Plant Cell Biotechnology and Molecular Biology, 2 (1&2) : 19-32,2001@ 2001 Society for Biology and Bitotechology

ISOLATION AND CHARACTERIZATION OF A SERINEPROTEINASE INHIBITOR cDNA FROM CABBAGE ANDITS ANTIBIOSIS IN TRANSGENIC TOBACCO PLANTS

D. A. PULLIAMT, D. l. WilLIAMS., R. M. BROADWAY., AND C. N. STEWART'"

TDepartment of Biology, University of North Carolina, Greensboro, NC 27402.,6174, USA; * Department of Entomology

New York State Agricultural Experiment Station, Cornell University, Geneva, NY, USA; Syngenta Agribusiness

Biotechnology Research, Inc., 3054 Cornwallis Rd., Research Triangle Park, NC 27709, USA (D.A.P); Department ofBiological Sciences, Illinois State University, Normal, Illinois 61790-4120, USA (D.L.W); 11327 Reid Place, Grass

Valley, CA 95945, USA (R.M.B), [*For correspondence: Fax: 336 334 5839 Email: nstewart@uncg.edu]

ABSTRACT

Plant proteinase inhibitors (Pis) are of special interest because of their role in

plant defense against herbivorous insects. We isolated a cDNA clone for a serine

PI from Brassica o/eracea, cabbage (BoPI). A comparison of the putative coding

sequence from the cabbage clone with soybean trypsin inhibitor identified

conserved amino acids and peptide motifs. Furthermore, it seems to be a member

of a 6-8 gene family in cabbage. The serine PI cDNA was subcloned into a plant

expression vector under the control of the CaMV 355 promoter, and transgenic

Nicotiana tabacum. (tobacco) cv Xanthi were produced to test the ability of BoPI to

enhance resistance against insects in a heterologous system. These plants were

compared with transgenic plants containing different insect resistance transgenes

(proteinase inhibitors and a Bacillus thuringiensis cry1Ac). The transgenic plants

containing BoPI gene outperformed over other transgenic plants produced with

diffierent PI genes, and compared favorably with Bt cry1 Ac transgenic plants in a

bioassay with Heliothis virescens, tobacco budworm.

Key Words: Brassica, Herbivory, Insect Resistance, Proteinase Inhibitor, Transgenic Plants

Abbreviations: Bt, Bacillus thuringiensis; CEW, corn earworm (Helicoverpa zea); TBW, tobaccobudworm (Heliothis virescens); YDK, Bt-susceptible TBW; YDH2, Bt-resistant TBW.

Nucleotide sequence appears in the Gene Bank, EMBL and DDBJ under the Accession No. U18995.

Corresponding Editor: Dr. P. Venkatachalam

20

Broadway and Colvin,

1994).1992; Lorita, et al.,

INTRODUCTION

Plant genes that protect against herbivory maybe useful for heterblogous expression intofood and fiber crops (Boulter, 1989, 1993;Vogel et al., 1968). Proteinase inhibitors (Pis)are common in plants and have drawnattention as possible transgenes for insectdefense in crops. Pis are of particular interestbecause they are generally the product of asingle gene, and inhibit proteolytic enzymes ofanimal and fungal origin, but rarely plantorigin, and therefore are thought to act asprotective agents (Baldwin and Schultz, 1983;Brattsten, 1991; Green and Ryan, 1972; Hilderet al., 1993; Laskowski and Sealock, 1977).Several studies have demonstrated that Pismight provide adequate protection against avariety of economically important lepidopteraninsects (Broadway and Duffey, 1986; Hoy andShelton, 1987; Johnson et al., 1989; Lipke etal., 1954; Oppert et al., 1993; Sanchez-Serrano et al., 1987; Thomas et al., 1994,1995; Xu, et al., 1996).

As the result of the significant biologicalactivity of cabbage Pis against herbivores andpathogens, we cloned a PI gene andexpressed it in transgenic plants to betterunderstand these molecules and to exploretheir effectiveness. We were interested indetermining if expression of a cabbage PI in aheterologous system leads to an increasedresistance to insect damage. This reportincludes the isolation and sequencecharacterization of a serine PI cDNA clonefrom cabbage (Brassica oleracea ProteinaseInhibitor, BoPI), and its heterologousexpression in tobacco. In addition, we used atransgenic approach to compare BoPI to otherinsect resistance genes. We compared BoPIwith Bacillus thuringiensis Cry1 Ac (Bt)(Stewart et al., 1996a), and three proteinaseinhibitors from the lepidopteran Manducasexta (Kanost et al., 1989). Previous workdemonstrated that Bt Cry1Ac is very effectivein controlling lepidopteran larvae such asHeliothis virescens (tobacco budworm) andHelicoverpa lea (corn earworm). The M.sexta Pis had affinity for trypsin (AT),chymotrypsin (AC) and anti-elastase (AE)(Kanost et al., 1989), and these Pis areeffective in controlling thrips (Thomas et al.,1994) and whitefly (Thomas et al., 1995), butwere untested against Lepidoptera.

MATERIALS AND METHODS

cDNA cloning, Sequencing and Analysis

The production and accumulation of Pis inplants can be activated by a variety ofmechanisms. Potato, tomato and poplar Pishave been shown to be wound inducible, bothat the site of wounding and systemically(Bradshaw et al., 1990; Graham et al., 1986;Sanchez-Serrono et al., 1986). I n contrast,the production of Pis in cabbage (Brassicaoleraceae), especially trypsin andchymotrypsin inhibitors, are linked to plantdevelopment (Broadway and Missurelli, 1990).Low levels of PI activity in cabbage areproduced in young foliage in seedlings(Broadway and Missurelli, 1990; Broadwayand Colvin, 1992). When the plant reachesthe 11-13 leaf stage, the level of PI activitygradually increases in young leaves, andreaches a maximal level of activity in theyoung foliage on mature plants. Theproduction of Pis in cabbage is synchronizedwith the appearance of herbivorous insects inthe field. Thus, the Pis are present when theresistance factors are most needed againstthese pests (Broadway and Missurelli, 1990;Broadway and Colvin, 1992). In addition,cabbage foliar extracts containing Pis havebeen shown to significantly reduced growthand development of larval Lepidoptera and

plant pathogenic fungi (Broadway, 1995;

A cabbage (Brassica oleracea var. capitata Lcv. Superpack) cDNA library was constructedin Lambda Zap II with mRNA purified from theyoung leaves of mature cabbage plants(Napoli et al., 1990), shown previously to be arich source of PI protein (Broadway andMissurelli, 1990). This library was screenedwith antibodies produced in rabbits againstaffinity-purified cabbage PI (Broadway, 1993).Several positive clones were identified. An809 bp clone was plaque-purified and theinsert sequenced using terminator cyclesequencing and an Applied Biosystems(Forter City, CA) fluorescence sequencer.The 809 bp Brassica oleraceae proteinaseinhibitor (bop/) coding region was isolated as a

21

EcoRI-Xhol restriction fragment thensubcloned into.pBluescript II SK (Strategene,USA).

Enzyme Assays

The initial enzyme assays performed on bulknumbers of transgenic plants were performedas follows. The determination of trypsin,chymostrypsin or elastase inhibition activity intransgenic plants was determined by amodification of the methods described byGeiger and Fritz (1983). Approximately 0.5gm of fresh leaf tissue was homogenized in 5ml of cold extraction buffer (25 mM NaHPO4pH 7.0, 10 mM EDT A free acid, 1% Sarkosyl,1 % Triton-X 100). Each homogenate waspoured into a sterile, 50 ml conical centrifugetube and diluted with an additional 20 ml ofextraction buffer. A portion of each extractwas used in a Bradford analysis (BioRad,USA) to determine the total soluble proteinconcentration.

Each sample was assayed inquadruplicate by combining 1 00 ~g of totalplant protein and the appropriate amount ofextraction buffer to bring each reaction volumeto 800 ~I in a 1 ml quartz cuvette. After brieflymixing the reaction mixtures, 200 ~I of BAPNA

(1.74 mg ml-1) (N a-benzoyl-DL-arginine p-nitroanilide, Sigma) was mixed into eachsample.

A standard containing 2.5 mg/mlbovine trypsin (or chymotrypsin or elastase, asappropriate) and a blank solution lacking theBAPNA substrate were prepared toaccompany each set of plant samples. All thecuvettes were incubated at 25°C for 10 minafter the addition of all reagents. Theabsorbance of each sample was recorded byspectrophotometry at 410 nm using thesubstrate blank and the standard as areference. The resulting spectrophotometricdata were used to calculate the percentinhibition of each PI/plant sample.

The bop; cDNA was isolated from

pBluescript II SK by digestion with Xbal andXhol to expose cohesive overhangs requiredfor ligation into an intern1ediate cloning vector,

pBJ40. The intermedate vector is a 14 kBplasmid that confers spectinomycin resistancein bacterial cells. The polylinker in pBJ40 isflanked by the cauliflower mosaic viruspromoter (CaMV) 35S and nopaline synthasegene (nos) 3' terminator. The cassette wasisolated as a Sacl-EcoRI restriction fragmentfrom pBJ40, and this was inserted betweencorresponding sites in the polylinker of theplant expression vector pBIN19. The plasmidwas renamed pBIN/BoPI (Fig. 1). The planttransformation vectors containing Bt (Stewartet al., 1996b) and the M. sexta Pis (Thomas etal.,

1994) were of similar construction as BoPI,with the antibiosis transgenes under thecontrol of the 35S promoter, and kanamycinas the plant selectable marker.

Transgenic Plants

Transgenic tobacco (Nicotiana tabacum cvXanthi) plants were produced using publishedmethods (Horsch et al. 1985). Primarytransformants were grown in a growthchamber with 500 ~E m-2 S-1 irradiance and12-h photoperiods to maintain plants for theinsect bioassays. Plants were watered threetimes a week and fertilized as needed. PlantDNA was isolated according to publishedmethods (Doyle and Doyle, 1987, Stewart a~dVia,

1993). Plant DNA samples werequantified by fluorometric spectrophotometry(Hoefer DyNA Quant 200, Hoefer PharmaciaBiotech Inc, USA). PCR was used to assesstransgenic state of the plants (Table 1).Standard PCR was performed by 40 cycles of94°C,

55°C, and 72°C. Ethidium bromidestained agarose gel electrophoresis was usedto visualize PCR products. Transgeneexpression or activity was estimated usingprotein blot analysis for Bt (Stewart et al.1996a) or enzyme assays for Pis.

~~

Subsequent enzyme assays from animproved procedure (Menges et al. 1997,Thompson et al. 2000) were performed onleaves extracts from individual plants (Fig 4).Approximately 2 gm of fresh leaf tissue wasmacerated in 2 ml of homogenization buffer(100 mM Tris-HCI pH 7.5, 0.1 M CaClv usinga semi-automated plant tissue homogenizer(Bioreba Inc, USA). The homogenate wastransferred to a clean 1.5 ml centrifuge tubeand clarified by centrifugation at 15,000 rpm,'4°C for 10 minutes. Total protein of each plantextract was assessed by BCA assay (Pierce,USA). For inhibition assays, 10 mg/mlworking stocks of trypsin and trypsin-

22

Table 1. Primer sequences and predicted DNA product sizes of transgenes.

Gene &

Primer(s)

Primer (bp) Primer SequenceProduct (bp)

GGCAGTTACTACGTTCTCCCCCGATAGGGGTAGCGAATG

BoPiForwardReverse

455 21mer18mer

M. sexta Pi'sForwardReverse

ACGACCAATTTACAGCCCAGGTTGTACAAACGCTTCCCTCAGC

770 20mer21mer

ATTTGGGGAATCTTTGGTCCACAGTACGGATTGGGTAGCG

Cry1AcForwardReverse

560 20mer20mer

* bp, Base pairs

Table 2. Transformation efficiency of tobacco plants subjected to Agrobacterium mediated genetransfer.

M.

sexta AC 300 50

50 14

a Number of leaf disks co-cultivated in Agrobacterium. b Number of leaf disks that produced

callus during antibiotic selection. CTotal number of shoots excised from callus. d Number of

rooted shoots, each representing unique transgenic events.

23

chymotrypsin protease inhibitor (Cat No. T-

7409 and T -9777 respectively, SigmaChemical Co., USA) were prepared bydissolving each compound in digestion buffer(10 mM Tris-HCI, pH 7.8, containing 0.1 mMsodium azide).

virescens (strain YDK)), the at-resistanttobacco budworm (strain YHD2) (Gould et al.,1995), and corn earworm (Helicoverpa zea).The eggs of each insect strain were incubatedin 30-ml transparent plastic cups withunwaxed cardboard lids at 20°C until theyhatched. Three newly hatched larvae wereremoved from the plastic cups and applied toeach leaf disk in a bioassay arena using a finehair paint brush, and the lid placed back onthe bioassay arena. The bioassays weremaintained on a stainless steel wire shelf thatallowed even air circulation, and the bioassayswere conducted for five days, with periodicwatering of the disks to maintain the health ofthe leaf disks. The treatments weremaintained at 25°C and constantly illuminatedwith fluorescent lighting throughout theexperiment. Data were collected at theconclusion of each trial measuring theantibiosis parameters: percent mortality, bodylength of surviving insects, and defoliation ofthe leaf disks. The data were analyzed usingSAS. A two-way analysis of variance(ANOV A) was performed using the categoricalvariables transgenic plant type and insectspecies to determine any significantdifferences with respect to the antibiosis

parameters. Multiple comparisons usingTukey's studentized range test wereperformed on all main effect means.

Protease activity was determined using afluorescence-based assay (EnzChek BODIPYFluorescence Kit, Cat No. E-6638, MolecularProbes, USA) in a 96-well format. Assayswere carried out in duplicate and blanks wereused to account for any background. Astandard curve was generated to determinethe activity of purified protease, and todetermine the effect of varying levels ofpurified inhibitor on a known concentration ofprotease. To detect protease-inhibitor activityin the plant extracts, 25 IJg of soluble proteinwas loaded into the well of a flat bottom, black96-well plate (Costar Brand, USA). Enoughtrypsin was added to each sample so that afinal concentration of 2.5 IJg/ml would beachieved. Enough digestion buffer was addedto each sample to bring the volume to 100 IJI.Finally, 100 IJI of the BIODIPY casein workingsolution was added. The microplate wasincubated for 1 hour at room temperature,protected from light.

Fluorescence was measured with a filterfluorometer (excitation 485 nm, emission 535nm) on a SpectraFluor Plus microplate multi-detection plate reader controlled by X-Floracquisition utility software (TECANInstruments, USA).

RESULTS

BoPI 1-2 codes for a Serine ProteinaseInhibitorInsect Bioassays of Transgenic Plants

The bioassay arenas were constructed using a100-mm x 10-mm polystyrene petri dish. Asingle 10-cm diameter filter paper was placedin the bottom of the dish then moistened with1-2 ml of deionized water. Leaf disks were cutfrom mature tobacco leaves using a 4-cmdiameter leaf borer with a beveled cuttingedge that was fashioned from a length ofcopper pipe. Two leaf disks from each plantwere placed on the filter paper, then the arenawas covered using the lid of the petri dish.Three replicates for each plant line were

prepared.

The clone (bop; 1-2) was 809 bp andcontained the complete coding sequence aswell as the complete 3' noncoding sequences(data not shown). The clone contained anopen reading frame (ort) of 642 bp starting atnucleotide 2. The ort contained a typicalhydrophobic signal sequence at residues 1-21.The amino acid residues at positions 22-41corresponded to the amino-terminal sequencedetermined for the most abundant mature PI(Fig. 3). The predicted mature peptide had acalculated molecular weight of 21 kDa and acalculated pi of 4.94. These values fall withinthe range reported previously for cabbage Pis

(Broadway, 1993).The lepidopteran species used in this

experiment were the Bacillus thuringensis (Bt)susceptible tobacco budworm (Heliothis

24

The peptide encoded by bop; 1-2 waspredicted to be a member of the soybeanKunitz class of trypsin inhibitors. It alsoshowed significant similarity to the a-amylase/subtilisin inhibitors of cereals. Thepredicted peptide had a 30% 1dentity tosoybean trypsin inhibitor-3 (Jofuku et al.,1989). The predicted BoPI peptide containedthe sequence VLDTDGDIIFDGSYYVL atresidues 24-40, which matched the signature

pattern ({LlVD}-x-D-x-{EDNTY}-{DG}-{RKH DENQ}-x-{LlVM}-x( 5)- Y -x-{LlVM}) foundin the amino-terminal section of Kunitzinhibitor family members (Bairoch, 1991). Thearginine residue at position 63 correspondingto active site arginine of soybean trypsininhibitor (Sweet et al., 1974) and fourcysteines that could facilitate intrachaindisulfide bonds (Laskowski and Kato, 1980)were conserved in the cabbage sequence. Adrought-induced protein related to the Kunitztrypsin inhibitor family was cloned in B. napus(Downing et al., 1992). The conserved amino-terminal motif (residues 23-39) and the firstcysteine pair is present in the B. napussequence but not the active site arginine orthe second cysteine pair (Fig. 3) (Downing etal., 1992). Overall, the predicted BoPI peptidehad slightly less identity to the B. napuspeptide (46/214 identical residues) comparedto the soy peptide (56/214).

varying intensity were seen in each digest

(Fig 2).

Transgenic Plants

We recovered multiple events ofindependently transformed lines containingeach gene of interest from 300 leaf diskstaken from an inbred cultivar of tobacco(Xanthi) transformed with Agrobacterium (Fig.5) (Table 2). All plants were morphologicallynormal and fertile. Southern blot analysisdemonstrated that all transgenes wereintegrated with 1-4 copies contained in plants(data not shown).

Transgene Expression

Bt transgenic plants had similar expressionlevels compared with earlier work withtransgenic canola (Stewart et al., 1996b).There was a range of low (0.005%) to high(0.1 %) expression levels in transgenic plants.Likewise, enzyme analysis of PI trangenicsshowed a range of expression as determinedby the hydrolysis of BApNA by the appropriatedigestive enzyme. For example, BoPItransgenic plants (n=11) inhibited the releaseof p-nitroaniline from 6.31% to 27.61%compared to wild-type plants. There were nosignificant differences in proteinase inhibitionamong Pis at the P=0.05 level. In thesubsequent enzyme assays to moreaccurately assess individual plant linedifferences using an improved method(Menges et al. 1997, Thompson et al. 2000),the same relative patterns of transgenicexpressed PI to endogenous PI were similar(Fig 4). However, there was great variationamong lines of all transgenic plants'expression of the transgenes, as ,a/all asendogenous PI (Fig. 4).

Cabbage pi Gene Family

Genomic Southern blotting (Fig. 2) andanalysis of genomic clones (data not shown)suggested that BoPI was present as amember of a small gene family. This is similarto soybean (Jofuk.: and Goldberg, 1989) andpotato (Ishikawa et al., 1994) proteinaseinhibitors and winged bean chymotrypsininhibitor (Habu et al., 1992) gene families. Acabbage genomic library in Lambda Fix II(Stratagene) was constructed and screenedwith a cabbage bop; 1-2 cDNA. Six positiveclones were purifed and shown to fall into 2distinct classes by restriction digestionan~lysis. PCR amplification of the bop; codingsequences in the genomic clones suggestedthat these cabbage bop; genes are intronless(not shown). Cabbage genomic DNA wasdigested with enzymes that do not have sitesin the bop; 1-2 cDNA clone, and analyz~d bySouthern blotting. Several bands (6-8) of

Insect Bioassays and Plant Performance

Insect ass-ays and protein assays wereperformed on the same plants. In general, thegrowth and defoliation by the insects on wild-type (WT) leaf disks was higher thantransgenic leaf disks for all three insects (P <0.05) (Fig. 6). Likewise, larval corn earworm(CEW) survived significantly better on WTleaves than on any of the transgenics(P<0.05). All CEW that fed on transgenic

25

Xhol Xbal

EcoRI

MWB E H X"p

NPTII

pBIN19/BoPI14799 bps

\RB

\/

""1

2" ,..-NPTlII

~---~

3\1fji r:Gl~!' ~';...xktiJ lttIK$" IT1:1I

'!!...::Ii-f'X'7T9v!."~ST

;lIvl'C"TL!rNER~"

A;f".i1"f".i1GP~1'OrmDp .'WIWO Y~tI ELmtl

i;f"QIefRlSrnV" R/ii'-nP \I K\I~sUJHWL D Kl!LJJG ; :

II!'

DfGls rr'ilvf1:lp tf1lw1 toe NI!iJG TlUJ1WS DUJ-'rSlN

" R srR1v (;mV pm!:.iWSPYWIRlfJ!A{DGrl:

c,I'G"':;'!:.p~:

IrnM(':l...l!.I1'Lj:

~~~

COG,.

~m90pi

:.'Xkt13 m. .f'C1A !J $ A Y ;;fWI~WII;.l£jV..; I 'T~S

,:.('ii1AIY"'1Frv-rc1..~Fl.!!JNlr..:iJLI.Y..Lt;J'c

P A ? sf'JIw R 5 I. P\/ E D I.LP./E (; P A 'J

sf!1c M DrCI. .rT!1iAlgiD I) K\£J(; DllJ';

.rml ! .RLiJ. .

pm, e A (J G ems ~"W- -.-lIiJA M

E .: Gri1Ivl"RlG~ L ;;Ii D Dl9J11.BJ RU:..:!I V ~

Bop; !F1{",...t,) lfJ;

Sop, rnF~...tiJ ll!t ff'!!W'

;e-~c

..g

:.§.c..=cIJ)Co>...I-

Plant Line 4

Figure 1. Plasmid map of pBIN/BoPl. Figure 2. Cabbage genomic Southem. Digested cabbage genomic DNA was fractionated by gelelectrophoresis, transferred to a nylon membrane (Sambrook et al., 1989) and hybridized to d~oxygenin-labeled cabbage pin 1-2 according tomanufacturer's instructions (Boehringer-Mannheim, Indianapolis). The final wash conditions were 0.1x SSC at 55 °C. HybridiZIng bands werevisualized with Lumi-Phos 530 after exposure to film for 2 hours. Lanes: MW, digoxygenin-UTP-tailed Hindi" digest of lambda DNA (bands at 23, 9.4,6.5, 4.4, 2.3, 2.0 and 0.56 kb); B, BamHI; E, EcoRI; H, Hindi"; X, Xbal. Figure 3. Comparison of the amino acid sequence derived from the bopicDNA clone from cabbage (B. oleracea) with soybean Kunitz-type trypsin inhibitor 3 (G. max) (Jofuku et al., 1989) and the drought-induced BnD22from B. napus (Downing et al., 1992). The amino-terminal peptide sequcnce of the B. oleracea PI, residues 22-41, was determined at ComellBiotechnology Facility. The active site arginines in the B. oleracea and G. max Pis are shown with a closed circle, conserved cysteine residues areshown with triangles and the cleavage site to produce the mature cabbage peptide is shown with an arrow. The predicted PI peptides containedsequences starting at residues 24, 27, and 23 for B. oleracea, G. max, and B. napus respectively which matched the signature pattem ((LlVM}-x-D-x-(EDNTY}-{DGHRKHDENQ}-x-{LIVM}-x(5)- Y -x-{LIVM}) found in the amino-ierminal section of Kunitz inhibitor family members (Bairoch, 1991). Figure4. Enzyme (trypsin or chymotrypsis) assays performed on wildtype tobacco (Xanthi), BoPI and Manduca sexta anti-chymotrypsin NK32) individualevents (transgenic T1 progeny).

.

J),~

26

tobacco expressing the Bt endotoxin werekilled. However, there was more survivorshipof CEW when fed on tobacco expressing PIproteins compared with Bt (Fig. 6).Survivorship of CEW on plants expressing PIproteins (BoPI, M. sexta-AT, AC and AE) wassimilar. Survivorship of CEW on Bt transgenicplants was significantly different than CEW onPI transgenic plants (P < 0.05).

The average length of CEW on at plantswas smaller than CEW on any plantexpressing a proteinase inhibitor protein (Fig.6). The average length of H. virescens (YDKand YHD2) on Bt and BoP! plants weresimilar. These insects were smaller than H.virescens on the plants expressing the M.sexta proteinase inhibitors. However, themeans observed between Bt and BoPI, versusthe M. sexta Pis were not significantlydifferent (P < 0.05).A low, but comparable level of survivorship

was observed in YHD2 insects on Bt and BoPIplants. However, survivorship was high forYHD2 on plants expressing the M. sextaderived Pis. Moreover, the survivorship ofYHD2 that fed on plants expressing the M.sexta Pis was similar to that of YHD2 on wild-type plants. The mortality of YHD2 observedin Bt and BoPI transgenics was significantlydifferent than the survivorship of YHD2observed in the M. sexta derived PItransgenics (P < 0.05). This trend was alsoobserved in the YDK strain of H. virescens.Both Bt and BoPI transgenics were associatedwith similar levels of mortality of YDK insects.However, survivorship of YDK insects on anyM. sexta transgenic plant showed survivabilitysimilar to YDK on WT plants. The survival ofYDK on Bt and BoPI transgenic plants wassimilar, and the values were significantly lowerthan the survivorship of YDK on any of the M.sexta derived PI transgenics (P < 0.05).

DISCUSSION

The growth and development of caterpillarsare significantly reduced when on plantstransformed with Bt or PI (Hoffmann et al.,1992; Hua et al., 1993, Macintosh et al.,1990a; Santos et al., 1997). These studiesestablished that at is more effective than Pisin controlling lepidopteran insects. Thefindings in the present study expanded thisobservation to an array of serine proteinaseinhibitor genes, including anti-trypsin, anti-elastase and anti-chymotrypsin Pis, andcompared their effectiveness against at-susceptible and at-resistant caterpillars. Asexpected, tobacco transformed with at Cry1Acendotoxin was more effective in killing insectsthan any of the Pis examined in this study,with the exception of BoPI on TBWsurvivorship in the bioassay. This profounddifference between Bt and the Pis can beattributed to mode of action. The effect of Btingestion is immediate and more lethal thanthat of the Pis. Ingestion of the at endotoxininduces pore formation in the cells in theinsect midgut, causing death within hours. Incontrast, ingestion of Pis will ultimately lead toa decline in the feeding behavior of theinsects, resulting in a decrease in growth,causing death in several days.

As anticipated, the average defoliation byCEW, YDK and YHD2 on wild-type plants wassignificantly higher (P < 0.05) than the

defoliation observed on the transgenic plants(Fig. 6). The average defoliation by CEW inall transgenics was similar, and no significantdifferences in defoliation by CEW wereobserved among transgene type (P < 0.05).

However, defoliation by CEW was slightly

higher among plants expressing proteinaseinhibitors than in at plants. Likewise, theaverage defoliation by YHD2 in all transgenicswas similar, and no significant differenceswere observed among transgene type.Defoliation by YHD2 was slightly higheramong plants expressing proteinase inhibitorsthan in Bt plants. Defoliation by YDK in plantsexpressing the M. sexta AT and AE proteinaseinhibitor proteins had defoliation levels similarto non-transgenic plants. There were nodifferences in the average defoliation by YDKon Bt, BoPI and the M. sexta AC transgenics.

The cabbage-derived PI (BoPI) used inthis study shows promise as a useful naturalinsecticide against certain lepidopteraninsects. BoPI effectively reduced survivorshipof the Bt-resistant (YHD2) and Bt-susceptible(YDK) strains of tobacco budworm, exhibitinglevels similar to plants producing the Cry1Actoxin. However, BoPI plants were not aseffective at reducing survivorship of cornearworm (CEW). This finding is consistentwith a previous study on CEW that

27

Figure 5. Development of tobacco transgenic plants; A-Leaf explants for cocultivation; B-Shoot buddevelopment from cocultivated explants; C- Transgenic plants growing on medium and D-Comparison oftransgenic leaf performance with wild leaf to insect bioassay.

28

120

100

mCEW

8TBW (YDK)

DTBW fYHD2)

20

-~-

Bt

aWild-

TypeAT AC AE

fransgene

_6

E.5.5.c

'g,4.!!~ 3~co

-I 2

CCEW

.TBW (YDK)

C TBVv (YHD2)

~

8t

0

Wild-Type

BoPI AT AC I\E

Transgene

100

I:JCEW

8TBW (YDK)

I:JTBW (YHD2)

-;;:~

ia>

'>...~II)

II)

~IV

..J

80

60

40

20

Wild-Type

St AT

ACAE

Transgene6\

dJi"C""

BoP:

29

reported significant differences in thesusceptiblity to St (Cry1 Ac) among field strainsof TBW and CEW. Of the two species, CEWhad a higher tolerance for Cry1Ac. It was alsounusual to observe that there were nodifferences in performance between TDK andYDH2 when allowed to feed on Bt-transgenicplants. While we have no explanations forthese apparently aberrant results, the BoPItransgenic plants performed comparably to Btin TBW control.

incorporated cabbage proteinase inhibitorsinto artificial diets (Broadway, 1995, 1996).Broadway investigated the potential ofherbivorous insects to become resistant toplant proteinase inhibitors, under thehypothesis that long-term exposure to certainproteinase inhibitors would reduced the toxiceffects of subsequent exposure to thosetoxins. For instance, diamondback moth

(Plutella xylostella) , imported cabbageworm(Pieris rapae), and cabbage loopers(Trichoplusia m) are all cabbage specialists,and possess adaptive defenses to cabbagephytochemicals. Hypothetically, they shouldbe more resistant to Pis in cabbage. Incontrast, generalists like CEW, an insect thatdoes not feed on cabbage, should be moresusceptible to cabbage Pis. In vitro inhibitionstudies demonstrated that the trypsins frcmimported cabbageworm were not susceptibleto inhibition by cabbage PI, while the trypsinsfrom CEW were significantly inhibited bycabbage PI (supporting the hypothesis).However, feeding studies using artificial dietdemonstrated that growth and developmentfor both species was not effected by ingestionof cabbage PI (Broadway, 1995). Similarresults were found when the insects werefeeding on plant tissue containing trypsininhibitors (Broadway and Colvin, 1992;Broadway 1995). In contrast, the cabbagelooper was susceptible to cabbage PI asdemonstrated by in vitro inhibition studies andingestion studies. That study demonstratedthat some lepidopterans have the ability toadapt to certain PIs by secreting a suite ofenzymes that are not susceptible thoseinhibitors (Broadway, 1996). In the presentstudy, survivorship and defoliation levels bycorn earworm on BoPI plants, were similar tothose observed on plants expressing theManduca sexta derived serine Pis, confirmingthat CEW is not susceptible to cabbage PI.

While BoPI does have some merit as ,lepidopteran control agent, it will likely notperform well stacked with Bt in transgenicplants. As Santos et al. (1997) point out, Pismay inhibit proteinases needed to activate Btprotoxin into the insecticidal form. In BoPI x Bthybrids, we have observed a significantdecrease in antibiosis (data not shown).Nonetheless, BoPI might prove to be aneffective PI for lepidopteran control intransgenic plants when Bt is not desirable. Itmight also be useful when a plant-derivedtransgene is desired.

ACKNOWLEDGEMENTS

This research was supported, in part, byUSDA NRI grant #91-37302-6219 (RMB),Hatch funds (RMB) and UNC-Greensborofaculty grants (CNS). We wish to thank AprilQuick, and Wendy Kain for their assistance inproducing the data. We would like to thankHans Bohnert for the Manduca sexta PIvectors and Guy Cardineau and DowAgroSciences for the Bt cry1 Ac gene andantibody. We also thank Fred Gould for~upplying YDK and YDH2 strains of tobaccobudworm for insect bioassays.

~

,I.:

t

Another interesting observation of thepresent study was the heightened sensitivity ofCEW to St. It is not clear why CEN wascompletely controlled in this study by Cry1 Ac.Since we had a range of Bt expression, weexpected some larval survival. Previousinvestigations have reported that CEW wasless sensitive to the Cry1Ac delta-endotoxinthan the observations in the present study(Luttrell et al., 1999; Macintosh et al., 199Gb;Sims et al., 1996). Stone and Sims (1993)

REFERENCES

Bairoch,

A. 1991. Prosite: A dictionary of sitesand patterns in proteins. Nucleic AcidRes. 19: 2241-2246.

Baldwin, I. and Schultz, J. 1983. Rapidchanges in tree leaf chemistry induced bydamage: E'iidence for communictionbetween plants. Science 221: 277-279.

family accumulates upon water stress inleaves, not in seeds. Plant J. 2:-685-693.

Boulter, D. 1989. Genetic engineering of plantsfor insect resistance. Outlook onAgriculture 18: 2-6.

Doyle, J., and Doyle, J. 1987. A rapid isolationprocedure for small amounts of fresh leaftissue. Phytochemical Bulletin 19: 11-15.

Boulter, D. 1993. Insect pest control by copyingnature using genetically engineered crops.Phytochemistry 34: 1453-1466.

Geiger, J., and Fritz, G. 1983. Determination oftrypsin inhibition. In Methods of enzymaticanalysis HU B, Bergmeyer J, Grass M(eds) VCH Publishers, Deerfield Beach,FL, pp. 121-126.

Bradshaw, H., Jr.,. Hollick, J., Parsons, T.,Clarke, H., and Gordon, M. 1990.Systemically wound-responsive genes inpoplar trees encode proteins similar tosweet potato sporamins and legumeKunitz trypsin inhibitor. Plant Mol. Bioi. 14:51-59.

Graham, J., Hall, G., Pearce, G., and Ryan, C.1986. Regulation of synthesis ofproteinase inhibitors I and II mRNAs inleaves of wounded tomato plants. Planta169: 399-405.

Green, T., and Ryan. C. 1972. Wound-inducedproteinase inhibitor in plant leaves: Apossible defense mechanism againstinsects. Science 175: 776-777.

Gould, F., Anderson, A., Reynolds, A.,Bumgarner, L., and Moar, W. 1995.Selection and genetic analysis of aHeliothis virescens (Lepidoptera:Noctuidae) strain with high levels ofresistance to Bacillus thuringiensis toxins.J. Econ. Entomol. 88: 1545-1559.

Brattsten, L. B. 1991. Bioengineering of cropplants and resistant biotype evolution ininsects: counteracting coevolution. Arch.Insect Biochem, Physiol. 17: 253-267.

Broadway, R.M. 1993. Purification and partialcharacterization of trypsin/chymotrypsininhibitors from cabbage foliage.Phytochemistry 33: 21-27.

Broadway, R. M. 1995. Are insects resistant toplant proteinase inhibitors? J. InsectPhysiol. 41: 107-116.

Broadway, R. M. 1996. Dietary proteinaseinhibitors alter complement of midgutproteases. Arch. Insect Biochem. Physiol.32:39-53. Habu, Y., Peyachoknagul, W., Umemoto, K.

Sakata, Y., and Ohno, T. 1992. Structureand regulated expression of Kunitz

.chymotrypsin inhibitor genes in wingedbean Psophocarpus tetragonolobus L.DC. J. Biochem. 111 :249-258

Broadway, R.M., and Duffey, 5.5. 1986. Theeffect of dietary protein on the growth anddigestive physiology of larval Heliocoverpazea and Spodoptera exiqua. J. InsectPhysiol. 32: 827-833.

Hilder, V., Gatehouse, A., and Boulter, D.1993. Transgenic Plants Contering InsectTolerance: Protease Inhibitor Approach. InTransgenic plants Kung S, Wu R (eds)Academic Press, Inc, London, pp. 317-338.

Broadway, R.M., and Missurelli, D.Regulatory mechanisims ofinhibitory activity in cabbagePhytochemistry 29: 3721-3725.

1990.trypticplants.

Broadway, R.M., and Colvin, A.A.1992.Influence of cabbage proteinase inhibitorsin situ on the growth of larval Trichoplusiani and Pieris rapae. J. Chemical Ecology18: 1009-1023.

Downing, W.L., Mauxion, F., Fauvarque, M.O.,Reviron, M.P., de Vienne, D., Vartanian,N., and Giraudat, J. 1992. A Brassicanapus transcript encoding a proteinrelated to the Kunitz protease inhibitor

Hoffmann, M.P., Zalom, F.G., Wilson, L.T.,Smilanick, J.M., Malyj, L.D., Kiser, J.,Hilder, V.A., and Barnes, W.M. 1992.Field evaluation of transgenic tobaccocontaining genes encoding Bacillusthuringiensis delta-Endotoxin or cowpeatrypsin inhibitor: efficacy againstHeiocoverpa lea (Lepidoptera:Noctuidae). J. Econ. Entomol. 85: 2516-2522.

31

Horsch, R.B., Fry, J.E., Hoffman, N.L.,Eichholtz, D. Rogers, S.G., and Fraley,R.T. 1985. A simple and general methodfor transferring genes into plants.Science 227:1229-1231.

Lipke H, Fraenkel G, Liener I (1954) Effect ofsoybean inhibitors on growth of Triboliumconfusum. Food Chern. 2: 410-414.

Lorito, M., Broadway, R., Hayes, C., Woo, S.,Noviello, C., Williams, D., and Harman, G.1994. Proteinase inhibitors from plants asa novel class of fungicides. Mol. Plant-Microbe Interact. 4: 525-527.

Hua, X.K., Chen, X.B., Ma, W., and Fan, Y.L.1993. Transgenic tobacco plants bycotransformation with proteinase inhibitorII and delta-endotoxin genes. ChineseScience Bulletin 38: 1561-1566. Luttrell, R.G., Wan, L., and Knighten, K. 1999.

Variation in susceptibility of noctuid(Lepidoptera) larvae attacking cotton andsoybean to purified endotoxin proteins andcommercial formulations of Bacillusthuringiensis. J. Ecan. Entamol. 92: 21-32.

Hay,

C., and Shelton, A. 1987. Feedingresponse of Artogeia rapae (Lepidoptera:Pieridae) and Trichoplusia ni (Lepidoptera:Noctuidae) to cabbage leaf age. Environ.Entomol. 16: 680-682.

Macintosh, S.C., Kishore, G.M., Perlack, F.,Marrone, P.G., Stone, T.B., Sims, S.R.,and Fuchs, R.L. 1990a. Potentiation ofBacillus thruringiensis insecticidalactivity by serine protease inhibitors. J.Agric. Food Chem. 38: 1145-1152.

Ishikawa, A., Ohta, S., Matsouoka, K., Hattouri,T., and Nakamura, K. 1994. A family ofpotato genes that encodes Kunitz-typ~proteinase inhibitors: structuralcomparisons and differential expression.Plant Cell Physiol. 35:303-312.

Macintosh, S.C., Stone, T.B., Sims, S.R.,Hunst, P.L., Greenplate, J.T., Marrone,P.G., Perlack, F.J., Fischhoff, D.A., andFuchs, R.L. 1990b. Specificity andefficacy of purified Bacillus thuringiensis

proteins against agronomically importantinsects. J. Invertebr. Pathol. 56: 258-266.

Jofuku, K.D. and Goldberg, R.B. 1989. Kunitztrypsin inhibitor genes are differentiallyexpressed during the soybean life cycleand in transformed tobacco plants. PlantCell 1:1079-1093.

Jofuku,K.D., Schipper, R.D., and Goldberg,R.B. 1989. A frameshift mutation preventsKunitz trypsin inhibitor messenger RNAaccumulation in soybean embryos. PlantCell 1:427-436.

Menges, D.A., Ternullo, D.L., Tan-Wilson,A.L., and Gal, S. 1997. Continuous assayof proteases using a microtiter platefluorescence reader. Anal. Biochem.254: 144-147.

Johnson, R., Narvaez, J., An, G., and Ryan, C.1989. Expression of proteinase inhibitors Iand II in transgenic tobacco plants: Effecton natural defense against Manduca sextalarvae. Proc. Nat!. Acad. Sci. USA 86:9871-9875.

Napoli, C., Lemieux, C., and Jorgensen, R.1990. Introduction of a chimeric chalconesynthase gene into petunia results inreversible co-suppression of homologousgenes in trans. Plant Cell 2: 279-289.Kanost, M.R., Sarvamangala, V.P., and Wells,

M.A. 1989. Primary structure of a memberof the serpin superfamily of proteinaseinhibitors form an insect Manduca sexta. JBioi. Chem. 264: 965-972.

Oppert, B., Morgan, T.D., Culbertson, C., andI Kramer, K.J. 1993. Dietary mixtures of

cysteine and serine proteinase inhibitorsexhibit synergistic toxicity toward the redflour beetle, Tribolium castaneum. CompoBiochem. Physiol. 105C: 379-385.

Laskowski,M. and Kato, I.'inhibitors of proteinasesBiochem.49:593-626.

1980.

.Ann

ProteinRev.

Sanchez-Serrano, J.J., Keil, M., O'Connor, A.,Schell, J., and Willmitzer, L. 1987. Wound-induced expression of a potato proteinaseinhibitor II gene in transgenic tobaccoplants. EMBO J. 6: 303-306.

Laskowski, M.

Enzymes.York

and Sealock, R.

Academic Press,

1977.

TheInc., New

j

t~~~:r;

32

Stone, T.8., and Sims, S.R. 1993. Geographicsusceptibility of Heliothis virescens. andHeliocoverpa zea (Lepidoptera:Noctuidae) to Bacillus thuringiensis. J.Econ. EntomoJ. 84: 989-994.

Sanchez-Serrono, J., Schmidt, R., Schell, J.,and Willmitzer, L. 1986. Nucleotidesequence of proteinase inhibitor IIencoding cDNA of potato (Solanumtuberosum) and its mode of expression.Mol. Gen. Genet. 203: 15-20.

Sweet, R.M., Wright, H.T., Clothia, C.H., andBlow, D.M. 1974. Crystal structure of thecomplex porcine trypsin with soybeantrypsin inhibitor (Kunitz) at 2.6 Aresolution. Biochemistry 13:4212-4228.

Santos, M., Adang, M., All, J., Boerma, H., andParrott, W. 1997. Testing trangenes forinsect resistance using Arabidopsis.Molecular Breeding 3: 183-194.

Thomas, J., Adams, D., Keppenne, V.,.Wasmann, C., Brown, J., Kanost, M., and

Bohnert, H. 1995. Protease inhibitors ofManduca sexta expressed in transgeniccotton. Plant Cell Rep. 14: 758-762.

Sims, S.R., Pershing, J.G., and Reich, 8.J.1996. Field evaluation of transgenic corncontaining a Bacillus thuringiensis Berlinerinsecticidal protein gene againstHelicoverpa zea (Lepidoptera: Noctuidae).J. Entomol. Sci. 31: 340-346.

Thomas, J.C., Wasmann, C.C., Echt, C., Dunn,R.L., Bohnert, H.J., and McCoy, T.J. 1994.Introduction and expression of an insectproteinase inhibitor in alfalfa (Medicagosativa L.). Plant Cell Rep. 14: 31-36.

Stewart, C.N., Jr., Adang, M.J., All, J.N.,Boerma, H.R., Cardineau, G., Tucker, D.,and Parrott, W.A. 1996a. Genetictransformation, recovery, andcharacterization of fertile soybeantransgenic for a synthetic Bacillusthuringiensis cry lAc gene. Plant Physiol.112: 121-129.

Thompson, V.F., Saldana, S., Cong, J., andGolI, D.E. 2000. A BODIPY fluorescentmicroplate assay for measuring activity ofcalpains and other proteases. Anal.Biochem. 279: 170-178.

Vogel, R., Trautschold, I., and Werle. E. 1968.Natural proteinase inhibitors. AcademicPress, New York.

Xu, D., Xue, Q., McElroy, D., Mawal, y" Hilder,V.A., and Wu, R. 1996. Constitutiveexpression of a cowpea trypsin inhibitorgene, CpTi, in transgenic rice plantsconfers resistance to two major rice pests.Molecular Breeding 2: 167-173.

Stewart, C.N., Jr., Adang, M.J., All, J.N.,Raymer, P.L., Ramachandran, S., andParrott, W.A. 1996b. Insect control anddosage effects in transgenic canola,Brassica napus L. (Brassicaceae),containing a synthetic Bacillusthuringiensis cry lAc gene. Plant Physiol.

, 112:115-120.

Stewart, C.N., Jr., and Via, L.E. 1993. A'rapidCT AB DNA isolation technique useful frRAPD fingerprinting and other P(applications. Bio Techniques 14: 748-57 -