in is specified by mid, the minus-dominance gene · strain is chromosomally mt- but carries an...

Copyright 8 1997 by the Genetics Society of America

Mating Type in Chlamydomonas Is Specified by mid, the Minus-Dominance Gene

Patrick J. Ferris and Ursula W. Goodenough

Department of Biology, Washington University, St. Louis, Missouri 63130 Manuscript received January 9, 1997

Accepted for publication April 7, 1997

ABSTRACT Diploid cells of Chlamydomonas reinhardtii that are heterozygous at the mating-type locus (mt"/mt-)

differentiate as minus gametes, a phenomenon known as minus dominance. We report the cloning and characterization of a gene that is necessary and sufficient to exert this minus dominance over the plus differentiation program. The gene, called mid, is located in the rearranged (R) domain of the mt- locus, and has duplicated and transposed to an autosome in a laboratory strain. The impll mt- mutant, which differentiates as a fusion-incompetent plus gamete, carries a point mutation in mid. Like the f u s l gene in the mt" locus, mid displays low codon bias compared with other nuclear genes. The mid sequence carries a putative leucine zipper motif, suggesting that it functions as a transcription factor to switch on the minus program and switch off the p2us program of gametic differentiation. This is the first sex- determination gene to be characterized in a green organism.

E UKARYOTIC sex presumably originated in single- celled organisms like the green alga Chlamydome

nus reinhardtii, whose haploid mitotic (vegetative) cells differentiate into gametes of two mating types, called plus and minus, in response to nitrogen starvation (SAGER and GRANICK 1954) and a blue light signal (BECK and HARING 1996). When the gametes are mixed, they adhere via two independent sets of cellcell recognition molecules (reviewed in GOODENOUCH 1991) and then fuse to form diploid zygotes that go on to form meiotic spores. During meiosis, the mating-type trait segregates 2:2 (SMITH and REGNERY 1950), indicating that sex is determined by gene(s) encoded at a single locus called mt.

Both the mt+ and mt- loci have been cloned (FERRIS and GOODENOUGH 1994) and shown to comprise large (- 1 megabase) regions in the left arm of linkage group (LG) VI that are under recombinational suppression and therefore segregate as a unit. In the middle of each mt locus is a -200-kilobase (kb) sector called the R domain because it displays numerous rearrangements (transpositions, inversions, additions and deletions) when the mt+ and mt- sequences are compared. The two R domains also carry blocks of DNA that are unique to one mt locus or the other, leading to the proposal (FERRIS and GOODENOUGH 1994) that these unique sequences might contain genes necessary to generate the plus or the minus gametic phenotypes. This prediction has been borne out in the case of the fus l gene, which has been localized to the unique region c in the mt+ R domain (FERRIS et al. 1996). The fusl gene encodes

Cmrespondzng author: Patrick Ferris, Department of Biology, Box 1229, Washington University, St. Louis, MO 63130. E-mail: [email protected]

Genetics 146 859-869 (July, 1997)

the "fringe" glycoprotein located on the plus mating structure, which adheres to its counterpart on the minus mating structure as a prelude to gametic cell fusion (GOODENOUGH et al. 1982).

The fusl gene is involved in mate recognition. Sexual eukaryotes also carry gene (s) involved in sex determination. These typically encode transcription factors that initiate a cascade of gene expression leading to sexual differentiation; examples include MATa 1 in yeast (HER- SKOWITZ et al. 1992) and the Sry protein of mammals (WERNER et al. 1995). Genetic studies of sex determination in C. reinhardtii have yielded three observations. First, diploid mt"/mt- heterozygotes are found to mate as minus gametes (EBERSOLD 1967), a phenomenon called minus dominance. Second, the mt--linked mutation impl l converts minus cells to "pseudo-plus" cells; these differentiate as plus gametes but cannot fuse with minus partners because they lack an mt' chromosome and hence a fusl gene product (GOODENOUGH et al. 1982; GALLOWAY and GOODENOUGH 1985). Third, a mutation in the is01 gene, unlinked to mt, also generates pseudo-plus gametes in a mt- background but has no detectable phenotype in mtf cells (CAMPBELL et al. 1995).

We report here the characterization of the mid (minus dominance) gene of C. reinhardtii, which is necK sary and sufficient to convert mt+ cells to cells that mate as minus. The gene is located within a unique sector of the mt- R domain, a sector that has transposed to an autosome in the laboratory strain CG421 and encodes a putative leucine zipper-containing polypeptide. The impll mutation is shown to entail two nucleotide changes in the mid gene that result in a single amino acid substitution in the zipper domain. We propose that the Mid protein, perhaps in concert with other proteins

860 P. J. Ferris and U. W. Goodenough

(e.g., the Is01 polypeptide), brings about sexual differentiation in C. reinhardtii.

MATERIALS AND METHODS

Chlamydomonas methods. Chlamydomonas strains, available from the Chlamydomonas Genetics Center, Duke Uni- versity as C G stocks, were maintained on Tris-acetate-phos- phate (TAP) medium, supplemented with 4 hg/ml nicotinamide as needed. Gametes were prepared by resuspending cells in nitrogen-free high salt minimal (HSM) medium (HAK RIS 1989). Genetic crosses were performed using standard protocols (HARRIS 1989). The nic7 marker was scored as a failure to grow on TAP medium supplemented with 15 p1/ liter 3-acetylpyridine. The mating phenotype was assayed by mixing each strain to be tested with control gametes of mt+ (CC-620) and mt- (CC-621) and checking for agglutination by microscopy. Any strains that agglutinated with both tester strains were checked to confirm that they were self-agglutinating.

In crosses between CC-85 and imp11 mtC ele fusl'T (described in RESULTS), the instability of ele means that zygotes could, in theory, arise by selfing between impl I mt- ele fusl+T (minus) and impll mtC fusl+T (plus) gametes. However, any such zygotes would generate 4 Nic+:O Nic- tetrads, and no such ratios were encountered.

Transformation of the Chlamydomonas nuclear genome was accomplished by vortexing enzymatically dewalled cells in the presence of polyethylene glycol, glass beads and DNA (KINDLE 1990), with modifications as described in FERRIS (1995). Procedures for making Chlamydomonas DNA, polyA' RNA, and for performing Northern and Southern blots have been described previously (FERRIS et al. 1996).

Source of DNA clones: A AZAPII library constructed using polyA+ RNA from zygotes harvested 60 min after mating (ARMBRUST et ai. 1993) was the source for the cDNA clones. Genomic DNA from the mt loci was derived from the kEMBL3 phage that make up the chromosomal walk described in FERRIS and GOODENOUCH (1994). The plasmid pMid12.5 contains a 12.5-kb PstI fragment from phage BA3 inserted into the PstI site of pUC13. Since the BamHI site in the pUCl3 polylinker is at the left end of pMid12.5 (as depicted in Figure l ) , plasmid pMid7.l was constructed by digesting pMid12.5 with BamHI and religating to remove the two leftmost BamHI fragments.

The equivalent BamHI/PstI fragment to that in pMid7.1 was cloned from the impll mutant, as follows. Genomic DNA from CC-1148 (impll mt-) was digested with BamHI and PstI, and several size fractions isolated after electrophoresing the DNA on a low melt agarose gel. Aliquots from these size fractions were used to prepare a Southern blot, which was hybridized with probe G. DNA from the hybridizing fractions was ligated into BamHI/PstI-cut pUC13, and transformed into Escherichia coli strain TG1. A clone carrying the appropriate insert was identified by colony hybridization (MANIATIS et al. 1982) using probe G.

DNA fragments used as hybridization probes were isolated from low melting point agarose and purified by phenol extrac- tion before labeling by nick translation (MANIATIS et al. 1982). The source of the probes was as follows. Probe A is a 1.2-kb Sac1 fragment from phage BE2. Probe B is a 1.4kb XhoI/ BamHI fragment from phage BEl. Probe C is a 1.2-kb Smd fragment from phage BA3 (or one of its plasmid derivatives). Probe D is a 0.6-kb XhoI/Satl fragment (the SalI site is in the phage polylinker) from phage PH2 (which is from the mt+ walk). Probe E is a 1.8-kb SmaI fragment from phage BB1.

Probe F is a 2.4kb SmaI fragment from BA3 (or one of its plasmid derivatives), and probe G is a 500-base pair (bp) PstI/ XhoI fragment from cDNAl that is mainly the mid coding region (the PstI site is in the plasmid polylinker).

PCR and sequencing: A cDNA clone representing the coding region of the mid transcript in the imp11 mutant was produced by reverse transcription (RT)-PCR from polyA' RNA isolated from impl 1 gametes. The RT-PCR Kit from Stra- tagene was used with Vent DNA polymerase (New England Biolabs) and two primers, AGAGCGCTTTCCATACC (ends 7 bp 5' of the starting methionine) and CACAG'ITGCTAG TGCTC (ends 42 bp 3' of the stop codon), and the following cycling conditions: 94" for 1 min, 60" for 1 min, 72" for 1 min, for 35 cycles. The resulting product was purified from a low- melt agarose gel, ligated into HzncII-cut pUC118 and sequenced. The same primers and conditions were used to assay for the presence of mid in transformants.

DNA sequences were determined by cloning into pUCl18/ 119 and performing single-stranded sequencing using the Sequenase Kit (United States Biochemical). The wild-type genomic sequence is available as GenBank accession no. U92071. DNA sequences were analyzed using the Genetics Computer Group software package (University of Wisconsin) on a VAX/VMS computer.

Origin of the 421 element: Southern blots were prepared from all progenitor and progeny strains of CC421 available from the Chlamydomonas Genetics Center (Duke University) and hybridized with probe B to score for the presence of the novel-sized XhoI fragment in the 421 element. Only mtC strains were checked since the 421 element could not be inherited from a plus parent. CC-421 was created from a cross using CC-350 in 1977. CC-350 was created from strain CG44 before 1975 ( S ~ H et al. 1975). Neither of these strains currently carries the 421 element, nor does CC-422 (also derived from CC-350 in 1977), nor CC-1336 (which derived from CC-422).

Four extant strains were derived from CG421 in 1988: C G 2660,2661,2662, and 2663. One of these, CC-2661, has inherited the 421 element. The instability of the element means that it could have been present in any of the other strains and later lost, but the data suggest that the 421 element was either present in the minw gamete that gave rise to CG421, arose during the cross, or arose and became fixed during vegetative propagation of the CG421 strain before 1988.

RESULTS

CC-121 contains two mid loci: The imp21 mutant strain is chromosomally mt- but carries an mtK-linked mutation affecting mating-type determination (a mutant mid gene, see below). As a consequence, imp2 2 cells differentiate into "pseudo-plus" gametes that express plus flagellar agglutinins (involved in the initial adhe- sion to minus gametes) and plus mating structures. These mating structures, however, lack the plus

fringe" glycoprotein necessary for fusion to minus gametes (GOODENOUGH et ul. 1982) because the fus2 gene, encoding plus fringe, is located exclusively in the mtf locus and hence is absent from the imp1 1 mt- genome. Introduction of a cloned fusl gene by transformation [transgenes integrate at apparently random sites in C. reznhurdtzi (GUMPEL and PURTON 1994)] allows imp21 gametes to fuse with minus partners (FERRIS et al. 1996).

In our initial genetic analysis of such a transformed

"

Mating Type in Chlamydomonas 861

TABLE 1

Segregation of the 421 element in crosses

A nic7’ impll mt- f w l + T X nic7 impll+ mt- eb (CG421) (Nic+, plus) (Nic- , minus)

Progeny genotype Nic phenotype Agglutinates as

nic7 impll+ mt- - minus nic7 imp11 + mt- ek - minus nic7’ imp11 mt- + Plus nic7+ imp11 mt- eb“ + minus

B: nic7 mt+ (CG85) X nic7+ impll mt- ele (A6, A16 or (212) (Nic-, plus) (Nic’, minus)

Progeny genotype Nic phenotype Agglutinates as

nic7 mt+ - Plus nic7 mt+ ekb - minus nic7+ impll mt- + Plus nic7+ imp11 mt- eb + minus

The table shows the observed phenotypes and predicted genotypes of a tetratype tetrad for each of the two types of crosses described in the text. Since nic7, impll and mt are all tightly linked, recombination among these markers is not considered. The fusl transgene has been designated f w l + T ; its segregation in the progeny is not indicated since it was not usually scored. Markers irrelevant to this analysis have not been included.

a This class of progeny was used as the minus parent in B. Progeny 1-4 in Figure 2 are members of this class of

progeny.

impl 1 mt- strain (hereafter designated impll mt- fusl’ 7 J , it was crossed to the minus strain CC-421 (nic7 ac29u mt- spr-u-1-27-3) (Table 1A). The progeny of this cross exhibited an apparently aberrant segregation of mt. Of nine complete tetrads, three gave the expected proportion of two progeny agglutinating as minus and two as plus (since the f u s l transgene assorts independently of mt, roughly half of these plus agglutinators are capable of fusion while the rest are not). In four other tetrads, however, the ratio was three minus to one plus, and the remaining two tetrads yielded minus progeny only. The nic7 marker, which is very tightly linked to mt (SMWH et d. 1975; FERRIS 1995), segregated normally, and the Nic- progeny always showed a minus phenotype, indicating that the mt locus itself was behaving normally.

Since both parents carry an mt- chromosome, we initially considered the possibility that the aberrant segregation was somehow caused by this unusual circum- stance. However, subsequent analysis, detailed below, demonstrated that the CG421 parent carries two mid genes, one in the mt- locus and a second that assorts independently of mt. Since mid is dominant, mt+ progeny that inherit this second locus will differentiate as minus gametes, generating “extra” minus progeny. Hereafter, this second mid locus will be referred to as

the “421 element” (abbreviated ele in genetic nomenclature), which is located either in the right arm of linkage group (LG) VI or, more likely, in an autosome (cumulative tetrad data from relevant crosses: PD:NPD:T = 14:11:24 for nic7and ek).

To simplify further analysis, the 421 element was crossed into an mt+ background. Three Nic’ progeny from the previous cross that agglutinate as minus, and hence presumably have the genotype nicT impll mt- ele (designated A6, A16 and C12), were separately crossed to CG85 (nic7 mt’) (Table 1B). Progeny from these crosses inherit an mt locus that specifies either plus (mt”) or pseudo-plus (imp11 mt-); therefore, any minus progeny will by definition carry the element. Nic7 segregated 2 Nic+:2 Nic-; the mating phenotype also segregated 2 minus2 plus, but independently of nic7. The cross therefore generated progeny that were Nic’ and agglutinate as plus, indicating that the impl 1 mutation is still present in the strains, and progeny that were Nic- and mate as minus, documenting, as predicted, that the element is dominant over mt+.

To ascertain how large a region of the mt- locus is contained within the 421 element, genomic DNA was isolated from several of the nic7 mt+ eb progeny, restriction digested, and the resulting Southern blots hybridized with probes from the mt locus. Probes were chosen that either identify restriction fragment length poly- morphisms (RFLPs) between the mt+ and mt- loci or hybridize only to mt- sequences and give no signal with mt+ DNA. Probes from the thi10 locus (map position -145 kb, see FERRIS and GOODENOUCH 1994), the nic7 locus (270 kb) , the 16-kb repeat (1 10 kb) and region e (160 kb) all produced a hybridization pattern typical for mt+ strains (data not shown), indicating that these sequences are not included in the 421 element and ruling out disomy of LGVI in CC-421. Probe C (Figure l) , which hybridizes only to mt- DNA, hybridized to the same-sized fragment in mt- strains and in progeny that are nic7 mt+ e b (Figure 2a), indicating that this sequence lies within the element. To determine how much of the mt- locus is included within the 421 element, additional probes near probe C were tested, Probes A and E recognize only mt+ WLPs in the nic7 mt+ ele strains (not shown) and must therefore lie outside the duplicated region. Probes B and D (Figure l ) , which derive from the segments present in both mt loci, hybridize to one XhoI fragment corresponding to the LGVI mt locus and another of a novel size in strains carrying the 421 element (Figure 2, b and c). Presum- ably each of the novel XhoI fragments spans the junction between the mt--derived sequences within the 421 element and adjoining sequences. Thus -23 kb of the mt- locus is contained within the element, as shown in Figure 1. Using the novel-sized XhoI fragment detected by probe B as an RFLP marker for the 421 element in various strains, we determined that the element is not

862

f- telomere

P. J. Ferris and U. W. Goodenough

segment 3 region f

segment 4

I 70 kb 60

I I 50

I 40

mid transcript

E X X B X B E H B Sa H S a x Sa H X H Sa E X S a H E X Sa I / I 1 1

probe A probe B - -

probe C probe F " II

probe D probe E -

extent of nt locus duplication in CC-421

pMid12.5 pMid7.1

I expanded in Figure 3

FIGURE 1.-Map of a portion of the mf locus. A restriction map is shown for portions of segment 3 and 4 and the intervening DNA found in the mt- locus R domain; the map scale is as defined in FERRIS and GOODENOUGH (1994). The location of the mid gene is indicated. Below the restriction map, the locations of hybridization probes A-F are marked, as well as the extent of the mt- locus duplicated in strain CC421 and the locations of the DNA fragments cloned into plasmids pMid12.5 and pMid7.1. Key to the restriction enzymes: B, BamHI; E, EcoRI; H, HindIII; Sa, SulI; X, XhoI.

currently in CG350, the minus parent of CC-421, but is in CC-421 and a progeny strain of CC-421, suggesting that the 421 element arose at the time CC-421 was constructed in 1977 (details are given in MATERIALS AND

METHODS).

Not only has a 23-kb portion of the CC-421 mt- locus been copied and transposed, it has also undergone en- doduplication. The two XhoI junction fragments show a much stronger hybridization signal than their single- copy counterparts in LGVI (Figure 2, b and c), strongly suggesting that the 421 element exists as a tandemly duplicated array that behaves as a single locus in genetic crosses. Further molecular characterization of the element is in progress.

The 421 element is unstable: Meiotic progeny car- rymg the 421 element and either mt" or imp11 mtf on LGVI prove to display mating-type instability. When such "extra" minus clones are propagated vegetatively and then induced to undergo gametogenesis, a subpop- ulation of cells is found to be agglutinating as plus (and succeeds or fails to fuse depending on its f u s l endow- ment). The extent of this instability is highly variable: some strains throw off very few plus gametes and most of the cells have remained minus after 2.5 years in culture; others convert entirely to the plus phenotype after only a few transfers.

Molecular studies were performed to ascertain whether the mid function of the 421 element was being lost or suppressed during this process. A progeny clone

(C12) containing a mixture of plus and minus cells was subcloned for single colonies. Two types of subclones emerged, some that were mixtures of plus and minus cells and some that were pure plus, suggesting that the plus condition is stable. Genomic DNA was prepared from two such subclones, one containing mostly minus gametes and another that was pure plus. As shown in Figure 2d, when hybridized with probe B, the XhoI fragment specific to the 421 element has been lost in the plus subclone, indicating that the instability results from physical loss of the 421 element sequences, and ex- plaining why the plus state is stable.

Localization of the mid gene: The sequences that comprise the 421 element include portions of segments 3 and 4, found in both the mti and mt- R domains, and roughly 10 kb of intersegment DNA, much of which is repeated elsewhere in the genome (hybridizing to multiple fragments when used as probes for Southern blots). However, short, unique-sequence, minu5specific probes were detected at one end of the intersegment, which we have labeled region f in keeping with previous nomenclature (FERRIS and GOODENOUCH 1994). Co- transformation was used to localize the mid gene within these sequences: nic7 mt" cells (CC-85) were cotrans- formed with the nic? gene (pNic7.9; FERRIS 1995) and various plasmids or isolated restriction fragments from region j and nicotinamide-independent (3-acetylpyridine-resistant) transformants were tested for their mating phenotype. Plasmid pMid12.5, which contains the


3- z n

mt, ele

C

m c u d -

0 0 k

mt

ele

b

m 0

Q 2 3- z 0 Q

2 I z

d I z h h

.I F mt ele

FIGURE 2.-Delimiting the 421 element. (a) A Southern blot made using Smddigested genomic DNA from the indicated strains was hybridized with probe C. A 1.2-kb fragment is present in both the mt- locus (labeled mt) and in the 421 element (labeled ele). The probe does not hybridize to mt+. The impll mt- ele strain is the progeny called A6 from the cross impll mf-

f u s l + T X CC421 (Table 1A). Prog 1 and prog 2 are mt+ ele progeny from CC-85 X A6 (Table 1B). (b) A Southern blot made using Xhddigested genomic DNA from the indicated strains was hybridized with probe B. A 2.3kb fragment is present in both mt loci and a 1.9-kb fragment only in strains carrying the 421 element. Prog 3 is a mt' ele progeny from CC-85 X A16 and prog 4 is a mt+ ele progeny from CC85 X C12 (Table 1B). (c) A Southern blot made using Xhddigested genomic DNA from the indicated strains was hybridized with probe D. A 4.1-kb fragment is present in the mt+ locus, a 4.0-kb fragment in the m f locus and a 2.1-kb fragment only in strains carrying the 421 element. (d) A Southern blot cut and probed as in b is shown. C12 minus is a subclone of the impll mt- ele progeny C12 that predominantly contains cells mating as minus; C12 plus is a subclone that contains only cells mating as plus.

entire intersegment (Figure l ) , yielded cotransformants that mate as minus; subsequent transformations with smaller restriction fragments derived from pMid12.5 or pMid7.1 localized the gene further (Figure 3). The transformation results suggest that mid lies between the NruI and XhoI sites; further analysis showed that the XhoI site is just 7 bp beyond the mid stop codon, meaning that successful transformation can be achieved even with fragments that lack the normal 3' UTR.

Cotransformation frequencies with mid are consis-

tently poor: only -10% of the Nic+ colonies show any minus phenotype. Moreover, most of the 10% display only a partially transformed phenotype (the transformed clone contains a mixture of plus and minus cells), and only a small number of the cotransformants exhibit a 100% minus phenotype. The partial phenotypes could represent unstable integrations of the mid transgenes and/or their suboptimal expression; this has not yet been analyzed.

mt+ cells successfully transformed with the EcoRI/


e.:..:..: .. :..:..:..:..:..:..: ..:.. :..:..:..:..: .. ........................................................................................................... pMid7.1 - probe G

+- telomere mid transcript - 1 kb

E H Sc B sa H M Sc C Sa M S a P I I I I I I I I I I I ?I

I I I I I I I I I h vsm Sm Sm SmSt N X Sm NN -

probe C probe F

EcoRVXhol (2/9)

EcoRIIStul (0/59)

EcoRIINmI (0/26)

SacVSad (0/42)

EcoRVIXhol (1/17)

HindllllHindlll (2/16)

ApaVqOal (2/19)

Hind1 I IIXhol (1 /6)

ClaVMfel (9/69)

NmVNnrl(2/56)

FIGURE 3.-Detailed restriction map around the mad gene. Above the map the mid transcript is depicted, with transcription proceeding from left to right. The four exons are shown as blocks; the thin lines represent introns and UT&. The DNA cloned into pMid7.1 is indicated at the top of the figure. The locations of probes C and F (derived from genomic DNA clones) and probe G (derived from a cDNA clone) are indicated. The positions of 10 restriction fragments used in attempts to cotransform nic7 mt+ cells to minus are indicated. The number of cotransformants with at least a partial minus phenotype out of the total number of Nic+ transformants is indicated to the right of each fragment. The Hind111 site at the right end of the HindIII/ Hind111 fragment is in the pUCl3 polylinker. The restriction site key is as in Figure 1, with the following additions: C, CluI; M, MfeI; N, NruI; P, PstI; Sc, Sad; Sm, SmuI; St, StuI; V, EcoRV.

XhoI, ApuI/ApuI, and CZuI/MfiI fragments (Figure 3) and exhibiting a 100% minus phenotype were mated to wild-type mt+ and found to be capable of forming viable meiotic zygotes. The efficiency of gametic fusion in these crosses is reduced compared to a wild-type mating.

Characterization of the mid gene: Guided by the transformation results, probe F was used to screen a cDNA library. Five different cDNAs were recovered, named cDNAl, 11, 12, 16, and 31. The complete sequence was determined for cDNAl, and partial sequence from the others. These sequences were compared with the genomic sequence (Genbank accession U92071), which was determined for 2579 bp from the StuI site to the rightmost SUA site (Figure 3).

Northern blot analysis of polyA’ RNA from mtC gametes (Figure 4) indicates that the mid mRNA is 1.1 - 1.2 kb in length. The 5’-most cDNA is 16, which starts at 645 (numbering from the StuI site). At the 3‘ end,

although all five of the cDNAs contain a polyA tail, they terminate at several different sites. Three of the five terminate at close to the same position (Figure 5 ) ; cDNAl1 is -125 bp shorter, and cDNAl is -60 bp longer. This is consistent with the Northern blot analysis (Figure 4): the band visualized by the mid cDNA probe is broader than the band visualized by a control cDNA with a similar-sized message. These numbers suggest that cDNAl6 may be close to full length.

Most Chlamydomonas mRNAs have the sequence TGTAA within 14-17 bp of the polyA tail. None of the mid cDNAs have an exact match to this sequence, although four of the five match it in four of the five bases (underlined in Figure 5 ) . In fact, the sequence TGTAA occurs only once in the genomic mid sequence, at 2445 bp, well beyond the ends of these cDNAs. Pre- sumably in the absence of an exact match to the polyadenylation signal, several less ideal sequences are used.

The gene contains three introns of unusually small

G V I

mid

204

Ft(;t'Rt. 4.-Transcripti011~11 rcgrdation of mid. PolyAi\' RNA I'rorn cithcl- \cgc*t;rtiw (1') o r gametic (G) cells o f m / strain (K-6!!l \vas c.lcctrophorcscr1 on a fo~-rn;lldehydc agarose gel, tl.;lnsfcwwl t o 21 nylon nlcnl lx~nc and hyhridizecl with probe G (I; lhclcrl jni(4. As ;I control, the same blot was suhsrquently rchyl~ridizcd \vith cDNA 204 thi1t is rxprcssed constitrlti\dy (FERRIS ;Ind < ; o o ~ ) t . s o r x ; t I 1 9 X i ) .

size. In order, 5' t o 3'. the introns are 63, 58 and 57 bp. The second intron has an atypical GC at the 5' end, rather than the usual GT. cDNAl 1 is derived from a partially spliced message and still contains the first and third introns; processing is complete in the other four cDNAs.

The coding region o f the m,id gene is predicted to be the opcm rcading frame that begins at nucleotide 67.5 antl encodes 147 amino acids (Figure 6a) with a calcu- lated pl of 8.7 and a predicted molecular weight of Ifi,300. N o significant homologues to the mid protein were noted in a search o f available databases using the NCRI RIAST program; in particular, no consetwd DNA binding motifs (homeobox, HMG, etc.) were detected. A putative leucine zipper motif (L.ANI)S<:I-IUIZ P/

crl. 1989) occurs near the Gterminus: V109, L116, 1,123 and L,I.CSO (underlined) are found in a domain strongly predicted ( R o s r and S,\SIII-K 1994) to adopt an a-heli- cal configuration. The Gterminus itself is rich in basic amino acids, consistent with the possibility that the domain rcprcsents a basic region leucine zipper (bZIP) motif (TL'KNI-K and TIln 1989). Alternatively, the C- terminus may carry a nrlclear localization signal [the minimal consensus being four basic amino acids in an eight-amino acid span (SIL.\'I<K 1991)].

The sequence composition of the mid gene is quite unusual. The coding region is only 50% GC, and 5' and 3' noncoding and flanking sequences are 5.5% GC (Table 2). Both are lower than the genome average o f -62% ( HAKKIS 1989). Moreover, mid displays very low codon bias, generating a very low B value ( R = 0.161), where a 13 value o f 0 indicates that all synonymous co- dons are used with equal frequency and a value o f 1 indicates that only one codon is used for each amino acid ( 1 ~ ) s ~ ; antl GII.I.I-SPII< 1991). In contrast, codon usage in > 100 other C. rrinhnrdlii nuclear gene sequences is very biased (L1mzEr and PIPIXNO 199.5), with a median 11 value o f 0.617 (see FI-KKIS PI (11. 1996, Figure 9). Several other genes linked to m t and under

1685 I

cgcattgtgttgtgaacacgaggttgggac - polyA cDNAll

1809 I

atggcccgagcggtttaataaaataaaatg - polyA cDNA12.31

1810 I

tggcccgaycggtttaataaaataaaatgc - polyA cDNA16

1869

gacctcaaaaacgcaaaaacgcaaaccacr!! - polyA cDNAl

FI(X.RI< .~.-Pol!adenyl;ltion sites in mid cDNAs. Thc DX.1 sequence at thc point ofpolyA addition is depicted for the five midcDNAs. A putative polyclenylation signal is underlincd in cach case.

tight recombinational suppression display the usual codon bias (FERKIS d al. 1996), indicating that the lack of bias i n mid is not obviorlslv caused by the absence of recombination.

To investigate the control of mid gene expression, a Northern blot \vas prepared using polVA' gametic and vegetative RNA and hybridized with a mid cDNA probe or with cDNA 204, a probe derived from a constitutively expressed gene (Figure 4). Although low-level expression of mid during vegetative growth cannot be ruled out, there is clearly a strong upregtllation of midexpres- sion in the min?ls gametes.

imp11 is a mutation in the mid gene: The m--linked imp11 mutation has been proposed to result from a loss- of-function mutation in the mid gene (GOOIIENOLKH and FI-RKIS 198i). I t has been shown in diploids that the imp11 mutation is recessive to the wild-type m- locus (G..\I.I.~wAY and G~OIIENOUC;H 1985). Because of the extensive recombination suppression around ml, the fact that both midand imjll I are tightly linked to the m/- locus is inadequate proof of their identity. Several experiments were therefore performed to document that i m p 1 1 is due to a mutation in mid.

A plasmid equivalent to pMidi.1 was constructed using genomic DNA from an imp11 strain (see ~ \ T E K I ~ I . S /\SI) METHODS). "hen the wild-type and imp1 I plasmids were compared using more than SO restriction enzymes, no differences in restriction sites or fragment sizes were detected. The imp11 plasmid was next sequenced from -200 bp upstream of the ATG to roughly 500 hp be- vond the stop codon. When compared to wild type, two nucleotide changes were noted, both in the coding region (Figure 6h): the transition at bp 1164 creates a synonymous substitution, antl the transversion at 11 (56 creates an amino-acid substitution, lysine + isoleucine, in the domain carrying the putative leucine zipper. The changes also create an MSPI site (MsrI was not used in the original mapping) in imp1 1. RT-PCR of polvA" RNA purified from imp1 I gametes yielded a fragment that, when sequenced, demonstrated that a properly spliced


a

1 MACFLARFQF ISPDSPATKA VTLQIKRSGQ DMYACITGHS YSAPVFTVEC

51 KLKPDAEWVR WMASFIWQM EAEGFLLNEG TSESTLPAQP AKKADLTLHD

1 0 1 ISmFHLPm W C W S Q rTYycRRL G I D R w Y m A-

b

T Y L @ I L acg tac t t g aaa a t t c t a wild type

1160

T Y L @ I L a c g t a c t t ( L t a a t t c t a impll

Msel

FIGURE 6."Sequence of the Mid protein. (a) The 147- amino acid coding region predicted from the mid cDNA sequence is shown. Four amino acids that could comprise a leucine zipper are highlighted. The boxed section is expanded in b. (h) Comparison of the sequence of the mid gene in wild type and in the impl 1 mutant reveals two nearby nucleotide changes (hold). These substitutions result in a change in the amino acid sequence (circled), and create an MseI site in impll.

message containing the mutant sequence is being expressed. These data are consistent with the imp11 phenotype being the result of a single missense mutation in mid, but do not rule out the possibility that the change could represent a fortuitous strain difference.

The crosses described earlier indicate that a gene or genes within the 421 element are able to complement imp1 1. To prove that mid is that gene, a wild-type mid transgene was introduced into an imp11 strain by a genetic cross (available impl l strains cannot easily be used for transformation since they lack selectable markers). A nicy impll mt- fusIiT strain was crossed to a nic7 mt' strain transformed to minus with the 3.5-kb ApuI/ ApuI fragment (Figure 3). A number of Nic' (hence impll) progeny displayed a minus phenotype, presumably the result of their inheriting the mid transgene (which is unlinked to mt), indicating that mid is sufficient to complement impl 1. Genomic DNA was prepared from two of the imp11 strains that mate as minus and digested with MseI (to detect the imp1 1 RFLP) . The resultant Southern blot demonstrates that these two strains contain both an impl I version of mid (presumably at the mt locus) and a wild-type version (the transgene) (Figure 7). Unlike the mt" strains carrying a mid transgene, the complemented imp11 strains mate as efficiently as wild-type mt- strains.

Finally, we tested whether the impl 1 copy of mid was indeed nonfunctional, in which case it would fail to transform mt+ cells to minus. Two plasmids were constructed, one using wild-type DNA and the other impl 1, by ligating the 3.0-kb MfeI fragment containing the mid

TABLE 2

Percentage of GC in the mid gene

Segment Sequence length (hp) Percentage GC

5' upstream" 674 56.5 Coding region 444 50.5 Intron 1 63 48 Intron 2 58 47 Intron 3 57 56

Downstream' 710 55.2 3' UTR' 573 55.0

From the StuI site to the initiating AUG. 3' UTR of cDNAl.

"From the 3' end of cDNAl to the SUA site ending the sequenced region.

gene into the EcoFU site (which is in the polylinker of the plasmid vector) of pThi4.9, which contains the th i lp gene (FERRIS 1995). These two plasmids (pre- sumed identical except for the changes in the mid coding region) were used to transform CC-123 (thilO mt'). Thi+ transformants were picked and their mating phenotype tested. Of the 45 prototrophs analyzed from the wt-mid transformation experiment, 16 displayed at least a partial minus phenotype. In contrast, none of the 44 prototrophs analyzed from the impl I-mid transformation displayed any minus phenotype. Seven out of 10 impl I-mid transformants, analyzed in a PCR-based assay, contained mid DNA, confirming that imp1 I-mid sequences were stably integrated in these strains but were incapable of initiating a minus gametogenesis program.

In summary, this series of experiments indicates that the imp1 I phenotype is the result of a single missense mutation in the mid gene. We propose, therefore, that the imp11 mutant allele be designated as mid-I.

DISCUSSION

Sex determination in C. reinhardtii: This report documents that region f of the mt- locus R domain carries the mid gene that is necessary and sufficient to convert a plus cell into a minus cell. This means that all the essential genes that encode minusspecific gametic traits are carried by both mt+ and mt- haploid cells, that is, they can be considered "autosomal," and their expression is induced, either directly or via some mid-dependent cascade, by the mid gene product.

When the mid gene is inactivated by the impl I mutation to create the mid-I allele, minus-specific traits are not expressed and plusspecific traits are expressed (the exception being the fringe-dependent fusion trait encoded by the mt+ locus, which is physically absent from mt- cells). This means that the expression of plus-specific genes is repressed, either directly or via some mid- dependent cascade, by the mid gene product. Since the only mti locus-encoded gene required for a mid-1 strain

I s 0 0 Q I

+ s 0

0

* 0

FKXIW i.”h wid transgrnc ~ C S C I I C S ilnpl I. The indicated strains ~ w r e tligcwed with Mwl, and the resulting Southern b l o t hylxitlizcd with p r o h c (;. m l ’ docs n o t hybridize t o the prohr. Both wiltl-rypc and imp1 I contain an ~Msrl fmgmcnt o f 400 hp (:@). The fragment o l ‘ 900 hp in wild-type (0) is repl;lccd by t w o fragments in the i 1 ~ p I 1 mutant (0). The two Nic’ m i n r r s strains (prog a, prog b) are s h o w n t o be irn/1ll stlains cm+lg a wild-type 1 n d transgene.

to complete the life cycle as a / ) /us gamete is the structural ,fusl gene, it appears that there are no other indis- pensable structural or regulatory genes required for mating in the mt’ l o c ~ ~ s .

Sex determination in C. rrinhnrdlii is therefore very straightfonvard (Figure 8) : the presence of mid renders a cell minus; the absence of m i d renders a cell p l z w . The Mid protein may well interact with other gene products to effect this result: if its putative leucine zipper motif is in fact a determinant of its function, i t may hetero- dimerize with (other) DNA binding protein(s) (Ho rl nl. 1994; C ; I . ~ \ T R and HARRISOX 199.5), proteins that would presumably be present in both plus and minus cells. The postulated Mid coeffectors may play other roles in gene expression when Mid is absent, as is the case in yeast (HI<RSKO\VITZ PI crl. 1992).

A candidate Mid coeffector is the isol gene product. Strains carrying the autosomal mutation is01 display no mutant phenotype in a rnl+ background, but generate both minus and pseudo-plus gametes in a m - background, meaning that their capacity t o express the minus gametogenesis program is adequate in some cells and below threshold in others (CAMPRIXI, PI a/. 1995), a phenotype also ohsenred in many of the mid transformants.

Although there may be a very low level of mid gene expression in vegetative cells, the message level is clearly much higher in gametic cells (Figure 4), suggesting that midgene transcription or message stability is responsive, either directly or via intermediate effectors, to nitrogen stawation. A similar nitrogen-sensiti\.e pattern of expression has been documented for the mating-type regulatory gencs o f Scl~izartrrrhnlnrn~rr.~ pornhr (KEI.I.Y PI al. 1988).

minus cell

mid . as minus

plus cell t mating

as plus

heterozygous diploid

mid . mt’ locus

mt+locus

as minus

FKX~RF. 8.-Model for control of mating type. In m i n u s cells, the protein product of the mid gene is postrllatcd t o act to activate genes involved in minzr.cspecific lilnctions (msg), and repress those involved in pIm-specific functions (psg). In /hs cells, in the absence of mid, the msg’s are not actiratetl and the psg’s are postulated to he trmscrihed constitutively. In hetel-ozvgous diploids, only the m/- locus contributes a regulatory function ( i .e. , mid), so that mating type is regulated ;IS in the haploid minfts cell.

The 421 element: Our identification of the mid gene was greatly aided by the fortuitous discovery ofa translo- cated copy of mid and i t s flanking sequences i n the CC-421 strain. Several transposable elements have been characterized in C. rriinhard/ii (DAY P/ nl. 1988; FERRIS 1989; GRAHAM P I nl. 1995; FICRRIS P/ nl. 1W6), but this is the first reported case wherein a genomic sequence has acquired several of the properties o f a transposon. The original sequence has remained in place; the new sequence has endoreplicated, undergone tandem reit- eration, and inserted into a new, unlinked location, presumably an autosome; and the new sequence is 1111-

stable, being lost in new genetic backgrounds at variable rates. Nothing is yet known about how the loss occurs, but since the haploid cells remain fully viable after the element has been lost, i t presumably entails a local exci- sion event and not, for example, a complete loss of the translocation-carnring chromosome.

Two cases are known in which sex elements display


motile properties. In the homothallic yeasts, mating- type sequences are copied and transferred in an orderly fashion from one of the silent casettes to an expressed locus (GUTZ and SCHMIDT 1990). In certain Dipteran insects, a male-determining M factor moves, with high frequency, from one chromosome to another in an apparently random fashion, converting autosomes to sex chromosomes in the process (DUBENDOWER et al. 1992). The behavior of the 421 element is clearly different from either of these, but it raises the intriguing possibility that sex-determining genes may possess, or acquire, the capacity to establish new chromosomal locations even when this trait is only very rarely mani- fested in the lineage. Inherent in this speculation is the possibility that, given time, a novel mt locus could be established during the course of Chlamydomonas speciation.

During the course of these experiments we have encountered two kinds of homothallism (i.e., clones that are able to self-mate to form viable zygotes that undergo an apparently normal meiosis) in a species that is normally obligately heterothallic. (1) As strains that are mt+ ele lose the element, they become a mixture of interfer- tile plus and minus cells. The plus cells are not capable of further mating-type switching and so cannot form new homothallic clones, but the minus cells are poten- tially capable of continued homothallism. (2) Many of the mt' cells transformed with the mid gene produce clones containing cells mating as plus and minus. Assum- ing that this phenomenon is due to variable levels of mid gene expression, it could generate a heritable homothallic state.

If either of these types of homothallism were regular- ized by additional mutations, a species could quickly change from a heterothallic to a homothallic lineage. The volvocine algae in fact include both homothallic and heterothallic species throughout the Order (reviewed in GOODENOUGH et al. 1995), indicating that these transitions have been common during the evolu- tion of the group.

Unusual properties of the mid gene: In a previous study we report that the fusl gene has three properties that distinguish it from the rest of the genes characterized in C. reinhardtii: it carries a high density of very small introns, it lacks a stringent 3'-polyadenylation signal and is therefore polyadenylated at multiple positions, and it lacks any codon bias (FERRIS et al. 1996). These same three properties are found in the mid gene, and although the absence of codon bias is less extreme in mid ( B = 0.161) than infusl ( B = 0.050), this may result from the fact that mid is a small gene and hence less likely than fusl to yield a random pattern. Impor- tantly, these properties do not characterize ayl or ay2, genes located just outside the R domain of the mt loci and expressed early in zygote development, nor do they characterize several other genes expressed exclusively

in the zygote (WOESSNER and GOODENOUGH 1989; MAT- TERS and GOODENOUCH 1992; J. P. WOESSNER and U. W. GOODENOUGH, unpublished observations). Therefore, these properties do not correlate with the suppression of recombination that characterizes mt-linked genes (FERRIS et al. 1996), nor do they correlate with being transcribed/translated under nitrogen-starved conditions (the nutritional state of both gametes and zygotes). Instead, they correlate with being located in the R domain of the mt locus and/or being hemizygous in zygotes.

The very low codon bias in these genes is particularly dramatic, and extends also to their introns and flanking sequences that are at most 55% GC in the two R-domain genes (FERRIS et al. 1996 and present study) as compared to the genome average of 62% (HARIUS 1989). Of the several possible interpretations for such data discussed in FERRIS et al. (1996), we currently favor the notion that since the R domain has clearly undergone large numbers of chromosomal rearrangements, mutations may have accumulated as well at the level of nucleotide composition and hence sequence. The factors that drive and/or select for such an accumulation of mutations may participate in the process of speciation.

We thank Dr. MICHEL LEDIZET (University of California, San Fran- cisco) for the &value calculations and discussions about codon bias, and Mr. WILLIAM SWANSON (University of California, San Diego) for the computer analysis of Mid predicted secondary structure. Dr. EI~IZ- BETH HARRIS (Chlamydomonas Genetics Center) helped us sort out C. reinhardtii genealogy. LINDA Shw1.1. and AMY FEARNCOMBE provided technical assistance, and we thank members of the laboratory for comments on the manuscript. This research was funded by National Science Foundation grant MCB-9218817.

LITERATURE CITED

ARIVIBRUST, E. V., P. J. FERRIS and U. W. GOODENOUCH, 1993 A mating type-linked gene cluster expressed in Chlamydomonas zygotes participates in uniparental inheritance of the chloroplast genome. Cell 74: 801-811.

BECK, C. F., and M. A. HARING, 1996 Gametic differentiation in Chla- mydomonas. Int. Rev. Cytol. 168: 259-302.

CAMPBELL, A. M., H. J. RAYALA and U. W. GOODENOUGH, 1995 The isol gene of Chlamydomonas is involved in sex determination. Mol. Biol. Cell 6: 87-95.

DAY, A., M. SCHIRMER-RAHIRE, M. R. KUCHKA, S. P. MAYFIELD and J.-D. ROCHAIX, 1988 A transposon with an unusual arrange- ment of long terminal repeats in the green alga Chlamydomonas reinhardtii. EMBO J. 7: 1917-1927.

DUBENDOWER, A,, D. HILFIKER-KLEINER and R. NOTHIGER, 1992 Sex determination mechanisms in dipteran insects: the case of Musca domstica. Semin. Dev. Biol. 3: 349-356.

EBERSOLD, W. T., 1967 Chlamydomonas reinhardi: heterozygous diploid strains. Science 157: 447-449.

FERRIS, P. J., 1989 Characterization of a Chlamydomonas transposon, Culliver, resembling those in higher plants. Genetics 1 2 2 363- 377.

FERRIS, P. J., 1995 Localization of the nic-7, ac-29 and thz-10 genes within the mating-type locus of Chlamydomonas reinhardtii. Genet- ics 141: 543-549.

FERRIS, P. J., and U. W. GOODENOUCH, 1987 Transcription of novel genes, including a gene linked to the mating-type locus, induced by Chlamydomonas fertilization. Mol. Cell. Biol. 7: 2360-2366.

FERRIS, P. J., and U. W. GOODENOUGH, 1994 The mating type locus


of Chlamydomonas reinhardtii contains highly rearranged DNA sequences. Cell 76: 1135- 1145.

FERRIS, P. J., J. P. WOESSNER and U. W. GOODENOUCH, 1996 A sex recognition glycoprotein is encoded by the plus mating-type gene f u s l of Chlamydomonas reinhardtii. Mol. Biol. Cell 7: 1235-1248.

GALLOWAY, R. E., and U. W. GOODENOUGH, 1985 Genetic analysis of mating locus linked mutations in Chlamydomonas reinhardtii. Genetics 111: 447-461.

GLOVER, J. N. M., and S. C. HARRISON, 1995 Crystal structure of the heterodimeric bZIP transcription factor c-Fos-c-Jun bound to DNA. Nature 373 257-261.

GOODENOUCH, U. W., 1991 Chlamydomonas mating interactions, pp. 71 -1 12 in Microbial Cell-Cell Interactions, edited by M. DWORKIN. American Society for Microbiology, Washington, DC.

GOODENOUCH, U. W., and P. J. FERRIS, 1987 Genetic regulation of development in Chlamydomonas, pp. 171 -189 in GeneticRegulation of Development, edited by W. LOOMIS. Alan R. Liss, New York.

GOODENOUGH, U. W., P. A. DETMERS and C. HWANG, 1982 Activa- tion for cell fusion in Chlamydomonas: analysis of wild-type gametes and non-fusing mutants. J. Cell Biol. 9 2 378-386.

GOODENOUCH, U. W., E. V. ARMBRUST, A. M. CAMPBELL and P. J. FERRIS, 1995 Molecular genetics of sexuality in Chlamydomonas. Annu. Rev. Plant Physiol. Plant Mol. Biol. 4 6 21-44.

G m , J. E., J. G. SPANIER and J. W. JARVIK, 1995 Isolation and characterization of Pioneerl, a novel Chlamydomonas transposable element. Curr. Genet. 28: 429-436.

GUMPEL, N. J., and S. PURTON, 1994 Playing tag with Chlamydomonas. Trends Cell Biol. 4: 299-301.

GUTZ, H.. and H. SCHMIDT, 1990 The genetic basis of homothallism and heterothallism in Saccharomyces cerevisiae and Schizosaccharw mycespombe. Semin. Dev. Biol. 1: 169-176.

HARRIS, E. H., 1989 The Chlamydomonas Sourcebook. Academic Press, San Diego.

HERSKOWITZ, I., J. RINE and J. STRATHEW, 1992 Mating-type determination and mating-type interconversion in Saccharomyces cereuis- iae, pp. 583-656 in The Molecular and Cellular Biology of the Yeast Saccharomyces: Gent Expression, edited by J. R. BROACH, J. R. PRIN- GLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Ho, C.-Y., J. G. ADAMSON, R. S. HODGES and M. SMITH, 1994 Hetero- dimerization of the yeast MATal and MATa2 proteins is medi- ated by two leucine zipper-like coiled-coil motifs. EMBO J. 13: 1403-1413.

KELLY, M., J. BURKE, M. SMITH, A. KLAR and D. BEACH, 1988 Four mating-type genes control sexual differentiation in the fission yeast. EMBO J. 7: 1537-1547.

KINDLE, K. L., 1990 High-frequency nuclear transformation of Chla- mydomonas reinhardtii. Proc. Natl. Acad. Sci. USA 87: 1228-1232.

LANDSCHULZ, W., P. JOHNSON and S. MCKNIGHT, 1989 The DNA binding domain of the rat liver nuclear protein C/EBP is bipar- tite. Science 243: 1681-1688.

LEDIZET, M., and G. PIPERNO, 1995 The light chain p28 associates with a subset of inner dynein arm heavy chains in Chlamydomonas axonemes. Mol. Biol. Cell 6: 697-711.

LONG, M., and J. H. GILLESPIE, 1991 Codon usage divergence of homologous vertebrate genes and codon usage clock. J. Mol.

MANIATIS, T., E. F. FRITSCH and J. SAMBROOK, 1982 Molecular Clun- ing: A Laboratoly Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

MATTERS, G. L., and U. W. GOODENOUGH, 1992 A gene/pseu- dogene tandem duplication encodes a cysteine-rich protein expressed during zygote development in Chlamydomonas reinhardtii. Mol. Gen. Genet. 232 81-88.

ROST, B., and C. SANDER, 1994 Combining evolutionary information and neuronal networks to predict protein secondary structure. Proteins 19: 55-72.

SAGER, R., and S. GRANICK, 1954 Nutritional control of sexuality in Chlamydomonas reinhardi. J. Gen. Physiol. 37: 729-742.

SILVER, P. A,, 1991 How proteins enter the nucleus. Cell 64: 489- 497.

SMITH, G. M., and D. C. REGNERY, 1950 Inheritance of sexuality in Chlamydomonas reinhardi. Proc. Natl. Acad. Sci. USA 36: 246-248.

SWH, R. D., G. W. MARTINEK and W. T. EBERSOLD, 1975 Linkage of six genes in Chlamydomonas reinhardtii and the construction of linkage test strains. J. Bacteriol. 124: 1615-1617.

TURNER, R., and R. TIJAN, 1989 Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos- cJun heterodimers. Science 243: 1689-1694.

WERNER, M. H., J. R. HUTH, A. M. GRONENBORN and G. M. CLORE, 1995 Molecular basis of human 46XY sex reversal revealed from the three-dimensional solution structure of the human SRY- DNA complex. Cell 81: 705-714.

WOESSNER, J. P., and U. W. GOODENOUCH, 1989 Molecular characterization of a zygote wall protein: an extensin-like molecule in Chlamydomonas reinhardtii. Plant Cell 1: 901-911.

EvoI. 32: 6-15.

Communicating editor: S. L. ALLEN

in is specified by mid, the minus-dominance gene · strain is chromosomally mt- but carries an...

Documents