CHAPTER-3

Materials

&

Methods

3. Materials and Methods

Table-10: Sources of various chemicals employed are the following:

Chemicals Company

2- Mercaptoethanol Sisco Research Laboratories, India

Acrylamid/bis-Acrylamid Sisco Research Laboratories, India

Agarose for gel electrophoresis Sigma, USA

AgNO3 Sisco Research Laboratories, India

Amino allyl dUTP Sigma, USA

Ammoniumpersulfate (APS) Sisco Research Laboratories, India

Ampicillin (100mg/ml in dH2O, stored at -20°C) Sigma, USA

Bacto-Agar Himedia, India

Bacto-Trypton Himedia, India

Boric acid Sisco Research Laboratories, India

Bovine Serum Albumin Himedia, India

Bromphenolblue Sisco Research Laboratories, India

Bromphenol-blue Sisco Research Laboratories, India

Chloroform Merck, India

Cot-1 DNA Invitrogen, USA

Cydye GE Health care, USA

Diethylpyrocarbonate (DEPC) Sigma USA

Dimethysulfoxide 1 Sigma USA

Di-Sodiumhydrogenphosphate-Dihydrate Sisco Research Laboratories, India

dNTPs Labovera, Germany

DTT (DL-Dithiothreitol) Sigma USA

EDTA Sisco Research Laboratories, India

Ethanol Sisco Research Laboratories, India

Ethidium Bromide Sigma USA

Formamide Sigma, USA

Formaldehyde Sisco Research Laboratories, India

Glycerol Merck, India

Glycine Sisco Research Laboratories, India

Glycogen Sigma, USA

HCl Merck, India

HEPES Sisco Research Laboratories, India

Hydroxylamine hydrochloride Sigma, USA

Isoamylalcohol (3-methyl-1-butanol) Merck, India

Isopropanol (2-propanol) Merck, India

Magnesiumchloride-hexahydrate Sigma, USA

Methanol Merck, India

Mineral oil Sigma, USA

NaOH Sisco Research Laboratories, India

Phenol Merck, India

Proteinase- K Sigma, USA

RNAase Sigma, USA

Salmen Sperm DNA Invitrogen, USA

Sodium chloride Sisco Research Laboratories, India

Sodiumdodecylsulfate (SDS) Sigma, USA

TEMED Sisco Research Laboratories, India

Tris (Tri(hydroxymethyl)aminoethane) Sisco Research Laboratories, India

TRIzol Reagent Invitrogen

Trypsin Himedia, India

Yeast extract for molecular biology Himedia, India

Table-11: Following kits were employed:

Kits Company

Big Dye Terminator V3.1 Applied Biosystem,, USA

Bioprime Array CGH, Genomic labeling Module Invitrogen, USA

Dual luciferase reporter Assay System Promega, Madison, USA

EZ DNA Methylation Kit Zymo Research, USA

Lipofectamine-2000 Invitrogen, USA

High-Capacity cDNA Archive Kit Applied Biosystem,, USA

Low RNA input fluorescent linear amplification Kit Agilent, USA

pGEM-T Easy Vector System Promega, Madison, USA

QIA Quick PCR purification Kit Qiagen, USA

Table-12: Sources of Plastic and Glasswares are the following:

Plastic and Glass wares Company

0.2mL & 0.5mL PCR tubes Axygen, USA

1.3mL micro centrifuge tubes Tarson, India

10cM petric plate (tissue culture), T25 and T75 tissue culture

Flasks

Tarson, India

15mL & 50mL sterile centrifuge tubes Tarson, India

1mL, 0.2mL pipette tips Tarson, India

Cryo vials Tarson, India

Test tube, 50mL, 100mL, 500mL, 1000mL glass beaker Borosil, India

Table-13: Details of the Instruments employed for the study:

Instruments Company

3030xl Genetic Analyzer Applied Biosystem, USA

Broviga (Agarose Gel Electrophoresis System) Balaji Scientific, Chennai

Broviga (Vertical Gel Electrophoresis System) Balaji Scientific, Chennai

Centrifuge (5415R, 5810R) Eppendroff Germany

Christ RVC-2-18 Martincrist, Germany

Concentrator Plus Eppendroff Germany

ELICO LI-612 pH Analyzer ELICO, India

ESCO laminar hood Mumbai, India

FB-12 Luminometer (Berthold) Germany

Gradient MilliQ Millipore, USA

Hera cell Thermo scientific, USA

HPLC Waters Milford, MA 01757

Hybridization Oven (G2545A) Shel Lab, Cornelius

Icematic (D101) Castelmac, Italy

ITC - Incubator (HE014) Chennai, India

Ligation bath Thermocon, India

Microarray Scanner (2565BA) Agilent, USA

Microwave oven (Samsung) Japan

Nanodrop spectrophotometer (ND-1000) Thermo Scientific, USA

NuAire-86°C Ultra low Freezer Plymouth, USA

Olympus Microscope (CK2) Hamburg, Germany

Orbitek Scigenics, Chennai

PCR Workstation Labcaire

Peltier Thermal Cycler (PTC-200) MJ Research

Pipettes Eppendorff, Hamburg, Germany

Pressure steam sterilizer Nat Steel Equipment Pvt Ltd, Mumbai

Rostospin Tarson, India

Rotek Tilting shaker India

RP C18 column (250 x 4.6 mm, 5 micron, 120 A°) Grace Vydac, USA

Sartorius (CP225D) Germany

Spectra Fuge Mini Korea

Spinix Tarson, India

Spinwin Tarson, India

Translumintor (254 and 366 nm) Uvi-tech, UK

UV-Gel documentation system Uvi-tech, UK

Veriti, Thermal Cycler Applied Biosystems, USA

Water bath Thermocon, India

Table-14: List of Restriction Enzymes/ Enzymes/ DNA ladder

Restriction Enzymes/ Enzymes/ DNA ladder Company

100bp ladder New England Biolabs, USA

1kb ladder New England Biolabs, USA

50bp laddre New England Biolabs, USA

BstUI New England Biolabs, USA

Calf Intestinal Phosphatase New England Biolabs, USA

Deep Vent polymerase New England Biolabs, USA

DNAse 1 Sigma, USA

DyNAzyme II Finnzymes, Finland

HindIII New England Biolabs, USA

HpaII New England Biolabs, USA

KpnI New England Biolabs, USA

McRBC New England Biolabs, USA

MseI New England Biolabs, USA

MspI New England Biolabs, USA

Nuclease P1 Sigma, USA

PvUII New England Biolabs, USA

RsaI New England Biolabs, USA

SssI Methylase New England Biolabs, USA

T4- DNA Ligase New England Biolabs, USA

Table-15: Various Cell Culture media, chemicals and cell lines employed for the study

Cell Culture Company

5 aza 2 deoxy Cytidine Sigma, USA

CaSki NCCS, Pune

DMSO Sigma, USA

Dulbecco's Modified Eagle Medium (DMEM) Sigma, USA

Fetal Bovine Serum (FBS) Invitrogen, USA

HeLa NCCS, Pune

Penicillin Sigma, USA

RPMI-1640 Sigma, USA

SiHa Cells NCCS, Pune

Streptomycin Sigma, USA

Trypsin Sigma, USA

Table-16: Different Buffers and Reagents employed for the study:

Buffer Composition

DNA Extraction Buffer 10mM Tris, pH (8.0), 0.1 M EDTA (pH 8.0), 0.5% SDS. Add RNAse

(10mg/ml) just before use

DNA Dissolving Buffer

10mM Tris, pH7.6, 0.1mM EDTA

TBE (10x)

0.9 M Tris base, 0.09 M boric acid, 0.02 M EDTA pH 8.0

TE solution 10X

10 mM Tris-HCl, 1 mM EDTA disodium salt pH 7.5

TBS (1x)

10 mM Tris-HCl pH 7.5, 100 mM sodium chloride.

SOC media

2% Bacto tryptone, 0.5% Yeast extract, 0.05% sodium chloride, 0.02%

potassium chloride, 2 M glucose, 2 M Mg2+ stock.

2XYT

16g Bacto Tryptone,10g Bacto Yeast Extract, 5g NaCl, Adjust pH to 7.0

with 5N NaOH. Adjust to 1L with distilled H2O and Sterilize by

autoclaving.

Phosphate Buffer Saline [pH-7.4] (1000mL)

3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3 mM KCl, 135 mM NaCl,

pH 7.4.

5X TBE [pH-8.3] (1000mL)

0.45 M Tris-Borate, 0.01 M EDTA, pH 8.3

Buffer P1 (Re-suspension Buffer)

50mM Tris Base [pH-8.0], 10mM EDTA and

RNAse - 100µg/mL

Buffer P2 (Lysis Buffer)

200mM NaOH, 20% SDS

Buffer P3 (Neutralization Buffer)

Potassium acetate – 3M [pH – 5.5]

Silver Staining

Fixing Solution: 10% ethanol+0.5% acetic acid

Staining solution: 200mg silver nitrate to 100mL of fixing solution

Developing solution: 3% NaOH + 0.5% formaldehyde

Microarray Hybridization Solution 0.25M sodium phosphate, 4.5% SDS, 1 mM EDTA, 3XSSC and 60 µg of

salmon sperm DNA

Microarray washing Solution Wash 1: 1X SSC pre-warmed at 50 ºC

Wash 2: 0.1% SDS and 1X SSC pre-warmed at 50 ºC

Wash 3: 0.1% SDS and 1X SSC pre-warmed at 50 ºC

Wash 4: 0.1% SDS and 1X SSC pre-warmed at 50 ºC

Wash 5: 1X SSC at room temperature

Wash 6: 0.1X SSC at room temperature

Table-17: Different Plasmids and their source

Plasmids Company

pGEMT Promega, USA

pGL2-Enhancer Promega, USA

pGL2-Control Promega, USA

phRL-TK Promega, USA

Protocols employed were adopted from Sambrook and Russell (2001). Molecular Cloning: A

Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press.

METHODOLOGY

The overall research plan is divided into seven sections which involved identification and

quantification of the extent of global methylation, prevalence of HPV in normal and cervical

cancer samples, identification of differentially methylated regions in cervical cancer as opposed

to normal samples at the genome wide level, validation of the above findings in a panel of

normal and cervical cancer samples and finally the usefulness of demethylating agents on the

restoration of the expression of genes identified as hypermethylated (Figure 16).

Figure-16: The overall research plan employed in the study. The overall research plan was divided into different

section which involved identification of global methylation and differentially methylated CpG Island across the

genome. The results of the study were validated using different gene specific methylation detection techniques.

3.1. Maintenance of Cell Line:

Cervical cancer cell lines SiHa, CaSki and HeLa (NCCS, Pune) were used in the study. HeLa

and SiHa were maintained in DMEM while CaSki in RPMI medium supplemented with 10%

FBS at 37ºC in 5% CO2 environment. All used human tumor cell lines were adherent growing

cells previously stored in liquid nitrogen and were thawed rapidly just before the use. The cells

were dissolved in 10 mL DMEM or RPMI supplemented with 10% FBS (fetal bovine serum),

100µg/mL Penicillin, 100μg/mL streptomycin, and centrifuged at 800rpm for 5 minutes. Then

cells were resuspended in 10 mL medium and seeded in cell culture flaks. To avoid cellular

overgrowth, the cultures were passaged twice per week. The cells were washed once with 5mL

PBS and incubated in 500 µL 0.25%Trypsin/EDTA solution until the cells were de-attached

from the plates. The reaction was stopped adding 5mL medium followed by dilution (1:10) into

new medium and sub cultured.

3.2. Cryopreservation of tumor cells:

For cryopreservation 1x 107 cells were trypsinized and centrifuged in complete medium at 800

rpm for 5 minutes. The cell pellets were quickly resuspended in 5mL freezing-media (70%

medium+ 20% FBS+10% DMSO). Then the cell suspension was aliquoted into cryo-tubes and

cooled down to -80°C. Later the cryo-vials were transferred to liquid nitrogen tanks for long term

conservation.

3.3. 5-aza-2’-deoxycytidine Treatment:

5-aza-2‘-deoxycytidine was added to the culture media at various concentrations of 0, 5, 10, 15,

20, 50, 100µM respectively for 3 days with fresh drug being added every day and a final day of

recovery with no drug. On fourth day the cells were collected for RNA extraction using

TriReagent® according to manufacturer‘s instructions. All the experiments were carried out in

duplicates.

3.4. Separation of nucleic acids by gel electrophoresis:

RNA and DNA molecules are negatively charged, due to their phosphate groups, and able to

migrate within an electric field towards the cathode. This property is used for their

electrophoretic separation within an agarose gel. For DNA and RNA, the agarose gels are

prepared by dissolving agarose in 1 x TBE (Tris-Borate-EDTA) buffer. Depending on the size of

the DNA fragments, different agarose concentrations are used. DNA molecules between 0.5- 7kb

are separated in 1.0 % (w/v) agarose gels, whereas molecules of 0.2- 3kb are separated in 1.5 %

(w/v) agarose gels. For the detection of both DNA fragments and RNA under UV-light (λ =

254nm), the DNA or RNA intercalating molecule ethidium bromide was added to the agarose

solution before polymerization. As standard, 5μl of 100bp DNA ladder marker (NEB, USA) was

loaded on the gel. The DNA migration was carried out by 7-10 V/cm and the DNA were

visualized on a UV- transilluminator. For documentation an image was captured for each DNA

or RNA gel. To avoid secondary structures of the RNA molecule, its electrophoresis was carried

out under denaturating conditions, in 1x MOPS buffer and 1.0% agarose. All materials used in

RNA electrophoresis were RNAse free. RNA was added to DEPC-dH2O and RNA loading

buffer. The solution was incubated at 65°C for 10 minutes to denature the RNA. After

preparation of the agarose-MOPS-buffer-gel the samples were loaded on the gel. For

electrophoresis 1x MOPS-DEPC-dH2O buffer was used. The RNA migration was strictly carried

out at 60V for 2 hours. The ribosomal 18S and 28S RNA were used as a size marker.

3.5. Sample Collection and DNA isolation:

Cervical biopsy samples from patients who were diagnosed at Kasturba Medical College,

Manipal, and Karnataka, India for cervical cancer were included in the study. Informed consent

to collect the samples was obtained from every participant, in accordance with the ethical

committee of Kasturba Hospital. Tissue biopsy, Pap smear and cell lines were used as source of

DNA. The biopsy samples were washed in sterile 1XTBS and cut into small pieces in sterile

petri plates. The diced sample were placed in 1.5 mL of micro centrifuge tube containing 500

µL DNA extraction buffer (50mM Tris HCl pH 8.0, 200mM NaCl, 20mM EDTA pH 8.0 and 1%

SDS). The lysate was transferred to a 1.5 mL micro centrifuge tube and incubated at 37°C for

overnight with 10μg/mL proteinase K and 10μg/mL RNAse. The tube was inverted occasionally

and made sure not to vortex at any point of time. After complete digestion equal volumes of

buffer saturated phenol was added to the 1.5mL micro centrifuge tube and mixed for 20 minutes.

Contents of the tube were then centrifuged at 12,000rpm for 15min at 4°C.The upper layer was

collected and transferred to a fresh tube. Equal volumes of Chloroform: Isoamyl alcohol (24:1)

was added and mixed for 15min at room temperature. Tube was again centrifuged at 12,000rpm

for 15min at 4°C and the upper layer was transferred to sterile 1.5mL micro centrifuge tube. To

this, 1/10th volume of 3M of sodium acetate and double the volume of 100% ethanol was added,

mixed and then was left at -80°C for 2 hrs. Tube was again centrifuged at 12,000rpm for 15min

at 4°C and the supernatant was discarded. To the pellet, 500μL of 70% ethanol was added and to

dislodged the pellet. Tube was centrifuged as above and the supernatant was discarded. The

tubes were dried on the bench top until it was semi dried. About 50μL of 1XTE pH 8.0 (10mM

Tris/1mM EDTA Buffer) or MilliQ water was added and kept on the bench until it was

completely dissolved. Then the DNA was stored at -20°C for further use. For isolation of DNA

from cell lines and exfoliated cells, cells were washed with PBS (twice) centrifuged at 800rpm

for 5min and the pellet were lysed in 500µL of DNA extraction buffer. The remaining steps of

DNA extraction were followed as performed for DNA extraction from biopsy samples.

3.6. HPV Genotyping:

HPV genotyping was done by nested PCR approach wherein first round of PCR was performed

with PGMY09/11 (Gravitt, Peyton et al. 2000) followed by second round of PCR wherein 5µL

of above PCR product was used as template and amplification was done using GP5+/GP6+

series of primers as described previously (Evans, Adamson et al. 2005). The PGMY09/11 (Table

18) primer system was developed by Gravitt et al, comprised of two non degenerate pools of

oligonucleotide primers designed to amplify 450bp region of L1 gene. The upstream PGMY11

pool consisted of 5 oligonucleotides while PGMY09 consisted of 13 oligonucleotides. The

amplification mixture contained 4.5mM MgCl2, 50mM KCl, 2.5U of Taq DNA polymerase,

200µM dNTPs (dATP, dCTP, dGTP, and dTTP) and 50pmol of each primer pool (Table-10).

Negative and positive controls were included

to monitor contamination of

each PCR reaction.

Amplifications were performed in a Veriti Thermocycler with the following cycling parameters:

95°C for 5min, 95°C for 1min, 57.5°C for 1min, and 72°C for 1min 30sec for 40 cycles, 72°C for

10min for PGMY9/11 series of primers. Further 5µL of the above PCR product was used as

template to amplify 150bp region of L1 gene by general primers GP5+/GP6+. The amplification

mixture contained 3.5mM MgCl2, 50mM KCl, 2.5U of Taq DNA polymerase, 200 µM dATP,

dCTP, dGTP, and dTTP, and 150ng of each primer (GP5+ and GP6+). Amplifications were

performed in a Veriti Thermocycler for 40 cycles

with the following cycling parameters: 95°C

for 1min, 40°C for 1min, and 72°C for 1.30min. Five micro liters of PCR product was resolved

on a 1.5% agarose gel and stained with ethidium bromide (10mg/mL). Samples which showed

band at 150bp was identified as HPV positive purified from the agarose gel and used for direct

sequencing using Big Dye terminator kit in Genetic Analyzer 3130XL according to the

manufacturer‘s instruction. The HPV strain was identified by using NCBI BLAST search.

Table-18: List of primers used for HPV genotyping (Gravitt, Peyton et al. 2000; Evans, Adamson et al. 2005).

Primer name Sequence

GP5+/GP6+ Primers

GP5+ TTTGTTACTGTGGTAGATACTAC

GP6+ GAAAAATAAACTGTAAATCATATTC

PGMY9/PGMY11 Primers

PGMY11-A GCACAGGGACATAACAATGG

PGMY11-B GCGCAGGGCCACAATAATGG

PGMY11-C GCACAGGGACATAATAATGG

PGMY11-D GCCCAGGGCCACAACAATGG

PGMY11-E GCTCAGGGTTTAAACAATGG

PGMY09-F CGTCCCAAAGGAAACTGATC

PGMY09-G CGACCTAAAGGAAACTGATC

PGMY09-H CGTCCAAAAGGAAACTGATC

PGMY09-Ia GCCAAGGGGAAACTGATC

PGMY09-J CGTCCCAAAGGATACTGATC

PGMY09-K CGTCCAAGGGGATACTGATC

PGMY09-L CGACCTAAAGGGAATTGATC

PGMY09-M CGACCTAGTGGAAATTGATC

PGMY09-N CGACCAAGGGGATATTGATC

PGMY09-Pa GCCCAACGGAAACTGATC

PGMY09-Q CGACCCAAGGGAAACTGGTC

PGMY09-R CGTCCTAAAGGAAACTGGTC

HMB01b GCGACCCAATGCAAATTGGT

3.7. Detection of global hypomethylation by RP-HPLC:

3.7.1. In-vitro methylation of Plasmid DNA: Plasmid DNA (50µg) was artificially methylated

using Sss1 methylase according to the manufacturer‘s instruction in a reaction consisting of

10XNEB buffer-2 (10µL), SAM (32mM) 1µL, Sss1 methylase (20U/uL) 3µL and water to make

the volume up to 100µL, incubated at 37°C for 4h followed by the addition of 2µLof Sss1

methylase and 1µLof SAM, incubated further at 37°C for overnight. The artificial methylation

was confirmed by digesting 200ng equivalent artificially methylated DNA with methylation

sensitive and non-sensitive isoschizomers namely Hpa11 and Msp1. Resistance to digestion with

Hpa11 following artificial methylation indicated complete methylation.

3.7.2. Chemicals for HPLC: All chemicals were of analytical reagent grade. Deionized water

(Merck, India) and HPLC grade methanol (Merck, India) were used throughout. The

deoxynucleoside standards (2‘-deoxycytidine, deoxyguanosine and deoxyadenosine) were

obtained from Sigma-Aldrich. 5-methyl- 2‘-deoxycytidine was obtained from Moravek

Biochemicals. Calf intestinal alkaline phosphatase (CIP) was obtained from New England

Biolabs. DNase1, Sodium acetate, zinc sulfate and nuclease P1 were obtained from Sigma-

Aldrich, Bangalore.

3.7.3. Analytical Procedure: Global 5 methyl cytosine (5mC) levels were estimated using HPLC

as described with little modifications (Cezar, Bartolomei et al. 2003; Fuke, Shimabukuro et al.

2004). Two microgram of genomic DNA was incubated with 3U of DNase1 in a 15µL reaction

volume for 4h. The sample was boiled at 100°C for 5min and quick chilled on ice. Double the

volume of 30mM sodium acetate, 10mM zinc sulfate to a final concentration of 1mM, and 6µg

of Nuclease P1 were added to the sample and incubated overnight at 37°C. Next day, 2µg of

fresh nuclease P1 was added and incubated further at 42°C for 30min. The sample was passed

through Quia quick spin column to remove impurities that may otherwise block the column. The

samples were lyophilized to 10µL following which 3µL of 1M Tris (pH-8.0), 2µL of 10XNEB

buffer-3 and 5U of calf intestinal phosphatase (NEB) were added and further incubated at 37°C

for 2 hours. Samples were kept at -20°C until analysis.

The chromatographic separation of deoxy nucleosides was performed under ambient column

temperature, maintaining the samples at 4°C using isocratic conditions with a flow rate of

1mL/min. Dipotassium hydrogen phosphate buffer [K2HPO4 (pH 4.1)] supplemented with 10%

methanol was used as mobile phase and C-18 Grace Vydac smart column used as a solid phase.

The injection volume was maintained at 10µL and the column elute was monitored at 260nm and

280nm. For calibration purpose, solutions containing 100ng /µL of the 5 standards – dC, 5dmC,

dT, dA and dG were used. The chromatographic peaks were assigned based on their retention

time in the column.

The general outline of the procedure is shown in the figure 17. The degree of global DNA

methylation was evaluated by measuring the peak area at 280nm (A5mdC/ [A5mdC + AdC]),

where A is peak area (Cezar, Bartolomei et al. 2003; Fuke, Shimabukuro et al. 2004; Shahrzad,

Bertrand et al. 2007). Peaks corresponding to 5mC and other nucleosides were collected for 30

min interval during the entire run. The relative degree of methylation in the DNA samples was

measured as the percentage of the mC of the total cytosine, calculated as, where A is the peak

area.

% of 5mdC = A5mdC/ [A5mdC + AdC] x 100

Figure-17: Overview of simplified representation of the technique, which is used for separation of DNA

nucleosides and quantification of global DNA methylation levels. After enzymatic hydrolysis of genomic DNA,

nucleosides could be separated by high-performance liquid chromatography (HPLC) followed by the relative

quantification of 5 methyl deoxycytidine to cytidine for identification of the extent of global hypomethylation.

3.7.4. Instrumentation: A high performance Liquid Chromatography system includes mobile

phase reservoir, pump for the delivery of mobile phase, sample inlet for the introduction of

sample, column with stationery phase, detector for the identification of the compound and

computer for data processing as indicated (Figure 18).

A Waters 2695 alliance auto injector liquid chromatograph equipped with a quaternary pump, a

well plate auto sampler, a column oven, a 2487 dual lambda absorbance detector, and Empower

2 software were used in this work. The chromatographic columns were a Grace Vydac smart RP

C18 column (250 X 4.6 mm, 5 micron, 120 A°). SPSS software version 16.0.1.3 was used for all

the statistical analyses of HPLC data. Independent t-test was used to test for the differences in

means and associations at p≤0.05 level were considered as statistically significant.

Figure-18: Diagrammatic representation of High Pressure Liquid Chromatography setup used for estimating the

global methylation level in a given sample.

3.8. Methylation Sensitive Arbitrary Primed PCR (MS-AP-PCR):

Methylation sensitive arbitrary primed PCR (MS-AP-PCR) was performed according to

published protocol with modification (Gonzalgo, Liang et al. 1997). In brief, 2µg of normal and

tumor genomic DNA was either digested with 20U of Rsa1 enzyme, 20U of Rsa1 and Hpa11 or

20U of Rsa1 and Msp1 (NEB, USA) at 37°C for 16h. DNA (2μg) was digested with 20U Rsa1

(NEB) in 1XNEB buffer 4 overnight at 37°C in a total reaction volume of 50μL. One micro liter

of digested DNA was separated on a 1.5% agarose gel. Digested DNA was divided into two

aliquots and digested separately with methylation sensitive and non sensitive isoschizomers

namely HpaII and Msp1 respectively in 100µL reaction volume. The Hpa11 and Msp1

restriction digestion was performed in two separate tubes. The digestion mixture contained

1XNEB buffer-4, 20U of restriction enzyme. 1µg of DNA were digested with Rsa1 for overnight

at 37°C in a total reaction volume of 100μL. The samples were incubated at 65°C for 20min to

inactivate the enzymes, and then stored at −20°C until analysis. One hundred nanograms of the

digested DNA were subjected for PCR amplification using the arbitrary primers MGCO (5‘-

AACCCTCACCCTAACCGCGC-3‘) and MGE2 (5′-AACCCTCACCCTAACCGGCC-3′) in a

25µL reaction volume containing 1XPCR buffer, 200µM dNTPs, and 200ng of primers and 1U

of Taq DNA polymerase. The PCR was performed in PTC-200 Peltier Themal Cycler for five

cycles under low stringency 95°C for 60s, 50°C for 30s and 72°C for 90s followed by 30 cycles

under high stringency 95°C for 15s, 55°C for 15s and 72°C for 45s. The amplicons were

resolved in 8% non denaturing polyacrylamide gel for 4 h at 150 V and visualized by silver

staining. Gel elution of amplified PCR products resulted in the generation of methylation

sensitive finger printing. Bands appearing in cancer cells but not in the normal cells were

interpreted as hypermethylated. Conversely, the disappearance of band in cancer samples

compared with normal samples was considered as a loss of methylation or hypomethylation.

Candidate bands that were differentially methylated were excised from polyacrylamide gels and

transferred to a micro centrifuge tube containing 50µL sterile H2O. The tube was then kept in a

boiling water bath for 10min and vortexed to facilitate dissolution of DNA. The elute (5µL) was

reamplified in 25µL with the same primers that were used for MS-AP-PCR. The PCR was

performed for 35 cycles with 95°C for 60s, 55°C for 30s and 72°C for 60s. The amplified

products were agarose gel purified, cloned into a pGEMT vector according to manufacturer‘s

instructions and sequenced in 3130 genetic analyzer (Figure 19).

Figure-19: Principle of MS-AP-PCR: It involves digesting the normal and tumor genomic DNA with restriction

enzymes such as Rsa1 which cuts outside the CpG island followed by their digestion with methylation sensitive and

non-sensitive isoschizomers, PCR with random primers, separation of the band on polyacrylamide gel,

identification of differentially methylated band, isolation, cloning and sequencing. The sequences were searched in

BLAST program of NCBI (http://www.ncbi.nlm.nih.gov/BLAST/) to identify the sequence similarity.

The sequences were searched in BLAST program of NCBI

(http://www.ncbi.nlm.nih.gov/BLAST/) to identify the sequence similarity. The agarose gel

purification involves excising the DNA-containing agarose gel slice, chopped into small pieces

and placed in a 1.5mL micro centrifuge tube, containing 500µL of buffer saturated phenol. The

tube was kept at -80⁰C for 2h followed by centrifugation at 12,000rpm for 15min. The

supernatant was transferred to a fresh 1.5mL micro centrifuge tube and equal volume of

chloroform-isoamyl alcohol (24:1) was added. The tubes were mixed for 15min in a rotospin at

20rpm for 15min. The tubes were again centrifuged at 12,000rpm for 15min; supernatant was

transferred to a fresh 1.5mL micro centrifuge tube. The DNA was precipitated by the addition of

1/5th

volume 10M ammonium acetate, mixed and incubated at -80⁰C for 2h. The tubes were

centrifuged at 12,000rpm for 15min and the supernatant was discarded. To these tubes 500µL of

70% alcohol was added, pellets were dislodged and the tubes were again centrifuged at

12,000rpm for 15min. The supernatant was discarded; DNA was semidried and dissolved in

15µL of MQ water. The concentration of the eluted PCR product was quantified using the

agarose gel electrophoresis along with a size standard of known concentration.

3.9. Differential Methylation Hybridization and Human CpG Island Microarrays:

3.9.1. Patient Sample Pooling Strategy: A total of 40 cervical tissue biopsy samples collected

from participants who were diagnosed at Kasturba Medical College for cervical cancer were

included in the study. All the participants gave consent for donation of samples to the present

study, in accordance with the Kasturba Hospital (KH) ethical committee and were used for

Differential Methylation Hybridization (Huang et al, 1999). Of these, 20 were normal and 20

were cervical squamous cell carcinoma (SCC) samples. Two pools were constructed – one

normal and one tumor, each pool containing 20 samples and 10μg of total DNA (Figure 20). The

pool was constructed in such a way that each sample contributed equal concentration of genomic

DNA (500ng each). Further, for pooling age matched non malignant and malignant samples were

used. Non-malignant samples were cases of hysterectomy who did not had any clinical lesion on

the cervix and their PAP test was reported as normal whereas the malignant samples were

squamous cell carcinomas as confirmed by their histopathology.

3.9.2. Amplicons Generation, Labeling and Hybridization:

Differential methylation hybridization analysis was conducted based on a technique developed

for global scanning of methylation changes in the human genome (Huang, Perry et al. 1999)

(Figure 21). DNA (10ug) was pooled as described as above. Two pools were constructed (normal

pool and tumor pool) from 20 samples, each sample contributing 500ng. Each pool was digested

in 1XTE pH 8.0 with 5µL proteinase-K (10mg/mL) in 100µL reaction volume for overnight at

37⁰C, purified by standard phenol-chloroform method followed by ethanol precipitation and was

dissolved in sterile MQ water. Five microgram equivalent DNA from each pool was taken and

subjected to digestion with MseI (50U) in a 100µL reaction volume at 37ºC for 16h to reduce the

genomic complexity and also to help the ligation of the universal linkers which will further help

to amplify the methylated CpG amplicons after digesting the gDNA with methylation sensitive

restriction enzymes (BstU1 and HpaII). The digestion with MseI (50units) was performed in 1X

NEB-2, 1X BSA at 37ºC overnight as recommended by the supplier (New England Biolabs,

Beverly, MA). A portion of the digested DNA was then run on 1.5% agarose gel to check for the

efficiency of the digestion. A uniform smear indicates complete digestion. The restricted DNA

was lyophilized to 14.5µL and ligated to PCR linkers produced by mixing equimolar

concentration of oligomers (H-24, 5‘-AGG CAA CTG TGC TAT CCG AGG GAT and H-12, 5‘-

TAATCC CTC GGA), heating to 95ºC, and cooling to room temperature. MseI digested DNA

was then ligated with universal linkers (annealing of equimolar concentration of H-12 and H-24

linkers) with T4-DNA Ligase at 16ºC for 16h in a ligation bath (Thermocon) which involves

attachment of the H-12 and H-24 linker dimers to the MseI digested DNA. The ligation was

performed in 25µL reaction volume containing 14.5µL restricted DNA, 4µL of annealed

linkers (100µM), 1X ligase buffer, T-4 DNA ligase (New England Biolabs, Beverly, MA) and

1µL of MQ water. After 16h of incubation at 16ºC the ligase was inactivated by heating at 65ºC

for 10min. In order to check whether the linker ligation was successful, a test PCR was

performed which contained 1µL of ligated DNA, 2.5µL of H24 linker (100ng), 1µL of deep vent

polymerase (2U/µL) [ (New England Biolabs, Beverly, MA)], 2.5µL 10X Thermopol buffer,

3.5µL of dNTPs [(4mM) (Sigma, Bangalore, India)] in a 25µL reaction volume. The test PCR

was performed in Veriti Thermal cycler (ABI, USA) using following cycling condition 72ºC for

5min followed by 20cycles of 97ºC for 1min, 72ºC for 3min and with a final extension of 72ºC

for 10min. The PCR product (5uL) was checked on a 1.5% agarose gel and the smear was

visualized using ethidium bromide (10mg/mL). A smear between 200bp to 2000bp indicated the

successful linker ligation. The PCR product was then purified using the Qiagen Purification Kit

(Qiagen; USA) according to the manufacturer‘s instruction.

Following linker ligation, the DNA was digested using two rounds of methylation sensitive

restriction enzymes BstU1 and HpaII (New England Biolabs, Beverly, MA) which cut at sites

CGCG and CCGG respectively provided the above sites are unmethylated. In the event that they

are methylated, these enzymes will not digest the DNA leaving it intact such that it can be

amplified by the next round of PCR. The methylation sensitive restriction digestion was

performed sequentially first with Hpa11 enzyme followed by BstU1 enzyme. The linker ligated

DNA was first lyophilized (Christ RVC-2-18, Germany) to 10µL, and digested with 50U of

HpaII enzyme in 1X NEB buffer -1 in 50µL reaction volume at 37ºC for 16h. This was followed

by digesting the DNA with 50 U of BstU1 enzyme at 60ºC for 16h. The methylation sensitive

restriction digested DNA was then purified using the Qiagen Purification Kit according to the

manufacturer‘s instruction. The intact DNA fragments were amplified by PCR using Deep vent

polymerase in a 100µL reaction with H-24 as the linker specific primer.

Figure-20: Schematic Diagram for pooling strategy used in the present study. Twenty normal and 20 tumor

samples were pooled to make normal and tumor pools; methylated amplicons were generated, labeled and

hybridized into a 12K CpG island microarray chip to identify the genes which are hyper- or hypomethylated in

cervical squamous cell carcinoma.

The next round of PCR known as Linker PCR is used to amplify the methylated amplicons

performed over 23 cycles wherein the methylated DNA, with intact linkers on both ends, is

amplified, whereas the unmethylated DNA cut at the BstU1 and HpaII sites and is not amplified.

The PCR condition was same as that used for test PCR. The amplicons are then checked on a

1.5% agarose gel. An optimal smear between 200 to 2000bp indicates successful linker PCR

amplification.

Figure-21: Schematic diagram for Differential methylation Hybridization (DMH). DNA samples were first

treated with a four-base cutter, MseI (TTAA), known to restrict bulk DNA into small fragments (<200bp), but

preserved larger GC-rich CpG island fragments relatively intact. These GC-rich fragments are ligated to linkers and

restricted by methylation-sensitive endonucleases and then were amplified by PCR using linker-primers. Methylated

DNA fragments of the test sample were protected from restriction and amplified by linker-PCR, whereas the same

unmethylated fragments in the reference sample are restricted and could not be amplified, and vice versa. These

amplified products, therefore, contained different pools of DNA fragments due to the differential methylation status

of tumor relative to the normal control. Test and control amplicons are co hybridized to the CpG island microarray,

and hypermethylation of multiple CpG islands in the test DNA was simultaneously detected using a two-color

fluorescence system, Cy5 and Cy3 (Huang, Perry et al. 1999). The differentially methylated CpG sites were

identified by taking the ratio between Cy-5 and Cy-3. Cy-5vs Cy-3 ratio>1.5, were considered as hypermethylated

while <0.5 were considered as hypomethylated and those between 0.5 to1.5 were considered to be unaltered.

3.9.3.Generation of methylated amplicons using Linker polymerase chain reaction: The PCR

mixture included the 20µL digested DNA, 30µL of 10XThermoPol buffer, 7.5µL of 10uM H-24

primer, 6µL of 10mM each dNTPs mixture, 6µL of Deep Ventexo-

DNA polymerase (2U/ µL),

and water to a total volume of 300µL. The amplification reaction was as follows: an initial

exposure for 5min at 72⁰C to fill in the protruding ends of the ligated DNA, followed by 20

cycles of 1min at 97⁰C and 3min at 72⁰C, and ending with a 10min final extension at 72⁰C. The

amplicons were then checked on a 1.5% agarose gel. An optimal smear between 200 to 2000bp

indicates successful linker PCR amplification. The methylated amplicons generated as above by

PCR was purified by Qiagen Purification Kit (Qiagen, USA) according to manufacturer‘s

instruction.

3.9.4. Aminoallyl-dUTP incorporation: The fluorescent dye labeling was followed essentially

that described by DeRisi et al. (www.microarrays.org). The methylated amplicons were then

labeled with Cyanine dyes using indirect method wherein amino allyl modified dUTPs were first

incorporated into the methylated amplicons, purified using Qiagen PCR Purification kit followed

by cyanine dye incorporation. The PCR products were dried in vaccuo and reconstituted to

24µL. To this 20µL of 2.5X random primers were added. The mixture was denatured at 95⁰C for

5min. The denatured product was placed on ice for 5min and 5µL of 10X-dNTP-aminoallyl mix

(2mM each dATP, dCTP, dGTP 0.35mM dTTP and 1.8µL of 10mM aminoallyl-dUTP) and 1µL

of Klenow fragments were added. The sample was held at 37⁰C for 2h. The reaction was stopped

by addition of 5µL of bioprime stop buffer. The amino allyl labeled methylated amplicons was

purified using the Qiagen Purification Kit.

3.9.5. CY dye coupling: The dye-coupling step was performed in the dark. The aminoallyl-

labeled sample was re-suspended in 4.5µL of 0.1M sodium bicarbonate (pH 9.0) and the CY dye

in 4.5µL DMSO, mixed gently and incubated at room temperature for 1.5h. At the end of

incubation, 4.5µL of 4M hydroxylamine was added to quench the coupling reaction. Thirty-nine

micro liters of 100mM sodium acetate (pH 5.2) was added to the mixture and uncoupled CY dye

was removed using a QIAquick column. The total CY dye incorporation from the purified

sample was determined with Cy5 detected at 650nm and Cy3 detected at 550nm using nanodrop

spectrophotometer. To calculate the picomoles of dye incorporated, the following two equations

were used:

pmol of Cy3 dye incorporated = A550 X(total volume of target)/0.15

pmol of Cy5 dye incorporated= A650 X(total volume of target)/0.25

3.9.6. Microarray hybridization: Normal samples were coupled with Cy3 while tumor samples

were coupled with Cy5. The fluorescently labeled probes were then hybridized into 12K CpG

island microarray chip, washed and scanned using Agilent microarray scanner (2565BA). All the

restriction enzymes were purchased from New England Biolabs, USA. 150pmol and 180pmol

Cy-3 and Cy-5 incorporated probes were used for hybridization into 12K CpG island microarray

chip.

First, both the Cy5-coupled tumor and Cy3-coupled normal amplicons were re-suspended with

20µg of human Cot-1 DNA in 15µL of water, mixed with pipette several times up and down and

kept for Cot-1 pre annealing which was done at 95⁰C for 10min, 65⁰C for 5min and 37⁰C for

30min. After thorough mixing, a hybridization solution containing 0.25M sodium phosphate,

4.5% SDS, 1mM EDTA, 3XSSC and 60µg of salmon sperm DNA was added to the Cot-1 pre

annealed labeled probe samples. The mixture was denatured at 95⁰C for 5min, cooled to 60⁰C,

and applied to the microarray slide. Microarray hybridization was carried out for 16h at 60⁰C in

a hybridization chamber.

The post hybridization washing steps were essentially those described by DeRisi et al

(www.microarrays.org). Briefly, the microarray slide was inverted in 1XSSC and 0.1% SDS

solution to let the cover slip slide off the slide. The slide was then transferred to a slide rack and

placed at 50⁰C in 1XSSC and 0.1% SDS solution for 5min and washed for another 5min at room

temperature. The last washing step was of 5min duration wash at room temperature with

0.2XSSC solution. The slide was dried by centrifuging in Spectrafuge mini for 5min and scanned

immediately with the Agilent microarray scanner (2565BA).

3.9.7. Microarray Image Data Analysis: Hybridized arrays were scanned at 5 µm resolution on

Agilent microarray (2565BA) scanner at 100PMT voltage settings to obtain maximum signal

intensities. The slide was scanned at 550nm and 650nm respectively and the resulting TIFF

image was analyzed by Feature Extraction software (V 9.5.1). The background subtraction was

done using the Feature extraction software. The data from the 16bit TIFF image was extracted

using Feature extraction software (V.9.5.1) and data was LOWESS normalized using Gene

Spring software (v.7.3.1). The Cy-3 and Cy-5 fluorescence intensities were obtained for each

hybridized spot. Each spot was defined by position of the grid over the array image. Array spots

with fluorescence signals close to background signal, reflecting PCR or printing failures, were

excluded from data analysis. Because Cy-3 and Cy-5 labeling efficiencies varied among samples,

the Cy-5:Cy-3 ratios from each image were normalized according to the

GE_Non_AT_95_Feb2007 protocol (Agilent technologies, USA), which uses minimum signal

correction (Global method) for background subtraction, followed by dye normalization using

rank consistence probe method and further it uses LOWESS as normalization correction method.

After normalization the .txt file which was generated was further analyzed using Genespring GX

(V7.3) software to identify the differentially methylated genes after locally weighted scatter plot

regression (LOWESS) analysis. The differentially methylated genes were identified based on the

ratio between the normalized Cy-5: Cy-3 signals. The ratio ≥1.5 were considered as

hypermethylated and ≤0.5 were considered as hypomethylated loci.

3.10. Microarray based DNA methylation profiling in cervical cancer cell lines by aPRIMES

technique:

Array-based profiling of reference-independent methylation status (aPRIMES) technique

described previously was used for identifying the methylated CpG islands in cervical cancer cell

lines namely SiHa and CaSki with little modifications (Pfister, Schlaeger et al. 2007) (Figure

23). High molecular weight genomic DNA was isolated from these cell lines as described in

DNA isolation section. The 80-90% confluent T75 flask was washed with PBS, trypsinized,

washed with PBS and used for DNA extraction. In brief, the cells were treated with 5µL of

proteinase-K (10mg/mL) and 500µL of DNA extraction buffer incubated at 37⁰C until the cells

got digested. Subsequently the DNA was extracted using standard phenol chloroform and

ethanol precipitation method and dissolved in sterile MQ water and stored at -20⁰C until use. The

quality and quantity of the DNA was assessed by agarose gel electrophoresis and

spectrophotometric techniques.

The methylation profiling by aPRIMES was performed on the SiHa and CaSki cell lines as

described previously by Pfister.et al (2007) with modification. Two microgram cell line genomic

DNA was restricted to completion with 20 U MseI for 16h in a final volume of 50µL in the

buffer provided by the supplier. Heat inactivation was carried out at 65⁰C for 10min. A test PCR

was performed with H24 linker so as to check the efficiency of ligation. MseI fragments were

then subjected to linker-mediated PCR as essentially described by Huang et al (1999) and the

same protocol was followed essentially as described in the DMH section. In brief 2ug of gDNA

isolated from cell lines were digested with 50U of Mse1 and ligated with Mse1 specific

universal linkers namely H12-H24 according to the protocol described by Huang et al (1999)

with modification.

Figure-22: Flowchart for the array-PRIMES procedure. Array-PRIMES compare two differentially restricted

aliquots from the same genome of interest by competitive hybridization

to a CGI array. Genomic DNA was digested

with MseI and ligated to adapter primers. Subsequently, one-half of the

samples were digested with the methylation-

sensitive restriction enzymes HpaII and BstUI to cut unmethylated CGIs, and the remaining

half was digested with

the methylation-specific enzyme McrBC to cut methylated CGIs. Restricted samples were

then subjected to 20

cycles of linker-mediated PCR, differentially labeled with fluorescent dyes, and competitively hybridized

to a CGI

microarray (Pfister et al., 2007).

Half of the resulting ligated MseI fragments were digested with the restriction enzyme McrBC

for 8 h following the conditions recommended by the supplier. McrBC restriction digestion was

performed in 25 µL reaction volume containing 10 µL of Mse1 digested linker ligated DNA, 2.5

µL of 10XNEB buffer-2, 2.5 µL of 10XBSA, 0.5 µL of 100XGTP, 2 µL of McrBC (10 U/ µL)

and 7.5 µL of MQ water at 37⁰C for 8h. The other half of the MseI digested linker ligated DNA

was digested with the two methylation-sensitive endonucleases HpaII (New England Biolabs;

recognition site CCGG, 16 h, 37⁰C) and BstUI (New England Biolabs; recognition site CGCG,

16 h, and 60⁰C) according to the recommendations of the supplier as mentioned in the protocol

described in ‗materials and method DMH section‘. Following methylation sensitive restriction

digestion methylated and unmethylated amplicons were developed by linker PCR with H24

linker as primer. Indirect labeling strategy was used. For this 1µg equivalent of methylated and

unmethylated amplicons were used for amino-allyl incorporation using Bioprime aCGH kit.

After purification amino allyl incorporated amplicons were coupled with Cy3 and Cy5 as

described previously in DMH section. Here unmethylated amplicons were labeled with Cy3 and

methylated amplicons by Cy5 followed by their hybridization into the 12K human CpG island

microarray chip. Hybridization and post hybridization washing of microarray was done

according to the protocol available at http://www.microarrays.org. Microarray slides were

scanned using Agilent microarray Scanner 2565BA at 5µM resolutions with different PMT

settings so as to get maximum signals. Methylation sensitive restriction digestion, methylated

amplicon generation, amino allyl labeling, cyanine dye coupling, hybridization, washing the

microarray slide, and data analysis was performed as described in DMH section.

3.11. Identification of expressed CpG Island sequence (ECISTs) tag by Microarray

3.11.1. Sample Preparation: The Cervical cancer cell line SiHa was maintained in our

laboratory as described previously and was treated with 5 µM 5-Aza-2-deoxy cytidine (5-Aza-

2DC) at an initial density of 2 x 104cells/cm

2 for 3 days

before harvesting. Control cultures were

maintained in the absence of 5-Aza-2DC. Total RNA was extracted from treated and control set

of cells by using the Trizol reagent according to the protocol mentioned in the ‗RNA extraction

section‘. The concentration and integrity of RNA was assessed by agarose gel electrophoresis

and also spectrophotometrically by Nanodrop spectrophotometer.

3.11.2. Preparation of Amplicons for Expression Analysis: Total RNA (30µg) was subjected to

DNase1 treatment, used for cDNA synthesis and fluorescent labeling using Agilent low RNA

input fluorescent linear amplification Kit (Agilent Technologies, USA) according to the

manufacturer’s instruction. In brief the DNase1 treatment mixture contained 30µg of total

RNA, 5µL of 10X DNase1 digestion buffer, 3µL of Amp grade DNase1(1U/µL) in a total

reaction volume of 50µL, incubated at 37⁰C for 30 min. The DNase1 enzyme was inactivated

by heating at 65⁰C for 10min. The cDNA synthesis and fluorescent labeling was done using the

Low RNA input fluorescent linear amplification kit according manufacturer’s instruction. In

brief, 10µg of DNase1 treated RNA was used for cDNA synthesis. The cDNA was purified for

fluorescence labeling by CyScribe GFX purification kit. Incorporation of aa-dUTP into cDNA

amplicons (5µg) was conducted using the Bioprime array CGH Labeling System. Cy5

and Cy3

fluorescent dyes were coupled to aa-dUTP-labeled test (2-Aza-2DC treated sample) and

reference (untreated sample) amplicons, respectively, and co hybridized to the 12K human CpG

island microarray chip. Hybridization and the post hybridization

washing protocols were

according to DeRisi et al (www.microarrays.org). Hybridized

slides were scanned with the

Agilent microarray Scanner (2565 BA) and the acquired images were analyzed with the Feature

extraction software (V.9.5.1). The detailed protocol for amino allyl labeling, cyanine dye

coupling, hybridization, washing, scanning and data analysis was essentially the same as

described in ‗materials and method DMH section‘.

3.12. Bioinformatic interrogation of methylation microarray data to identify genes regulated

by methylation

We have used a novel pipeline to analyze the methylation microarray data (Figure 23). First,

microarray data was analyzed to identify a list of differentially methylated genes. We used

Feature Extraction (9.7.5.1) and Gene Spring (7.3.1) software to identify the differentially

methylated gene which includes procedures for quality control, normalization (LOWESS) and

statistical analysis of microarray data. The resulting annotated gene list was filtered based on

ratio as mentioned above to identify genes with differential methylation. The sequence of the

clones which were spotted on to microarray chip was further confirmed by BLAST search of

NCBI.

Differentially methylated sequences were used to search for CpG island using CpG island

searcher program (http://cpgislands.usc.edu/) and promoter sequences were identified by

transcriptional regulatory element database (TRED) maintained by Cold Spring Harbor

Laboratory (CSHL) ( http://rulai.cshl.edu/cgi-bin/TRED/) and Database of transcription start site

DBTSS (www.dbtss.hgc.jp). Methylation and expression data for those regions which satisfy the

above criteria were further mined using three databases namely Meinfotext

(http://mit.lifescience.ntu.edu.tw/), Pubmeth (www.pubmeth.org) and PUBMED

(www.pubmed.com). Gene ontology, pathway analysis and interaction predictions were done

using ROCK database (http://rock.icr.ac.uk/search) and VisAnt (http://visant.bu.edu). Candidate

genes were selected and validated in a panel of normal and cancer samples by bisulfite genomic

sequencing and or combined bisulfite restriction analysis (COBRA) approach. The transcription

factor (TF) binding sites in the sequence were predicted using Transcription Element Search

System (http://www.cbil.upenn.edu/cgi-bin/tess) and AliBaba2.1 (http://www.gene-

regulation.com /cgi-bin/pub/programs/alibaba2i). Bisulfite sequencing data presentation and

compilation (http://biochem.jacobs-university.de/BDPC) tool was used for analysis of BGS

results.

Figure-23: Novel pipeline used to analyze methylation microarray data

3.13. Cell lines and 5-aza-2’-deoxycytidine treatment:

RNA was extracted from the cervical cancer cell lines namely SiHa, CaSki and HeLa (1X106)

treated with various concentrations of 5-Aza-2-Deoxy cytidine (5-Aza-2DC) for 3 days. A

10mM stock solution of 5-aza-2‘-deoxycytidine (5-aza) (Sigma, St. Louis, MO) was prepared in

dimethylsufoxide (DMSO) and kept at -80°C until used. Working dilutions were prepared from

aliquots using DMSO prior to each treatment. SiHa, CaSki and HeLa cells were treated with 5,

10, 20, 50 and 100µM 5-Aza-2DC for 3 days. 1mL of TRIZOL® Reagent was added and cells

were scraped out. RNA was extracted with 0.2 mL of chloroform. RNA present in the aqueous

layer was precipitated with 0.5mL of isopropanol, washed with 75% ethanol, dried and

dissolved in 30µL of DEPC treated water. The integrity of the bands were checked in 1%

agarose gel, stained with ethidium bromide (1 mg/mL) and visualized under UV light.

3.13.1. DNase1Treatment of Total RNA: The total RNA was subjected to DNase1 (Ambion,

USA) treatment and used for RT-PCR. In brief 10 µg of total RNA was subjected to 1U of

DNAse1 (Ambion) treatment in 50µL reaction volume containing 5µL of 10XDNase1 buffer

and incubated at 37°C for 15 min. The DNase1 enzyme was heat inactivated at 65°C for

10min.

3.13.2. Reverse Transcriptase PCR: Expression of double C2-like domains, beta (DOC2B), and

zinc finger protein 471 (ZNF471) genes were analyzed by RT-PCR. The cDNA synthesis was

performed according to High-Capacity cDNA Archive Kit (Applied Biosystems, USA) protocol

wherein 10µL of DNAse1 treated RNA (2µg) was mixed with 10µL of RT mix (2µL of 10XRT

Buffer, 0.8µL of 25XdNTP, 2µL of 10XRT primer, 1µL of Reverse transcriptase enzyme and

4.5µL of DEPC water) using the conditions as follows: 25°C for 10min, 37°C for 120min, 85°C

for 5s in Master Cycler Thermocycler. The resultant cDNA from the RT-PCR was used for

studying the expression of DOC2B and ZNF471 genes. The GAPDH was used as internal

control to check for the integrity of cDNA. The primers were purchased from BioServe, India.

cDNA (50-100ng) was amplified using 1XPCR Buffer (5mM KCl, 10mM Tris HCl pH 8.3,

1.5mmol/L MgCl2 and 0.1% Triton X-100), 200µmol dNTPs, 100ng of forward and reverse

primer each and 2U/µL of Taq polymerase in a 25µL reaction volume with following cycling

conditions 95°C for 5min, then 34 cycles with denaturating at 95°C for 30 s, respective annealing

temperature for 1min and polymerization at 72°C for 45s and a final extension of 72°C for 5min.

The annealing temperature and primers used for RT-PCR are given in the table-19. The PCR was

performed in Master Cycler Thermocycler. The PCR products were separated on a 1.5%

agarose gel and bands were visualized using ethidium bromide staining (10mg/mL).

Table-19: List of RT-PCR primers used in the study

Gene Primer sequence (5’→ 3’) Annealing Temperature (°C)

Product Size

(bp)

GAPDH

Forward : TGGTGTGGTTCTGGGCATCCACG

Reverse : TGGGAGCTCGCTGGTGAGCGTG

60 97

DOC2B Forward : TGGTGTGGTTCTGGGCATCCACG

Reverse : TGGGAGCTCGCTGGTGAGCGTG

60 103

ZNF471 Forward: ATGCTTTCAAACAGAGATCACAC

Reverse : CACAGGATGAGCTATCACTAAAA

57.5 195

3.14. Methylation Sensitive DMSO-PCR (MS-DMSO-PCR):

The MS-DMSO-PCR was performed as mentioned previously (Kholod, Boniver et al. 2007) in a

25µL reaction volume containing 1X PCR buffer, 200µM dNTPs, and 100ng each of forward

(CCCGAGGTTAGAGTGCTGTG) and reverse (CTCCTGGATGCTGATGGTC) primers, 0-5%

DMSO, 20ng of template DNA and 1U Taq polymerase so as to get a PCR product of 1000bp

with following cycling conditions: 95°C for 5min , then 30 cycles with denaturation at 95°C for

30s , 64°C for 1min and 72°C for 2min and a final extension of 72°C for 10min. The PCR

primers were designed to -700 to 300bp (chr17:31,121-32,120) of TSS using Primer-3 software

(http://www.frodo.wi.mit.edu/). PCR products were analyzed on 1% agarose gel and bands were

visualized by staining with ethidium bromide (10mg/mL).

3.15. Bisulphite Treatment of gDNA:

The bisulfite reaction was first described in early 1970s and was used by Frommer and

associates to distinguish between cytosine and 5mCytosine (5mC) in DNA (Frommer, McDonald

et al. 1992; Clark, Harrison et al. 1994). In this reaction, DNA is first treated with sodium

bisulfite which converts cytosine residues to uracil in single stranded DNA, under conditions

whereby 5mC remains essentially non-reactive. The DNA sequence under investigation is then

amplified by PCR with primers specific for bisulfite modified DNA. Many methods based on the

same principle have been developed including bisulfite genomic sequencing PCR (BSP),

methylation-specific PCR (MSP), combined bisulfite restriction analysis (COBRA) and

methylation-sensitive single nucleotide primer extension (MS-SNuPE), with the first two being

the most commonly used. All methods share the same procedure of modifying DNA with sodium

bisulfite as the first step and subsequently PCR amplification with primers specific for modified

DNA.

The genomic DNA from normal and tumor tissue biopsy samples were used for bisulfite

treatment using EZ DNA methylation Kit according to the manufacturer‘s instructions. In brief,

2µg of gDNA was treated with 5µLof M-dilution buffer in 50µL reaction volume and incubated

at 37⁰C for 15min. CT conversion reagent was prepared by adding 210µL of M-dilution buffer

and 750µL MQ water and the contents were dissolved by vortexing. One hundred micro liter of

CT conversion reagent was added to 50 µL of the DNA prepared as above and incubated for 16h

at 50⁰C. Samples were incubated in ice for 10min and 400µL of M-binding buffer was added,

mixed and samples were loaded into Zymo-Spin IC columns. The tubes were centrifuged at

10,000X g for 30 sec and flow through was discarded. The column was washed by adding 100µL

of M- wash buffer and centrifuged at 10,000Xg for 30sec. M-desulphonation buffer (200µL) was

added and tubes were incubated at room temperature for 20min. After incubation tubes were

centrifuged at 10,000Xg for 30sec. Flow through was discarded and tubes were washed with

200µL of M-wash buffer and centrifuged at 10,000Xg for 30s (twice). The columns were placed

into a 1.5mL of micro centrifuge tube and bisulfite converted DNA was eluted using 20µL of

elution buffer by centrifuging at 10,000Xg for 30s. Three to five microlitre of bisulfite converted

DNA was used for PCR.

3.16. Bisulfite genomic sequencing (BGS): The COBRA and BGS were done according to the

protocol described previously with modification (Frommer, McDonald et al. 1992; Xiong and

Laird 1997). After bisulfite conversion the sequence under investigation was amplified by PCR

with a set of strand-specific primers to yield a pair of fragments, one from each strand, in which

all uracil and thymine residues have been amplified as thymine and only 5-methylcytosine

residues have been amplified as cytosine. The PCR products can be sequenced directly or can be

cloned and sequenced to provide methylation maps of single DNA molecules. Bisulfite treatment

thus introduces specific changes in the DNA sequence that depends on the methylation status of

individual cytosine residues, yielding high-resolution information about the methylation status of

a segment of DNA (Figure 24). The primers were designed so as to anneal to bisulfite treated

DNA using Methyl primer express-V.1 (Applied Biosystem, USA). The COBRA and BGS were

performed for double c2-dmain beta (DOC2B), RAB6C, member RAS oncogene family

(RAB6C), Zinc finger protein 471 (ZNF471), Death-associated protein kinase 1 (DAPK1) and

Cycline dependent kinase inhibitor 2A (CDKN2A). The primer sequence, amplicon length and

annealing temperatures are detailed in Table 20.

In brief, 100ng of bisulfite treated DNA was amplified in a 25µL reaction volume containing

100ng each of forward and reverse primers. PCR reaction contained 1XPCR buffer, 200µM

dNTPs, 2U/µL Taq Polymerase, using the following PCR conditions: 95ºC-5min, 95ºC-30s,

respective annealing temp for 1min, 72ºC for 1min and 72ºC for 10min for 35 cycles.

Amplifications were performed in a Veriti Thermocycler (ABI, USA). Taq polymerase and

primers were purchased from Sigma Genosys Bangalore. Following electrophoresis, PCR

products were gel purified, precipitated with ethanol and ammonium acetate and dissolved in

sterile MQ water. PCR product was directly sequenced in ABI3130 Genetic analyzer according

to manufacturer‘s instructions using big dye terminator kit. The sequences were aligned and

checked manually with the original unconverted sequence to find out the methylated and

unmethylated CpG present at low level and also to confirm the extent of bisulfite conversion.

Figure-24: Outline of bisulfite genomic sequencing (BGS). BGS involves treating the DNA with bisulfite reagent,

gene specific PCR, purification of the PCR product, sequencing and comparing the sequence with the unconverted

original sequence to identify the methylated and unmethylated cytosines. The methylated CpG are detected as CpGs

while unmethylated ones are detected TpG after bisulfite conversion and subsequent PCR.

Table-20: Genes and primers sequences used for BGS

Gene

Name

Sequence (5‘ → 3‘) Annealing Temp (°C) Amplicon

Length (bp)

DOC2B F:GTATGTGTGTATTTGTATATTTGYGTGTG

R:CCCCRAACRACCCTAACTTAACCRCTACC

61.8 412

DAPK1 F:GAGGGTAGTTTAGTAATGTGTTATAGGTGG

R:ACCCCAAACCCTACCRCTACRAATTACC

57.5 380

RAB6C F:GGATYGATGTTGTTTTAGTYGGTTGA

R:CCAAAAACTCRCRCACTCAACAAATTAAAC

60 394

ZNF471 F:GATTATTTTTATTTTGTTAAGGGGTTGAA

R:TAAAAACCAAAAACRTCCCTAATTACTAT

57.5 363

CDKN2A F: GTGAGTTGAGGTAAGATYGGAGATTGG

R: ATAACRAAACTACTACTACTCCACRAC

57.5 392

3.16.1. Quantitation of methylation level: The percentage of methylation for each CpG sites was

calculated by comparing the peak height of cytosine signals with sum of the peak heights of the

cytosine and thymine signals. A single C at CpG position was considered as 100% methylated, a

single T as no methylation and overlapping C and T as partially methylated. In case of partial

methylation the percentage of methylation was calculated as ratios of peak height of cytosine to

sum of values of cytosine plus thymine signals and expressed in percentage (Balanathan, Ball et

al. 2004).

3.17. Combined Bisulfite Restriction Analysis (COBRA): COBRA was performed according to

the method of Xiong and Laird (1997) using digestion with BstUI (5′-CGCG) restriction enzyme

(Figure 25). In brief bisulfite conversion of DNA and PCR was done as mentioned in BGS

section. The PCR product (5µL) was digested with 1µL of BstUI (10U) in a 20µL reaction

volume at 60⁰C for 16h and was ran on a 6% polyacrylamide gel and stained with silver stain or

2% agarose gel stained with ethidium bromide as described previously. The image was captured

using Gel documentation system. The bands were checked and scored manually to identify the

methylation.

Figure-25: Outline of the COBRA procedure. COBRA consists of a standard sodium bisulfite PCR, followed by

restriction digestion. During the first step, unmethylated cytosine residues are converted to thymine, whereas

methylated cytosine residues are retained as cytosine. The consequences for the restriction site BstUI are illustrated.

3.18. Promoter constructs, artificial methylation, transfection and luciferase assays:

A reporter construct consisting of DOC2B (-440bp to +225bp) promoter driving a luciferase

gene (pGL2-Enhancer) was created. The primers were purchase from BioServe, Hyderabad,

India. 100ng normal fibroblast DNA was amplified using 1XPCR Buffer (5mM KCl, 10mM Tris

HCl pH 8.3, 1.5mmol/L MgCl2 and 0.1% Triton X-100), 200µmol/L dNTPs, 100ng of primer

(Forward Primer: 5‘-TTGTGGGTACCCCCAGGGTCCCCTGATCAC-3‘ and Reverse Primer:

5‘-CCGGAAAGCTTCGGCCCTGACTTGGCCGCT-3‘) and 2U/µL of Taq polymerase. The

PCR was performed in Master Cycler Thermo cycler with conditions as follows: 95°C for 5min,

followed by 35 cycles of 95°C for 30s, 65°C for 1min and 72°C for 2min with a final extension

of 72°C for 10min so as to generate a PCR product of 665bp.The PCR products was run on a

1.5% agarose gel and visualized under UV Gel Documentation System. Amplified product was

double digested with Kpn1/ HindIII and cloned in pGL2-Enhancer vector upstream of the

Photinus pyralis luciferase coding sequence which contains an acceptor splice site at its 5’

end. The construct was verified by restriction digestion with KpnI and HindIII and

sequencing. The plasmid DNA is confirmed using sequential digestion with enzymes KpnI and

HindIII. The sites of each have been incorporated in the promoter sequence that has been ligated

into the reporter vector. The restriction digestion confirmation of the plasmid was first carried

out with digestion with KpnI (G*GTACC) supplemented with 1X NEB buffer 1 and 1X BSA

incubated for a period of 16h. The digested product was further subjected to digestion with

HindIII (A*AGCTT) supplemented with 1XNEB buffer-2 and incubated for a period of 16h.

3.18.1. In vitro methylation of pGL2-Enhancer-DOC2B reporter constructs: The pGL2-

DOC2B plasmid was artificially methylated in vitro using the CpG-specific SssI DNA methylase

according to the manufacturer‘s instructions. In brief, 20µg plasmid DNA was incubated with

Sss1 Methylase (2.5U/µg DNA) in the presence of 1600uM S-Adenosylmethionine (SAM) for

four hours at 37⁰C, with another 1600µM of SAM being added after the first two hours of

incubation. The unmethylated DNA was treated as above but without methylase. Plasmid DNA

was phenol/chloroform extracted; ethanol precipitated and quantified using 0.8% agarose gel

electrophoresis and Nanodrop Spectrophotometer. Completion of methylation was confirmed by

digestion of the plasmids with the methylation-sensitive and non sensitive restriction

endonucleases namely HpaII and Msp1 respectively.

3. 18.2. Transient Transfection Assays: Transient transfection of human cervical cancer cell line

HeLa was carried out using Lipofectamine-2000 reagent (Invitrogen, USA) according to

manufacturer‘s guidelines. The methylated and unmethylated (pGL2-Enhancer-DOC2B)

constructs (1.6µg) were co-transfected with pRL-SV40 vector (50ng) into 80-90% confluent

cultures of HeLa cells in a 6-well tissue culture plates with Lipotransfectamine-2000 reagent

according to manufacturer‘s guidelines. Four hour before and six hour after transfection media

was replaced with fresh DMEM complete medium. The cell lysates were prepared after 24h.

3.18.3. Luciferase assays: Luciferase and Renilla assays were performed using the Dual-

Luciferase reporter assay kit according to manufacturer‘s instruction. Briefly after 24h the cells

were washed with PBS and lysed in 300µL/well of passive lysis buffer. The cells were incubated

in the lysis buffer for 30min at room temperature in a 1.5mL micro centrifuge tube, centrifuged

at 2000rpm for 5min and supernatant was used for luciferase assay. The 20µL of cell lysate was

added to 100µL of Luciferase assay reagent and firefly luciferase was measured on a FB12

Luminometer (Berthold, Germany). The light emission of both firefly luciferase and Renilla

luciferase was detected for 10 s intervals. After a luciferase reading, 100µL of Stop and Glow

reagent was added to the lysate prepared from each well and Renilla luciferase was measured.

The luciferase activities are represented as relative activities [firefly luciferase activity (pGL3)

divided by Renilla luciferase activity (pRL-SV40)].

3.19. Statistical analysis:

All the statistical analysis was done using Microsoft Excel 2007(Microsoft, USA). The t-test

was used for statistical analysis and significance. The P-value less than 0.05 were considered

statistically significant and data was represented as mean ± S.E.M.