNA extraction, W-specific RAPD markers, primers
and PCR
Genomic DNA was extracted from posterior silk glands of
larvae or legs of moths as described previously (Abe et al.
1996; 1998a).
PCR using 10-mer primers was carried out as previ-
ously described (Abe et al. 1998a). Briefly, 45 cycles of
PCR were performed on a Zymoreactor II Thermal Cycler
(ATTO Co.) as follows: 94�C for 1 min, 37�C for 1 min,
and 72�C for 3 min followed by a final extension of
10 min at 72�C. PCR products were analyzed by elec-
trophoresis on 2% agarose gels and stained with ethidium
bromide.
The twelve W-specific RAPD markers used in this study
were described previously (Abe et al. 1998a; 2005b).
BAC libraries, screening, DNA sequencing and
sequence analysis
Two B. mori bacterial artificial chromosome (BAC)
libraries, constructed separately using genomic DNA from
mixed populations of males and females of the p50 and
C108 silkworm strains, were used (Wu et al. 1999).
Another B. mori BAC library was also constructed using
genomic DNA extracted from a mixed population of the
p50 strain (K. Mita, unpublished data). We used a locus-
specific PCR strategy according to the protocol described
in Yasukochi (2002) to obtain a BAC clone containing the
W-Rikishi RAPD marker sequence. To detect the W-Ri-
kishi RAPD marker as a sequence-characterized amplified
region (SCAR) marker (Paran and Michelmore 1993), we
used primers Rikishi-A1 (50-GGCGATGCTGTGTACCC
AGAATGT-30) and Rikishi-B2 (50-GTCCTCTGCGA
Genetica (2008) 133:269–282 271
123
![Page 4: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/4.jpg)
TGGGTGGCACATA-30) (Abe et al. 2005b). We obtained
one positive BAC clone (designated 1C7C) containing the
W-Rikishi RAPD marker sequence, which was sequenced
by a shotgun method. Based on its nucleotide sequence, we
designed longer primer pairs (Table 1) to amplify the
regions containing the boundaries of retrotransposable
elements as new W-specific PCR markers.
For shotgun sequencing, BAC DNA was physically
fragmented using the HydroShear process (GeneMachines
Inc., USA). The fragmented DNA was separated by aga-
rose gel electrophoresis, and 2- and 5-kb fractions were
extracted from gels. Using T4 DNA ligase (TaKaRa Bio
Inc.), fragments of each size were ligated separately into a
pUC118 plasmid vector that had been previously digested
with Hinc II and treated with bacterial alkaline phospha-
tase. The ligated DNA samples were introduced into E. coli
DH10B by electroporation, resulting in 2- and 5-kb shot-
gun libraries.
About 1,000 clones were selected from each library for
sequencing. Plasmid DNA was prepared from overnight
cultures using an automated plasmid isolation machine
(PI-1100; Kurabo Ind. Ltd.). Sequencing was carried out
from both ends of plasmid DNAs using an ABI 3700
capillary sequencer and BigDye Terminator v3.1 Cycle
Sequencing Kit (Applied Biosystems). About 4,000
sequence profiles, which had been qualified by Phred
(CodonCode Co.), were assembled by the CAP4 program
of the Paracel Genome Assembler using a Compac
machine of the Dragon Genomic Center, TaKaRa Bio
Inc.
The BLAST program (Altschul et al. 1990) was used to
search for sequence similarities with known DNA
(BLASTN) or protein (BLASTX) sequences.
Observation of the sex heterochromatin body
We observed the sex heterochromatin body (SB), which is
easily detected in the highly polyploid nuclei of the sucking
stomachs in females (Pan et al. 1987), by the method of
Tanaka et al (2000). Excised sucking stomachs were dis-
sected on slides with forceps. The tissue was then stained
with acetic orcein (3%), covered with coverslips, com-
pressed after 10 min, and observed by light microscopy.
GenBank accession numbers
The nucleotide sequences of the seven stretches of the
1C7C BAC clone reported here were deposited in the
DDBJ, EMBL and GenBank nucleotide databases under
accession numbers AB251908–AB251914.
Results
Breakage of the T(W;3)Ze chromosome by X-ray
irradiation
We attempted to fragment the T(W;3)Ze chromosome
using X-rays. In Experiment 1, to breed only female larvae,
newly hatched black larvae (male) were removed by
tweezers. Alternatively, to breed only male larvae, reddish
larvae (female) were removed. The larvae reached the
fourth instar, we discriminated the zebra or white larvae
and bred only zebra male and white female larvae. Using
this approach of Experiment 1, we detected one zebra male
larva out of 7,002 males (Table 2). Unfortunately, this
Table 1 Primer sequences for
amplification of W-specific
PCR markers of the 1C7C BAC
clone
W-specific PCR marker Primers Sequence 50-30 Product size (bp)
W-R-C2 C2-A GATGCGCACACGGATGACTACTTCG 578
C2-B ACTGAAATGGGTCTAAAGTTAGTGG
W-R-C8 C8-C AAAGTGGTGAATATTGAGTACAGCT 613
C8-D CAGCACGCGACGGGTGCCTGAATCG
W-R-C12 C12-G ACACTACTTTCCGGTTACGTACCAT 578
C12-H GTGACTGCCGATGGAATACAAAGTC
W-R-C18 C18-K GTCCTAGTTTCATGCTAGCTTCAGT 440
C18-L AAGCAGGCTTAGCCTTCGGCACAGA
W-R-C21 C21-G AACTTCGGGTAGTGCAGTGCTAGTA 483
C21-H GGTCCATTCCACATCAGATCATTCA
W-R-C27 C27-Q CGGAGGAATTCCGCGAATACAGCGT 507
C27-R ATTCACCACTTCATTATCCTGGAAT
W-R-C29 C29-E CGACCGTGAGAGTGCCAGCATCAGC 575
C29-F TTACTTAAAACTTGAAGTTAATGCG
272 Genetica (2008) 133:269–282
123
![Page 5: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/5.jpg)
larva died during the 5th instar. Therefore, it was imme-
diately dissected and genomic DNA was extracted from the
posterior silk gland and used as template for PCR. No W-
specific RAPD markers were amplified from this zebra
male. We detected 10 white female larvae out of 8,072
females (Table 2). Two of the 10 white females died dur-
ing 5th instar; DNA was extracted from the posterior silk
gland of each and used as templates for PCR. Ten W-
specific RAPD markers were amplified from these two
larvae. Eight of the 10 white female larvae grew into adult
moths, were crossed with C108 males, and produced eggs.
After oviposition, genomic DNA extracted from legs of
each of these eight moths was used as templates for PCR;
10 W-specific RAPD markers were also amplified from
these eight female moths. Thus, all 10 white female larvae
appearing in this study contained all 10 W-specific RAPD
markers, as did the normal zebra female. These results
indicated that in all white females the breakage occurred in
the attachment site between the W-chromosome segment
carrying the putative Fem gene (B region) and the chro-
mosome 3 fragment carrying Ze (Fig. 1C).
In Experiment 2, we reared the resulting larvae to the
final instar, and distinguished the sexes by inspecting the
post-ventral surface. Using the method of Experiment 2,
we detected three females out of 9,868 white larvae
(Table 3). The three white female larvae grew into adult
moths, were crossed with C108 males, and produced eggs.
After oviposition, genomic DNA extracted from legs of
each of these three moths was used as templates for PCR,
yielding products for all 10 W-specific RAPD markers.
These results indicated that the breakage occurred at an
attachment site between the B region and the Ze-containing
chromosome 3 fragment in these individuals (Fig. 1C). We
also detected one male out of 8,925 zebra larvae (Table 3)
which grew into an adult moth, was crossed with C108
females, and produced eggs. After copulation, genomic
DNA was extracted from the legs and used as a template
for PCR; only three W-specific RAPD markers (W-Bonsai,
W-Yukemuri-L and W-Yukemuri-S) were amplified from
this male moth. Among its progeny, both white and zebra
larvae appeared. The ratio of zebra females:zebra males
was 1:1, and all zebra larvae contained the same three
W-specific RAPD markers, irrespective of sex. These
results indicated that the breakage occurred in the B region
(Fig. 1B) between Fem and the Ze containing segment, and
that the W chromosome fragment generated was accom-
panied by a chromosome 3 fragment containing the
W-Bonsai, W-Yukemuri-L, and W-Yukemuri-S RAPD
markers (designated as the ‘‘W(B-YL-YS)Ze’’ chromo-
some) (Table 4). However, the structure of this W(B-
YL-YS)Ze chromosome is not known. One possibility is
that it was attached to an autosome. A more detailed
genetic study is needed to clarify the features of the
W(B-YL-YS)Ze chromosome.
Presence or absence of W-specific RAPD markers on the
T(W;2)Y chromosomes and the W chromosome of the C125
We determined the presence or absence of the W-
specific RAPD markers in three sex-limited yellow cocoon
strains and the original type C125 strain. The T(W;2)Y-Chu
type strain contained six of the 12 previously identified
W-specific RAPD markers (W-Rikishi, W-Yukemuri-L,
W-Yukemuri-S, W-Bonsai, W-Samurai, and W-Mikan)
(Table 4). Both the T(W;2)Y-Abe and T(W;2)Y-Ban
translocations contained only one of the 12 W-specific
RAPD markers (W-Rikishi). However, the C125 strain
contained all 12 W-specific RAPD markers (Table 4).
These results suggested that the original W chromosome of
the T(W;2)Y-Abe and -Ban strains differed from the stan-
dard normal Japanese-W-Eve type. However, the original
W chromosome of the T(W;2)Y strain was the W chro-
mosome of the C125 strain (Kimura et al. 1971).
Therefore, this explanation does not seem likely. Another
possibility is that almost all of the attached regions, except
for one containing the W-Rikishi RAPD marker with the
putative Fem gene, were deleted from the T(W;2)Y-Abe
and -Ban chromosomes. Therefore, to investigate the
presence or absence of the regions around the W-Rikishi
RAPD marker sequence in the T(W;2)Y-Abe and -Ban
chromosomes, we attempted to obtain a BAC clone con-
taining the W-Rikishi RAPD marker sequence and to
convert the DNA sequences of this BAC clone into new
W-specific PCR markers, as described below.
1C7C BAC clone structure and amplification patterns
of new W-specific PCR markers using newly designed
primers
We used a PCR strategy to obtain the BAC clone, 1C7C,
which contained the W-Rikishi RAPD marker sequence,
and subjected it to shotgun sequencing. The total amount of
sequences obtained from 1C7C BAC clone was 92,501 bp.
We were unable to construct a single contiguous sequence
due to the presence of many repetitive DNA elements.
Table 2 Segregation in the F1 progeny of the cross between the sex-
limited Zebra-W strain irradiated by X-ray and SCH strain (EXP.1)
sch ($) +sch (#)
Ze + Ze +
8062 10 1 7001
Mating: female · male
Zþsch
/T(W;3)Ze · Zsch/Zsch)
Genetica (2008) 133:269–282 273
123
![Page 6: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/6.jpg)
However, based on BLASTN and BLASTX searches, we
identified many regions containing the boundaries of ret-
rotransposable elements, from which we have developed 7
new W-specific PCR markers.
W-1C7C-C2 stretch
The W-1C7C-C2 stretch (4355 bp) contained two partial
amino acid (aa) coding regions which were revealed by
BLASTX and BLASTN searches to contain part of the
reverse transcriptase (RT) domain of a non-LTR retro-
transposon. We designated these non-LTR retrotransposons
as Tama and Akebono. However, we could not find typical
poly(A) tails (Fig. 2A), and therefore, we could not deter-
mine the precise boundary between these two elements. To
amplify the region containing the boundary of Tama and
Akebono as a W-specific PCR marker, we designed a longer
primer pair, C2-A and C2-B. The new primers produced a
female-specific band (designated as the W-R-C2 marker)
along with some non-specific bands, as shown in Fig. 3A.
W-1C7C-C8 stretch
The W-1C7C-C8 stretch (8562 bp) contained a long aa and
a partial aa coding region. BLASTX and BLASTN sear-
ches revealed that the long aa sequence contained cysteine
and histidine (Cys) motifs, protease (Pro), RT, RNase H
(RH), and integrase (Int) domains, and an open reading
frame (ORF) typical of a Pao-like LTR retrotransposon
(designated Ichiro) (Abe et al. 2001; Xiong et al. 1993).
Moreover, a poly(A) tail of a BMC1-like non-LTR retro-
transposon appeared at the 50 end (Ogura et al. 1994; Abe
et al. 1998b). Furthermore, the sequence of BMC1, from
the 50-UTR to ORF1, appeared at the 30end, and we iden-
tified LTR-like sequences at both ends of the ORF of
Ichiro. We suspected that the sequence 50-GGGGGG-30 in
the region between the ORF of Ichiro and the 50-UTR of
BMC1 might represent a polypurine tract (PPT). Although
we could not definitively identify the initiation site of the
30LTR of Ichiro from the sequence data of the 50LTR
because the 50LTR may be incomplete, it should be
included in the region adjacent to the PPT. The sequence
data also strongly indicated that another non-LTR
Fig. 1 Three models of
expected breakage of the
T(W;3)Ze chromosome by X-
ray. (A) A breakage occurs
between one end of the W
chromosome and the Fem gene
(A region); (B) A breakage
occurs between the Fem gene
and the attachment site of the W
and chromosome 3 fragment (B
region); (C) A breakage occurs
in the attachment site between
the W and chromosome 3
fragment
Table 3 Segregation in the F1 progeny of the cross between the sex-
limited Zebra-W strain irradiated by X-ray and C108 strain (EXP.2)
Ze ($) Ze (#) +Ze ($) +Ze(#)
8924 1 3 9865
Mating: female · male
(Z/T(W;3)Ze, p/p · Z/Z, p/p)
p; Plain(p) is without marking
Table 4 Presence or absence of W-specific RAPD markers in the silkworm strains and W chromosome variants
Strain or chromosome Kabuki Kamikaze BMC1-
Kabuki
Sakura Sasuke Musashi Rikishi Yukemuri-L Yukemuri-S Bonsai Samurai Mikan
C125 + + + + + + + + + + + +
T(W;2)Y-Chu – – – – – – + + + + + +
T(W;2)Y-Ban – – – – – – + – – – – –
T(W;2)Y-Abe – – – – – – + – – – – –
W(B-YL-YS)Ze – – – – – – – + + + – –
274 Genetica (2008) 133:269–282
123
![Page 7: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/7.jpg)
retrotransposon was inserted into the 50LTR of Ichiro.
Therefore, we determined that the W-1C7C-C8 stretch was
composed of three retrotransposons (Fig. 2B). To amplify
the region containing the boundary of Ichiro and the 50
non-LTR element as a W-specific PCR marker, we
designed a longer primer pair, C8-C and C8-D. The new
primers produced a female-specific band (designated as the
W-R-C8 marker), accompanied by some non-specific
bands, shown in Fig. 3B.
W-1C7C-C12 stretch
The W-1C7C-C12 stretch (6670 bp) contained three partial
aa coding regions. BLASTX and BLASTN searches
revealed that one of them contained part of the RT domain
of a non-LTR retrotransposon, and a second aa coding
region at the 50 end contained part of ORFs 1 and 2 of
BMC1. Another non-LTR retrotransposon called TREST1
(accession No. D55702) was located at the 30 end. In the
non-LTR retrotransposons adjacent to the BMC1 sequence
(designated Manga), we could not find the 30-UTR or
poly(A) tail. These results indicated that BMC1 was
inserted into Manga. Moreover, a BLASTN search
revealed that the nucleotide sequence (nucleotide positions
3498–3781) between Manga and TREST1 was partially
homologous to an already reported Bombyx repetitive
sequence but that the remaining region was not homolo-
gous to any known sequence. Therefore, we determined
that the W-1C7C-C12 stretch was composed of three
Fig. 2 Schematic diagrams of
the seven stretches of 1C7C
BAC clone and the female-
specific PCR markers. (A) W-
1C7C-C2; (B) W-1C7C-C8; (C)
W-1C7C-C12; (D) W-1C7C-
C18; (E) W-1C7C-C21; (F) W-
1C7C-C27, and (G) W-1C7C-
C29. These maps are based on
DNA sequence information.
Each block indicates a
transposable element and each
box with an arrow indicates one
LTR of each retrotransposon.
The arrows under or over each
box indicate the transcriptional
orientation. The double-ended
arrows in each stretch indicate
the newly designed female-
specific PCR markers. RT,
reverse transcriptase domain;
Cys, cysteine and histidine
motif; Pro, protease domain;
RH, RNase H domain; Int,
Integrase domain; PPT,
polypurine tract
Genetica (2008) 133:269–282 275
123
![Page 8: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/8.jpg)
non-LTR retrotransposons, a Bombyx repetitive sequence,
and an unknown sequence (Fig. 2C). To amplify the region
containing the boundary of Manga and the Bombyx
repetitive sequence as a W-specific PCR marker, we
designed a longer primer, C12-G and C12-H. The new
primers produced a female-specific band (designated as the
W-R-C12 marker), accompanied by some non-specific
bands, as shown in Fig. 3C.
W-1C7C-C18 stretch
The W-1C7C-C18 stretch (1381 bp) contained two partial
aa coding regions. BLASTX and BLASTN searches
revealed that one of them contained part of the Cys motifs
of a Pao-like LTR retrotransposon (designated Yukata)
and the other one contained a portion of the non-LTR
retrotransposon BMC1. Moreover, a poly(A) tail of a
retroelement was attached to the 50 end. Therefore, we
determined that the W-1C7C-C18 stretch was composed of
two retrotransposons and the poly(A) tail of a retroelement
(Fig. 2D). To amplify the region containing the boundary
of Yukata and BMC1 as a W-specific PCR marker, we
designed the longer primer pair C18-K and C18-L. The
new primers produced a female-specific band (designated
as the W-R-C18) as shown in Fig. 3D.
W-1C7C-C21 stretch
The W-1C7C-C21 stretch (8673 bp) contained four partial
aa coding regions. BLASTX and BLASTN searches
revealed that an aa coding region at the 50 end contained
part of ORF2 of BMC1, an aa coding region adjacent to
BMC1contained part of the RT domain of a non-LTR
retrotransposon (designated Otaku), an aa coding region
adjacent to Otaku contained parts of the RT, RH, and Int
domains of a Pao-like LTR retrotransposon (designated
Kimono), and the remaining aa coding region adjacent to
Kimono contained part of ORFs 1 and 2 of a BMC1-like
non-LTR retrotransposon. We could not find the 30-UTR or
poly(A) tail of Otaku. These results indicated that the
BMC1 element at the 50 end was inserted into Otaku.
Moreover, we could not find the 50LTR, Cys motif, or Pro
domains of Kimono, similarly indicating that Otaku was
inserted into Kimono. We suspected that the sequence 50-GGGGGAA-30 in the region between the ORF of Kimono
and the BMC1-like non-LTR retrotransposon might rep-
resent a PPT. Moreover, we found that the ORF of this
BMC1-like retrotransposon did not contain an RT domain
or poly(A) tail. These results indicated that the BMC1-like
retrotransposon was inserted into Kimono. Although we
could not definitively determine the 30LTR of Kimono
because the 50LTR was not contained in this stretch, the
sequence between the PPT and the end of the aa coding
region of the BMC1-like retrotransposon was thought to be
a part of the 30LTR. Therefore, we determined that W-
1C7C-C21 stretch was composed of four retrotransposons
as shown in Fig. 2E. To amplify the region containing the
boundary of Otaku and Kimono as a W-specific PCR
marker, we designed a longer primer pair, C21-G and C21-
H. The new primers produced a female-specific band
(designated as the W-R-C21 marker), as shown in Fig. 3E.
W-1C7C-C27 stretch
The W-1C7C-C27 stretch (2465 bp) contained two partial
aa coding regions. BLASTX and BLASTN searches
revealed that one of them contained part of ORF1 of BMC1
and the other one contained part of the RT domain of a
non-LTR retrotransposon (designated Hide). The 50end of
this copy of BMC1 was slightly truncated; further, we
could not find the typical poly(A) tail of Hide. These
results indicated that the BMC1 element was inserted into
Fig. 3 Amplification patterns of genomic DNA from males and
females of the p50 strain using the seven newly developed primers
sets shown in Table 1. (A) W-R-C2; (B) W-R-C8; (C) W-R-C12; (D)
W-R-C-18; (E) W-R-C21; (F) W-R-C27 and (G) W-R-C29. Arrow-
heads indicate female-specific PCR markers. M, molecular size
marker (100 bp ladder). The number at the left indicate base pairs
276 Genetica (2008) 133:269–282
123
![Page 9: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/9.jpg)
the 30-UTR region of Hide. Therefore, we determined that
the W-1C7C-C27 stretch was composed of two non-LTR
retrotransposons (Fig. 2F). To amplify the region contain-
ing the boundary of BMC1 and Hide as a W-specific PCR
marker, we designed a longer primer pair, C27-Q and C27-
R. The new primers produced a female-specific band
(designated as the W-R-C27 marker), as shown in Fig. 3F.
W-1C7C-C29 stretch
The W-1C7C-C29 stretch (5753 bp) contained two partial
aa coding regions. BLASTX and BLASTN searches
revealed that one of them contained part of a Pao-like
retrotransposon, Kamikaze (Abe et al. 2001) and that the
other one contained part of ORF2 of a non-LTR retro-
transposon (designated Tojo). We identified the 30LTR of
Kamikaze, between the aa coding regions of Kamikaze and
Tojo. Therefore, we determined that the W-1C7C-29
stretch was composed of two retrotransposons as shown in
Fig. 2G. To amplify the region containing the boundary of
kamikaze and Tojo as a W-specific PCR marker, we
designed a longer primer pair, C29-E and C29-F. The new
primers produced a female-specific band (designated as the
W-R-C29 marker), accompanied by some non-specific
bands, as shown in Fig. 3G.
Presence of W-specific sequences around the W-Rikishi
RAPD marker in the sex-limited yellow cocoon strains
As described above, both W chromosomes of the T(W;2)Y-
Abe and -Ban strains contained only the W-Rikishi RAPD
marker. To map this region in more detail, we investigated
the presence or absence of the seven newly developed W-
specific PCR markers (W-R-C2, W-R-C8, W-R-C12, W-R-
C18, W-R-C21, W-R-C27 and W-R-C29) derived from the
1C7C BAC clone. The T(W;2)Y-Abe and -Ban type chro-
mosomes contained all seven W-specific PCR markers
(data not shown).
Sex heterochromatin body in sex-limited yellow cocoon
strains
We prepared sucking stomachs of the p50 strain (normal W
chromosome) and two sex-limited yellow cocoon strains
(T(W;2)Y-Chu and T(W;2)Y-Abe types), and inspected
them in detail for the presence and shape of SBs. In the p50
strain, a single SB was regularly observed in the nuclei of
female moths (Fig. 4B and C), whereas no SB was detected
in nuclei of male moths (Fig. 4A). In the sex-limited
yellow cocoon strain with the T(W;2)Y-Chu type
chromosome, several cases were recognized. In one, we
observed a single smaller SB than in the p50 strain
(Fig. 4D and E). In another, we observed several SBs in
each nucleus (two, Fig. 4F; four, Fig. 4G) in female moths.
However, the other sex-limited yellow cocoon strain with a
T(W;2)Y-Abe type chromosome showed no SB in the
nuclei of female moths (Fig. 4H and I). As expected, we
detected no SB in nuclei of males of either sex-limited
yellow cocoon strain (data not shown).
Genetic behavior of the T(W;2)Y-Abe chromosome in
female meiosis
We suspected that the T(W;2)Y-Abe chromosome and
T(W;2)Y-Chu chromosome may behave as a chromosome
2 not a W chromosome during meiosis because the frag-
ment of chromosome 2 present in this strain might be
longer than the fragment of the W chromosome. However,
all newly hatched female larvae carrying the T(W;2)Y-Abe
and T(W;2)Y-Chu chromosomes were translucent (od),
while all male larvae were normal opacity (+od) (Table 5).
Thus, the T(W;2)Y-Abe and T(W;2)Y-Chu chromosomes
behaved as a W chromosome in meiosis.
Discussion
Breakage of the T(W;3)Ze chromosome
Just prior to deposition, the egg nucleus is in metaphase of
the first maturation division, which is soon terminated by
elimination of the first polar body (Sakaguchi 1978). After
metaphase I, the W chromosome and Z chromosome move
to opposite poles. The movement of an induced W chro-
mosome fragment to a particular pole is thought to be
random. We can detect the fragmentation of the T(W;3)Ze
chromosome only when the fragments containing Ze mar-
ker and the putative Fem gene separate each other and
move to opposite poles. In this study, three breakage pat-
terns in the T(W;3)Ze chromosome could be expected. A
breakage in the A region (Fig. 1A), would produce a zebra
female larva with the deletion of several W-specific RAPD
markers. However, this zebra female larva cannot be dis-
tinguished from a normal zebra female larva. A breakage
occurring in the B region (Fig. 1B), would produce a white
female larva with the deletion of several W-specific RAPD
markers. Alternatively, if a deleted W chromosome
containing the putative Fem gene was expelled and
the simultaneously generated chromosome 3 fragment
accompanied by a W chromosome fragment remained, a
zebra male larva containing several W-specific RAPD
markers would appear. A breakage occurring in the
Genetica (2008) 133:269–282 277
123
![Page 10: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/10.jpg)
attachment site between the W and chromosome 3 frag-
ment would produce a white female larva with all
10 W-specific RAPD markers, as for a normal zebra
female, and a zebra male larva lacking W-specific RAPD
markers (Fig. 1C). As all 13 white female larvae obtained
in Exp. 1 where we reared selected males and females
based on larval markers and Exp. 2 where we imposed no
prior selection contained all 10 W-specific RAPD markers,
the breakage was strongly indicated to have occurred at
the attachment site between the W and autosomal Ze-
containing fragments. Similarly, it is thought that the zebra
male larva obtained in Exp. 1 had a chromosome 3 frag-
ment, but did not contain a W chromosome fragment
(Fig. 1C). However, the zebra male larva obtained in Exp.
2 contained three W-specific RAPD markers. This result
strongly indicated that a breakage had occurred in the B
region (Fig. 1B), and the irradiation had generated a W
chromosome fragment containing the W-Bonsai, W-Yu-
kemuri-L, and W-Yukemuri-S RAPD markers but no copy
of Fem, accompanied by the chromosome 3 fragment
carrying the Ze marker.
Deletions of the W chromosome region from the
T(W;2)Y chromosome
Kimura et al (1971) employed irradiation to a total of 707
female pupae of the C125 strain carrying normal W chro-
mosomes from 1961 to 1969. Out of a total of 4,502
batches of eggs reared during nine years, they obtained
only one batch in which all the females made yellow
cocoons and all the males made white cocoons. Thus, the
original T(W;2)Y chromosome was clearly produced by
only one event (translocation) in a single female. At that
time, the sex-limited yellow cocoon strain did not show
physiological defects due to the translocation of a chro-
mosome 2 fragment to the W chromosome (Kimura et al.
Fig. 4 The effects of the
deletions of the W chromosome
on the shape of SBs. Arrowhead
indicates SBs. (A) Male nucleus
of p50 strain. No SB is
observed. (B) and (C) Female
nuclei of p50 strain. (normal W
chromosome). A single SB is
observed in each nucleus. (D),
(E), (F) and (G) Female nuclei
of sex-limited yellow cocoon
strain (T(W;2)Y-Chu type
chromosome). A smaller SB is
observed (D and E). Dispersed
SBs are observed (F and G).
(H) and (I) Female nuclei of
sex-limited yellow cocoon
strain (T(W;2)Y-Abe type
chromosome). No SB is
observed. Bar = 10 lm
Table 5 Genetic behavior of the T(W;2)Y chromosomes in female
meiosis
Mating scheme No. of crosses od +
Y($) +(#) Y($) +(#)
T(W;2)Y-Abe/+od · od /od 5 1133 0 0 1145
T(W;2)Y-Chu/+od · od /od 5 1071 0 0 1149
278 Genetica (2008) 133:269–282
123
![Page 11: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/11.jpg)
1971). However, several physiological defects were later
recognized in females containing the T(W;2)Y chromo-
some during the breeding process for developing a
commercial silkworm race (Niino et al. 1987). Therefore
Niino et al (1988) subsequently applied gamma-ray treat-
ment to delete the extra part of the translocated
chromosome 2 fragment except for the Y locus. Thus, the
T(W;2)Y chromosomes had again been modified by irra-
diation, and it seems likely that several silkworm strains
containing differently modified T(W;2)Y chromosomes
were distributed to researchers.
Although there are no precise rearing and distribution
records on the three T(W;2)Y chromosomes (-Chu, -Abe
and -Ban types) used in this study, the original W chro-
mosome of all three strains was the normal W chromosome
of the C125 (Kimura et al. 1971). Because the T(W;2)Y-
Abe type chromosome contained only the W-Rikishi
RAPD marker, we suspect that the W chromosome of the
C125 strain at that time was not the Japanese-W-Eve type
containing the 12 W-specific RAPD markers found in most
Japanese stocks/strains. However, both the T(W;2)Y-Abe
and -Ban type chromosomes contained all seven new
W-specific PCR markers developed from the 1C7C BAC
clone. These results strongly indicated that almost all
regions of the W chromosome were deleted from the
T(W;2)Y-Abe and -Ban chromosomes, but the region
containing the sequence of the 1C7C BAC clone as well as
the putative Fem gene remained. Therefore, these T(W;2)Y
chromosome are thought to have been produced by the
following processes. First, the region of the W chromo-
some containing the six W-specific RAPD markers (W-
Kabuki, W-Kamikaze, W-Musashi, W-Sakura, W-Sasuke
and W-BMC1-Kabuki) was deleted by X-ray irradiation.
Subsequently, the region containing the putative Fem gene
was translocated to chromosome 2 (Fig. 5). This chromo-
some is thought to be the T(W;2)Y-Chu type. Then, the
region of the W chromosome of the original T(W;2)Y
chromosome containing the 5 W-specific RAPD markers
(W-Mikan, W-Samurai, W-Bonsai, W-Yukemuri-L, and
W-Yukemuri-S) was deleted by irradiation or spontane-
ously during the breeding process (Fig. 5). This
chromosome, containing only the W-Rikishi RAPD mar-
ker, is thought to be the T(W;2)Y-Abe or -Ban type
chromosome. Based on these observations, we treat the
T(W;2)Y-Abe and T(W;2)Y-Ban chromosomes as being
identical.
A sex chromatin body (SB), observed in the nuclei of
lepidopteran females, has been deduced to be composed of
condensed W chromosomes (Ennis 1976; Traut and Marec
1996). The number of SBs in a cell nucleus of B. mori
corresponds to the number of W chromosomes. Whereas in
a mutant female with more W chromosomes or their
fragments, more sex chromatin bodies is found per
polyploid nucleus, and each SB is composed of copies of
the different W (Ito 1977; Pan et al. 1986, 1987). However,
translocation or fusion of the W chromosome with an
autosome or with the Z chromosome is accompanied by
fragmentation of the SB in polyploid cells of the moth,
Ephestia kuehniella (Marec and Traut 1994; Traut et al.
1986). Traut et al (1986) showed that deletion of approx-
imately half of the W chromosome in Ephestia results in a
drastic size reduction of the SB. Similarly, in B. mori,
several SBs were observed in each nucleus of the sex-
limited pB (TWPB) strain (Tanaka et al. 2000). In the
present study, we observed several smaller SBs in a single
nucleus of a cell having the T(W;2)Y-Chu type chromo-
some (Fig. 4D, E, F and G). Moreover, no SB was detected
in nuclei of female moths having the T(W;2)Y-Abe type
chromosome (Fig. 4H and I). These results strongly indi-
cate that the W chromosome region of the T(W;2)Y-Abe
type chromosome is too short to form an SB detectable by
light microscopy.
Additionally, we suspected that the T(W;2)Y-Abe and
T(W;2)Y-Chu chromosomes may behave as a chromosome
2 not a W chromosome during meiosis. However, the
T(W;2)Y-Abe and T(W;2)Y-Chu chromosomes behaved as
a W chromosome in meiosis (Table 5). This indicated that
even the relatively small fragment of the W remaining was
capable of paring with the Z and driving normal meiotic
segregation.
The chromosome 2 fragment containing the Y gene
translocated to W chromosome lost the opportunity of
chromosomal recombination and behaves as part of the W
chromosome. The properties of lack of recombination and
genetic degeneration are closely connected in the evolution
of heteromorphic sex chromosomes (reviewed in Charles-
worth et al. 2005). Therefore, the several chromosome
fragments translocated to the W chromosome (T(W;2)Y,
T(W;2)pSa and T(W;3)Ze) will be useful for molecular
analyses of the degeneration and evolution of chromosome
fragments.
Order of the W-specific RAPD markers and the position
of putative Fem gene
It is impossible to estimate the relative position of the
putative Fem gene to and the genetic distance between the
W-specific RAPD markers based on the recombination
frequency, since crossing over is restricted to males in B.
mori. However, by combining available data on the pres-
ence or absence of W-specific RAPD markers on the
deleted W chromosomes in this study with the results of
Abe et al (2005b) and Fujii et al (2006, 2007), the relative
positions of the W-specific RAPD markers and the putative
Fem gene could be mapped (Fig. 6). The T(W;10)+w–2
Genetica (2008) 133:269–282 279
123
![Page 12: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/12.jpg)
chromosome does not contain the W-Mikan RAPD marker
(Abe et al. 2005b). The T(W;3)Ze chromosome does not
contain the W-Samurai and W-Mikan RAPD markers (Abe
et al. 2005b). The DfZ-DfW chromosome contains the W-
Bonsai, W-Samurai, and W-Mikan RAPD markers (Fujii
et al. 2006). The ZeW chromosome contains the W-Bonsai,
W-Yukemuri-L, and W-Yukemuri-S (Fujii et al. 2007).
The W(B-YL-YS)Ze chromosome also contains the W-
Bonsai, W-Yukemuri-L, and W-Yukemuri-S. These results
strongly indicate that although the order of W-Yukemuri-L
and W-Yukemuri-S could not be determined, these 5 W-
specific RAPD markers are arranged in the order W-Mikan,
W-Samurai, W-Bonsai, and W-Yukemuri-S or W-Yuke-
muri-L RAPD starting from one end of the W chromosome
(Fig. 6). Moreover, it is concluded that regions containing
these 5 W-specific RAPD markers (from the W-Mikan to
W-Yukemuri-L or W-Yukemuri-S), do not contain the
putative Fem gene.
The T(W;2)Y-Chu and -Abe chromosomes did not con-
tain the W-Kabuki, W-Kamikaze, W-Musashi, W-Sasuke,
W-Sakura, and BMC1-Kabuki RAPD markers. However,
the T(W;2)Y-Abe chromosome contained only the W-
Rikishi RAPD marker. These results strongly indicate that
although the order of 6 W-specific RAPD markers, except
W-Rikishi, could not be determined, the W-Rikishi RAPD
marker is located most distal from one end of the W chro-
mosome. Furthermore, it is concluded that the W-Rikishi
RAPD marker is nearest to the putative Fem gene. The
positional information of the putative Fem gene obtained in
this study could be an essential first step for its cloning.
It is of interest that even large deletions of the W
chromosome do not affect female fertility. Moreover, the
present full-length normal W chromosome is not likely to
be essential because large deletions of these parts of the W
chromosome do not affect viability. Combining the DNA
sequence data of W-specific RAPD markers and W-specific
BAC clones (Abe et al. 1998a, 2005a and 2005b) with the
results of this study, we suggest that except for the region
containing the putative Fem gene, the W chromosome is a
huge useless graveyard.
Fig. 5 Schematic diagrams of
the generation of the T(W;2)Y-
Chu and T(W;2)Y-Abe
chromosomes. The female-
specific RAPD markers are
indicated at the right side of the
W chromosome. Y is the yellow
blood gene on chromosome 2.
Fem is the putative female-
determining gene
Fig. 6 Mapping of the female-
specific RAPD markers and the
putative Fem gene on the W
chromosome using the W
chromosome variants. For the
T(W;3)Ze, T(W;10)+w-2 DfZ-
DfW and ZeWZ2 chromosomes,
see the previous papers (Abe
et al. 2005b; Fujii et al. 2006,
2007). The pink rectangle is the
W chromosome or W
chromosome fragment. The
orders of 6 W-specific RAPD
markers (W-Kabuki, W-
Kamikaze, W-Musashi, W-
Sasuke, W-Sakura and BMC1-
Kabuki) and 2 W-specific
RAPD markers (W-Yukumuri-L
and W-Yukemuri-S) could not
be determined
280 Genetica (2008) 133:269–282
123
![Page 13: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/13.jpg)
Our results lead to the conclusions that (1) putative Fem
genes are not distributed evenly over the entire W chro-
mosome, (2) no gene governing viability or femaleness is
located on the regions deleted from the W chromosome in
the T(W;2)Y-Abe chromosome, (3) only an extremely
limited region, containing the W-Rikishi RAPD marker
sequence of the W chromosome, is required to determine
femaleness.
Since RAPD markers are well interspersed in the gen-
ome and unbiased with regard to linkage group (Promboon
et al. 1995), it is likely that the 12 W-specific RAPD
markers are randomly distributed on the W chromosome.
Under this assumption, only one-twelfth of the W chro-
mosome is retained in the T(W;2)Y-Abe chromosome, and
the putative Fem gene is located in the middle of the W
chromosome. It is very difficult to determine the exact
length of the W chromosome region of T(W;2)Y-Abe
chromosome. The haploid genome of B. mori (2n = 56) is
estimated to be 475 Mb (Mita et al. 2004). On the
assumption that all chromosomes are nearly the same size,
the size of the W chromosome can be estimated to be
17 Mb (475/28 = 16.96). Therefore, the length of one-
twelfth of the W chromosome can be estimated to be
1.4 Mb (17/12 = 1.416). This length can be covered by
contiguous BAC clones. Moreover, when candidates of the
Fem gene are obtained, whether or not they are located on
the W chromosome region of T(W;2)Y-Abe should be
investigated as an important test of its identification. Even
if a candidate gene is located somewhere on the W chro-
mosome, if it is not present in the W-region of the
T(W;2)Y-Abe translocation, it cannot be the Fem gene.
Thus, the T(W;2)Y-Abe chromosome will be indispensable
for positional cloning of the Fem gene.
Acknowledgements This work was supported by grants from
BRAIN (to K. M.), Grants-in-Aid for Scientific Research, MEXT
(Nos. 17052006, 17580044, 16011263 and 17018007) and JSPS (No.
16208006), the Insect Technology Project, MAFF/NIAS (No. 1216),
and the National Bioresource Project, MEXT.
References
Abe H, Ohbayashi F, Harada T, Shimada T, Yokoyama T, Kobayashi
M, Oshiki T (1996) An application of DNA diagnosis method for
preservation of the susceptible strain to densonucleosis virus
type-1 of the silkworm, Bombyx mori. J Seric Sci Jpn 65:196–
299 (in Japanese with English summary)
Abe H, Kanehara M, Terada T, Ohbayashi F, Shimada T, Kawai S,
Suzuki M, Sugasaki T, Oshiki T (1998a) Identification of novel
random amplified polymorphic DNAs (RAPDs) on the W
chromosome of the domesticated silkworm, Bombyx mori, and
the wild silkworm, B. mandarina, and their retrotransposable
element-related nucleotide sequences. Genes Genet Syst 73:
243–254
Abe H, Ohbayashi F, Shimada T, Sugasaki T, Kawai S, Oshiki T
(1998b) A complete full-length non-LTR retrotransposon,
BMC1, on the W chromosome of the silkworm, Bombyx mori.Genes Genet Syst 73:353–358
Abe H, Ohbayashi F, Sugasaki T, Kanehara M, Terada T, Shimada T,
Kawai S, Mita K, Kanamori Y, Yamamoto M-T, Oshiki T (2001)
Two novel Pao-like retrotransposons (Kamikaze and Yamato)
from the silkworm species Bombyx mori and B. mandarina:
common structural features of Pao-like elements. Mol Genet
Genomics 265:375–385
Abe H, Sugasaki T, Terada T, Kanehara M, Ohbayashi F, Shimada T,
Kawai S, Mita K, Oshiki T (2002) Nested retrotransposons on
the W chromosome of the wild silkworm Bombyx mandarina.
Insect Mol Biol 11:307–314
Abe H, Mita K, Yasukochi Y, Oshiki T, Shimada T (2005a)
Retrotransposable elements on the W chromosome of the
silkworm, Bombyx mori. Cytogenet Genome Res 110:144–151
Abe H, Seki M, Ohbayashi F, Tanaka N, Yamashita J, Fujii T,
Yokoyama T, Takahashi M, Banno Y, Sahara K, Yoshido A,
Ihara J, Yasukochi Y, Mita K, Ajimura M, Suzuki MG, Oshiki T,
Shimada T (2005b) Partial deletions of the W chromosome due
to reciprocal translocation in the silkworm Bombyx mori. Insect
Mol Biol 14:339–352
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic
local alignment search tool. J Mol Biol 215:403–410
Charlesworth D, Charlesworth B, Marais G (2005) Steps in evolution
of heteromorphic sex chromosomes. Heredity 95:118–128
Doira H (1978) Genetic stocks of the silkworm. In: Tazima Y (ed)
The silkworm, an important laboratory tool. Kodansha Ltd.,
Japan
Doira H (1992) Genetical stocks and mutations of Bombyx mori. In:
Doira H (ed) Important genetic resources. Silkworm Genetic
Division, Institute of Genetic resources, Faculty of Agriculture,
Kyusyu University, Fukuoka, Japan, pp 1–73
Ennis TJ (1976) Sex chromatin and chromosome numbers in
Lepidoptera. Can J Cytol 18:119–130
Fujii H, Banno Y, Doira H, Kihara H, Kawaguchi Y (1998) Genetical
stocks and mutations of Bombyx mori: Important genetic
resources, 2nd edn. Institute of Genetic Resources, Faculty of
Agriculture, Kyusyu University, Fukuoka
Fujii T, Tanaka N, Yokoyama T, Ninaki O, Oshiki T, Ohnuma A,
Tazima Y, Banno Y, Ajimura M, Mkita K, Seki M, Ohbayashi F,
Shimada T, Abe H (2006) The female-killing chromosome of the
silkworm, Bombyx mori, was generated by translocation between
the Z and W chromosomes. Genetica 127:253–265
Fujii T, Yokoyama T, Ninagi O, Kakehashi H, Obara Y, Nenoi M,
Ishikawa T, Mita K, Shimada T, Abe H (2007) Isolation and
characterization of sex chromosome rearrangements generating
male muscle dystrophy and female abnormal oogenesis in the
silkworm, Bombyx mori. Genetica 130:267–280
Goldsmith MR (1995) Genetics of the silkworm: revisiting an ancient
model system. In: Goldsmith MR, Wilkins AS (eds) Molecular
model systems in Lepidoptera. Cambridge University Press,
New York, pp 21–76
Goldsmith MR, Shimada T, Abe H (2005) The genetics and genomics
of the silkworm, Bombyx mori. Annu Rev Entomol 50:71–100
Hashimoto H (1933) The role of the W-chromosome in the sex
determination of Bombyx mori. Jpn J Genet 8:245–247 (in
Japanese)
Hashimoto H (1948) Sex-limited zebra, an X-ray mutation in the
silkworm. J Seric Sci Jpn 16:62–64
Ito S (1977) Cytogenetical studies on the chromosomes of silk
gland cells of the silkworm with special reference to the structure
and behavior of the sex chromosomes. Jpn J Genet 52:
327–340
Kimura K, Harada C, Aoki H (1971) Studies on the W-translocation
of yellow blood gene in the silkworm (Bombyx mori). Jpn J
Breed 21:199–203 (in Japanese with English summary)
Genetica (2008) 133:269–282 281
123
![Page 14: Identification of the female-determining region of the W ...Secure Site ...Translocation Deletion-mapping Sex chromosome RAPD Introduction The sex chromosomes of the silkworm Bombyx](https://reader033.vdocument.in/reader033/viewer/2022060711/6077023e392e4473e834ff24/html5/thumbnails/14.jpg)
Koike Y, Mita K, Suzuki MG, Maeda S, Abe H, Osoegawa K, deJong
PJ, Shimada T (2003) Genomic sequence of a 320-kb segment of
the Z chromosome of Bombyx mori containing a kettin ortholog.
Mol Genet Genomics 269:137–149
Marec F, Traut W (1994) Sex chromosome paring and sex chromatin
bodies in W-Z translocation strains of Ephestia kuehniella(Lepidoptera). Genome 37:426–435
Miao XX, Xub SJ, Li MH, Li MW, Huang JH, Dai FY, marino SW,
Mills DR, Zeng P, Mita K, Jia SH, Zhang Y, Liu WB, Xiang H,
Guo QH, Xu AY, Kong XY, Lin HX, Shi YZ, Lu G, Zhang X,
Huang W, Yasukochi Y, Sugasaki T, Shimada T, Nagaraju J,
Xiang ZH, Wang SY, Goldsmith MR, Lu C, Zhao GP, Huang YP
(2005) Simple sequence repeat-based consensus linkage map of
Bombyx mori. Proc Natl Acad Sci USA 102:16303–16308
Mita K, Kasahara M, Sasaki S, Nagayasu Y, Yamada T, Kanamori H,
Namiki N, Kitagawa M, Yamashita H, Yasukochi Y, Kadono-
Okuda K, Yamamoto K, Ajimura M, Ravikumar G, Shimomura
M, Nagamura Y, Shin IT, Abe H, Shimada T, Morishita S,
Sasaki T (2004) The genome sequence of silkworm, Bombyxmori. DNA Res 11:27–35
Niino T, Eguchi R, Shimazaki A, Shibukawa A (1988) Breakage by c-
rays of the +i-lem locus on the translocated 2nd chromosome in
the sex-limited yellow cocoon silkworm. J Seric Sci Jpn 57:75–
76
Niino T, Kanda T, Eguchi R, Shimazaki A, Shibukawa A (1987)
Defects and structure of translocated chromosome in the sex-
limited yellow cocoon strain of the silkworm, Bombyx mori. J
Seric Sci Jpn 56:240–246 (in Japanese with English summary)
Ogura T, Okano K, Tsuchida K, Miyajima N, Tanaka H, Takeda N,
Izumi S, Tomino S, Maekawa H (1994) A defective non-LTR
retrotransposon is dispersed throughout the genome of the
silkworm, Bombyx mori. Chromosoma 103:311–323
Pan QZ, Sugai E, Oshiki T (1986) Sex-chromatin in cell nuclei of
abdominal leg of the silkworm, Bombyx mori. J Seric Sci Jpn
55:483–487 (in Japanese with English summary)
Pan QZ, Sugai E, Oshiki T (1987) Sex-chromatin observation in cell
nuclei of tissues of the silkworm moth, Bombyx mori. J Seric Sci
Jpn 56:436–439 (in Japanese with English summary)
Paran I, Michelmore W (1993) Development of reliable PCR-based
markers linked to downy mildew resistance genes in lettuce.
Theor Appl Genet 85:985–993
Promboon A, Shimada T, Fujiwara H, Kobayashi M (1995) Linkage
map of random amplified polymorphic DNAs (RAPDs) in the
silkworm, Bombyx mori. Genet Res Camb 66:1–7
Sahara K, Yoshido A, Kawamura N, Ohnuma A, Abe H, Mita K,
Oshiki T, Shimada T, Asano SI, Bando H, Yasukochi Y (2003)
W-derived BAC probes as a new tool for identification of the W
chromosome and its aberrations in Bombyx mori. Chromosoma
112:48–55
Sakaguchi B (1978) Gametogenesis, fertilization and embryogenesis
of the silkworm: In: Tazima Y (ed) The silkworm, an important
laboratory tool. Kodansha Ltd., Japan
Tan YD, Wan C, Zhu Y, Lu C, Xiang Z, Deng HW (2001) An
amplified fragment length polymorphism map of the silkworm.
Genetics 157:1277–1284
Tanaka N, Yokoyama Y, Irobe Y, Abe H, Ninagi O, Oshiki T (2000)
Breakage and subsequent return for W chromosome-pB frag-
ment-fifth linkage group fusion chromosome in the sex-limited
pB silkworm strain (TWPB), Bombyx mori. J Seric Sci Jpn
69:327–330
Tanaka Y (1916) Genetic studies in the silkworm. J Coll Agric
Sapporo 6:1–33
Tazima Y (1941) A simple method of sex discrimination by means of
larval markings in Bombyx mori. J Seric Sci Jpn 12:184–188 (in
Japanese)
Tazima Y (1944) Studies on chromosome aberrations in the
silkworm. II. Translocation involving second and W-chromo-
somes. Bull Seric Exp Stn 12:109–181 (in Japanese with English
summary)
Tazima Y, Harada C, Ohta N (1951) On the sex discriminating
method by colouring genes of silkworm eggs. I. Induction of
translocation between the W and tenth chromosomes. Jpn J
Breed 1:47–50 (in Japanese with English summary)
Traut W, Weith A, Traut G (1986) Structural mutants of the W
chromosome in Ephestia (Insecta, Lepidoptera). Genetica 70:69–
79
Traut W, Marec F (1996) Sex chromatin in Lepidoptera. Quart Rev
Biol 71:239–256
Wu C, Asakawa S, Shimizu N, Kawasaki S, Yasukochi Y (1999)
Construction and characterization of bacterial artificial chromo-
some libraries from the silkworm, Bombyx mori. Mol Gen Genet
261:698–706
Xia Q, Zhou Z, Lu C, Cheng D, Dai F, Li B, Zhao P, Zha X, Cheng T,
Chai C, Pan G, Xu J, Liu C, Lin Y, Qian J, Hou Y, Wu Z, Li G,
Pan M, Li C, Shen Y, Lan X, Yuan L, Li T, Xu H, Yang G, Wan
Y, Zhu Y, Yu M, Shen W, Wu D, Xiang Z, Yu J, Wang J, Li R,
Shi J, Li H, Li G, Su J, Wang X, Li G, Zhang Z, Wu Q, Li J,
Zhang Q, Wei N, Xu J, Sun H, Dong L, Liu D, Zhao S, Zhao X,
Meng Q, Lan F, Huang X, Li Y, Fang L, Li C, Li D, Sun Y,
Zhang Z, Yang Z, Huang Y, Xi Y, Qi Q, He D, Huang H, Zhang
X, Wang Z, Li W, Cao Y, Yu Y, Yu H, Li J, Ye J, Chen H, Zhou
Y, Liu B, Wang J, Ye J, Ji H, Li S, Ni P, Zhang J, Zhang Y,
Zheng H, Mao B, Wang W, Ye C, Li S, Wang J, Wong GK,
Yang H, Biology Analysis Group (2004) A draft sequence for the
genome of the domesticated silkworm (Bombyx mori). Science
306:1937–1940
Xiong Y, Burke WD, Eickbush TH (1993) Pao, a highly divergent
retrotransposable element from Bombyx mori containing long
terminal repeats with tandem copies of the putative R region.
Nucleic Acids Res 21:2117–2123
Yamamoto K, Narukawa J, Kadono-Okuda K, Nohata J, Sasanuma
M, Suetsugu Y, Banno Y, Fujii H, Goldsmith MR, Mita K (2006)
Construction of a single nucleotide polymorphism linkage map
for the silkworm, Bombyx mori, based on bacterial artificial
chromosome end sequences. Genetics 173:151–161
Yasukochi Y (1998) A dense genetic map of the silkworm, Bombyxmori, covering all chromosomes based on 1,018 molecular
markers. Genetics 150:1513–1525
Yasukochi Y (2002) PCR-based screening for bacterial artificial
chromosome libraries. Methods Mol Biol 192:401–410
282 Genetica (2008) 133:269–282
123