information theory of dna sequencing
DESCRIPTION
Information Theory of DNA Sequencing. David Tse Dept. of EECS U.C. Berkeley ITA 2012 Feb. 10 Research supported by NSF Center for Science of Information. Abolfazl Motahari. Guy Bresler. TexPoint fonts used in EMF: A A A A A A A A A A A A A A A A. DNA sequencing. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/1.jpg)
Information Theory of DNA Sequencing
David Tse Dept. of EECSU.C. Berkeley
ITA 2012Feb. 10
Research supported by NSF Center for Science of Information.
Guy BreslerAbolfazl Motahari
![Page 2: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/2.jpg)
DNA sequencing
DNA: the blueprint of life
Problem: to obtain the sequence of nucleotides.
…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…
![Page 3: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/3.jpg)
Impetus: Human Genome Project
1990: Start
2001: Draft
2003: Finished3 billion basepairs
$3 billion
![Page 4: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/4.jpg)
Sequencing Gets Cheaper and Faster
Cost of one human genome• HGP: $ 3 billion• 2004: $30,000,000• 2008: $100,000• 2010: $10,000• 2011: $4,000 • 2012-13: $1,000• ???: $300
Time to sequence one genome: years/months hours/days
Massive parallelization.
![Page 5: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/5.jpg)
But many genomes to sequence
100 million species(e.g. phylogeny)
7 billion individuals (SNP, personal genomics)
1013 cells in a human(e.g. somatic mutations
such as HIV, cancer)
![Page 6: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/6.jpg)
Whole Genome Shotgun Sequencing
Reads are assembled to reconstruct the original DNA sequence.
![Page 7: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/7.jpg)
A Gigantic Jigsaw Puzzle
![Page 8: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/8.jpg)
Computation versus Information View
• Many proposed assembly algorithms for many sequencing technologies.
• But what is the minimum number of reads required for reliable reconstruction?
• How much intrinsic information does each read provide about the DNA sequence?
• This depends on the sequencing technology but not on the assembly algorithm.
![Page 9: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/9.jpg)
Communication and Sequencing: An Analogy
Communication:
Sequencing:
Question: what is the max. sequencing rate such that reliable reconstruction is possible?
sourcesequence
S1;S2; : : : ;SG R 1;R 2; : : : ;R N
max. communication rate = CchannelHsource source sym / sec.
sequencing rate GN DNA sym / read
![Page 10: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/10.jpg)
The read channel
• Capacity depends on
– read length: L
– DNA length: G
• Normalized read length:
• Eg. L = 100, G = 3 £ 109 :
read channelAGCTTATAGGTCCGCATTACC AGGTCC
¹L := LlogG
L ") C "
G ") C #
¹L = 4:6
![Page 11: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/11.jpg)
Result: Sequencing Capacity
H2( p) is (Renyi) entropy rate of the DNA sequence:
The higher the entropy, the easier the problem!
C = 0
C = ¹L
no coverage(Lander-Waterman 88)
duplication(Arratia et al 96)
L L LLH2 = lim
`! 11` logP(X
` = Y `)
greedyalgorithm
![Page 12: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/12.jpg)
Complexity is in the eyes of the beholder
Low entropy High entropy
harder to communicate
easier jigsaw puzzle harder jigsaw puzzle
easier to communicate
![Page 13: Information Theory of DNA Sequencing](https://reader036.vdocument.in/reader036/viewer/2022081511/568164c9550346895dd6e397/html5/thumbnails/13.jpg)
Conclusion
• DNA sequencing is an important problem.
• Many new technologies and new applications.
• An analogy between sequencing and communication is drawn.
• A notion of sequencing capacity is formulated.
• A principled design framework?