immunity, vol. 16, 881–895, june, 2002, copyright 2002 by ... · mithilesh kumar jha,1 jan...

Immunity, Vol. 16, 881–895, June, 2002, Copyright 2002 by Cell Press

Autoregulation of NFATc1/A Expression FacilitatesEffector T Cells to Escape from Rapid Apoptosis

calmodulin-dependent phosphatase calcineurin (for re-view see Crabtree, 1999), which binds to several siteswithin the regulatory region of NFATs and controls their

Sergei Chuvpilo,1 Eriks Jankevics,4

Dimitri Tyrsin,1 Askar Akimzhanov,1 Denis Moroz,1

Mithilesh Kumar Jha,1 Jan Schulze-Luehrmann,1

nuclear import and export (Rao et al., 1997; Serfling etBrigitte Santner-Nanan,2 Elizaveta Feoktistova,2

al., 2000).Thomas Konig,1 Andris Avots,1,6 Edgar Schmitt,3

NFATc1 (also designated as NFAT2 or NFATc) andFriederike Berberich-Siebelt,1 Anneliese Schimpl,2

NFATc2 (also designated as NFAT1 or NFATp) are highlyand Edgar Serfling1,5

expressed in peripheral T cells and control their effector1Department of Molecular Pathologyfunction; in particular, the expression of lymphokines,Institute of Pathologysuch as IL-2, IL-3, IL-4, IL-5, and IFN�. However, lympho-2 Institute of Virology and Immunobiologykine promoters are not the only targets which are boundUniversity of Wuerzburgand controlled by NFATc1 and NFATc2. Further targetD-97080 Wuerzburgpromoters for NFATs are the p21Waf1, the CD40 ligand,3 Institute of Immunologyand CD95 ligand promoters (Holtz-Heppelmann et al.,University of Mainz1998; Latinis et al., 1997; Santini et al., 2001; TsytsykovaD-55101 Mainzet al., 1996), indicating that in addition to effector func-Germanytion NFATs are also involved in the control of cell cycle4 Biomedical Research and Study Centerand, in particular, apoptosis of T lymphocytes. Activa-University of Latviation-induced cell death (AICD) of lymphocytes is a par-LV-1067 Rigaticular form of apoptosis which is of pivotal importanceLatviafor the termination of the immune response and, there-fore, the homeostasis of the immune system. One impor-tant route of AICD is the activation through so-calledSummarydeath receptors, in particular, of CD95 and TNF-receptorI. Their stimulation by CD95 ligand or TNF� leads to theThreshold levels of individual NFAT factors appear toactivation of a caspase cascade and, in turn, to cleavagebe critical for apoptosis induction in effector T cells.of death substrates and, finally, to apoptosis of T cellsIn these cells, the short isoform A of NFATc1 is induced(see, e.g., Schmitz et al., 2000). Both the CD95 ligandto high levels due to the autoregulation of the NFATc1and TNF� promoter contain multiple NFAT sites (Falvopromoter P1 by NFATs. P1 is located within a CpGet al., 2000; Li-Weber et al., 1999), suggesting thatisland in front of exon 1, represents a DNase I hyper-NFATs are major regulators of AICD of T cells.sensitive chromatin site, and harbors several sites for

NFATc1 and NFATc2 share 72% sequence homologybinding of inducible transcription factors, including ain their RSDs and act similarly in functional assays. How-tandemly arranged NFAT site. A second promoter, P2,ever, inactivation of either of the two genes resulted inbefore exon 2, is not controlled by NFATs and directsmarkedly divergent mutant phenotypes. Due to defectssynthesis of the longer NFATc1/B�C isoforms. Con-in the development of cardiac valves and septa,trary to other NFATs, NFATc1/A is unable to promoteNFATc1-deficient mouse embryos die in utero before

apoptosis, suggesting that NFATc1/A enhances ef-day 14 of gestation (de la Pompa et al., 1998; Ranger

fector functions without promoting apoptosis of ef-et al., 1998a) whereas no such defect in embryonic de-

fector T cells. velopment was observed in NFATc2-deficient mice.However, lymphocytes in NFATc2�/� mice older than 3

Introduction months develop a hyperproliferative syndrome which isreflected by a moderate increase in size of peripheral

NFAT (nuclear factor of activated T cells) proteins belong lymphoid organs (Hodge et al., 1996; Schuh et al., 1998;to a family of transcription factors which share a com- Xanthoudakis et al., 1996). This appears to be causedmon DNA binding domain of approximately 300 amino by distinct defects in AICD (Schuh et al., 1998), probablyacids (aa). This domain is very similar in its conformation due to an impaired expression of CD95 ligand (Hodgeto the Rel DNA binding domain of Rel/NF-�B factors et al., 1996). This phenotype was found to be acceleratedand, therefore, was designated as Rel similarity domain in mice deficient for both NFATc2 and NFATc3 (Ranger(RSD; for reviews see Rao et al., 1997; Serfling et al., et al., 1998c). In contrast, peripheral NFATc1�/� T cells2000). Among the four genuine NFAT factors, NFATc1, from RAG�/� mice show an impaired proliferation butNFATc2, NFATc3, and NFATc4, the RSDs exhibit ap- no apparent defects in apoptosis (Ranger et al., 1998b;proximately 70% sequence homology and about 40% Yoshida et al., 1998). Lymphocytes doubly deficient forwith a fifth protein, designated as NFAT5 (Lopez-Rodri- NFATc1 and NFATc2 exhibit a complete loss of IL-2 andguez et al., 1999). The nuclear translocation of genuine IL-4 production but—similar to NFATc2�/� lympho-NFAT factors but not of NFAT5 is regulated by the Ca2�/ cytes—a hyperproliferative syndrome which is charac-

terized by high IgG1 and IgE serum levels and an in-crease in activation markers (Peng et al., 2001). These5 Correspondence: [email protected] indicate that NFATc1 and NFATc2 exhibit both indi-6 Present Address: Institute of Radiation Research and Cell Biology

(MSZ), University of Wuerzburg, Germany. vidual and overlapping properties, suggesting that the

Immunity882

cellular threshold levels for both factors also determine and C-terminal peptides. The short NFATc1/A isoform(Northrop et al., 1994) is predominantly expressed in Twhich set of target genes will be expressed. We have

shown previously that T cell activation leads to the mas- effector cells and lacks the B�C-specific C-terminalpeptide sequences that are encoded in exons 10 andsive induction of the short isoform A of NFATc1 within

3–4 hr (Chuvpilo et al., 1999b), i.e., before the onset of 11 (Chuvpilo et al., 1999b). They share 31% sequencehomology with the C-terminal peptide of murine NFATc2AICD. This observation suggested that, due to the lack

of the C-terminal extension of approximately 245 aa (Luo et al., 1996a). Similar to the generation of humanNFATc1 isoforms, the synthesis of murine NFATc1 iso-which is present in all other NFAT proteins, NFATc1/A

might differ in biological function from other NFAT pro- forms is controlled by the activity of (at least) two polyA sites located downstream of exon 9 (pA1) and exonteins, including its longer isoform NFATc1/C. This view

prompted us to investigate the induction and function 11 (pA2), respectively (see Figure 1B).The transcription of both the human and murineof NFATc1/A in murine T lymphocytes.

Here we show that the induction of NFATc1/A in ef- NFATc1 gene results in two RNAs containing different5� ends. The most abundant NFATc1 RNA, designatedfector T cells is controlled by a strong inducible pro-

moter, P1. It results in splicing of exon 1 to exon 3 as NFATc1.� (Park et al., 1996), codes for an N-terminalpeptide of 42 aa which is missing in a minor RNA fraction,transcripts and, in concert with the activity of a weak

poly A site downstream of exon 9 (Chuvpilo et al., 1999b), designated as NFATc1.�. This encodes a unique N-ter-minal peptide of 29 or 27 aa in human or mouse, respec-leads to the massive synthesis of NFATc1/A in effector

T cells. A second, weak promoter, P2, lies in front of tively (Chuvpilo et al., 1999b; Park et al., 1996; Shermanet al., 1999). These findings and the structure of NFATc1exon 2 and directs the synthesis of longer NFAT isoforms

B and C. Both P1 and P2 generate DNase I hypersensi- 5� region suggest that NFATc1 RNAs are synthesizedfrom two promoters and by alternate splicing eventstive chromatin sites and are embedded in CpG islands

which are hypermethylated in nonlymphoid cells and (Serfling et al., 2000).demethylated in effector T cells. P1 but not P2 activityis autoregulated by NFAT factors which bind with high NFATc1 Transcription Is Controlled by Two Promotersaffinity to two tandemly arranged NFAT sites within P1 The 5� region of murine NFATc1 gene (Figure 1C) whichand enhance its induction. Infection of primary T lym- we cloned as an XbaI fragment of 8650 bp contains thephocytes with recombinant retroviruses expressing indi- most distal exon 1, encoding the 42 aa of NFATc1.�,vidual NFAT proteins indicates that NFATc1/A, in con- and exon 2, encoding the 27 aa in NFATc1.�. Exons 1trast to NFATc2 and NFATc1/C, does not enhance AICD. and 2 are separated from each other by an intron ofThese findings suggest that the massive synthesis of approximately 4 kb. Conspicuous sequence character-NFATc1/A upon activation of effector T cells ensures istics are 375 CpG dinucleotides, i.e., potential targetsthat these cells exert effector functions without inducing for DNA methylation, which are clustered around therapid apoptosis. transcriptional start sites and within the 5� untranslated

mRNA regions (Figure 1D). Sequence features withinResults intron 1 are a stretch of 160 pyrimidines, ten copies of

the pentanucleotide CTTTT, and a sequence of 40 bpInduction of NFATc1/A in T Cells that is 87.5% identical to a sequence within intron 1 ofActivation of human Jurkat T cells (Figure 1A) or human the murine whn nude gene that is also controlled by twoand murine primary effector T cells by TPA�ionomycin promoters and alternate splicing events (Schorpp et al.,(T�I) or by �CD3��CD28 Abs (see Chuvpilo et al., 1997). In addition, approximately 430 bp downstream1999a, 1999b) for 4 hr or longer led to a strong induction from exon 2, an integration sequence was detected forof synthesis of the short NFATc1 isoform A while the the retrovirus SL3-3, a potent inducer of T cell lympho-synthesis of the other NFATc1 isoforms and of NFATc2 mas in mice (Sorensen et al., 1996).remained unaffected (Figure 1A). The massive induction Depending on the activity of the two promoters, desig-of NFATc1/A was completely suppressed by 100 ng/ml nated as P1 and P2, NFATc1 transcription starts up-CsA which selectively inhibits NFAT factors, suggesting stream of exon 1 and exon 2, respectively. In RNasethat NFATs autocontrol the inducible transcription of mapping assays, using RNA from EL-4 T cells and M12NFATc1/A. This prompted us, first, to identify the B cells and an exon 1-specific probe, a strong, inducibleNFATc1 promoter region and analyze its activity, and P1 activity was detected in both cell types. In contrast,second, to study the role of NFATc1/A in effector T cells P2 activity was observed in EL-4 but not M12 cells (Fig-where it is strongly induced. ure 2A; P2). Moreover, P2 activity was found to be mark-

edly weaker, reaching about 5% of P1 activity. In EL-4cells, P1 activity was induced by T or I alone, and T�IStructure of the Chromosomal Murine NFATc1 Gene:

Alternative Splicing and Polyadenylation Events double treatment enhanced P1 induction, which couldbe abolished by CsA. Forskolin (F) treatment which en-Contribute to Its Expression

The murine NFATc1 gene which we have cloned as over- hances cAMP levels and upregulates the expression ofTh2-type NFAT target genes, e.g., IL-5, exerted a verylapping DNA fragments in BAC, cosmid, and � vectors

is located on chromosome 18 band E4 (Li et al., 1995) weak stimulatory effect on P1, either alone or in combi-nation with ionomycin, and it impaired T�I-mediated P1and consists of 11 exons that are spread over more than

100 kb DNA (Figure 1B). Similar to the human NFATc1 induction (Figure 2B).A single start point situated 53 bp in front of the firstgene (see Serfling et al., 2000), the murine gene is ex-

pressed in several isoforms which differ both in their N- translational start codon is used for transcription from

Autoregulation of NFATc1 and Apoptosis883

Figure 1. NFATc1/A Induction, Structure of the Murine Chromosomal NFATc1 Gene, and Its Promoter Region

(A) NFATc1/A induction in Jurkat T cells. Western blot with whole cellular proteins from Jurkat cells which were either left untreated (�; lane1) or treated with TPA�ionomycin (T�I) in the absence or presence of 100 ng/ml CsA for 2 or 4 hr.(B) Schematic structure of the NFATc1 gene. The lengths of 11 exons in bp is indicated above the gene. White numbers in black fields indicatethe lengths of 5� and 3� untranslated mRNA regions; black numbers indicate the lengths of protein coding segments. The positions of promotersP1 and P2 and poly A sites pA1 and pA2 are indicated.(C) Structure of the 8.65 Kb XbaI DNA fragment harboring the two promoters P1 and P2. The protein coding portions of exons 1 and 2 areindicated by dashed boxes, and their 5� untranslated mRNA regions are indicated by thick black bars. Horizontal arrows before both 5� mRNAregions indicate the promoters P1 and P2. Conspicuous sequence motifs are a stretch of 40 bp which is found in several other genesalternatively spliced at their 5� ends (see Schorpp et al., 1997), a stretch of 160 pyrimidines, ten copies of sequence CTTTT, and an integrationsequence for the retrovirus SL3-3, a potent inducer of T cell lymphomas (Sorensen et al., 1996).(D) Distribution of CpG residues within the promoter region. Above, one vertical dash indicates one CpG residue. The graph below shows thedistribution of 375 bp CpGs within 500 bp intervals of the XbaI fragment.

Immunity884

Figure 2. Detection of NFATc1 RNA in Lymphoid and Nonlymphoid Cells and RNase Mapping Assays

(A) Detection of transcripts directed from the NFATc1 promoters P1 and P2 in EL-4 T and M12 B cells. Probes for the detection of exon 1transcripts (P1) and of transcriptional start site at P2 were hybridized with whole RNA from EL-4 T cells (lanes 1–3) and M12 B cells (lanes4–6) which were either left uninduced (�) or induced by TPA and ionomycin for 1 or 4 hr. In lanes 7–12, the P2 probe was used alone.(B) P1 induction. RNAs from EL-4 cells induced for 1 hr by TPA (T), ionomycin (I), or forskolin (F) alone or in combination were investigated.In lane 9, cells were induced by T�I in the presence of 100 ng/ml cyclosporin A (CsA).(C) Mapping of the transcriptional start sites at P1. A probe recognizing upstream start sites of exon 1 transcription was hybridized with 5g of RNA from naive T cells, Th0, Th1, and Th2 cells, or EL-4 cells. The primary Th cells were induced by �CD3�CD28 Abs and EL-4 cellsby T�I for the times indicated.(D) Detection of P1 activity in various hematopoietic cells. An exon 1 probe (P1) was hybridized with 5 g (Th cells) or 10 g RNA from variouscells which were either left uninduced or induced for 1–48 hr by T�I. Primary mast cells were induced for 12 hr by I, IL-1, and IL-10 aspublished previously (Stassen et al., 2000). The position of exon 1 transcripts is indicated. P, undigested probes.(E) Detection of P1 activity in various murine cells. An exon 1 probe was hybridized with 10 g RNA from EL-4 T cells, embryonic stem (ES)cells, F9 embryonic carcinoma (EC) cells, L fibroblast, NIH 3T3 cells, HL-1 heart cells, and N2A nerve cells, which were either left uninducedor treated by T�I for 1 or 4 hr.

P2, while two transcriptional start points are used for lines (such as in 70 Z pre B cells, WEHI 231, M12, TIB209, and A20J B cells) treated with T�I for 1–4 hr, andtranscription directed by P1. These are located 315 and

255 bp upstream of the first ATG and appear to be used in NK cells. P1-directed transcripts were also detectedin primary mast cells stimulated with IL-1 and IL-10 foralternatively. As shown in Figure 2C, the distal site, P1dist,

is used after induction of naive T cells, Th1, and Th2 12 hr, and in CP2 cells, a mast cell line (Figure 2D anddata not shown) which agrees well with a role of NFATscells, whereas the P1prox site is predominantly used in

naive Th and Th1 but not Th2 cells. in regulating lymphokine expression in mast cells(Prieschl et al., 1995). None or at most a very weak P1-P1-directed transcription was detected in all activated

lymphoid cells investigated. In addition to transcription directed transcription was observed in P388 D1 mono-cytes (Figure 2D) and in all other nonlymphoid cells in-in EL-4 cells, it was found in naive primary T cells from

LNs activated by �CD3��CD28 Abs for 24 hr or 48 hr, vestigated, such as in embryonic stem (ES) cells (lineWW6), F9 embryonic carcinoma (EC) cells, L cells, 3T3in Th1 and Th2 cells activated for 2 hr, in several B cells


Figure 3. Mapping of DNase I Hypersensitive Chromatin Sites within the Promoter Region of the NFATc1 Gene and Characterization of anIntronic Transcriptional Enhancer

(A and B) EL-4 T cells and naive lymph node (LN) cells which were either left uninduced (�) or induced for 1 hr (EL-4, �) by TPA�ionomycinor 5 hr (LN�) by �CD3/�CD28 Abs. Nuclei from 108 cells were either left untreated or treated with increasing concentrations of DNase I. Afterextraction, the DNAs were digested with XbaI and, following Southern blotting, hybridized with PCR probes from the 3� end (A; left autoradio-graph) or the 5� end (B; right) of the 8.65 kb XbaI promoter fragment. Below, the length of DNA fragments generated after partial DNase Icleavage is presented.(C) Characterization of an intronic enhancer. Segments of 1 kb (HSS3) and 0.6 kb (HSS3core) from the HSS3 region of intron 1 were cloned intwo orientations in front of the 0.8 kb P1 promoter in a P1-luciferase construct. EL-4 cells were transfected and treated as indicated for 24 hr.

cells, HL-1 cardiomyocytes, and N2A neuronal cells HSS1-HSS4) were mapped over the 5� region of theNFATc1 gene. HSS1 and HSS4 are located over the P1treated with T�I for 1 or 4 hr (Figure 2E).and P2 promoters, HSS2 and HSS3, within intron 1.HSS2 is situated just downstream from exon 1 whereasDNase I Hypersensitive Chromatin Sites Are

Generated at the P1 and P2 Promoters HSS3 covers the 40 bp “common” and 160 bp pyrimidineDNA stretches (Figures 3A and 3B). All these sites ap-and Two Intronic Sites

Irrespective of the activation state of EL-4 cells, four peared to be quite resistant against DNase I in chroma-tin from primary naive LN cells, but stimulation byDNase I hypersensitive chromatin sites (designated as

Immunity886

Figure 4. P1 Promoter DNA Is Demethylated in T Effector Cells

(A) DNA sequences of immediate P1 region from murine effector T cells (above) and kidney cells (below) after Na-bisulfite modification forthe detection of methylated CpG residues. Note the methylation of all seven CpG residues in kidney DNA but not in DNA from effector T cells.As controls, the methylation profiles of nonmethylated control DNA (indicated by � in the inset above) and DNA methylated in vitro with SssIDNA methylase (� in the inset above) are shown between.(B) Methylation of P1 DNA supresses its activity. P1 DNA segments of 0.8 and 1.7 kb were methylated in vitro using SssI methylase, cloned,and transfected into EL-4 cells. After 24 hr, the cells were either left untreated or treated by TPA�ionomycin (T�I) or ionomycin�forskolin(I�F) for an additional 24 hr. In the inset, the patterns of 1.7 kb (lanes 3–6) or 0.8 kb P1 fragments (lanes 9–12) after cleavage with the restrictionenzymes HpaII (H) or MspI (M) are shown. In lanes 1 and 7, high molecular (LHM) or low molecular weight marker DNAs (LHM) and, in lanes 2and 8, the uncleaved DNA fragments of 1.7 or 0.8 kb, respectively, were separated. Lanes 3, 4, 9, and 10 contain nonmethylated DNAs; lanes5, 6, 11, and 12 contain DNAs methylated by SssI in vitro.


Figure 5. Induction Properties of NFATc1 P1Promoter in EL-4 Cells

(A) Characterization of the P1 core promoter.Luciferase gene constructs directed by P1segments of 0.8, 1.7, 2.7, or 5.5 kb were trans-fected into EL-4 cells. After 24 hr, the cellswere treated with TPA (T), ionomycin (I), orforskolin (F) alone or in combination for anadditional 24 hr in the absence or presenceof cyclosporin A (CsA).(B) Induction properties of murine IL-2, IL-4,and IL-5 promoters in EL-4 cells. Luciferasegenes directed by the murine IL-2 promoter(spanning the nucleotides from position �7to �293), IL-4 promoter (�12 to �270), or IL-5promoter (�44 to �507) were transfected intoEL-4 cells which were induced for 24 hr asindicated.

�CD3��CD28 Abs led to a rapid generation of sensitiv- to �370 were found to be methylated in genomic kidneyDNA whereas they were unmethylated within genomicity over P1 and P2 within 5 hr (Figure 3B). In chromatin

from F9 EC cells, these sites seem to be closed since P1 DNA from effector T cells. In order to show whetherDNA methylation might affect P1 induction, P1 frag-partial DNase I digestion of chromatin from these cells

did not give rise to any DNA fragmentation, regardless ments of 0.8 kb and 1.7 kb were isolated and methylatedin vitro using bacterial SssI methylase. As shown in theof whether or not they were treated with T�I (data not

shown). insert of Figure 4B, by cleavage of fragments with HpaIIor MspI, SssI led to a complete methylation of all CCGGIn order to investigate whether the intronic HSS2 and

HSS3 sites play a role in P1 activity, fragments spanning recognition motifs for both enzymes. When the methyl-ated and nonmethylated promoter fragments wereeither HSS2 or HSS3 were cloned in both orientations

in front of a promoter/luciferase gene driven by the 0.8 tested in EL-4 cells, a 5-fold decrease in the I�F-medi-ated activity was detected for methylated P1 DNA com-kb P1 core promoter and tested by transfection into

EL-4 cells. While no effect on P1 induction was observed pared to nonmethylated control DNA (Figure 4B). Thisindicates that DNA methylation can suppress P1 in-for the HSS2 fragment (data not shown), HSS3 frag-

ments of 1 or 0.6 kb DNA enhanced P1 induction in both duction.orientations 2- to 10-fold (Figure 3C). Hence, HSS3 wasdesignated as transcriptional enhancer, E1. As for P1(see below), the strongest induction of E1 was observed NFATs Autoregulate P1 Induction and Enhanceafter treatment of cells with a combination of I�F, NFATc1/A Synthesiswhereas a very poor induction was detected after T�I When 5� P1 segments spanning 0.8, 1.7, 2.7, or 5.5 kbtreatment. In particular, the F-mediated induction of P1 of upstream DNA were tested in EL-4 cells, all fragmentswas enhanced by E1 from about 5- to more than 50- showed a similar transcriptional activity (Figure 5A). Thisfold (Figure 3C). indicates that the proximal segment of 0.8 kb harbors

the most important promoter elements and, therefore,was designated as P1 core promoter. P1 activity wasDNA Hypomethylation Facilitates P1 Inductioninduced by F but markedly less by T or I alone. A combi-in T Effector Cellsnation of I�F, i.e., by inducers of Ca2�-involved signalingThe distribution of CpG dinucleotides within the NFATc1cascades or protein kinase A, resulted in a strong syner-5� region (Figure 1D) suggested that DNA methylationgistic activation of P1 whereas T�I induction was mark-might play an important role in the regulation of NFATc1edly less efficient (Figure 5A), contrary to its strong effectpromoters. To correlate the methylation status of P1on the P1 promoter in its chromosomal context (FigureDNA with its activity, DNA from various cell types was2B). This is also in striking contrast to the induction ofisolated, and genomic P1 DNA was sequenced followingthe IL-2 promoter in EL-4 cells whose activity is stronglymodification with Na-bisulfite which converts unmethyl-induced by T�I but not by I�F or F alone. However, itated but not methylated C to T residues (Frommer etresembles the induction of promoters of the Th2-typeal., 1992). As illustrated in Figure 4A for a fragment of P1

DNA, CpG residues spanning the nucleotides from �61 lymphokines IL-4 and IL-5, the activity of which is

Immunity888

Figure 6. Structure of P1 Promoter and Its Autoregulation by NFAT Factors

(A) P1 sequences are highly conserved between the human and murine NFATc1 genes. Transcriptional start sites are indicated by horizontalarrows; binding sites for transcription factors are indicated by black bars above the sequences. Brackets above the sequences indicate theoligonucleotides used in EMSAs for the identification of transcription factors binding.


strongly induced by I�F but weakly by T�I treatment ure 6B), (2) an excess of P1 NFATtand site with intactNFAT motifs but not of a site mutated in both NFATin EL-4 cells (Figure 5B).

Two DNA segments of approximately 270 bp from the motifs suppressed factor binding (lanes 4 and 5), and(3) Abs specific for NFATc1 or NFATc2 led to supershiftsP1 core promoter spanning the nucleotides from �25

to �250 and from �520 to �800 show more than 80% of NFATtand complexes (lanes 9 and 10), NFATtand is agenuine NFAT binding site. Compared to the NFAT�90sequence homology between mouse and human (Figure

6A). The proximal homology block contains two con- site of P1 (see also Zhou et al., 2002) and to Pu-bd ofIL-2 promoter, NFATtand is a stronger NFAT binding siteserved (TATA-like?) boxes located around 15 and 30 bp

upstream of the distal transcriptional start site, several (note that the EMSA probes used in Figure 6B wereof about the same specific radioactivity). According toG�C rich stretches, and, in addition, the sequences

TGATGTCA and TTTTCCA located within larger stretches supershift assays, the NFATtand complexes exhibiting theslowest and fastest mobility contain NFATc1 whereasof high sequence homology. The latter motif located

around position �90 corresponds to a NFAT consensus complexes with intermediary mobility contain NFATc2(lanes 9 and 10 in Figure 6B). Both types of complexessite (see below and Figure 6B), the former to a CREB

consensus binding sequence (see below). We will show are also formed with Pu-bd and the NFAT�90 site.Contrary to P1, the activity of P2 is not regulated byin detail elsewhere (D.T. et al., unpublished data) that

the G�C-rich motifs around positions �200 and �20 NFAT factors. The inability of P2 oligonucleotides tocompete for the generation of NFAT complexes (Figureare bound by SP1�SP3 and the CREB-like motif TGAT-

GTCA around position �145 by CREB, Fos, and ATF-2 6C) and missing NFAT binding motifs indicate that NFATfactors do not bind to P2.proteins. A similar CREB binding site was detected

around position �640 within the distal block of homol- The configuration of tandemly arranged TGGAAAANFAT core sequences at NFATtand led to the question ofogy and might contribute, along with the proximal site,

to the strong effect of elevated cAMP levels on P1 induc- whether, contrary to a typical NFAT site which is boundby monomeric NFAT and AP-1, NFAT dimers can bindtion. In addition, this distal P1 fragment is also bound by

NF-�B, NFAT, and, with low affinity, by GATA-3 protein to NFATtand. When we incubated mutated NFATtand siteswhich should suppress NFAT binding to one or the other(Figure 6A).

Within P1 DNA upstream of position �250, there are NFAT core motif in EMSA titration experiments with in-creasing concentrations of bacterially expressed GST-four additional consensus sequences for the binding of

NFAT factors. However, only two of them, which are NFATc1-RSD protein, a very similar complex formationwas observed with the wild-type or mutated probes. Atandemly arranged around position �675, formed spe-

cific NFAT factor complexes when they were incubated probe mutated in both motifs did not bind any GST-NFATc1-RSD protein (Figure 6D). However, dimer for-with GST-NFATc1-protein in EMSAs (data not shown).

When a probe spanning the tandem sites (NFATtand) was mation, i.e., the binding of two NFAT proteins to oneNFATtand probe, was observed when we introduced 5 orincubated with nuclear proteins from EL-4 cells, several

prominent inducible protein complexes were generated 10 bp between both NFAT motifs. This is shown in Figure6E where dimer formation could be observed with awhich were very similar in mobility to those generated

with the distal NFAT site (Pu-bd) of the IL-2 promoter, NFATtand�5n or NFATtand�10n probe whereas no dimer for-mation was detected with the distal IL-2 NFAT site (Fig-the prototypical NFAT site (compare lanes 2 and 17 in

Figure 6B). Since (1) an excess of distal IL-2 NFAT site ure 6E).The importance of NFAT activity in P1 induction issuppressed NFAT binding to NFATtand (see lane 8 in Fig-

(B) NFAT-like complexes bind to the NFATtand and NFAT�90 sites of P1. Nuclear proteins from noninduced EL-4 cells (lanes 1, 11, and 16) orcells treated with T�I for 1 hr in the absence (lanes 2, 4–10, 12, 14, 15, and 17–19) or presence of 100 ng/ml CsA (lanes 3 and 13) wereincubated with an NFATtand, NFAT�90, or IL-2 NFAT (Pu-bd) probe. For competition, 50 ng of a wild-type NFATtand site (lane 4), a mutated NFATtand

site unable to bind NFAT (lane 5), a wild-type NFAT�90 site (lane 6), a mutated NFAT�90 site (lane 7), or an IL-2 Pu-bd site (lane 8) was added.Abs raised against NFATc1 (lanes 9, 14, and 18) or NFATc2 (lanes 10, 15, and 19) were used in supershift assays.(C) NFATs do not bind to P2. Nuclear proteins from noninduced EL-4 cells (lane 1) or EL-4 cells treated by T�I for 1 hr (�, lanes 2–8) wereincubated with an NFATtand probe and 5 or 50 ng of IL-2 NFAT site or oligos spanning the nucleotides from position �107 to �142 (P2-1)or �72 to �107 from P2 (P2-2).(D) NFATc1 can bind to each of both NFAT core motifs within the NFATtand element. Increasing concentrations of GST-NFATc1-RSD proteinwere incubated with a wild-type NFATtand probe or probes mutated in one of two or both NFAT motifs.(E) Introduction of 5 or 10 spacer bp between the NFAT core motif leads to the generation of NFAT dimers. Increasing concentrations of GST-NFATc1-RSD protein were incubated with probes carrying 5 or 10 spacer nucleotides between the two NFAT motifs or an IL-2 NFAT siteprobe.(F) Introduction of NFAT mutations into NFATtand abolish P1 induction. Two micrograms DNA of luciferase constructs driven by wild-type (wt)P1 or a P1 fragment mutated in both NFAT sites of NFATtand (d-mut) was transfected into EL-4 cells which were either left untreated (–) ortreated by T�I or I�F.(G) Ectopic expression of NFATc2 or NFATc1/A in EL-4 cells enhances P1 activity. 0.2 micrograms of a P1-directed luciferase construct wastransfected into EL-4 cells either with 0.5 g empty vector DNA (�) or vectors expressing NFATc2 or NFATc1/A.(H) Ectopic expression of NFATc proteins in 293 HEK cells enhances P1 activity. One hundred nanograms of a P1-directed luciferase constructwas transfected into 293 cells either with 100 or 250 ng vector DNA (–) or the same amounts of vectors expressing NFATc1/A, NFATc1/C, orNFATc2. The inset shows the expression of NFAT proteins detected with an �HA-Ab in a Western immunoblot.(I) NFATc1 protein expression leads to a more persistent induction of endogenous P1 activity. RNAs from EL-4 cells stably infected with anempty virus (–) or viruses expressing NFATc1/A or c1/C and treated for 0–24 hr with T�I were assayed in RNase protein assays using probesto detect P1 or GAPDH transcripts. Above, the rate of P1 induction is indicated.

Immunity890

Figure 7. In Contrast to NFATc2 and NFATc1/C, NFATc1/A Is Unable to Promote Apoptosis of Effector T Cells

(A) NFATc2-deficient T cells show a delay in �CD3-mediated apoptosis. CD4� T cells from lymph nodes of wild-type or NFATc2�/� mice wereeither restimuated by incubation with an �CD3 mAb or an �CD95 mAb for 6 hr (green lines), 12 hr (orange), 24 hr (blue), or 48 hr (red).(B) Effect of ectopic NFAT expression on �CD3-mediated apoptosis. Twenty-four hours after stimulation with OVA peptide, CD4� T cells fromDO 11.10 TCR tg mice were infected with an empty retrovirus (EGZ-HA) or retroviruses expressing NFATc1/A or NFATc2. After 3 days ofexpansion, the cells were either left untreated or restimulated with plate-bound �CD3 mAb for 8 hr, stained with annexin V-PE, and analyzedby FACS.(C) NFATc2 and NFATc1/C but not NFATc1/A enhance �CD3 mAb-mediated apoptosis. The percentage of annexin V-positive cells is shownfrom noninfected cells (�) and cells infected with the control virus pEGZ-HA or NFAT-expressing retroviruses. Compilation of data from fourindependent experiments.(D) Detection of ectopic NFAT expression in primary T cells. Three days after infection of CD4� T cells from DO 11.10 TCR tg mice with controlvirus (pEGZ-HA, lane 1, � and �) or virus-expressing NFATc1/A (lane 2), NFATc1/C (lane 3), or NFATc2 (lane 4), the cells were either leftuninduced (�) or induced with plate-bound �CD3 mAb for 3 hr (�). Nuclear proteins from infected cells were prepared and assayed inWestern blots using an �HA Ab or, as loading control, a �-actin-specific Ab.


Figure 8. Model of Transcription of Murine NFATc1 Gene in T Cells

The transcription of NFATc1 gene is controlled by two promoters, P1 and P2, and two poly A sites, pA1 and pA2. The highly inducibletranscription of the short isoform NFATc1/A in effector T cells is always controlled by the strong promoter P1 and the weak poly A site pA1(see Chuvpilo et al., 1999b). The synthesis of the longer isoforms NFATc1/B and C is controlled by either P1 or P2 and by the strong poly Asite pA2. The autoregulation of P1 promoter by NFAT factors results in an increase of NFATc1/A but not NFATc1/B�C synthesis.

demonstrated by introducing mutations into P1 at the 1998; Ranger et al., 1998c). This is shown in Figure 7Awhere a marked delay in AICD induction of peripheralNFATtand site which suppress NFAT binding and by co-

transfections of a P1-directed luciferase reporter gene T cells from NFATc2-deficient mice can be seen aftertreatment with �CD3 Abs. Since NFATc1-deficient T cellsinto EL-4 and 293 cells with vectors expressing NFATc

proteins. As shown in Figure 6F, mutation of both NFAT are difficult to obtain due to the embryonic lethality ofNFATc1�/� mice, we transduced primary murine CD4� Tsites abolished any P1 activity. In cotransfections, ec-

topic NFATc2 expression resulted in a 2- to 3-fold in- cells from DO11.10 TCR tg Balb/c mice (Murphy et al.,1990) with retroviruses expressing NFATc1/A, NFATc1/C,crease and NFATc1/A expression in a 4- to 5-fold in-

crease in inducible P1 activity in EL-4 cells which or NFATc2. After primary stimulation with the corre-sponding Ova peptide and APCs, the cells were ex-express relatively high levels of endogenous NFAT (Fig-

ure 6G). In 293 HEK cells which express minute amounts panded for 3 days, and AICD was induced by incubationof cells for 8 hr with plate-bound �CD3 Abs. Transduc-of endogenous NFATs, a stronger increase in P1 activity

was observed after cotransfections with vectors ex- tion of primary T cells with “empty” control virus orvirus expressing-NFATc1/A led to an infection efficiencypressing NFATc1/A or c1/C (Figure 6H).

Expression of NFAT proteins in EL-4 cells exerts a between 20%–50% (measured by EGFP expression;Figure 7B), and the infected cells showed a spontaneousmoderate but measurable stimulatory effect on the ex-

pression of endogenous NFAT target genes, e.g., of apoptosis rate of approximately 10% after 3 days ofexpansion, very similar to noninfected cells. In contrast,the IL-2, IL-4, and IL-5 genes (our unpublished data). A

similar increase was detected when we measured the T cells transduced with viruses expressing eitherNFATc2 or NFATc1/C led to a relatively poor transduc-effect of NFATc1/A or NFATc1/C expression on endoge-

nous NFATc1/A RNA levels in RNase protection assays. tion efficiency between 10%–20%, and the cells showeda markedly higher spontaneous apoptosis rate of 15%.After induction for 24 hr by T�I, a 2- to 5-fold increase

in P1-directed NFATc1/A RNA levels was detected in Whereas stimulation of noninfected T cells or T cellsinfected with control virus or NFATc1/A-expressing viruscells expressing either NFATc1/A or c1/C compared to

control cells (compare lanes 5, 10, and 15 in Figure showed the same increase in apoptosis to about 40%of cells, those infected with NFATc1/C- or NFATc2-6I). All these results indicate that NFAT proteins control

NFATc1/A expression. expressing virus showed a strong increase in apoptosisrate between 70%–80%. Of note, uninfected cells ofthe same assay appeared also to be killed by fratricideIn Contrast to NFATc2 and NFATc1/C, NFATc1/A Does(Figures 7B and 7C). This indicates that in contrast toNot Promote Apoptosis of T Effector CellsNFATc2 and NFATc1/C, the short NFATc1 isoform AWe and others have shown previously that NFATc2-

deficient T cells show a delayed AICD (Schuh et al., does not enhance apoptosis of effector T cells, although

Immunity892

in infected cells it is expressed at a level that is the binding of transcription factors to promoter DNA andfacilitates the binding of other proteins, e.g., of MeCP1same as or even higher than NFATc1/C or NFATc2, re-

spectively (Figure 7D). and MeCP2, which repress transcription by recruitinghistone deacetylases (Boyes and Bird, 1992; Nan et al.,1998). DNA methylation also contributes to the inactiva-Discussiontion of tumor suppressor genes by blocking transcrip-tion from one allele (see Momparler and Bovenzi, 2000).In this study we show that in effector T cells NFAT tran-For NFATc2, a suppressor function in the generationscription factors autoregulate and enhance the massiveof tumor-like chrondrocytes was postulated studyinginduction of the short isoform A of NFATc1 which, inNFATc2-deficient mice (Ranger et al., 2000). The inser-marked contrast to NFATc1/C, NFATc2, and NFATc3tion of the aggressive retrovirus SL3-3 (Sorensen et al.,proteins, is unable to promote apoptosis. This mecha-1996) into the NFATc1 promoter region (Figure 1C) leadsnism appears to be a survival strategy of effector Tto T cell lymphomas and NFATc1 suppression (S.C. andcells for synthesis of lymphokines and other effectorA.B. Sorensen et al., unpublished data), suggesting thatmolecules before dying by AICD.NFATc1 might exert a similar function in the generationof lymphoid tumors.Structure and Expression of the Chromosomal

The two DNase I hypersensitive chromatin sites HSS1Murine NFATc1 Geneand HSS4, which were detected at P1 or P2, respec-Due to the alternative usage of two promoters and polytively, appear to be generated after stimulation of pri-A sites, three prominent NFATc1 isoforms are expressedmary lymphocytes, probably following hypomethylationin T cells which differ mainly in the length of theirof promoter DNA. In EL-4 thymoma cells, both HSS1C-terminal peptides. As presented in Figure 8, the induc-and HSS4, along with two additional intronic sites, HSS2tion of NFATc1/A, the most abundant NFATc1 isoformand HSS3, are constitutively accessible to DNase I (Fig-in effector T cells, is directed by the strong promoterures 3A and 3B), indicating an open chromatin confor-P1 and a proximal poly A site, pA1, which is locatedmation of NFATc1 promoter region in these cells. Whiledownstream of exon 9. Contrary to the pA2 DNA se-the function of HSS2 region in NFATc1 expression re-quences following exon 11 that are highly conservedmains unknown, HSS3 harbors a transcriptional en-between mouse and man, those around pA1 in intron 9hancer which can support P1 induction (Figure 3C).differ between both species. This suggests conspicuous

Two lines of evidence indicate that numerous, albeitdifferences in the poly A addition at pA1 between humannot all, properties for the strong induction of NFATc1and mouse, and, in fact, the 3� ends of murine andgene are located within the P1 core promoter of 800human NFATc1/A RNAs differ markedly in their lengthsbp. These are (1) the strong conservation of P1 DNA(Pan et al., 1997; Sherman et al., 1999; Kawai et al.,between mouse and human (Figure 6A) and (2) transfec-2001; D.T. et al., unpublished data). However, in spitetion studies (Figure 5A) which show that longer 5� DNAof these variations in 3� end formation, the functionalfragments spanning up to 5.5 kb DNA promote transcrip-collaboration between P1 and pA1 for the generation oftion as strong as the 800 bp P1 fragment. Among theNFATc1/A is conserved between mouse and human,transcription factors binding to and controlling P1, sev-indicating the functional importance of this mechanism.eral have been described to control promoters of otherIn contrast to NFATc1/A, RNA synthesis of the longerlymphoid-specific genes, such as NF-�B, NFAT, SP-1/isoforms, NFATc1/B and C, can be directed either bySP-3, and Fos (for review see Kuo and Leiden, 1999).promoter P1 or promoter P2, but it is always controlledThe collaboration between all these factors creates aby the strong distal poly A site, pA2 (Figure 8). TheP1 activity which resembles that of promoters of Th2-preferential use of pA1 upon activation of effector T cellstype IL-4 and IL-5 genes but differs markedly from theprevents the synthesis of NFATc1/B�C in these cells.activity of the IL-2 promoter (Figure 5). Remarkably, itInstead, they are the most abundant NFATc1 proteinsalso differs from the induction of the endogenousin naive and resting effector T cells (Chuvpilo et al.,NFATc1 gene in EL-4 cells which is strongly induced by1999b). NFATc1/B and C proteins contain either anT�I (Figure 2B) while the same inducers exert a marginalN-terminal peptide of 42 aa encoded in exon 1 or aneffect on P1 (Figure 5B). The strong forskolin effect mightN-terminal peptide of 27 aa encoded in exon 2, andreflect a strong contribution of P1 on NFATc1 expressionat their C termini they harbor either the short 128 aain Th2 cells which contain high cAMP concentrationsC-terminal peptide of isoform B or the longer peptideand express NFATc1 at a high level. All this indicatesof 246 aa typical for isoform C, which represents a weakthat (1) the chromosomal context and/or (2) additionaltransactivation domain (Chuvpilo et al., 1999a, 1999b).transcription factors binding to sequence elements lo-cated outside the promoter region contribute to NFATc1Structure and Function of the NFATc1 Promotersinduction in T cells.The NFATc1 promoters P1 and P2 are characterized by

the generation of DNase I hypersensitive chromatin sitesand are embedded in CpG islands. Our methylation Autoregulation of NFATc1/A Synthesis

by NFAT Factorsstudies show that P1 is hypermethylated in cells whereNFATc1 is not expressed, such as in kidney cells, and NFAT factors control P1 induction by binding to the

tandemly arranged NFAT site, NFATtand, at position �650demethylated in effector T cells. This agrees with thegeneral view that DNA methylation suppressess tran- within the distal homology block of P1 and a weaker

NFAT site, NFAT�90, within the proximal P1 promoterscription of numerous tissue-specific genes (Naveh-Many and Cedar, 1981). CpG methylation blocks the region (Zhou et al., 2002). Both sites differ from numer-


ous other NFAT sites within lymphokine promoters to data). A1/Bfl-1 is a member of the family of Bcl-2-relatedproteins and is known to exert a strong antiapoptoticwhich NFAT binds in concert with AP-1-like factors (for

a recent review see Macian et al., 2001). The latter con- effect upon induction of B cells through B cell and TNF�receptors (Grumont et al., 1999; Zong et al., 1999), simi-tain the consensus sequence 5�-caxwGGAAAawxxxg/

aTGAC/GTCAg/tc-3� (where capital letters denote highly lar to Bcl-2 and Bcl-XL whose expression also appearsto be controlled by NFAT factors (Kel et al., 1999). Inand lower case letters denote poorly conserved nucleo-light of these findings one may assume that the specifictides; w � A or T; x � any nucleotide), which occurseffect of individual NFAT proteins in apoptosis regula-ten times more frequently in promoters active in T cellstion might rely on their capability to control the expres-than in other promoters (Kel et al., 1999). NFATtand ap-sion of both pro- and antiapoptotic genes at the appro-pears also to be a stronger NFAT binding site than thepriate stage of T cell differentiation and activation. Whiledistal IL-2 NFAT site, Pu-bd. However, the binding ofit remains to be shown by more detailed studies howAP-1 to Pu-bd supports NFAT binding (Macian et al.,the NFAT proteins differ in this respect, our studies pre-2001) while no AP-1-like binding site is located 3� fromsented here and the marked differences in phenotypeNFATtand (and NFAT�90). It remains to be shown whetherbetween NFATc1- and NFATc2-deficient mice in AICDother factors support NFAT binding to NFATtand. In anycontrol (Hodge et al., 1996; Ranger et al., 1998b; Schuhcase, NFATtand is an important element through whichet al., 1998; Xanthoudakis et al., 1996; Yoshida et al.,NFATs autoregulate P1 induction and NFATc1/A expres-1998) document that NFAT factors are specific andsion at relatively low NFAT threshold levels.prominent regulators of genes controlling the AICD ofThe binding of NFATc1 and NFATc2 to NFATtand (FigureT effector cells.6B) suggests that NFATc1/A induction is controlled by

both factors. Whereas our cotransfection experimentsExperimental Procedures(Figures 6G and 6H) indicate that NFATc1 protein en-

hances P1 activity and NFATc1/A expression, the tre- Cells and DNA Transfectionsmendous increase in NFATc1/A (but not in NFATc1/ All lymphoid cells were grown to a density of 2 � 105 cells/ml in

RPMI medium containing 5% fetal calf serum (FCS). They wereB�C) levels in T cells double-deficient for NFATc2�3induced with TPA (20 ng/ml), ionomycin (0.5 M), or TPA�ionomycin(Ranger et al., 1998c) suggests that NFATc2 (and c3)(T�I) as indicated. In transient transfections of murine EL-4 T lym-inhibits—directly or indirectly—P1 activity. It is presentlyphoma cells, 10 g DNA was transfected into 2.5 � 107 cells using

unknown how both types of NFAT factors execute this a conventional DEAE-dextran transfection protocol. Mean values ofapparent divergent activity on P1 induction and three transfection experiments are shown. For the differentiation ofNFATc1/A expression. naive CD4�CD62Lhi murine T cells in vitro, naive T cells were isolated

from the spleens of BALB/cA mice using �CD4 and �CD62L Abscoupled to Dynabeads (Dynal, Hamburg, Germany). The cells wereNFAT Proteins and AICD of T Lymphocytesstimulated with �TCR� (2.5 g/ml) and �CD28 Abs (5 g/ml) and

The observation that the short isoform NFATc1/A which incubated in Iscove’s medium for 3 days. For Th1 differentiationlacks the C-terminal peptide of approximately 245 aa they were incubated with IL-12 (1000 U/ml), IL-2 (10 ng/ml), and

�IL-4 Abs (10 g/ml) and, for Th2 differentiation, with IL-4 (1000 U/typical for NFATc1/C and NFATc2 does not supportml) and �IFN� Abs (10 g/ml). After addition of IL-2, the cells wereAICD as do other NFATs suggests that this C-terminalincubated for a further 4 days. The resulting Th1 and Th2 cellspeptide plays an important role in inducing apoptosiswere stimulated for 5 hr with T�I or �TCR �� Abs as describedrelevant genes. For NFATc1/C and NFATc2, it has been previously (Chuvpilo et al., 1999b).

shown that their C-terminal peptide harbors a transacti-vation domain, TAD-B (Chuvpilo et al., 1999a; Luo et al., Antibodies

The following Abs were used for lymphocyte activation in EMSA,1996b), which, however, appears to be markedly weakerFACS, and Western blot assays. For T cell stimulation, 5 g/mlthan the strong N-terminal transactivation domain, TAD-A,plate-bound �CD3 mAb (145-2C11; cells kindly provided by J.A.that is common to all NFATs (Avots et al., 1999). In otherBluestone) and 10 g/ml �CD28 mAb (37.51; BD PharMingen) were

studies it has been shown that NFATc2 binds via its used; for AICD induction, �CD3 mAb or �Fas (�CD95) (Jo2; BDC-terminal peptide to the N-terminal region of the myo- PharMingen) were used. Annexin staining was performed usingcyte enhancer factor (MEF) 2D (Youn et al., 2000) which Annexin V-PE (BD PharMingen). For NFAT detection, the mAb 7A6

(Northrop et al., 1994) (ABR, MAR-024) raised against NFATc1 andbinds to two sites within the nur77 promoter and therebypolyclonal Abs 67.1 and T2B1 raised against NFATc2 (kindly pro-controls its activity (Woronicz et al., 1995). nur77 is anvided by A. Rao) were used.immediate early gene induced by TCR stimulation that

mediates thymocyte apoptosis. RNase Protection AssaysWhile it remains to be shown whether nur77 expres- For RNase protection assays, total RNA was extracted using TRIzol

reagent (Life Technologies, Gaithersburg, MD). The RNA was pro-sion is involved in NFAT-mediated control of AICD ofcessed according to PharMingen’s (San Diego, CA) RiboQuant pro-peripheral T cells, the expression of other proapoptotictocol using antisense RNA probes to determine transcriptional startNFAT-controlled genes, e.g., of CD95L gene, plays ansites. For the mapping of transcriptional start sites at promoter P1,

important role in this process (see, e.g., Ranger et al., a 386 bp Kpn I/Sac II fragment of 8.65 kb XbaI fragment (Figure 2B)1998c). However, in addition to their effect on proapo- was cloned in PKS and used for the synthesis of an antisense probe.ptotic genes, NFAT factors appear also to control the For mapping of exon 1 transcripts, a 126 bp fragment was used for

probe synthesis corresponding to the protein coding region of exonexpression of several antiapoptotic genes. Ectopic ex-1. For mapping of P2 transcripts, a 244 bp NotI/NotI fragment ofpression of NFATc1/A but not of NFATc1/C in EL-4 cells8.65 kb XbaI fragment was used.led to an increase in RNA levels of the A1 gene, and

two NFAT-motifs within the A1 promoter were identified Mapping of DNase I Hypersensitive Chromatin Sitesas NFAT binding sites in EMSAs using nuclear proteins The mapping of DNase I hypersensitive chromatin sites was per-

formed according to slightly modified protocols published pre-from induced EL-4 cells (F. B.-S. et al., unpublished

Immunity894

viously (Agarwal and Rao, 1998; Cockerill, 2000). 32P-labeled PCR Received: December 18, 2001Revised: May 9, 2002products of approximately 350 bp from the 5� and 3� termini of XbaI

promoter segment (Figure 1C) were used as probes in Southernhybridizations. References

Agarwal, S., and Rao, A. (1998). Modulation of chromatin structureElectrophoretic Mobility Shift Assays (EMSAs) with Nuclearregulates cytokine gene expression during T cell differentiation. Im-Protein Extracts and GST-NFATc1-RSD Proteinmunity 9, 765–775.Nuclear proteins from EL-4 cells and bacterially expressed GST-

NFATc1 spanning the RSD (aa 418–716) of NFATc1 were prepared Avots, A., Buttmann, M., Chuvpilo, S., Escher, C., Smola, U., Bannis-(Schreiber et al., 1988) and used in EMSAs as described (Klein- ter, A.J., Rapp, U.R., Kouzarides, T., and Serfling, E. (1999). CBP/Hessling et al., 1996). The following oligonucleotides were used as p300 integrates Raf/Rac-signaling pathways in the transcriptionalprobes and competitors and to introduce mutations into P1: NFATtand induction of NF-ATc during T cell activation. Immunity 10, 515–524.(�700) AGTGGAAGCGCTTTTCCAAATTTCCACAGCGGGGGAAGCC Berberich-Siebelt, F., Klein-Hessling, S., Hepping, N., Santner-Nan-(�661); NFAT3�-Mut (�700) AGTGGAAGCGCTTTTCCAAATTTAAACA nan, B., Lindemann, D., Schimpl, A., and Serfling, E. (2000). C/EBP�GCGGGGGAAGCC (�661); NFAT5�-Mut (�700) AGTGGAAGCGCT enhances IL-4 but impairs IL-2 and IFN-g induction in T cells. Eur.TTTGCAAATTTCCACAGCGGGGGAAGCC (�661); NFATtand-Mut (�700) J. Immunol. 30, 2576–2585.AGTGGAAGCGCTTTTGCAAATTTAAACAGCGGGGGAAGCC(�661);

Boyes, J., and Bird, A. (1992). Repression of genes by DNA methyla-NFATtand�5n (�700) AGTGGAAGCGCTTTTCCAATGTACATTTCCACAtion depends on CpG density and promoter strength: evidence forGCGGGGGAAGCC (�661); NFATtand�10n (�700) AGTGGAAGCGCTTTinvolvement of a methyl-CpG binding protein. EMBO J. 11, 327–333.TCCAATGTACAGTCAATTTCCACAGCGGGGGAAGCC (�661);Chuvpilo, S., Avots, A., Berberich-Siebelt, F., Glockner, J., Fischer,NFAT�90 (�102) CGGGGGAGGTGTTTTCCAGCTTTAAAAAGG (�74);C., Kerstan, A., Escher, C., Inashkina, I., Hlubek, F., Jankevics, E., etNFAT�90-Mut (�102) CGGGGGAGGTGTTTTGGAGCTTTAAAAAGG (�74).al. (1999a). Multiple NF-ATc isoforms with individual transcriptionalproperties are synthesized in T lymphocytes. J. Immunol. 162, 7294–

DNA Methylation Studies 7301.CpG methylation of P1 DNA was investigated after DNA Na-bisulfite

Chuvpilo, S., Zimmer, M., Kerstan, A., Glockner, J., Avots, A., Escher,modification (Frommer et al., 1992; Raizis et al., 1995). The followingC., Fischer, C., Inashkina, I., Jankevics, E., Berberich-Siebelt, F.,primers were used in PCR amplifications of modified genomic DNAet al. (1999b). Alternative polyadenylation events contribute to theand following DNA sequencing: 310-asen dir (�370) GTTTTGTTTTinduction of NF-ATc in effector T cells. Immunity 10, 261–269.TTGTTTTTTTAAAGTTGGAAAATATTTT; 310-asen dir nest TTTTTTCockerill, P.N. (2000). Identification of DNaseI hypersensitive sitesAAAGTTGGAAAATATTTTTTTYGGTTTT; 310-asen rev ACCTTTACwithin nuclei. Methods Mol. Biol. 130, 29–46.ACACCTCTAAAAACTCCCTCCAATCCC; 310-asen rev nest ACTCC

CTCCAATCCCTTGTATCCTCATTACC; 310-sense dir GTTTTTGTA Crabtree, G.R. (1999). Generic signals and specific outcomes: sig-TATTTTTGGGAGTTTTTTTTAGTTTTTTG; 310-sense dir nest TGGG naling through Ca2�, calcineurin, and NF-AT. Cell 96, 611–614.AGTTTTTTTTAGTTTTTTGTGTTTTTATTAT; 310-sense rev ACTCT de la Pompa, J.L., Timmerman, L.A., Takimoto, H., Yoshida, H., Elia,ACCTTCTACCTTTTTAAAACTAAAAAACACC; 310-sense rev nest A.J., Samper, E., Potter, J., Wakeham, A., Marengere, L., Langille,TTTTTAAAACTAAAAAACACCTCCCCCRACTC. B.L., et al. (1998). Role of the NF-ATc transcription factor in morpho-

genesis of cardiac valves and septum. Nature 392, 182–186.Retroviral Constructs, Infections, and Apoptotic Falvo, J.V., Uglialoro, A.M., Brinkman, B.M., Merika, M., Parekh,Induction of Primary T Cells B.S., Tsai, E.Y., King, H.C., Morielli, A.D., Peralta, E.G., Maniatis, T.,The bicistronic retroviral vector pEGZ-HA is based on the vector et al. (2000). Stimulus-specific assembly of enhancer complexes onpczCFG2 hCD8 EYZ in which the CMV enhancer replaces the U3 the tumor necrosis factor alpha gene promoter. Mol. Cell. Biol. 20,region of the 5� LTR of murine leukemia virus (see Berberich-Siebelt 2239–2247.et al., 2000). An oligonucleotide was cloned into its Eco RI site

Frommer, M., McDonald, L.E., Millar, D.S., Collis, C.M., Watt, F.,creating a start codon and HA-Flag epitope followed by ClaI, AscI,Grigg, G.W., Molloy, P.L., and Paul, C.L. (1992). A genomic sequenc-BsiWI, RsrlI, HpaI, and SacII sites. The retroviral vectors expressinging protocol that yields a positive display of 5-methylcytosine resi-NFATc2, NFATc1/A, or NFATc1/C were constructed by cloning hu-dues in individual DNA strands. Proc. Natl. Acad. Sci. USA 89, 1827–man NFAT cDNAs (Chuvpilo et al., 1999b) between the Cla I/HpaI1831.sites of pEGZ-HA. All DNA-modifiying enzymes were purchasedGrumont, R.J., Rourke, I.J., and Gerondakis, S. (1999). Rel-depen-from MBI Fermentas (St. Leon-Rot, Germany).dent induction of A1 transcription is required to protect B cellsLN CD4� T cells from 4- to 6-week-old DO11.10 TCR tg Balb/cfrom antigen receptor ligation-induced apoptosis. Genes Dev. 13,mice (Murphy et al., 1990) were isolated by passing them through400–411.CD4 T cell recovery columns (Cedarlane, Hornby, Canada). The cells

were cultured at 5 � 105/ml in X-VIVO15 (Bio Whittacker) supple- Hodge, M.R., Ranger, A.M., de la Brousse, F.C., Hoey, T., Grusby,mented with 5% FCS, Gln, nonessential aa, pyruvate (all 2 mM), M.J., and Glimcher, L.H. (1996). Hyperproliferation and dysregulationantibiotics (penicillin, streptomycin), and 5 � 10�5 M 2-ME. Dendritic of IL-4 expression in NF-ATp-deficient mice. Immunity 4, 397–405.cells were prepared from spleen, irradiated, and used as APCs. Holtz-Heppelmann, C.J., Algeciras, A., Badley, A.D., and Paya, C.V.CD4� T cells were stimulated by the cognate OVA-peptide (323–339) (1998). Transcriptional regulation of the human FasL promoter-en-presented on APCs and cultured in the presence of IL-2. After 24 hancer region. J. Biol. Chem. 273, 4416–4423.hr, they were infected with retroviruses as described previously

Kawai, J., Shinagawa, A., Shibata, K., Yoshino, M., Itoh, M., Ishii,(Berberich-Siebelt et al., 2000).Y., Arakawa, T., Hara, A., Fukunishi, Y., Konno, H., et al. (2001).Functional annotation of a full-length mouse cDNA collection. Nature

Acknowledgments 409, 685–690.

Kel, A., Kel-Margoulis, O., Babenko, V., and Wingender, E. (1999).We are very much indebted to Doris Michel and Ilona Pietrowski

Recognition of NFATp/AP-1 composite elements within genes in-for excellent technical assistance. For critical reading of the manu-

duced upon the activation of immune cells. J. Mol. Biol. 288,script we wish to thank Drs. S. Klein-Hessling and A. Palmetshofer.

353–376.For providing materials we wish to thank Drs. I. Berberich (Wurz-

Klein-Hessling, S., Schneider, G., Heinfling, A., Chuvpilo, S., andburg), T. Hanke (Wurzburg), A. Rao (Boston), C. Skerka (Jena), andSerfling, E. (1996). HMG I(Y) interferes with the DNA binding of NF-G. Suske (Marburg). This work was supported by the SFB 465 (Wurz-AT factors and the induction of the interleukin 4 promoter in T cells.burg) and SFB466 (Erlangen), the research group FOR 303, the grad-Proc. Natl. Acad. Sci. USA 93, 15311–15316.uate colleges “Immunomodulation” and “Control of Cell Growth”

(Wurzburg) of the DFG, and by the Wilhelm-Sander-Stiftung. Kuo, C.T., and Leiden, J.M. (1999). Transcriptional regulation of T


lymphocyte development and function. Annu. Rev. Immunol. 17, Ranger, A.M., Oukka, M., Rengarajan, J., and Glimcher, L.H. (1998c).Inhibitory function of two NFAT family members in lymphoid homeo-149–187.stasis and Th2 development. Immunity 9, 627–635.Latinis, K.M., Norian, L.A., Eliason, S.L., and Koretzky, G.A. (1997).Ranger, A.M., Gerstenfeld, L.C., Wang, J., Kon, T., Bae, H., Graval-Two NFAT transcription factor binding sites participate in the regula-lese, E.M., Glimcher, M.J., and Glimcher, L.H. (2000). The nucleartion of CD95 (Fas) ligand expression in activated human T cells. J.factor of activated T cells (NFAT) transcription factor NFATpBiol. Chem. 272, 31427–31434.(NFATc2) is a repressor of chondrogenesis. J. Exp. Med. 191, 9–22.Li, X., Ho, S.N., Luna, J., Giacalone, J., Thomas, D.J., Timmerman,Rao, A., Luo, C., and Hogan, P.G. (1997). Transcription factors ofL.A., Crabtree, G.R., and Francke, U. (1995). Cloning and chromo-the NFAT family: regulation and function. Annu. Rev. Immunol. 15,somal localization of the human and murine genes for the T-cell707–747.transcription factors NFATc and NFATp. Cytogenet. Cell Genet. 68,

185–191. Santini, M.P., Talora, C., Seki, T., Bolgan, L., and Dotto, G.P. (2001).Cross talk among calcineurin, Sp1/Sp3, and NFAT in control ofLi-Weber, M., Laur, O., and Krammer, P.H. (1999). Novel Egr/NF-ATp21(WAF1/CIP1) expression in keratinocyte differentiation. Proc.composite sites mediate activation of the CD95 (APO-1/Fas) ligandNatl. Acad. Sci. USA 98, 9575–9580.promoter in response to T cell stimulation. Eur. J. Immunol. 29,

3017–3027. Schmitz, I., Kirchhoff, S., and Krammer, P.H. (2000). Regulation ofdeath receptor-mediated apoptosis pathways. Int. J. Biochem. CellLopez-Rodriguez, C., Aramburu, J., Rakeman, A.S., and Rao, A.Biol. 32, 1123–1136.(1999). NFAT5, a constitutively nuclear NFAT protein that does notSchorpp, M., Hofmann, M., Dear, T.N., and Boehm, T. (1997). Char-cooperate with Fos and Jun. Proc. Natl. Acad. Sci. USA 96, 7214–acterization of mouse and human nude genes. Immunogenetics 46,7219.509–515.Luo, C., Burgeon, E., Carew, J.A., McCaffrey, P.G., Badalian, T.M.,Schreiber, E., Matthias, P., Muller, M.M., and Schaffner, W. (1988).Lane, W.S., Hogan, P.G., and Rao, A. (1996a). Recombinant NFAT1Identification of a novel lymphoid specific octamer binding protein(NFATp) is regulated by calcineurin in T cells and mediates transcrip-(OTF-2B) by proteolytic clipping bandshift assay (PCBA). EMBO J.tion of several cytokine genes. Mol. Cell. Biol. 16, 3955–3966.7, 4221–4229.Luo, C., Burgeon, E., and Rao, A. (1996b). Mechanisms of transacti-Schuh, K., Kneitz, B., Heyer, J., Bommhardt, U., Jankevics, E., Ber-vation by nuclear factor of activated T cells-1. J. Exp. Med. 184,berich-Siebelt, F., Pfeffer, K., Muller-Hermelink, H.K., Schimpl, A.,141–147.and Serfling, E. (1998). Retarded thymic involution and massive

Macian, F., Lopez-Rodriguez, C., and Rao, A. (2001). Partners ingerminal center formation in NF-ATp-deficient mice. Eur. J. Immu-

transcription: NFAT and AP-1. Oncogene 20, 2476–2489.nol. 28, 2456–2466.

Momparler, R.L., and Bovenzi, V. (2000). DNA methylation and can- Serfling, E., Berberich-Siebelt, F., Chuvpilo, S., Jankevics, E., Klein-cer. J. Cell. Physiol. 183, 145–154. Hessling, S., Twardzik, T., and Avots, A. (2000). The role of NF-ATMurphy, K.M., Heimberger, A.B., and Loh, D.Y. (1990). Induction by transcription factors in T cell activation and differentiation. Biochim.antigen of intrathymic apoptosis of CD4�CD8�TCRlo thymocytes in Biophys. Acta 1498, 1–18.vivo. Science 250, 1720–1723. Sherman, M.A., Powell, D.R., Weiss, D.L., and Brown, M.A. (1999).Nan, X., Cross, S., and Bird, A. (1998). Gene silencing by methyl- NF-ATc isoforms are differentially expressed and regulated in mu-CpG-binding proteins. Novartis Found. Symp. 214, 6–16; discussion rine T and mast cells. J. Immunol. 162, 2820–2828.16–21, 46–50. Sorensen, A.B., Duch, M., Amtoft, H.W., Jorgensen, P., and Ped-

ersen, F.S. (1996). Sequence tags of provirus integration sites inNaveh-Many, T., and Cedar, H. (1981). Active gene sequences areDNAs of tumors induced by the murine retrovirus SL3-3. J. Virol.undermethylated. Proc. Natl. Acad. Sci. USA 78, 4246–4250.70, 4063–4070.Northrop, J.P., Ho, S.N., Chen, L., Thomas, D.J., Timmerman, L.A.,Stassen, M., Arnold, M., Hultner, L., Muller, C., Neudorfl, C., Reineke,Nolan, G.P., Admon, A., and Crabtree, G.R. (1994). NF-AT compo-T., and Schmitt, E. (2000). Murine bone marrow-derived mast cellsnents define a family of transcription factors targeted in T-cell activa-as potent producers of IL-9: costimulatory function of IL-10 and kittion. Nature 369, 497–502.ligand in the presence of IL-1. J. Immunol. 164, 5549–5555.Pan, S., Koyano-Nakagawa, N., Tsuruta, L., Amasaki, Y., Yokota, T.,Tsytsykova, A.V., Tsitsikov, E.N., and Geha, R.S. (1996). The CD40LMori, S., Arai, N., and Arai, K. (1997). Molecular cloning and func-promoter contains nuclear factor of activated T cells-binding motifstional characterization of murine cDNA encoding transcription factorwhich require AP-1 binding for activation of transcription. J. Biol.NFATc. Biochem. Biophys. Res. Commun. 240, 314–323.Chem. 271, 3763–3770.

Park, J., Takeuchi, A., and Sharma, S. (1996). Characterization of aWoronicz, J.D., Lina, A., Calnan, B.J., Szychowski, S., Cheng, L., andnew isoform of the NFAT (nuclear factor of activated T cells) geneWinoto, A. (1995). Regulation of the Nur77 orphan steroid receptor infamily member NFATc. J. Biol. Chem. 271, 20914–20921.activation-induced apoptosis. Mol. Cell. Biol. 15, 6364–6376.

Peng, S.L., Gerth, A.J., Ranger, A.M., and Glimcher, L.H. (2001).Xanthoudakis, S., Viola, J.P., Shaw, K.T., Luo, C., Wallace, J.D.,NFATc1 and NFATc2 together control both T and B cell activationBozza, P.T., Luk, D.C., Curran, T., and Rao, A. (1996). An enhancedand differentiation. Immunity 14, 13–20.immune response in mice lacking the transcription factor NFAT1.

Prieschl, E.E., Gouilleux-Gruart, V., Walker, C., Harrer, N.E., and Science 272, 892–895.Baumruker, T. (1995). A nuclear factor of activated T cell-like tran-

Yoshida, H., Nishina, H., Takimoto, H., Marengere, L.E., Wakeham,scription factor in mast cells is involved in IL-5 gene regulation afterA.C., Bouchard, D., Kong, Y.Y., Ohteki, T., Shahinian, A., Bachmann,IgE plus antigen stimulation. J. Immunol. 154, 6112–6119.M., et al. (1998). The transcription factor NF-ATc1 regulates lympho-

Raizis, A.M., Schmitt, F., and Jost, J.P. (1995). A bisulfite method cyte proliferation and Th2 cytokine production. Immunity 8, 115–124.of 5-methylcytosine mapping that minimizes template degradation.

Youn, H.D., Chatila, T.A., and Liu, J.O. (2000). Integration of cal-Anal. Biochem. 226, 161–166.

cineurin and MEF2 signals by the coactivator p300 during T-cellRanger, A.M., Grusby, M.J., Hodge, M.R., Gravallese, E.M., de la apoptosis. EMBO J. 19, 4323–4331.Brousse, F.C., Hoey, T., Mickanin, C., Baldwin, H.S., and Glimcher, Zhou, B., Cron, R.Q., Wu, B., Genin, A., Wang, Z., Liu, S., Robson,L.H. (1998a). The transcription factor NF-ATc is essential for cardiac P., and Baldwin, H.S. (2002). Regulation of the murine Nfatc1 genevalve formation. Nature 392, 186–190. by NFATc2. J. Biol. Chem. 277, 10704–10711.Ranger, A.M., Hodge, M.R., Gravallese, E.M., Oukka, M., Davidson, Zong, W.X., Edelstein, L.C., Chen, C., Bash, J., and Gelinas, C.L., Alt, F.W., de la Brousse, F.C., Hoey, T., Grusby, M., and Glimcher, (1999). The prosurvival Bcl-2 homolog Bfl-1/A1 is a direct transcrip-L.H. (1998b). Delayed lymphoid repopulation with defects in IL- tional target of NF-�B that blocks TNF�-induced apoptosis. Genes4-driven responses produced by inactivation of NF-ATc. Immunity Dev. 13, 382–387.8, 125–134.

immunity, vol. 16, 881–895, june, 2002, copyright 2002 by ... · mithilesh kumar jha,1 jan...

Documents