Annals of Tropical Medicine & Public Health-Special February 2018 Vol 2.2

ISSN: 1755-6783

Internationally indexed

journal The journal is registered with the following abstracting partners: Baidu scholar, CNKI, EBSCO Publishing’s Electronic databased, Google Scholar, National Library, ProQuest, and African Index Medicus. It is indexed with DOAJ, EMASE, ESCI, Index Copernicus, Scimago Journal Ranking, and

SCOPUS

Impact factor for 2018: 2.75

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Title Page

The effect of an educational intervention based on SP38-18 BASNEF Model on nurses communication skills with patients in educational hospitals of Tehran in 2017 Status of heart rate variability and hemodynamic SP44-18 parameters of women-teachers according age

Investigating psychiatric disorders (Axis I) in trauma SP40-18 patients admitted to three trauma centers in Tehran city

Evaluation of antibacterial and anti-fungal properties SP41-18 of adding ZnO nanoparticles to tissue conditioner used in complete denture

The influences of sleep disorder on cognitive functions SP42-18 of a brain of patients with type 2 diabetes

The study of changes levels of liver enzymes and blood SP43-18 platelets before and 72 hours after phlebotomy

Using multiplex PCR method for distinguishing the SP44-18 aflatoxigenic and non-aflatoxigenic strains of Aspergillus flavus from isolated animal feed from industrial animal husbandries

Effect of photodynamic therapy with toluidine blue SP45-18 photosensitizer on nonsurgical management of peri- implant mucosal inflammation

Impact of an information booklet on knowledge and SP46-18 skills of mothers with children with cerebral palsy

The impact of demographic factors and professional SP47-18 quality of life on caring ability of nurses in intensive care units (ICUs) Prioritizing the factors affecting the operation and SP48-18 maintenance of medical equipment in Iran hospital based on AHP model

Investigation of Crown lengthening procedure on SP49-18 dimensions of supra crystal gingival tissues

Investigation of the actual costs of provided services in SP50-18 a health unit (Health House) in Kurdistan Province and proposing a model for credit allocation in the health sector

i

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

The effect of an educational intervention based on BASNEF model on nurses

communication skills with patients in educational hospitals of Tehran in 2017

Nazari, S1, Jalili Z

2*, Tavakoli R

3

1. MSc. Student, Department of Health Education and promotion, science and Research Branch, Islamic Azad

University, Tehran, Iran 2. Associate Professor, Department of Health Education and promotion, science and Research Branch, Islamic

Azad University, Tehran, Iran -corresponding author: Zahra.jalili@gmail.co m 3. Associate Professor, Department of Health Education and promotion, science and Research Branch,

Islamic Azad University, Tehran, Iran

*Corresponding author ABSTRACT Background and Aim: Effective communication is a vital element of nursing care. Nurses are the key people who are of the highest communication with patients . Nurses can inform from the demands of patients and can respond to them through establishing an effective communication. Effective communication skills in nu rses lead to satisfaction of patients from nursing services, stress reduction in patients and acceleration of their treatment process. Therefore, the current study aims to determine the effect of educational intervention based on BASNEF model on communicat ion skills of nurses with patients in educational hospitals of Tehran during 2017. Material & Method: In the current controlled before & after quasi-experimental study, 96 nurses from selected educational hospitals were selected by Clustering method and were randomly divided into intervention and control groups. Data was collected from a researcher made questionnaire based on BASNEF model. The collected data was distributed into samples after checking for validity and reliability. Educational intervention was performed, after pre-test, during 3 sessions, each 45 min., for intervention group based on presentation, question and answer, group discussion and deliberation. Descriptive statistics (frequency, frequency percent, mean and standard deviation) was use d for data analysis while inferential statistics (independent T-test, paired T-test, analysis of variance) was used for determining the level of significance. A statistical software, named as spss18, was used for above analyses in both intervention and con trol groups. Results: The results of the current investigation were showed that after intervention in the intervention group, the average knowledge mark, in addition to the structures of BASNEF model including attitude, subjective norms, enabling factors, behavioral intention, and behavior were obviously different from control group (p -value<0.05). It confirms the effect of education based on BASNEF model on communication skills of nurses with patients. Conclusions: Regarding the results of the current research, education of communication skills with patients based on the structures of BASNEF model can improve such skills in nurses and educational researchers will propose suitable education models to educational programmers based on these results . Keywor ds: BASNEF model, communication skills of nurses, patients INTRODUCTION Interpersonal communication between health care providers is the most important factor affecting the satisfaction of health care systems . The communication ability of employees of health system, especially nurses is very important. In addition, nurses are the greatest provider of health care services, who have a significant potential to influence the quality of health care. The communication topic in the nursing profession is very impo rtant, and its improvement has always been considered as a necessity in patient -centered programs and orientations (B Kermani et al. 2015). The Main factors of communication in the hospital are patients and nurses. The communication with patients is one of the key roles of nurses , which leads to improvement of health care and patient health, professional and social

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

personality development of nurses . Effective communication between nurses and patients and their relatives increases the satisfaction of patients and their companions (H Mahmoudi et al. 2010). When there is not enough time to communicate effectively with the client there will be many consequences. These consequences are not only psychological and behavioral, but also include physical aspects such as improving health indicators and recovery rates (M Barati et al. 2012). Establishing the right communication is essential to nursing care and has been emphasized on many occasions. Some nurse experts consider the ability to establish proper communication as the heart of all nursing care. Unfortunately, despite the importance of communication skills and its positive effects the results of the research have shown that nurses and other health care workers have been weak in communication with patients (P Porzoor et al. 2015). Gholami et al. (2012) reported a mean score of nurses' communication skills of 116.14±9.43 and often stated them at moderate level that there is a Meaningful relationship between communication skills, age, education and position. Siyamian et al. (2013) reported the mean score of communicational skills of health care personnel at 0.42 ± 4 and at moderate level. In this study, there was a significant relationship between communication skills and marriage status. Barati et al. (2012) using the Barton J tool reported a mean score of communication skills of health care employees of 61.12 ± 8. 215 employees (69.6%) had moderate communication skills, 86 (27.8%) had good communication skills and 8 (2.6%) had poor communication skills. However, Baghiyani Moghaddam et al. (2012) reported in their study that the average score of the communication skills of the managers of the medical education departments was 58.15±4.66 and the highest mean score was in the field of feedback 21.14±2.9 in the units under study. Other studies have also reported that nurses working in educational centers have poor communication skills and often do not establish proper and appropriate communication with the patient (M Safavi et al. 2016). Although communication skills are complex behaviors, they have the ability to teach and learn (S Soltani Arabshahi et al. 2016). It seems that patient-oriented communication skills require special attention and it is necessary to take essential measures in this regard. Due to the good relationship between nurses and patients as the main core of patient care, educational programs in this field should be coordinated with clinical practice and in line with clinical work, and also effective educational methods should be used (S Sabzevariet al. 2006). Therefore, it is necessary to have an active and continuous planning for effective communication between the nurse and the patient in order to meet the needs of the patients (M Matin et al. 2006). Therefore, in order to improve the level of health care services and increase the efficiency it is recommended that effective communication skills training workshops be held at all levels of health care services (F Zarei et al. 2012). Studies have shown that one of the useful educational patterns that in add ition to knowledge and attitude, environmental factors and subjective norms also affect people's health behaviors is a BASNEF pattern. This model includes structures of visible behavior manner, attitude, relatively permanent organization of beliefs about an object or situation that prepares a person to react in a particular direction; factors enabling, factors such as facilities, money, time and skill that are necessary conditions for realizing behavior and perceived subjective norms of social pressure to imply that a person follows the wishes of those who are more important to him than others (H Izadirad et al. 2013). The BASNEF model was presented by John Hubley in 1988. He believed that this model should be viewed as a

review list for the planning of a program rather than a general description of the complex processes that are found in the layers of the behavior of a person. The BASNEF model is consist of the elements of behavioral beliefs, attitudes,

subjective norms and enabling factors, which the word BASNEF consists of putting together the first letters of these

elements. This model is derived from the combination of both PRECEDE and behavioral intention models and is used to study the behavior and planning to change it and determine the factors that af fect people's decision making

to conduct behavior. The main difference between the BASNEF model and the behavioral intention model is that in this model, contrary to the behavioral intention model, any intention does not necessarily lead to behavior but there

are incentive factors such as money, skill, precision and existing services between the two, intention and behavior. In

studies that examined the mechanisms of the BASNEF model, also their effectiveness in establishing and changing behavior has been proven (A Khani Jeihooni et al .2012). Therefore, considering the necessity of communication

skills for nurses in improving the quality of services offered , in all phases of patient care both physical and mental

aspects and its effect on patients' satisfaction during hospitalization, this study aimed to determine the effect of educational intervention based on the BASNEF model on nurses' communication skills with patients in educational

hospitals of Tehran in 2016-2017. By carrying out this training based on the structures of the BASNEF model, a framework will be developed to improve the communication skills of nurses with patients , which will be their

guidelines as a part of their tasks. The results of this study will be presented to nurses and

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

nursing managers to be used in planning to improve the quality of health care services , which ultimately will increase the satisfaction of patients with the quality of hospital services. METHOD This semi-experimental study was a pre- and post-test control group with 96 nurses from selected educational hospitals affiliated to Tehran University of Medical Sciences with the aim of determining the effect of education based on the BASNEF model on communication skills of nurses with patients in the year 2016-2017. To determine the sample size according to the sample size of the Cochran samples for finite populations, by considering a 95% certainty and 80% power of test, the sample size was calculated to be 48 for each group. Thus, 48 nurses in the control group and 48 nurses in the intervention group a total of 96 nurses formed the research sample. The criteria for entering the study were made by nurses with a bachelor's or master's degree in nursing, who worked in different job shifts and willingness to cooperate in the pres ent study. Out-of-study criteria were nurses with less than six months work experience and those who had absent more than one session or were reluctant to participate in the study were excluded from the study. The sampling of nurses was based on clustering method. In this regards, two hospitals of Tehran University of Medical Sciences were randomly selected from seventeen hospitals. One hospital was considered as an intervention group and the other one as a control group. Then from each hospital four sections were selected randomly. The data-gathering tool was a researcher-made questionnaire based on the design of the BASNEF model and its validity and reliability. The questionnaire consisted of three parts: The first part contains demographic information of nurses (age, gender, marriage status, years of service, education level, employment status of shift work, type of department, passing of communication skills course); the second part consists of 21 question questions with scale of "correct, false", and the third part of the questionnaire related to the structures of the BASNEF model which included (14 questions of attitude), (9 questions of subjective norms), (10 questions of enabling factors), (9 behavioral intention questions), (30 behavior questions) which was scale measured with a 5-degree Likert scale. To determine the validity of the questionnaire, it was presented to 10 health education and health promotion professors. After the announcement of the results by the panel of judges, the necessary amendments were made and again sent to the professors to obtain a narrative confirmation. Finally, the questionnaire received a sufficient score in the accepted range of CVR-CVI. To determine the reliability of this questionnaire, samples were submitted to 15 nurses in a similar hospital and completed by them. The internal correlation of the questionnaire was calculated using Cronbach's Alpha method which was a 94% coefficient indicating a strong internal consistency of the questionnaire. Test-Retest method was used to determine the external correlation of the questionnaire, which was completed in two stages by 15 days by the same nurses. The results obtained from the Pearson test was 99.2 indicating a high repeatability. According to the goals, the research stages were designed as follows. In the pre-intervention stage first, the researcher referred to the research environment with the permission and the introduction of the letter and after her introduction to the authorities explaining the objectives , the method of work and the order of research and obtaining

permission from them began their research. Ethical considerations such as confidentiality of the information contained in the research samples, filling out the informed consent form by them as well as full authority to participate in the study and withdrawal from the study were observed. At the beginning of the work, briefing sessions for all the samples including the intervention and control group were presented to indicate the research objectives, how to complete the questionnaire and how to train the intervention. Then a pre-test was conducted

where all the studied cases including the control group and the intervention group completed the designed questionnaire including demographic questions and knowledge q uestions and questions of the structures of the BASNEF model (attitude, subjective norms, enabling factors, behavioral intent, and behavior). Then, the results of the questionnaires were analyzed using spss18 software. In the educational intervention, according to the results of

the pre-test questionnaire and the BASNEF model, the educational program included lectures , group discussion, deliberation, question and answer using educational aids accompanied by a presentation of a package of compilations including pamphlets and CDs. This training was conducted during three training sessions each time for 45 minutes (for nurses, head nurses and nursing directors). The stage after intervention was measured 3 months after the last session of the study in order to evaluate the effect of interventions . The questionnaire was used again for the test group. The results of the test and completed questionnaires were entered into the software and the results were compared with the results of the first stage. Limitations and problems of the research project includes limitation on the allocation of time and place on the part of the authorities, the high volume of work of nurses and the need for more time to complete the questionnaires, problems with the shift in the availability of the nurses and lack of easy access to them.

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Data was analyzed using SPSS 18 software. Descriptive statistics (frequency, frequency percentage, mean and standard deviation) were used to analyze the data and to determine the level of significance, inferential statistics (Chi-square, Fisher exact, independent T-test, one-way analysis of variance, Wilcoxon and T-paired) were used. RESULTS Data were analyzed for the both groups of 48 subjects in the intervention group and 48 in the control group. The results of the research regarding demographic variables using Fisher test showed that there was no statistically significant relationship between the two groups of intervention and control and the two groups were homogeneous. The demographic profile of each group is presented in (Table 1). Independent T-test showed that there was no significant relationship between the mean of knowledge in the two groups before the educational intervention and the paired T-test in the intervention group showed that the average score of knowledge three months after the intervention significantly increased (p<0.001) . In the control group, paired T-test showed that the mean of knowledge before and three months after the intervention did not have a significant relationship. Independent T-test showed that there was no statistically significant relationship between mean score of attitude in two groups of intervention and control, and paired T -test in intervention group showed that the mean score of attitude three months after training compared with before education was meaningful (p<0.001). The mean score of subjective norms in the intervention and control groups before intervention was not significant and the paired T-test in the intervention group showed that the average score of subjective norms three months after the intervention was significantly correlated with pre -training (p<0.001). However, there is no meaningful relationship in the control group three months after the training . Independent T-test showed that there was no significant relationship between mean score of behavioral intention in the two groups before t he intervention and the paired T-test in the intervention group showed that the mean score of the behavioral intention three months after the intervention was significant (p<0.001). There was no significant relationship in the control group three months after the intervention . Independent T-test showed that there was no significant correlation between the average score of enabling factors in the two groups before the intervention. Paired T-test in the intervention group showed that there was a significant correlation between the mean score of enabling factors three months after training compared to the pre -training (p<0.001). However, there is no meaningful relationship in the control group after three months of training . Independent T-test showed that there was no significant relationship between the mean components of behavioral intention and behavior in the two groups before the intervention . Paired T-test in the intervention group showed that the mean score of behavioral intention and behavioral factors increased significantly three months after the training (p<0.001). However, in the control group the mean score components of behavioral intention and behavior after three months after the intervention was not significant (Table 2). In examining the relationship between demographic variables and the structures of the BASNEF model in relation to

communication skills with nurses' patient attendance, which were conducted in intervention and control groups,

independent T-test and one-way variance before and after educational intervention showed that there is a statistically

significant difference between the components of demographic, years of service and passing communication courses

with the structures of the BASNEF model, both in the pre-test and post-test at a level of 0.95. This means that nurses

who have completed the course of communication with the patient as well as nurses who have passed through years

of experience in this field have improved their communication skills with the patient. Though, there is no

statistically significant difference between other dimensions of demographic components with the structures of the

BASNEF model, in other words , age, gender, marriage status, level of education, employment status , work shift,

and type of nurses' department do not affect the amount of their knowledge, attitude, subjective norms, and

behavioral intention on the communication skills of the patient. The results of the study are shown in Tables 3 and 4. DISCUSSION Mean knowledge scores in the intervention group increased compared to three months after training which indicates the effect of educational intervention on nurses' knowledge about patient communication skills tha t is in line with other studies (Zarei et al.2012; Managheb et al.2008; Sharifirad et al. 2007). Based on the results of this study, the mean scores of nurses' attitudes were improved three months after the intervention based on the BASNEF model in the intervention group, which was due to nurses' knowledge about communication skills with the patient and their influence on their beliefs which led to a positive attitude toward them in promoting effective communication skills with the patient as a necessity in the nursing profession. These findings are in line with other studies of Zarei et al.2012; Managheb et al.2008; Sharifirad et al. 2007.

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Based on the results of this study, the mean scores of subjective norms three months after the intervention in the intervention group significantly increased, indicating the effect of educational intervention on nurses and nursing directors and their other nursing colleagues , which was the most effective factor in supporting the role of subjective norms. These findings are in line with the studies of Mehamed et al. 2005. Increasing the mean scores of enabling factors three months after intervention in the intervention group indicated that nurses had access to the resources and financial resources available for particip ation in educational classes. The availability of enabling factors can be an effective facilitator for the practice of the desired behavior, which in this study can be considered as effective factors in improving commun ication skills with the patient, which are in line with the studies of Mehamed et al. 2005. The improvement in the mean of behavioral intention scores in the intervention group compared to the control group, three months after intervention was indicative of the effect of educational intervent ion based on the BASNEF model on nurses' behavioral intention in relation to improving the effective communication skills of the patient and using these skills more effectively. These findings are in line with the studies of Mehamed et al. 2005. The average of behavioral scores on effective communication skills of nurses with patient in the intervention group was increased compared to the control group, three months after the intervention, indicating the effectiveness of the educational intervention based on BASNEF model on nurses' behavior regarding effective communication skills with the patient. The results of the current study are consistent with the following studies (Zarei et al.2012; Managheb et al.2008; Sharifirad et al. 2007). The results of this s tudy considering the difference between the demographic variables and the structures of the BASNEF model in relation to the effective communication skills with patient, showed that there was no statistically significant difference between age, gender, type of department, work shift, and employment status of nurses with other components of the BASNEF model (p-value>0.05), which has been consistent with the study of Cheraghi et al. 2016. In addition, there was no significant difference in the current study between marriage status of nurses and other components of the structures of the BASNEF model (p -value>0.05), as Moharreri et al 2012 has achieved the same result. In this research, there was no significant difference between the level of nursing education an d the structures of the BASNEF model in spite of expectations (p -value>0.05). This can be due to the failure to include communication skills training in university courses, which brings about the vacuum of the educational system in our country. This meets Taghizadeh et al. 2007 studies . There was a significant difference between the years of service of nurses and the structures of the BASNEF model (p-value<0.05). This difference can be a source of personal experience in patient communication skills over the years; because communication skills are mainly acquisitive and the individual clinical experiences play a major role in improving these skills. Taghizadeh et al. (2007) has achieved the same result in their studies. There was also a significant difference between the time spent on communication with patients by nurses and the structures of the BASNEF model (p-value<0.05). This indicates that nurses who have completed the course of communication with the patient have improved their effective communication s kills with the patient. Taghizadeh et al. (2007) has achieved the same result in their studies. CONCLUSION Considering the results of this study, educational intervention based on BASNEF model results in the improvement of the score of components of knowledge, attitude, subjective norms, enabling factors , behavioral intent and behavior in communication skills with nursing patients. Therefore, based on this educational model, it is recommended to train educational planners for effective use in nursing educa tional programs, regarding effective communication skills with patients including nursing students' training in university courses , training new staff and nursing in-service training, to enhance these skills in the most effective way. ACKNOWLEDGMENTS This research is based on student's dissertation Master's degree in health education and health promotion Faculty of Medical Sciences, Islamic Azad University, Science and Research Branch of IRAN (IRU.SRB.REC.1396.14). In this way, we would like to thank and gratitude all those who helped the researchers in the implementation of this project.

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Effect of the training program based on the BASNEF model

________________________________________________________

Indivi dual Beliefs

Beliefs about the results of

Attitude about

doing an individualized

behavior

behavior

Behavior

Behavior

Subjective Intention Intention

Normative Beliefs Norms

Beliefs about whether others

BASNEF model

Fig. 1 Schematic chart of the

Enabling

are willing to do the right

Factors

thing or not

absolute and relative frequency of demographic of nurses in two

groups of intervention and control

Variable

Intervention Group Control Group p-value

Frequency (% )

Frequency (% )

Age

20-30 16 (33.3) 16 (33.3) 0.15

31-40

23 (47.9)

19 (39.6)

over

41 9 (18.8) 13 (27.2)

Gender

Female 38 (79.1) 32 (45.8) 0.14

Male 10 (20.8) 16 (33.3)

Marriage Status

Single 23 (47.9) 23 (47.9) 0.36

Marrie

d 25 (52.1) 24 (50.0)

Years of Service

0-10 years 18 (37.5) 18 (37.5) 0.49

11-20 years

22 (45.8) 24 (50.0)

21-30 years 8 (16.7) 6 (12.5)

Level of Education

Bachelor 38 (79.1) 41 (85.4) 0.54

Master Degree 10 (20.8) 7 (14.6)

Employment Status

Under Training 4 (8.3) 1 (2.1)

Conventional 2 (4.2) 3 (6.3) 0.24

Contractual 25 (52.1) 20 (41.6)

Officia

l 17 (35.4) 24 (50.03)

Work Shift

One Turn 15 (31.3) 15 (31.2) 0.39

Two Turns

16 (33.3) 15 (31.2)

Three Turns 17 (35.4) 18 (37.5)

Type of Department

Special 12 (25.0) 12 (25.0)

Emergency 12 (25.0) 12 (25.0) 1.00

Interna

l 12 (25.0) 12 (25.0)

Surgical 12 (25.0) 12 (25.0)

Communication Skills

Course Attendance 0.09

Yes 10 (20.8) 14 (29.2)

No 38 (79.1) 34 (70.8)

Fischer test was used to calculate p -value

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Table 2-Distribution of scores obtained from the BASNEF model in the intervention and control groups

before and after the intervention

Variable Intervention Control

Before After Effect Before After Effect T-test p-value

M ± SD M ± SD M ± SD M ± SD M ± SD M ± SD

Knowledge 0.50±12.6 0.54±0.17 1.60±5.94 0.53±11.06 0.53±11.05 0 3.57 0.0001

Attitude 20.06±3.68 35.64±3.45 14.58±0.57 5.34±21.65 3.57±20.89 0 3.56 0.0001

Subjective 23.75±0.52 34.75±0.14

11±0.38

23.77±0.68

23.64±.64

0.13±0.57 3.56 0.0001

Norms

Enabling 21.68±1.67 39.21±1.43

17.53±0.46

21.96±1.16 21.74±1.47

0 4.67 0.0001

Factors

Behavioral 16.36±1.86 29.42±.56

13.16±1.45

16.26±3.35 15.61±1.46

0 3.57 0.0001

Intention

Behavior 56.45±0.46 85.43±1.54 29.98±0.75 56.85±1.56 55.43±2.45 0 4.35 0.0001

Independent T-test and one-way variance were used to calculate p-value

Table 3-Relationship between demographic variables and baselines of BASNEF model in

intervention group before and after educational intervention

Knowledge

Attitude

Subjective Enabling Behavioral Behavior

Norms

Factors Intention

After

Befor After

Befor After

Befor After

Befor After

Befor After

Befor

e e e e e e

Age 0.333 0.537 0.542 0.541 0.245 0.234 0.535 0.535 0.798 0.823 0.245 0.234

Gender 0.813 0.743 0.624 0.536 0.156 0.467 0.319 0.212 0.013 0.457 0.156 0.467

Marriage Status 0.711 0.736 0.871 0.871 0.345 0.478 0.568 0.526 0.456 0.356 0.345 0.478

Years of Service 0.010 0.012 0.001 0.001 0.001 0.001 0.001 0.003 0.001 0.001 0.001 0.001

Level of 0.135

0.196

0.196

0.251

0.113

0.356

0.345

0.845

0.434 0.214 0.231 0.356

Education

Employment

Status 0.623 0.623 0.601 0.625 0.756 0.573 0.683 0.682 0.678 0.664 0.756 0.573

Work Shift 0.756 0.845 0.775 0.555 0.456 0.547 0.526 0.560 0.567 0.467 0.456 0.547

Type of 0.871

0.716

0.765

0.836

0.546

0.845

0.424

0.424

0.256 0.278 0.546 0.845

Department

Communication

Skills Course 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

Attendance

Independent T-test and one-way variance were used to calculate p -value

Table 4-Relationship between demographic variables and baselines of BASNEF model in control

group before and after educational intervention

Knowledge

Attitude

Subjective Enabling Behavioral Behavior

Norms

Factors

Intention

After

Befor After

Befor After

Befor After

Befor After

Befor After

Befor

e

e

e

e

e e

Age 0.645 0.624 0.387 0.375 0.751 0.777 0.724 0.812 0.412 0.657 0.751 0.777

Gender 0.211 0.223 0.276 0.312 0.456 0.234 0.643 0.454 0.328 0.467 0.456 0.234

Marriage Status 0.832 0.846 0.561 0.517 0.192 0.245 0.251 0.251 0.242 0.367 0.556 0.245

Years of Service 0.009 0.012 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

Level of 0.125

0.196

0.173

0.121

0.227

0.356

0.431

0.723

0.312 0.321 0.289 0.356

Education

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Employment

Status 0.578 0.613 0.473 0.471 0.432 0.576 0.654 0.528 0.534 0.521 0.432 0.576

Work Shift 0.325 0.321 0.345 0.524 0.313 0.356 0.176 0.572 0.423 0.473 0.313 0.567

Type of 0.456 0.461 0.873 0.873 0.543 0.637 0.212

0.367

0.425

0.695 0.543 0.637

Department

Communication

Skills Course 0.0004 0.004 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001 0.001

Attendance

Independent T-test and one-way variance were used to calculate p -value

References:

Barati,M.,Moeini, B., Samavati, A., Salehi, O.,2012.Assessment of communication skills level among medical

college students:verbal,listening,and feedback skills. J Urmia Nurs Midwifery Fac, 10 (2).pp.63-69. [In Persian]

Cheraghi, F., Sanahmadi ,A., Soltanian, A., Sadeghi, A., 2016. The Ssurvey of Nurses' Communication Skills with

Mothers and Hospitalized Children During Nursing Cares in Children Wards. Sci J Hamadan Nurs Midwifery Fac, 24 (3.pp.193-200. [In Persian] Izadirad, H., Masoudi ,G R., Zareban, I., Shahraki Poor, M., Jadgal, K.,2013. The Effect of Educational Program

Based on BASNEF Model on Women ’s Blood Pressure with Hypertension . Journal of Health Chimes. , 1 (2) .pp.22-31. [In Persian]

Kermani, B., Darvish, H., Ahmadi, A., Bani Asadi, A., Kolivand, P., 2015. Correlation between Communication Skills and Nurses' Standardized Communication in Hazrat Rasoul Akram Complex, The Neuroscience journal of shefaye k hatam, 3 (S1) .pp.16-24.[In Persian]

Khani Jeihooni, A.,Hatami,M., Kashfi, M., Heshmati, H.,2012. The Effectiveness of Education Based on BASNEF Model Program in Promotion of Preventive Behavior of Leishmaniasis among Health Worke rs and Families under Health Centers Coverage. Journal of Fasa University of Medical Science , 2 (1).pp.26-33.[In Persian]

Khatib Zanjani ,N., Moharreri, M., 2012.Assessing the Nurses' Knowledge and Awareness of Effective Verbal Communication Skills. Media, 3 (1) .pp.11-20. [In Persian]

Mahmoudi ,H.,Ebadi,A., Salimi, H., Najafi Mehri, S., Mokhtari Noori, J., Shokrollahi, F.,2010. Effect of nurse

communication with patients on axiety, depression and stress level of emergency ward patients. IJCCN, 3 (1).pp.3-

4.[In Persian]

Managheb ,S E., Jaafarian ,J., firouzi ,H., 2008. The effect of communication skills training based on Calgary - Cambridge guideline on knowledge, attitude and practice of family physician of Jahrom UNIVERSITY of medical sciences 2007. jjums.; 6 (3 and 4).pp .74-84. [In Persian]

Matin, M., Parvin ,N., Reisi ,S., Deris ,F., Reisi, M H.,2012. The study of the relationship between nurses and patients in Hajar hospital wards of Shahrekord in 2010, Journal of Clinical Nursing and Midwifery , 1 (2).pp.1-8. [In Persian]

Mehamed,F.,Sharifi,gh.,Shadzi,Sh,.Mosavi,AM.,Hasanzadeh,A.,2005.The Effect of Interpersonal Communication Skills Training on Healthy Families Based on the Healthy Model on Improving the Weight of 12-4 Months Children in Gachsaran 2004. Kerman University of medical sciences,5(14).pp. 1-8. [In Persian]

Porzoor, P., narimani, M., ebrahimi, M., Soleimani, E.,2015. Relationship between nursess social problems solving ability and their empathy in intensive care units, Quarterly Journal of nursing management, 3 (4).pp.27-35. [In Persian]

Sabzevari, S., Soltani Arabshahi, K., Shekarabi, R., Koohpayehzadeh, J.2006, Nursing Students ’ Communication with Patients in

Hospitals Affiliated to Kerman University of Medical Sciences,Iranian Journal of Medical Education, 6 (1). Pp.43-49. [In Persian]

Safavi, M., Ghasemipenchah, S., Fesharaki, M., Esmaeilpour Bandboni, M.,2016. Communication Skills and Its Related Factors in Guilans Teaching Hospitals' Nurses 94. Scientific Journal of Hamadan Nursing & Midw ifery Faculty, 24 (1).pp.50-57. [In Persian]

Sharifirad ,GH.,Baghiani Moghadam, MH.,Shadzi ,sh.,Mahamed ,F.,2006. The effectiveness of teaching

communicative skills to the health staff in improving the knowledge and behaviors of mothers of 4-12 month- old

children affected with weight losses . Bimonthly journal of Ilam University of medical sciences, 13(4) .pp.1 -8. [In

Persian]

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Soltani Arabshahi ,S., Ajami, A., Siabani, S.,2004. Investigation of Doctor-Patient Communication Skills Teaching,

Medical Learners ’ Perception (Stager-Intern) and Staffs of Iran University of Medical Sciences & Kermanshah University of Medical Sciences, RJMS, 11 (41).pp.423-431. [In Persian]

Taghizadeh,z.,Rezaiepor,A.,Mehran,A.,Alimoradi,Z.,2006.Usage of communication skills by midwives and its

relation .hayat,12(4).pp.47-55. [In Persian]

Zarei, F., Shojayizade, D.,2012. The Effect of Educational Intervention Based on BASNEF Model to Improve

Interpersonal Communication Skills of Nurses . Alborz University of Medical Sciences, 1 (3) .pp.173-178. [In Persian]

SP38-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Status of heart rate variability and hemodynamic parameters of women-teachers according to age.

Meruyert Burumbaye va1, Aiman Mussina

1, Ros a Suleimenovа1

, Karlygash

Tebenova2, Gulnaziya Alshynbekova

2, Abdrakhman Kulov

2

1JSC "Astana M edical University", Kazakhstan, 010000, Astana, Beybitshilik Street, 49A

2The Karaganda State University named after academician E.A. Buketov, Kazakhstan, Karaganda city, 100026, Karbysheva 7

ABSTRACT

The aim of this study is to examine the state of heart rate variability and hemodynamic of women-teachers

working in Astana secondary schools, depending on age, whose length of time worked is more than 20 years.

The study showed that with age there is a gradual decrease in involuntary nervous system influences on the

heart rate, reduction in the activity of parasympathetic autonomic nervous system, increase the stress of

regulatory systems. Women of 55-59 years old had definite stress of regulatory systems significantly higher

statistically. Also there was detected a trend toward improvement in systolic, diastolic, average and pulse

pressure values at the age of 40 to 59 years old. Women-teachers of 60 years and older had lower values of

heart rate variability and integrated hemodynamic parameters associated with a reduction in the influence of

rate sympathetic regulation and a decrease in basal metabolism.

Keywords: heart rate variability, hemodynamics, the index of regulatory systems activity, the index of functional changes, women-teachers.

Introduction

Cardiovascular diseases (CVD) being the cause of one-third of all deaths, are called a global problem and now scientists around the world believe that the heart rate variability (HRV) is a valuable non -invasive tool that can be used to check the balance of heart autonomic nervous system [1]. We all know that heart rate variability is inversely proportional to the increased content of cholesterol, increased blood pressure, coronary atherosclerosis, and stroke. [2] Change of heart rate is one of the predictors to be used as a criterion for evaluating the functional state of the body [3].

As the heart rhythm depends on the sex, age, and even the type of activity, the proposal of the European Society of Cardiology and the North American Society of Electrophysiology and Cardiac Pacing to conduct population studies aimed at identifying HRV standards for various contingents [4] is of great current interest.

According to statistics for 2015 in this country 48.4% of 8 510.1 thousand working employees are women. The proportion of women working in education is on the third place among all other professional groups . 81.3% of teachers are women [5] and 35% of them are experienced (with work experience of more than 20 years) women-teachers [6]. Innovations constantly introducing in the education s ystem to orient it to the new socio-economic environment and high requirements to the level of future school leavers training are work complicating factors for the teacher, which in turn can exacerbate both occupational health and general functional status of a working person. The constant activity of the working people requires a large flow of in ward power of a person. Continuous overload and stress factors at work may lead to disorganization of the employee [7- 11].

The high level of neuro-emotional stress and the degree of responsibility for the decisions made, the work done, and for the safety of students accompany the teaching profession definitely, thereby increasing the risk of developing cardiovascular diseases, hyperstress, and etc. [12-13]. Despite this, today there are only few researches aimed to study teachers ’ health and safety, which do not give a

complete picture of the women teachers CVS state according to age. Given the specificity and intensity of work, as

SP39-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

well as the inevitable physiological changes associated with aging, it is important to study the state of the cardiovascular system and functional characteristics of heart rate regulation among experienced women-teachers, to assess the functional state and to develop the adequate correction methods .

Taking into account all of the above, the purpose of our study was to examine the state of the cardiovascular system and functional characteristics of heart rhythm regulation of women -teachers taking into account their age peculiarities . Methods

The design of this study. This was a cross -sectional study. It was conducted among women with acceptable entry criteria: professional affiliation - teachers of educational institutions of Astana, over 20 years of work experience at school. Entry criteria were: acute and chronic morbidity.

The period from 2014 to 2016 was analyzed in the study. The sampling was represented by teachers of secondary schools of Astana. In general, the study involved 200 teachers of 40 to 71 years old. Before starting the study, all patients received an informed consent. This physiological study d id not contradict the principles of the Declaration of Helsinki and was approved by the local Ethics Committee. The average age of the patients was 49.5 ± 0.5 years, average professional experience was 27.7 ± 0.5 years (from 20 to 50 years). All examined women were divided into 5 age groups (40-44 years, 45-49 years, 50-54 years, 55-59 years, 60 years and older). The present scientific research taking into account its objectives and tasks included the registration of heart rate variability, using Varikard hardware and software complex of "Ramena" Company (Russian Federation). ECG records were made within 5 minutes of sitting, the patients were in a calm, relaxed state. The following parameters were evaluated:

1. The statistical characteristics of cardio intervals dynamic line: heart rate (HR, beats/min), the average length of the RR interval (Mean, ms), the total index of RR interval variability values for 5 minutes period (SDNN, ms); t he square root of the sum of the squares of the difference between the values of successive pairs of NN intervals (RMSSD, ms); percentage of successive intervals pairs NN, which differ by more than 50 ms (PNN50, %); the coefficient of variation (CV,%).

2. The spectral analysis of indicators: the total spectrum power (Total Power, TP, MC2), a high -frequency power

(High Frequency, HF, MC2), low frequency (Low Frequency, LF, mc2), very low frequency (Very Low Frequency,

VLF, mc2) ultra low frequency (Ultra Low Frequency, ULF, mc

2) components and the ratio LF / HF

(vagosympathetic interaction index);

3. According to R.M. Bayevsky, cardiointervalography indicators: fashion (Mo, ms), the degree of autonomous regulation circuit activity (CC1, c.u.); the degree of activity of the central regulating circuit (CCO, c.u.); centralization index (IC, c.u.); index of regulatory systems stress (SI, c.u.); IARS (a measure of activity of regulatory systems). IARS (index of activity of the regulatory systems) values are express ed in points from 1 to 10. Based on these points there were diagnosed the following functional states of: 1. The optimum stress regulation systems (IARS = 1-2). 2. Moderate stress of regulatory systems (IARS = 3-4). 3. Expressed stress of regulatory systems (IARS = 4-6). 4. Regulatory systems overstress (IARS = 6-7). 5. Exhaustion of regulatory systems (IARS = 7-8). 6. Adaptation failure (IARS = 8-10) [4,14,15,16].

SP39-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Also, the following parameters we registered: respiratory rate (RR breathing acts /min), systolic blood pressure (SBP, mmHg), diastolic blood pressure (DBP mm Hg), the calculation of the index of functional changes (IF C, points), the integral of peripheral hemodynamics: mean arterial pressure (MAP, mm Hg), pulse pressure (PP, mm Hg), minute

volume of blood circulatory (BCV l/min), systolic blood volume. (SBV, ml), cardiac index (CI, l/min*m2), the stroke

volume index (SVI, ml), total peripheral vascular resistance (TPVR, dyn/s*cm2), the index of total peripheral

vascular resistance (TPVRI, dyn/s*cm2), myocardial stress index (MSI c.u.), the indicator of myocard output work

(MOW c.u.). Statistical analysis. Computational procedures of mathematical statistics methods were used in the study, implemented in the licensed integrated "Statistica 6" package of complex statistical data. Kolmogorov -Smirnov test was used to assess the normality of distribution. The results of quantitative variables are presented as mean ± standard deviation (M ± SD). To detect statistical significance of differences of certain parameters mean values, the Student's t-test was used between the groups . The p-value <0.05 was considered statistically significant . Results

Out of 200 surveyed women-teachers under the study, in the age group of 40-44 years there were included 70 women (mean age 41.4 ± 0.2, experience in the specialty 21.1 ± 0.2), in the group 45-49 years - 33 women (mean age 46.9 ± 0.26, experience in the specialty 25.4 ± 0.6), 50-54 year - 41 females (mean age 52 ± 0.2, experience in the specialty 29 ± 0.6), 55-59 - 35 women (mean age 57 ± 0.3, experience in the specialty 33.7 ± 0.8), 60 years and over - 21 women (mean age 63.3 ± 0.7, experience in the specialty 40.4 ± 1.1). During HRV data analysis it was found that between the age groups of women -teachers significant differences in heart rate parameters were there, the average length of the RR interval, mode and stress index (Table 1). Heartbeat Frequency Indicator of women-teachers 40-44 years (75.5 ± 1.4 beats/min.) was higher than that of other age groups, and was significantly higher (p <0.03) compared with women -teachers 50 -54 years (70.6 ± 1.7 beats/min.). The average length of the RR interval was the lowest in the age group of 40-44 years old (811.5 ± 13.4 ms) and had a statistically significant difference (p <0.015) from the age group of 50-54 years old (872.3 ± 22.9 ms). The highest values were RMSSD with 55-59 years old women (271.7 ± 85.5 ms), and the lowest in the age group of 60 and more years old (171.2 ± 36 ms). Similarly, it was with the total variability index values of RR intervals and coefficient of variation. However, between these indicators of temporal analysis no statistically significant differences were found in the five age groups .

Indicators of spectral analysis of HRV were h igher in the age groups of 50-54 and 55-59 years old, the lowest values of indicators were identified in the age group of 60 years old teachers and older. In the age group of 55 -59 years old,

the total spectral power (TP) was significantly higher (199.9 ± 47.7 ms 2) compared to others . Similarly, the figures

of low-frequency, very low frequency, and ultra-low-frequency component of spectral analysis were higher, as well as the index vagosympathetic interaction. However, statistically significant differences between these indicators were not identified.

Table 1. HRV values of women-teachers with regard to age.

40-44 years

45-49 years

50-54 years

55-59 years

60 years and older

Index n=70 n=33 n=41 n=35 n=21

Interim analysis

HR, beats/min 75,5±1,4w3*

74±2,4 70,6±1,7 w1*

72,9±2,2 71,3±1,9

Mean, ms 811,5±13,4 w3*

833,9±23,6 872,3±22,9 w1*

851,1±27,7 852,3±21,5

RMSSD, ms

203,01±30,1 188,2±38,5 221,6±39,2 271,7±85,5 171,2±36

pNN50, % 13,8±1,8 13,3±3 10,5±2,1 9±2,1 11,7±3,8

SDNN, ms 169,1±22,1 160,3±29 178,2±26,6 218,5±60,8 144,7±27

SP39-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

CV, % 20,5±2,6

19±3,2

19,2±2,4 24,2±6,7 16,5±3

Spectral analysis

T P, ms2 171,2±26,9 167,5±32,2 182,9±31,4 199,9±47,7 131,8±25,2

HF, ms2 118,6±19,8 108,2±21,2 121,8±23,6 128,2±29,8 89,5±15,9

LF, ms2 90,8±13,4 92,2±18,7 95,7±15,4 114,4±31,1 63,6±13,4

VLF, ms2 58,3±10,4 66,4±14,9 65,5±12,6 74,2±19,4 50,5±15,4

ULF, ms2 41,2±8,6 40,5±8,6 49,01±10 45,6±11,3 31,6±7,5

LF/HF, у.е. 0,96±0,1 1,2±0,2 1,2±0,2 1,3±0,2 0,8±0,2

Indicators cardiointervalography by R.M. Bayevsky

Mo, ms 781,5±12,4 w3*

808,5±18,8 830,2±18,6 w1*

804,3±26,6 826,4±21,7

CC1, c.u.. 0,75±0,01 0,76±0,03 0,8±0,015 0,8±0,02 0,7±0,03

CC0, c.u. 8,5±0,5 9±0,8 10,23±0,9 9,9±1,02 8,5±0,8

SI, c.u. 282,3±32,2w4**

312,8±55,6w4*

552,8±172,85 561,9±103,9w1** w2*

405,6±83,6

IC, c.u. 1,1±0,06 1,2±0,1 1,3±0,1 1,3±0,1 1,1±0,2

IARS, points 4±0,2 4,1±0,3 4,3±0,3 4,6±0,3 4,1±0,4

Note: w1 - a group of 40-44 years old women, w2 - a group of 45-49 years old women, w3 - a group of 50-54 years old women, w4 - a group of 55-59 years old women; * - T he differences between the groups were statistically significant (p <0.05) ** - difference between the groups is statistically highly significant (p <0.001). Among the cardiointervalography indicators according to R.M. Bayevsky, a trend of higher values with higher age was noted, there was a more pronounced increase in the regulation systems ’ stress . However, in the age group of 60 years and older the lowest values were noted indicating the predominance of parasympathetic regulation of heart rate. Mode value of 40-44 years old women-teachers (781.5 ± 12,4 ms) was significantly lower (p <0.026) than that of 50-54 years old women-teachers (830.2 ± 18.6 ms). Centralization, vagosympathetic interaction index, as well as the indices per regulation activity degrees indicate the activity predominance of the central mechanisms of regulation over the autonomous mechanisms .

Centralization index was highest and similar in age groups of 50-54 and 55-59 years old (1.3 ± 0,1 c.u.). Vagosympathetic interaction index was similar in 45-49 and 50-54 years old women, and the highest in 55-59 years old women (1.3 ± 0.2 c.u.). The degree of regulation circuit autonomous activity was equally higher in 50-54 and 55-59 years old women (0.8 ± 0.8 and 0.015 c.u. ± 0.02 c.u. respectively), and lowest in the age group of teachers of 60 and more years old (0.7 ± 0.03 c.u.). The degree of central regulation contour activity was highest in 50-54 years old women (10.23 ± 0.9 c.u.). The activity of sympathetic regulation mechan isms and the state of the central control circuit can be judged by the stress index (SI). Stress index in the age group of 40-44 years old was the lowest (282.3 ± 32.2 c.u.) and also increased with age. There were statistically high significant differences between the age groups of 40-44 and 55-59 years old (p <0.001); and within the group of 45-49 years old women-teachers (312.8 ± 55.6 c.u.) there were statistically significantly (p <0.04) low stress values of the index compared to the age group of 55-59 years old (561.9 ± 103.9 c.u.). Index of regulatory system activity in all studied women corresponded to the degree expressed stress of regulatory systems (IARS = 4-6) and was statistically significantly higher in 55-59 years old women (4.6 ± 0,3, points).

Table 2. Values of hemodynamic parameters and integrated indicators of women-teachers considering their age.

40-44 years 45-49 years 50-54 years

55-59 years

60 years and older

Index n=70 n=33 n=41 n=35 n=21

RR breathing 20,3±0,5

w4*

22,5±0,7

w2*

acts/min 21,3±0,4 21,2±0,5 21,8±0,8

2,6±0,042w2*w3**w4**w

IFC, points 5** 2,7±0,062w1* w4* w5*

2,8±0,05w1**

2,9±0,07w1** w2*

2,9±0,05w1** w2*

SBP, mmHg 122,2±1,6 123,1±2,8 127,1±1,9w5*

127,3±2,6 120,5±2,3 w3*

SP39-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

DBP, mm Hg 75,1±1,2w3*w4**

74,2±1,5 w3* w4**

79±1,3w1* w2*

82±1,8w1** w2**

77,9±1,9

M AP, mm Hg 90,8±1,2 w3*w4**

90,5±1,6 w3* w4*

95±1,4 w1* w2*

97,1±1,9w1** w2*

92,1±1,8

PP, mm Hg 47,1±1,3 48,9±2,7 48±1,5 w5*

45,3±1,7 42,6±2,1 w3*

40,2±1,2w1**

w2** 33,9±1,2w1** w2** w3** 31±1,97 w1** w2** w3**

SBV, ml 48,3±1,1 w3** w4** w5** 46,5±1,8 w3** w4** w5** w4**w5** w5* w4*

BCV, l/min 3,7±0,1 3,4±0,2 w3** w4** w5** 2,8±0,1 w2** w4* w5** 2,5±0,1 w2** w3* w5* 2,2±0,1 w2** w3** w4*

CI, l/min*m2 2,2±0,07 w3** w4** w5** 1,9±0,09 w3* w4** w5** 1,6±0,07 w1** w2* w5* 1,4±0,08

w1** w2** 1,3±0,08 w1** w2** w3*

23,2±0,9 w1** w2*

w4* 19,6±0,8 w1** w2** w3* 18,4±1,2 w1** w2** w3*

SVI, ml 29±0,7 w3** w4** w5** 26,6±1,1 w3* w4** w5** w5* w5* w4*

2135,5±81,9 w3**

w4** 2261,1±110,4w3* w4**

2876,5±156,1w1**

w2* 3440,1±214,9w1** w2**

3734,4±338,5w1** w2**

TPVR, dyn/s*cm2 w5** w5** w4* w5* w3* w3*

TPVRI, dyn/s*cm2

1284,7±53,7 w3**

w4** 1293,9±69w3* w4** w5**

1648,3±92,9w1**

w2* 1970,3±118,5w1** w2**

2225±216,5w1** w2**

w5** w4* w5** w3* w5* w3** w4*

M SI, c.u. 9,22±0,2 9,1±0,4 9±0,3 9,3±0,4 8,6±0,26

3,3±0,1w1** w2** w3** 2,8±0,16

M OW, c.u. 4,4±0,09 w3** w4** w5** 4,2±0,2w4** w5** 3,8±0,1w1** w4** w5** w5** w1** w2** w3** w4**

Note: w1 - a group of 40-44 years old women, w2 - a group of 45-49 years old women, w3 - a group of 50-54 years old women, w4 - a group of 55-59 years old women, w5 - a group of women 60 years and older; * - The differences between the groups were statistically significant (p <0.05) ** - difference between the groups is statistically highly significant (p <0.001).

Respiratory rate (Table 2) in 55-59 years old women was higher than that of other age groups (22.5 ± 0.7 breathing acts/min), and differed significantly (p <0.05) from the group of 45-49 years old women (20.3 ± 0.5 breathing acts/min).

IFC calculation showed that the level of the blood circulatory system functioning consistent with stress of adaptation mechanisms . The highest values were observed in the age groups of 55-59 (2.9 ± 0.07 points) and 60-over 60 years old (2.9 ± 0.05 points).

Hemodynamic indicators of women-teachers had statistically significant differences in the values of SBP, DBP, MAP, PP, BCV, SBV, CI, SVI, TPVR, TPVRI, and MOW. So, there was a trend to an increase in SBP, DBP, MAP, and AP values at the age of 40 to 59 years, and their maximum values were observed in the age groups of 55-59 years old. Women-teachers of 60 years old and over 60 these indicators had median values of DBP and MAP and the lowest values of SAD and PP compared with other age groups, as well as systolic (120.5 ± 2.3 mm Hg) and pulse pressure (42 6 ± 2.1 mm Hg) were significantly lower (p <0.05) than that of 50-54 years old teachers . Statistically highly significant differences (p <0.001) were between the indicators of DBP and MAP in women of 40-44 years and 55-59 years old, and of 45-49 and 55-59 years old.

With age the values of SBV, BCV, SVI, CI were lowering. Multiple statistical differences were found between the age groups: SBV statistically significantly higher (p <0.001) in women 40-44 years, BCV is statistically significantly (p <0.001) lower in teachers of 60 and older (2.2 ± 0.1 l/min) compared with the ages from 45 to 59 years old, CI

(2.2 ± 0.07 l/min*m2) and SVI (29 ± 0.7 ml) of 40-44 years old teachers were the highest and significantly different

from indicators of 50-54, 55-59, and 60-over 60 years old women. With age TPVR (2135.5 ± 81.9 dyn/cm

2 to a * 3734.4 ± 338.5 din/s*cm

2) and TPVRI (from 1284.7 ± 53.7

dyn/s*cm2 to 2225 ± 216.5 dyne/s*cm

2) increased and differed statistically significantly in women of 40-44 years

old (p <0.001), 50-54 years old (p <0.001), 55-59 years old (p <0.001) and 60-over 60 years old (p <0.001). The lowest value of myocardial stress index had teachers of 60-over 60 years old (8.6 ± 0.26 c.u.) and significantly higher (p <0.001) had teachers of 40-44 years old (4.4 ± 0,09 c.u.), and statistically low (p <0.001) values were observed at the age of 60-over 60 years old (2.8 ± 0.16 c.u.). Discussion

SP39-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Stress index values in all age groups were significantly higher than the normal range and showed a high degree of regulatory systems stress . From the literature it is known that the stress index is very sensitive to the increased tone of the sympathetic nervous system and the psycho -emotional overload, which are always there in the work of teachers and can enhance the activity of this indicator [16]. Russian scientists claim that the decrease in women ’s vagal regulation occurs before the age of 51-60. The shift to the predominance of the sympathetic nervous system influence in the control of heart rhythm happens at the age of 41-50 [17]. About the regulator systems ’ stress certifies the calculated indicator of regulatory systems activity, which

corresponded to the degree of the expressed regulatory systems stress, and was significantly higher in women of 55-

59 years old. This shows the active mobilization of protective mechanisms including increasing the activity of the

sympathetic-adrenal system and pituitary-adrenal system (IARS =4-6). For women in peri-menopause and post-

menopause overactivation of sympathetic - adrenal system is quite usual. The occurrence of such conditions may

associate with mental stress in teachers, as prooved by studies of P.M. Baevs ky et al [14], which is caused by a

variety of factors: fear of job loss, long working days, dissatisfaction with professional status, underestimation of

managers and colleagues, increased responsibility and poor labor motivation. All this may eventually lead to

exhaustion of compensatory mechanisms that reduce the adaptive capacity of the body and as a result to increase the

risk of various diseases [18]. About the stress of adaptation mechanisms, one can judge by the IFC, which corresponded to the level o f stress of the circulatory system functioning. High values were in the age groups of 55-59 (2.9 ± 0.07 points) and 60-over 60 years old (2.9 ± 0.05 points), confirming regular decrease of adaptive mechanisms, typical at that age.

The found tendency to increase the values of SBP, DBP, MAP, PP at the age from 40 to 59 years old, and their maximum values noted in the age group 55-59 years, corresponds to the results of previous studies, which suggest that with age the level of systolic arterial blood pres sure increases, while the diastolic pressure is changed slightly. With age also increases the average pressure and pulse pressure. Increased arterial blood pressure is mainly due to age-related changes in the vascular system - loss of elasticity of the large arterial trunks, increased peripheral vascular resistance. It should be noted, however, that, despite the increasing values of these factors in the elderly, blood pressure does not rise significantly due to the reduction in cardiac output and an increas e in capacity of the aortic elastic reservoir [19].

With age, such changes of heart muscle fiber as atrophy and replacement by connective tissue are inevitable. As a result, the force of heart rate decreases and metabolic disorders increase. This leads to a dynamic-energy deficit at work related to the body's stress . Clinical and experimental studies have shown that with increasing age hemodynamic variables such as cardiac output and cardiac index decrease, and total peripheral vascular resistance, and its index respectively, go up. This pattern was also found in our study. It is assumed that the reduction of minute volume of blood circulation with age is associated with a fall of the basal metabolism, a nd decrease in the metabolic processes in which the oxygen demand is reduced. Some scientists have linked an increase in total peripheral vascular resistance with organic disorders in the vessels . It is known that during aging in peripheral arteries, especially in small vessels sclerosis develops, thereby significantly decreasing its clearance, and this explains the increased values of TPVR and TPVRI.

Lower hemodynamic parameters in older women suggest the domination of cardiovascular system humoral - metabolic link, which manifests itself in the form of reducing the number of premature beats in rhythmogram and displacement of cardiac rhythm management autonomic balance towards sympathetic activity [20]. Conclusion

Thus, the results indicate that with age there was a gradual decrease in autonomic influences on the heart rate, reduction in the activity of parasympathetic autonomic nervous system, increase the stress of regulatory systems . Women teachers 60 and older revealed lower rates of heart rate variability and integrated hemodynamic parameters associated with a reduction in the influence of the sympathetic link of rate regulation and a decrease in basal metabolism.

SP39-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

In view of the above the following statements can be considered sufficiently substantiated. With age structural, metabolic and functional changes do occur in the cardiovascular system. These involutional disturbances lead to the emergence of new cardiac rhythm management levels . Along with this , compensatory mechanisms responsible for normal blood circulation in various states of stres s do trigger. But do not forget, that with aging adaptation possibilities also reduce, so given the fact that the explored category of women-teachers is constantly exposed to occupational stress and works in heightened requirements conditions, the study of the functionality of their bodies and the development of adequate methods to remedy such conditions is relevant. References.

Choi, B., Schnall, PL., Dobson, M., Garcia-Rivas, J., Kim, H., Zaldivar, F., Israel, L., Baker, D. (2014) Very long (>48 hours) shifts and

cardiovascular strain in firefighters: a theoretical framework. Ann Occup Environ Med. 2014;26:5. DOI: 10.1186/2052-4374-26-5

Kang, D., Kim, Y., Kim, J., Hwang, Y., Cho, B., Hong, T., Sung, B., Lee, Y. (2015) Effects of high occupational physical activity, aging,

and exercise on heart rate variability among maleworkers . Ann Occup Environ Med. 2015;27:22. DOI: 10.1186/s40557-015-

0073-0. eCollection 2015. Baevsky, R.M. (2002). Analysis of heart rate variability using different electrocardiographic systems/ method. Recommendations . Moscow, М. Task Force of the European Society of Cardiology and the North American Society of Pacing and Electrophysiology.(1996). Heart

rate variability. Standarts of Measurement. Physiological interpretation and clinical use. Circulation. 1996; 93:1043 –1065

Kazakhstan, 2015. Women and men of Kazakhstan. The statistical compilation. Astana, Kazakhstan. Kazakhstan, 2014. Country baseline report of Kazakhstan. Astana, Kazakhstan. Rubtsov M. U., 2010. Scientific substantiation criteria occupational stress at different degrees of intensity of mental labor among workers of modern offices . Synopsis, Moskow, Russia . Churakov, A., Ivanov, M. (2006) Stress in the workplace. Some hygienic aspects // Proceedings of the V kongress "Occupation and Health" (pp. 316-318). Moscow, Russia . Yushkova, O. (1999). Chronic stress when changing mental work. Occupational Medicine. 1999; 7: 6-11. Grevtsova, E. (2007). Integrated socio-hygienic assessment of working conditions and health of teachers of secondary schools of

the Russian Federation Central Federal District and measures to optimize them (Doctoral dissertation, Ryazan, Russia ).

Glukhova, T. (2001). Professional teacher health as a priority activity of the school psychologist. Actual problems of activi ty of

the teacher-psychologist ( pp. 33-47). Samara, Russia Akhmerova, S. (2010). Professional activity and health educator. Moscow: Education Arsenal, 2. Anisimov, A. (2010). Psychological assessment of social health teachers . Herald of psychotherapy, 35 (40), (92 -101). Baevsky,

R.M., Kirillov, O.I., Kletskin, S.Z. (1984). Mathematical analysis of heart rate changes during stress . Moscow: Nauka . Aghajanian,

N.A. and etc. (2006). Actual problems of adaptation, ecological and regenerative medicine. Moscow: Medica . Baevsky, P.M.,

Ivanov, G.G., Chireykin, L. et al. (2001). Analysis of heart rate variability using different electrocardiographic systems

(guidelines). Arrhythmology Bulletin, 24, 79. Kalinin, I.N. (2008). Gender features of vegetative status in healthy subjects aged 15-60 years . Materials of IV All -Russian symposium with international participation "Heart rate variability: Theoretical aspects and practical application." (pp. 121 -124). Izhevsk, Russia . Burumbayeva, M.B., Mussina, A.A., Stankus, A., Sholanova, M.K., Suleimenova, R.K. (2016). Influence of psycho-emotional state on heart rate variability of women teachers of older age groups . Valeology: Health - illness – recovery, 3 (39-43). Korkushko, O.V. (1980). Clinical Cardiology in geriatrics . Moscow : Medicine. Igoshina, N.A., Chermnykh, N.A. (2008). The autonomic regulation of the heart rhythm in old people in different age groups . Materials of IV All-Russian symposium with international participation "Heart rate variability: Theoretical aspects and practical application." (pp. 107-110). Izhevsk, Russia .

SP39-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Investigating Psychiatric Disorders (Axis I) in Trauma Patients Admitted to Three Trauma

Centers in Tehran City

Hossein Saidi

1, Mohamad Tahmasbi Sisakht

2, Monireh Sadat Mojtabavi

3, Reza

Mosaddegh 4, Mahdi Rezai

5

1Associate Professor, Emergency medicine management Research center, Rasoul-e-Akram Hospital, Iran university of

Medical Sciences, Tehran, Iran (drhsaidi@yahoo.com) 2Assistant Professor, Emergency medicine, Clinical Research Development Unit,Yasuj University of Medical Sciences,

Yasuj, Iran. (m.tahmasbi80@yahoo.com) 3Emergency Medicine Resident, Emergency medicine management Research center, Rasoul-e-Akram Hospital, Iran

university of Medical Sciences, Tehran, Iran( monireh349@yahoo.com) 4Assistant Professor, Emergency medicine management Research center, Rasoul-e-Akram Hospital,

5Iran university of

Medical Sciences, Tehran, Iran (mosaddegh_rz@yahoo.com) 5 Assistant Professor, Emergency medicine management Research center, Rasoul-e-Akram Hospital, Iran university of

Medical Sciences, Tehran, Iran 2-Research and Development Center of Firoozgar Hospital Tehran, Iran (corresponding author) (mah_re@yahoo.com)

Abstract

Background: Traumatic injury is the most common cause of emergency department visits. According to studies,

over 36% of emergency department visits due to trauma. Numerous studies have been conducted psychiatric

disorders after trauma but no study about the association of axis I psychiatric disorders in trauma patients

admitted to the emergency has taken place.

Materials and Methods: This cross-sectional observational study in three trauma centers affiliated to Tehran

University of Medical Sciences (Firoozgar, Rasool Akram (PBUH) and Haft-e-Tir Hospital). All the trauma

resulting from traffic accidents (Motor Vehicle Collisions) have been among the population. According to the

calculated sample size of 90 trauma patients were enrolled in the second half of 1394. In order to do a

comparison of 90 healthy volunteers who were matched for age and sex is considered as a control group. For

psychiatric disorders and validated SCID questionnaire was used.

Findings: anxiety disorder, drug addiction, alcohol dependence was more common in trauma patients and B II D, but obsessive - compulsive significantly in healthy volunteers was observed.

Conclusion: Considering the high prevalence of psychiatric disorders in trauma patients is recommended a

simple screening test when obtaining a driver's license written test to be performed and people who have

serious mood disorders to consult with a psychiatrist to determine the percentage of traffic accidents

prevented.

Keywords: Psychiatric disorders, axis I diseases, trauma Introduction Traumatic injury is the most common cause of emergency department visits. (1) According to studies, over 36% of emergency department visits due to trauma. (2) Studies of psychiatric disorders after traumatic events have been conducted (6-3) But at the same time a study of psychiatric disorders in people with trauma and accidents (Motor Vehicle Collisions) check there, while the results of this review in planning for preventive measures, treatment and rehabilitation can be important. Therefore, we decided to study psychiatric disorders (Axis I) in trauma patients admitted to trauma centers affiliated to Tehran University of Medical Sciences. Materials and methods

This cross-sectional observational study in three trauma centers affiliated to Tehran University of Medical Sciences (Firoozgar, Rasool Akram (PBUH) and Haft-e-Tir Hospital) has been done. All the trauma resulting from traffic

SP40-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

accidents (Motor Vehicle Collisions) have been part of our population.Due to sample size calculation, 90 patients in the second half of 1394 have been enrolled. The patients were all injured traffic. Inclusion criteria were age older than 16 years, has been able to do an interview, complete consciousness and if the patient does not consent to be interviewed, has not been studied. For psychiatric disorders and validated questionnaire was used SCID. This questionnaire in Iran by Sharifi et al (7) have been translated and validated. After completing the questionnaire, a questionnaire was conducted by researchers guideline rate. Two psychiatric experts to analyze the data obtained were used. In order to do a comparison of 90 healthy volunteers from the general population who were matched by age and sex, were used as a control group. The data is encoded into SPSS software for data analysis questionnaire was conducted according to the guide. Descriptive analysis of quantitative variables and qualitative variables on average by 95% the frequency and prevalence have been reported. In an analytical study to compare variables between patients with traumatic and control tests t, Chi2 and Fisher Exact is used. The significance level of less than 5% is considered.

Research findings

In each group, 90 subjects were enrolled. 90 trauma patients who were alert and able to respond to the questionnaire were SCID I and 90 healthy volunteers who for age and sex were matched. The mean age of the patients and volunteers, respectively (33.56-41.5, 95% CI) 36.8 and (32.9-42.6, 95% CI) 35.3 year was that there were no significant differences. (T, p <0.001) In trauma patients, 88% were male and 90% were male enrolled in the control group were not significantly different between the two groups. In trauma patients, 65% were married and 71% were married at the controls. The frequency of axis I disorders in the two groups can be seen in Table 1.

Table 1: Comparative Study of axis I disorders in trauma patients and control group Trauma patients Healthy volunteers Significant (p)

Major Depression 4.5 4.5 0.99 Anxiety disorder 22 14.3 0.041 Drug dependence 38.5 23.1 0.01 Alcohol dependence 9.9 3.3 <0.001 Bipolar disorder (BID) 1.1 1.1 0.91 B II D 19.8 13.2 0.045 Dysthymia disorder 2.2 3.3 0.11 Delusional disorder 1.1 1.1 0.9 Acute psychotic disorder 1.1 0 0.19 Panic disorder 3.3 2.2 0.33 OCD 3.3 8.8 <0.001 PTSD 1.1 0 0.11 Adjustment disorder 1.1 1.1 0.91

Discussion

30 to 60 percent of patients in the medical sector (Non-psychiatric) were admitted to at least one psychiatric disorder noteworthy that in most cases, lack medical attention disorders leading to increased length of hospitalization and medical expenses, disability and mortality (4). Studies have been done on trauma patients often after trauma and the effects of trauma on psychiatric disorders have been demonstrated in several studies. Bombardier and colleagues in 2010 to study the prevalence of major depressive disorder in patients with traumatic brain injury in America is studied. In this study, the prevalence of major depressive disorder in a follow-up one month and 31% in a 6-month follow-up was 21% (3). Orlovska et al in a study in 2014 patients with post-traumatic psychological disorders are investigated. The results of this study have shown that traumatic head injury increases the risk of schizophrenia (RR = 1.65), depression (RR = 1.59) and bipolar disorder (RR = 1.28) associated (4). In this study, Max et al in 2012 on multiple trauma patient who had been hospitalized in the department of neurology, it was found in a 6-month follow-up, 13% of children and 21% of adults have major depression criteria (5).

Conclusion

SP40-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

The results of this study can be stated that axis I disorders in trauma patients compared to healthy volunteers significantly greater and in between this disorder and anxiety disorder and hypomania (BIID) is more common than others. The frequency of psychotic disorders of mood disorders was very low. It is recommended that a simple screening test when obtaining a driver's license written test to be performed and people who have serious mood disorders consultation with a psychiatrist to determine the percentage of traffic accidents to be prevented. References

Office of Statistics and Programming National Center for Injury Prevention and Control CDC. National estimates of nonfatal injuries treated in hospital emergency departments –United States, 2000. Morbidity & Mortality Weekly Reports 2001;50:340– 346. McCaig LF, Nawar EW. National hospital ambulatory medical care survey: 2004 Emergency Department Summary. Advance Data from Vital and Health Statistics. 2006;372:1-32 Bombardier CH, Fann JR, Temkin NR, Esselman PC, Barber J, Dikmen SS: Rates of major depressive disorder and clinical outcomes following traumatic brain injury. JAMA 2010; 303:1938–1945 . Orlovska S, Pedersen MS, Benros ME, Mortensen PB, Agerbo E, Nordentoft M. Head injury as risk factor for psychiatric disorders: a nationwide register-based follow-up study of 113,906 persons with head injury. Am J Psychiatry. 2014 Apr 1;171(4):463-9. Max JE, Keatley E, Wilde EA, Bigler ED, Schachar RJ, Saunders AE, Ewing-Cobbs L, Chapman SB, Dennis M, Yang TT, Levin HS:

Depression in children and adolescents in the first 6 months after traumatic brain injury. Int J Dev Neurosci 2012; 30:239–245.

Shalev AY, Freedman S, Peri T, Brandes D, Sahar T, Orr SP, Pitman RK. Prospective study of posttraumatic stress disorder and

depression following trauma. Am J Psychiatry. 1998 May;155(5):630-7. Sharifi V, Assadi SM, Mohammadi MR, Amini H, Kaviani H, Semnani Y, et al. A persian translation of the structured clinical

interview for diagnostic and statistical manual of mental disorders: psychometric properties. Comprehensive Psychiatry. 2009;

50(1): 86 – 91.

SP40-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Evaluation of Antibacterial and Anti-fungal

Properties of Adding ZnO Nanoparticles to

Tissue Conditioner Used in Complete Denture

Seyyed amin Mosavi1*, Reza Gottasloo

2, Aboulfazl Akbarzadeh

3, Samin Sadighi

4, Azin Khoramdel

5

1Assistant professor, Tabriz Faculty of Dentistry, Tabriz University of Medical Sciences, Tabriz Iran

2Associate professor, Tabriz Faculty of Microbiology, Tabriz University of Medical Sciences, Tabriz, Iran

3 Associate professor, Tabriz Faculty of Modern Science, Tabriz University of Medical Sciences, Tabriz, Iran 4Tabriz Faculty of Dentistry, Tabriz University of Medical Sciences, Tabriz, Iran 5 Assistant of Department of Periodontics, Tabriz University of Medical Sciences, Tabriz,

Iran Corresponding author Email: S_aminmousavi88@yahoo.com

Abstract

This study was conducted to evaluate anti-bacterial and anti-fungal properties of adding ZnO nanoparticles to

tissue conditioner. In this study, an experimental study that was conducted in Tabriz University School of

Dentistry in 2016. For this purpose, four micro-organisms in six different concentration of ZnO nanoparticles

and at 24 and 48 hours were examined which included a total of 288 samples. ZnO nanoparticles were

synthesized using optical sequestration and samples prepared by three methods of scanning electron

microscopy (SEM), X-ray diffraction (XRD) and infrared (FT-IR) were confirmed. Zinc oxide nano-particles with

mass percentages (0.675 and 1.25 and 2.5, 5, 10 and 20), according to the principles of MIC method was

constantly homogeneous tissue conditioners liquid. Micro-organisms were added to the nanoparticles

prepared after culturing. Then the rate of microbial growth was measured by turbidity test using

spectrophotometer device. Complete inhibition of growth in Candida albicans, and Enterococcus faecalis occur

in 24 hours and 48 hours at a concentration of 20 percent, in Pseudomonas aeruginosa at a concentration of 10

percent and for Streptococcus mutans in 24 hours at a concentration of 20 percent and 48 hours at a

concentration of 10 percent. The most effective concentration of influence for Candida albicans and

Enterococcus faecalis are at a concentration of 10 percent and for Streptococcus mutans and Pseudomonas

aeruginosa are at a concentration of 5 percent. The combination of ZnO nanoparticles causes in inhibiting the

growth of micro-organisms in tissue conditioner.

Keywords: ZnO nanoparticles, tissue conditioner, micro-organisms

Introduction

Tissue conditioners can be used for the treatment and preparation of irritated tissues supporting the denture. In cases

where the removal of the denture from the mouth is not possible, a thin layer of tissue conditioners in the mucosal surface of the denture can be used which acts as a buffer to prevent trauma (1). One of the most common complications of complete dentures is denture stomatitis or atrophic chronic candidiasis incidences. With repeated use of dentures, denture tissue surface and the space created between the tissue levels and mucosal tissues of the patient gradually become susceptible to the growth and colonization of microorganisms (2). Radnai et al (3) in a

study examined the combination of chlorhexidine and miconazole gel with different percentages of Viscogel tissue conditioner with the discs from them in vitro conditions on colonization of Candida albicans that in their study, only a miconazole gel composition with effective tissue conditioner was reported. In a study that was conducted by Zhang L, et al. (4) on the antibacterial properties of zinc oxide nanoparticles on E.Coli bacteria, it was found that the

nanoparticles have properties to prevent the growth of bacteria in the laboratory. In a study of Kristina Kairyte (5) it was shown that zinc oxide nanoparticles as suspension has antifungal and antimicrobial properties. Although numerous studies have been conducted on antimicrobial properties of zinc oxide but investigating the effect of these nanoparticles has not been done on tissue conditioner. This study was conducted to evaluate anti-bacterial and anti-

fungal properties of ZnO nanoparticles in tissue conditioner. Weight percentages due to the lack of experience

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

(combination of nanoparticles) in a wide range 0.675 and 1.25 and 2.5, 5, 10 and 20 to explore minimum required for killing microorganisms is considered. Materials and Methods This research is an experimental study that was conducted in Tabriz University School of Dentistry in 2016. Sample size To determine the number of sample size, power & sample size software was used and given that there was no estimate of standard deviation and the mean groups studied in previous studies, so to determine the sample size, the results of the pilot study were used. The formula for calculating sample size to test the average difference between

the two groups is that n = [(Zα/2 + Zβ)2 × S1

2×S2

2]/ (μ1 - μ2)2, that in this formula, the rate of α=0.05, power is 80

percent, standard deviation of control group is 0.05, standard deviation of experimental group is 0.2 and the expected difference between the two groups is 2 units (Table 1). The number of 6 samples for each of the groups were calculated, due to this we have 4 types of microorganisms and 6 concentrations and two different time, a total of 48 groups are studied that from each group, 6 samples will be prepared. (Total 288 samples).

Table 1: Sample size

Nano-particle concentration (mass %) Time

20 10 5 2.5 1.25 0.625

(hour)

M16=6 M15=6 M14=6 M13=6 M12=6 M11=6 24 Streptococcus

M26=6 M25=6 M24=6 M23=6 M22=6 M21=6 48 mutans

E16=6 E15=6 E14=6 E13=6 E12=6 E11=6 24 Enterococcus

E26=6 E25=6 E24=6 E23=6 E22=6 E21=6 48 faecalis

S16=6 S15=6 S14=6 S13=6 S12=6 S11=6 24 Pseudomonas

S26=6 S25=6 S24=6 S23=6 S22=6 S21=6 48 Yrvzhnza

C16=6 C15=6 C14=6 C13=6 C12=6 C11=6 24 Candida

C26=6 C25=6 C24=6 C23=6 C22=6 C21=6 48 albicans

Method Synthesis of ZnO nanoparticles ZnO nanoparticles were synthesized using optical sequestration. In this way, a certain amount of zinc acetate salt was dissolved in ethanol and distilled water. The dispersion of particles was performed with ultrasound device and inside a reactor under reflux was heated at 80 ° C for 2 hours. Then a certain amount of silver nitrate salt added to the warm solution, reflux continued for an hour. The resulting solution was stirred under ultraviolet light for 2 hours without heat. Finally, the sediment is centrifuged and was transferred to the furnace and is calcined at 550 ° C. (9). Specifications of ZnO is used:

(1) ZnO (purity: 99%, size: 10-30 nm, nearly spherical)

ZnO nanoparticles prepared by the three methods of scanning electron microscopy (SEM), X-ray diffraction (XRD) and infrared (FT-IR) were confirmed. Figure 1 shows SEM images of nanoparticles prepared. After careful study and point to examples of different areas, the size of magnetic nanoparticles was determined about 40 to 1000 nm.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Figure 1. Image related to SEM of Zinc oxide (ZnO) nanoparticles

X-ray diffraction (XRD) analysis The crystal structure of magnetite synthesized samples were analyzed by XRD. The amount of θ2 in the range of 20 to 100 were considered. As expected the figure obtained (zinc oxide nanoparticles) have shown that fully

corresponds to the spectral lines of authority. The most intense peaks of the respective crystal nanoparticles was

determined that the average crystal size of Debye Scherrer formula about the size of nanoparticles (Fig. 2).

(2) Dhkl = 0.9λ (βCosθ) In this formula, β shows half the width of diffraction XRD and λ is equal to 0.154 nm and θ is equal to half the

diffraction angle θ2.

Figure 2. Image related to X-ray diffraction zinc oxide nanoparticles

Infrared Spectroscopy (FT-IR) analysis IR spectrum of nanoparticles of zinc oxide (ZnO) shown in the figure above that absorption bands related to nanoparticle functional groups is confirming its correct synthesis (Fig. 3).

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Figure 3. Image related to the infrared spectrum of zinc oxide nanoparticles Adding ZnO nanoparticles to the tissue conditioners Nanoparticles prepared with mass percentages (0.675 and 1.25 and 2.5, 5, 10 and 20) according to the principles of MIC method was constantly homogeneous tissue conditioners liquid (material used tissue conditioners is GC brand). It should be noted that in determining the concentrations of nanomaterials, it is important to note that adding nanoparticles at concentrations of more than 20 percent, causing the toxic properties (6). Therefore, the highest concentration of using mass nano-particles 20 percent was considered. Then according to the principles of MIC method, this was half the number of dilution at each step (7). (The reason of mixing with fluid is homogenization better and provide more homogeneous solution). The composition prepared was in acrylic mold that was prepared with dimensions of 8 x 6 x 2 mm (Figures 4-8).

Figure 4- Weighing materials

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Figure 5- Tissue Conditioner

Figure 6- Zinc oxide nanoparticles

Figure 7- Prepared templates and prepared samples

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Figure 8- Zinc oxide nanoparticles after weighing Cultivation of microorganisms To determine the amount of bacterial growth inhibition, MIC method used. By definition, MIC is the minimum concentration of antimicrobial substances that cause visible inhibit the growth of micro-organisms (8). In this study, the four bacterial species that are representative of the different types of pathogenic microorganisms, is used. To improve the measurement of - Staphylococcus aureus (ATCC 6538) as positive gram and NON-SPOROGENIC - Pseudomonas aeruginosa (ATCC 9027) as representative of negative and resistant gram bacteria - Candida albicans (ATCC 10231) as pathogenic fungi in the mouth

- Enterococcus faecalis (ATCC 29212) as representative of negative and resistant gram

bacteria Are used (9).

Growth medium (Brain Heart broth Merc, Darmstadt, Germany) for microbial growth tested according to the manufacturer's instructions, in the form of 30 grams per liter was prepared and then sterilized by autoclave (4). Growth medium of blood agar was prepared in the usual way for specimens (6). (Figure 9) To prepare the fungal suspension to a concentration of 1.5 × 105 CFU, cc 1 from suspension with a concentration of 1.5 × 108 is mixed with cc9 of the growth medium and suspension with a concentration of 1.5 × 107 was obtained and the same thing was repeated two more times until the suspension to reach a concentration of 1.5 × 105. The final suspension at a concentration of 1.5 × 105 CFU is poured in each test tube by Sampler and a combination of ZnO nanoparticles was added to the tissue conditioners. Incubation was performed for 24 hours and 48 hours at 37 ° C (6) Figure (10).

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Figure 9- The tubes inoculated with micro-organisms and nanoparticles

Figure 10- The pipes ready for reading in the spectrophotometer device Measuring the bacterial growth rate by turbidity Then the microorganisms' growth rate was measured by a spectrophotometer device. The microorganisms' growth rate on the basis of turbidity and turbidity readings were recorded at 600 nm was performed on the machine and reading in device was performed in 600 nm.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Figure 11- Spectrophotometer device Results

Determination of anti-fungal properties of Candida albicans in tissue conditioners with mass percentage of 0.675 and 1.25 and 2.5, 5, 10 and 20 containing ZnO nanoparticles Results of Table 2 shows the mean and standard deviation of the growth of Candida albicans turbidity by spectrophotometry device - In 0.625 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 2.28 and in 48 hours is 1.79 mg per liter.

- In 1.25 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 2.11 and in 48 hours is 1.68 mg per liter.

- In 2.5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 1.86 and in 48 hours is 1.53 mg per liter.

- In 5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 1.53 and in 48 hours is 1.16 mg per liter.

- In 10 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 0.75 and in 48 hours is 0.23 mg per liter.

- In 20 concentration mass percent of the combination of nano-particles, complete inhibition of growth occurred.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 Table 2: Comparison of anti-fungal properties of Candida albicans in tissue conditioners containing different percentages of ZnO

nanoparticles in two time

48 hour 24 hour

amount ZnO concentration

Standard Mean Standard

Mean

deviation deviation

0.53 1.79 0.57 2.28 6 0.625

0.57 1.68 0.63 2.11 6 1.25

0.55 1.53 0.51 1.86 6 2.5

0.53 1.16 0.70 1.53 6 5

0.17 0.23 0.34 0.75 6 10

0.00 0.00 0.00 0.00 6 20

3.53 15.02 5.57 11.18 6 observer

.000 .000 P value

P value of One way Anova

Pairwise comparison of nanoparticles combination concentrations in studying of anti-fungal properties of Candida albicans shows that: - 0.625 percent concentration of nanoparticles significantly has lower turbidity than the control sample (p

<0.05). - 1.25 concentration of nanoparticles in terms of growth inhibition is similar to 0.625 percent concentration. - 2.5 percent concentration of nanoparticles is similar to 1.25 percent. - 5 percent concentration of nanoparticles is similar to 2.5 percent. - 10 percent concentration of nanoparticles significantly has lower turbidity than 5 percent sample (p <0.05). - 20 percent concentration of nanoparticles has caused complete inhibition of growth.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Table 3: Tukey test pairwise comparison of concentration of nanoparticles combination in studying of anti-fungal properties of

Candida albicans

48 hour 24 hour

P value (I-J) P value (I-J) concentration concentration

)J( )I(

0.000 13.23 0.000 8.90 0.625% Control

0.654 0.11 0.543 0.17 1.25 % 0.625%

0.580 0.15 0.357 0.25 2.5 % 1.25 %

0.123 0.37 0.289 0.32 5 % 2.5 %

0.015 0.93 0.026 0.78 10 % 5 %

0.057 0.23 .022 0.75 20 % 10 %

Also, according to Table 3 is observed that over the period from 24 to 48 hours to increase the effectiveness of Candida albicans, at all stages and levels of p values significantly increased. The fungus Candida albicans, complete inhibition of growth occurs at the time of 24 hours and 48 hours at a concentration of 20 percent. Generally, the best concentration of influence in both 24 hours and 48 hours is the concentration of 10 percent ZnO.

Figure 12: Comparison of anti-fungal properties of Candida albicans in tissue conditioners containing different percentages of

ZnO nanoparticles in two time

Determination of anti-fungal properties of Streptococcus mutans in tissue conditioners with mass percentage of 0.675 and 1.25 and 2.5, 5, 10 and 20 containing ZnO nanoparticles Results of Table 3 shows the mean and standard deviation of the growth of Streptococcus mutans turbidity by spectrophotometry device - In 0.625 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 4.07 and in 48 hours is 3.32 mg per liter.

- In 1.25 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 3.93 and in 48 hours is 3.11 mg per liter.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

- In 2.5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 3.51 and in 48 hours is 2.45 mg per liter.

- In 5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 1.71 and in 48 hours is 1.12 mg per liter.

- In 10 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 0.74 and in 48 hours, complete inhibition of growth occurred. - In 20 concentration, complete inhibition of growth occurred. Table 4: Comparison of anti-fungal properties of Streptococcus mutans in tissue conditioners containing different percentages of

ZnO nanoparticles in two time

48 hour 24 hour ZnO

Amount

Standard Mean Standard

Mean concentration

deviation deviation

.84 3.32 1.08 4.07 6 0.625

.93 3.11 0.15 3.93 6 1.25

0.55 2.45 0.99 3.51 6 2.5

0.18 1.12 0.16 1.71 6 5

0.00 0.00 0.33 0.74 6 10

0.00 0.00 0.00 0.00 6 20

3.77 16.08 2.15 13.22 6 Observer

.000 .000 P value

Pairwise comparison of nanoparticles combination concentrations in studying of anti-fungal properties of Streptococcus mutans shows that: - 0.625 percent concentration of nanoparticles significantly has lower turbidity than the control sample (p

<.05).

- 1.25 and 2.5 concentrations of nanoparticles in terms of growth inhibition is similar to 0.625 percent concentration. - 5 percent concentration of nanoparticles significantly has lower turbidity than the 2.5 percent (p <.05). - 10 percent concentration of nanoparticles significantly has lower turbidity than the 5 percent (p <.05).

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Table 5: Tukey test pairwise comparison of concentration of nanoparticles combination in studying of anti-fungal properties of

Streptococcus mutans

48 hour 24 hour Concentration Concentration

P value (I-J) P value (I-J) )J( )I(

0.000 12.75 0.000 9.15 0.625% control

.637 0.21 0.821 0.14 1.25% 0.625%

.054 0.67 0.067 0.42 2.5 % 1.25 %

0.000 1.32 0.000 1.80 5 % 2.5 %

.016 1.13 0.033 0.97 10 % 5 %

0.036 0.74 20 % 10 %

Also, according to Table 4 is observed that over the period from 24 to 48 hours, At all stages and levels of p values somewhat reduced. In Streptococcus mutans, complete inhibition of growth at the time of 24 hours occurs at a concentration of 20 percent and 48 hours occurs at a 10 percent concentration. Generally, the best concentration of influence in both 24 hours and 48 hours is the concentration of 5 percent ZnO.

Figure 13: Comparison of anti-fungal properties of Streptococcus mutans in tissue conditioners containing different percentages

of ZnO nanoparticles in two time Determination of anti-fungal properties of Enterococcus faecalis in tissue conditioners with mass percentage of 0.675 and 1.25 and 2.5, 5, 10 and 20 containing ZnO nanoparticles Results of Table 5 shows the mean and standard deviation of the growth of Streptococcus mutans turbidity by spectrophotometry device - In 0.625 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 3.14 and in 48 hours is 2.87 mg per liter.

- In 1.25 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 2.78 and in 48 hours is 2.49 mg per liter.

- In 2.5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 2.17 and in 48 hours is 1.84 mg per liter.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

- In 5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 1.62 and in 48 hours is 1.17 mg per liter.

- In 5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 0.65 and in 48 hours is 0.41 mg per liter. - In 20 concentration mass percent of the combination of nano-particles, the turbidity at 24 and 48 hours was zero. Table 6: Comparison of anti-fungal properties of Enterococcus faecalis in tissue conditioners containing different percentages of

ZnO nanoparticles in two time

48 hour 24 hour

Standard Mean Standard

Mean ZnO

deviation deviation amount concentration

0.98 2.87 0.96 3.14 6 0.625

0.70 2.49 1.02 2.78 6 1.25

0.63 1.84 1.11 2.17 6 2.5

0.58 1.17 1.07 1.62 6 5

0.23 0.41 0.42 0.65 6 10

0.00 0.00 0.00 0.00 6 20

5.00 13.12 6.02 12.09 6 observer

.000 .000 P value

Determination of anti-fungal properties of Pseudomonas aeruginosa in tissue conditioners with mass percentage of 0.675 and 1.25 and 2.5, 5, 10 and 20 containing ZnO nanoparticles Results of Table 6 shows the mean and standard deviation of the growth of Pseudomonas aeruginosa turbidity by spectrophotometry device - In 0.625 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 3.31 and in 48 hours is 2.87 mg per liter.

- In 1.25 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 2.69 and in 48 hours is 2.37 mg per liter.

- In 2.5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 1.95 and in 48 hours is 1.77 mg per liter.

- In 5 concentration mass percent of the combination of nano-particles, turbidity rate in 24 hours is 0.89 and in 48 hours is 0.66 mg per liter.

- In 10 and 20 concentration mass percent of the combination of nano-particles, complete inhibition of growth can be seen.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Table 7: Comparison of anti-fungal properties of Pseudomonas aeruginosa in tissue conditioners containing different percentages

of ZnO nanoparticles in two time

48 hour 24 hour

Standard Mean Standard

Mean ZnO

deviation deviation Amount concentration

0.97 2.83 1.1 3.31 6 0.625

0.66 2.37 1.03 2.69 6 1.25

0.28 1.77 1.02 1.95 6 2.5

0.22 0.66 0.26 0.89 6 5

0.00 0.00 0.11 0.36 6 10

0.00 0.00 0.00 0.00 6 20

3.64 12.98 4.42 11.24 6 obsever

.000 .000 P value

Discussion and Conclusion

In the present study, increasing ZnO nanoparticles to tissue conditioners caused in decreasing the growth of Candida

albicans. So that increasing 0.625 concentration mass percent of the combination of nano-particles has caused a

significant reduction in the growth of Candida albicans compared to control sample at both 24 and 48 hours.

Complete inhibition of growth occurs at the time of 24 hours and 48 hours at a concentration of 20 percent.

Generally, the best concentration of influence in both 24 hours and 48 hours is the concentration of 10 percent ZnO.

Antimicrobial activity of metals depends on their contact surface. Particles conversion form the size of micrometers

to nanometers, has caused in improving electrostatic interactions between the bacteria and nanoparticle and

antimicrobial activity increases and adding the nanoparticles into other materials will lead antibacterial properties

(10). In the present study, increasing ZnO nanoparticles to tissue conditioners caused in decreasing the growth of

Streptococcus mutans. So that increasing 0.625 concentration mass percent of the combination of nano-particles has

caused a significant reduction in the growth of Streptococcus mutans to control sample at both 24 and 48 hours.

Complete inhibition of growth at the time of 24 hours occurs at a concentration of 20 percent and 48 hours occurs at

a 10 percent concentration. Generally, the best concentration of influence in both 24 hours and 48 hours is the

concentration of 5 percent ZnO. In the present study, increasing ZnO nanoparticles to tissue conditioners caused in

decreasing the growth of Enterococcus faecalis. So that increasing 0.625 concentration mass percent of the

combination of nano-particles has caused a significant reduction in the growth of Enterococcus faecalis compared to

control sample at both 24 and 48 hours. Complete inhibition of growth occurs at the time of 24 hours and 48 hours at

a concentration of 20 percent. Generally, the best concentration of influence in both 24 hours and 48 hours is the

concentration of 10 percent ZnO. Bacterial growth graph consists of four phases of delays, increasing, stationary and

death, thus, at low percentages nanoparticles (such as silver and zinc oxide) inhibit the growth of bacteria is not

100% and bacteria continue to their growth and reproduction. This issue showed no effects at low concentrations

and effectiveness of nanoparticles in higher concentrations (11). In the present study, increasing ZnO nanoparticles

to tissue conditioners caused in decreasing the growth of Pseudomonas aeruginosa. So that increasing 0.625

concentration mass percent of the combination of nano-particles has caused a significant reduction in the growth of

Pseudomonas aeruginosa compared to control sample at both 24 and 48 hours. Complete inhibition of growth at the

time of 24 hours occurs at a concentration of 20 percent and 48 hours occurs at a 10 percent concentration.

Generally, the best concentration of influence in both 24 hours and 48 hours is the concentration of 5 percent ZnO.

According to the metal nanoparticles at high percentage levels has contributed to the process of polymerization of

dental materials and causes in reducing their biocompatibility. So the minimum concentration values which are

effective, must be used.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 References Mc Carthy JA, Moser JB. (1984). Tissue conditioning and functional impression materials and techniques. Dent Clin North Am. 28(2):239-51. 4. Chow CK, Matear DW, Lawrence HP.(1999). Efficacy of antifungal agents in tissue conditioners in treating candidiasis.Gerodontology. 16(7):110-118. Radnai M, Whiley R, Friel T, Wright PS. (2010). Effect of antifungal gels incorporated into a tissue conditioning material on the growth of Candida albicans. Gerodontology. 27(4):292-6. Zhang L, Jiang Y, Ding Y, Povey M, York D. (2007). Investigation into the antibacterial behavior of suspensions of ZnO nanoparticlEs (ZnO naofluids). Journal of Nanoparticle Research. 9 (5):479–489. Kairyte K , Kadys A , Luksiene Z. (2013). Antibacterial and antifungal activity of photoactivated ZnO nano particles in suspension. Journal of Photochemistry and Photobiology: biology. 128: 78–84 Nam KY. (2011). In vitro antirnicrobial effect of the tissue conditioner containing silver nanoparticlcs. J Adr Prosthodont, 3(7):20-24 Albrektsson T, Zarb GA. (1989). The Branemark osseointegrated implant. 2nd ed. Quintessence, Chicago, Illinois; 167. Lyon DG, Chick AO. (1975). Denture sore mouth and angular cheilitis. Dent practit. 7: 212-17.

Huh J-B, Lim Y, Youn H-I, Chang BM, Lee J-Y, Shin S-W. (2014). Effect of denture cleansers on Candida albicans biofilm formation over resilient liners. The journal of advanced prosthodontics. 6: 109-14. Sousa C. J. A, Pereira, M. C, Almeida R. J, Loyola A. M, Silva A. C. A, Dantas N. O. (2014). Synthesis and characterization of zinc

oxide nanocrystals and histologic evaluation of their biocompatibility by means of intraosseous implants. 47(5):416–424.

Morones J. R., Elechiguerra J. L., Camacho A., The bactericidal effect of silver nanoparticles, Nanotechnology. 16(10): 2346–

2353.

SP41-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

The Influence of Sleep Disorders on Cognitive Functions of a Brain of Patients with Type 2 Diabetes

A.S. Kasenova*, L.E. Eszhanova, D.D. Tursbekova, A.K. Durmanova

JSC «Medical University Astana», the Neurology Department CF «University Medical Center», the Endocrinology Department 49 A

Beybitshilik Street, 010000 Astana, Kazakhstan.

*Corresponding Author: alemtanatar@mail.ru

ABSTRACT

The results of neuropsychological and sleep examination with use of validated tests and questionnaires at 136 patients with the verified type 2 diabetes mellitus diagnosis are presented in this article. The average age of the examined patients was 59,19±5,649. Patients were in decompensated condition on indicators of carbohydrate metabolism. By results of neuropsychological testing cognitive functions of a brain were reduced in all age groups at patients with type 2 diabetes and were characterized by retardation of intellectual activity rate, the reduction of speech fluency, the depression of concentration of attention, memory disturbances of dynamic character. 77, 9% of patients had sleep disorders, including, mild degree - 28% of patients; moderate - 30, 9% of patients. The intrasomnic disorders including frequent night awakenings with the subsequent difficulty of sleep initiation prevailed. It is revealed that insomnia negatively influences on such cognitive functions of a brain as attention and visual-constructive skills.

Keywords: type 2 diabetes, cognitive disturbances, MoCA test, insomnia, Epworth Sleepiness Scale (ESS), Pittsburg Sleep Quality Index (PSQI), Insomnia Severity Index (ISI), glycated haemoglobin (HbA1c (%).

INTRODUCTION

The Diabetes Mellitus (DM) has a significant burden on national health systems of many countries of the world. According to the latest data, published by WHO about 347 million people around the world suffer from DM from which 90% have type 2. It is known that the diabetes mellitus (DM) – the complicated metabolic disease which is characterized by big prevalence of cerebral vascular pathology which is morphological substrate of cognitive disorders. According to authors, the prevalence of moderate cognitive disturbances at type 2 diabetes makes 20% among men and 18% among women of 60 years and older, and exceeds the prevalence of moderate cognitive disturbances in population (10-15%) [1,2,3]. According to researchers, the pathophysiology of the cognitive disturbances (CD) at type 2 diabetes is based on change of the structurally functional relations in a brain occurring in process, more accelerated natural aging. [4]. At patients with a diabetes mellitus decrease of rate of psychomotor reactions [5] is observed, executive functions [5,6,7] suffer, verbal memory is reduced, rate of obtained information processing [8] is reduced and the attention is reduced [9]. The connection of DM and cognitive disturbances is mediated by a number of the processes including chronic hyperglycaemia, vascular changes, in particular the angiopathy leading to disturbance of cerebral blood flow and neurotrophic providing, neuromodulator changes bound with insulin dysfunction and its receptors in a brain. At the same time, clinical trials showed that up to one third of patients with DM, have a sleep disorder [10]. Results of researches of the last years showed that less than 6 hours sleep duration is associated with development of resistance to insulin and augmentation of risk in development of type 2 DM in further [11,12,13].

MATERIAL AND METHODS

136 patients older than 40 years with clinically and laboratory proved type 2 diabetes were examined. The research included the participants of both gender living in Astana with a different national and ethnic origin to be convinced that the research advantage and burden are distributed evenly. Neuropsychological testing is held with use of validated tests (The Montreal Cognitive Assessment). By this scale visual-constructive and executive skills, memory, attention, speech, including speech fluency, thinking, and space and time orientation were estimated [14]. For identification of insomnia the scales and questionnaires recommended by Clinical Guideline for the Evaluation and Management of Chronic Insomnia in Adults, 2008 were used (Pittsburg Sleep Quality Index (PSQI), Insomnia Severity Index (ISI), Epworth Sleepiness Scale (ESS), the Spielberger State-Trait Anxiety Inventory (STAI), the Beck Depression Inventory (BDI))

1. Pittsburg Sleep Quality Index (PSQI). The scale of the Pittsburg Sleep Quality Index consists of 7 components allowing to estimate for the last month subjective value of sleep quality, latency for sleeping, duration and efficiency of sleep, intrasomnic disturbances, somnolent drugs use and day activity disturbances. The score of components exceeding 5 points is regarded as an insomnia.

SP42-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

2. Insomnia Severity Index (ISI). The Insomnia Severity Index consists of 7 components allowing to

estimate current that is for the last 2 weeks sleep problems. The sum of results, corresponding to 0-7 points is regarded as normal, the sum of 8-14 points - mild sleep disorders, the sum of 15-21 points respectively as moderate sleep disorders and the sum of 22-28 points as the expressed sleep disorders.

3. Epworth Sleepiness Scale (ESS). Epworth Sleepiness Scale allows to estimate day drowsiness and consists of 7 components. The sum of results, corresponding 10 points and more is regarded as a pathological sleepiness, 6-10 points - moderate sleepiness, the sum of no more than 5 points as normal.

4. The Spielberger State-Trait Anxiety Inventory (STAI), the Spielberger test consists of 20 statements relating to anxiety as a state (anxiety condition, reactive or situational anxiety) and from 20 statements on anxiety definition as disposition, personal feature (anxiety trait). The anxiety level up to 30 points is considered as low, from 30 to 45 points - moderate, from 46 points and above - high. The minimum assessment on each scale - 20 points, maximum - 80 points.

5. The Beck Depression Inventory (BDI). The Beck Depression Inventory includes 21 categories of symptoms and complaints. To each category there are 4-5 corresponding statements to which values from 1-3 depending on the importance of this statement for severity assessment of depression are appropriated. The maximum point on a scale corresponds to 63, minimum - to 0. The questionnaire’s reliability and validity is confirmed in numerous studies. The total point on all categories is considered when interpreting data. 0-9 – absence of depressive symptoms; 10-15 – mild depression (sub depression); 16-19 – moderate depression; 20-29 – the expressed (moderately severe) depression; 30-63 – severe depression

Statistical analyses. Statistical data processing of the results of conducted study is done by SPSS Statistics 10 program. Qualitative characteristics are described by absolute and relative (%) values. Quantitative characteristics are as an arithmetic average ± standard error (M±m). The statistical importance of differences between groups will be determined by Mann-Whitney's method, for carrying out the correlation analysis Pearson's correlation will be used.

RESULTS The general characteristic of the studied group is presented in the table:

Characteristics No. (%) or means ±SD Number of patients 136 Age 58,97±5,884 Sex (female/male) 89/47 (65/34, 3%) Duration of diabetes 10,29±7,423 HbA1c (%) 9,9260±2,602 Hypertension 90 (65, 7%) Ischemic heart disease 1 (7%) Hypertension + Ischemic heart disease 22 (16,1%)

Women prevailed on gender structure - 89 (65%). The average age of examined was 58, 97±5,884. The average disease duration was 10, 29±7,423 years. The average level of glycated haemoglobin (HbA1c) was 9, 92±2,602. 40 (29, 9%) patients with type 2 DM noted that they used medicines for sleep initiation.

Characteristics No. (%) or means ±SD Number of patients 136 MoCA (N – 26-30) 19,26±3,584 Visuoconstructional Skills (n – 3 ) 1,89±,814 Naming (n -3) 2,92±,405 Attention (n – 6) 4,02±1,226 Language (n – 3) 1,15±,830 Abstraction (n – 2) 1,28±,767 Delayed recall (n – 5) 1,82±1,560 Orientation (n – 6) 5,76±,672 BDI 12,31±8,016 Situational anxiety scale 30,81±9,205 Personal anxiety scale 46,12±6,778 ISI 13,25±7,699 ESS 5,38±3,010

SP42-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

PSQI 10,8088±5,0251 Subjective sleep quality (0=Very good; 1= Fairly good; 2= Fairly bad; 3= Very bad) 1,79±,799 Sleep latency (≤15min=0; 16-30 min=1; 31-60 min=2; ≥60min=3) 2,08±1,075 Sleep duration (≥7=0; 6-7=1; 5-6=2; ≤5=3) 1,76±1,085 Habitual sleep efficiency (≥85%=0; 75-84%=1; 65-74%-2; ≤65%=3) 1,31±1,183 Sleep disturbances 1,76±0,712 Use of sleeping medication ,49±,852 Daytime dysfunction 1,63±1,039

Cognitive functions have been reduced by results of neuropsychological testing (MoCA). Also visual-constructive skills have been reduced, at the same time executive skills remain and begin to decrease with increase in age. Patients with type 2 diabetes have coped with the "the naming of objects" test. Investigating attention function, we have revealed that changes of the “Attention” function in a varying degree are found in all patients with type 2 diabetes. As for the speech activity test It should be noted that the results have been reduced in all patients. Difficulties in carrying out of abstract concepts are established in 25% of patients with type 2 DM. It should be noted that the test results "The delayed reproduction" have been reduced, in general after an interference patients could reproduce 2-3 subjects from five earlier offered. Patients with type 2 diabetes in general remained orientation in space and time.

The frequency of insomnia occurrence at patients with type 2 diabetes by results of PSQI n (%)

N The sum of components up to 5 points The sum of components over 5 points

136 29 (22,1) 107 (77,9)

By results of PSQI the insomnia meets in 77, 9% of cases. Estimating subjective value of sleep quality it should be noted that more than a half of patients with type 2 diabetes in different age groups estimated there sleep as "rather bad" or "very bad". Patients with type 2 diabetes generally noted that they experienced difficulties with sleep initiation from 30 minutes up to 60 minutes and more. The sleep efficiency was reduced at patients with type 2 diabetes. In structure of sleep disorders the disturbances connected with sleep maintenance prevailed, patients noted that they had a superficial sleep with easy awakening with the subsequent difficulty of repeated sleep initiation. Patients with type 2 diabetes noted day activities disturbances from mild to the expressed degree. By results of ISI mild (38 (28%) patients) and moderated (40 (30, 9%) patients) sleep disorders prevailed. The average ISI value - 13, 25±7,699. The degree of expressiveness of sleep disorders accrued with increase in age. By results of ESS pathological day drowsiness was revealed at 3 (4, 4%) patients and moderate day drowsiness was observed at 60 (42, 3%) patients. The average ESS value was 5, 38±3,010. Estimating anxiety level by results of the Spielberger State-Trait Anxiety Inventory 88 patients (64, 7%) had a low situational anxiety, moderate at 33 (24, 3%) and high at 14 (11%) patients. At the same time indicators of personal anxiety were low at 1 (0, 7%), moderate at 45 (33, 1%) and high at 90 (66, 2%) patients. The average value of BDI results was 12, 31±8,016. The symptoms of depression were absent at 53 (39%) patients, at 83 (61%) patients there were depression symptoms from mild to serious degree, in our observation mainly mild and moderate expression degree (61 (44,8%)) were present.

DISCUSSION Exception criteria. Existence of the serious or unstable accompanying somatic pathology. Previous strokes and transient ischemic attacks, craniocerebral injuries, CNS tumours, CNS diseases (inflammatory, degenerative, epilepsy, cerebral palsy). Mental disorders, depression, dementia, alcohol abuse and narcomania. Cognitive functions by results of neuropsychological testing (MoCA) in all age groups were reduced. Visual - constructive skills were reduced in all age groups that shows fairly expressed cognitive dysfunction connected with frontal lobes dysfunction. At the same time the executive skills remain and begin to decrease with increase in age. Patients with type 2 diabetes in all age groups coped with the "naming of objects" test. Researching attention function, we revealed that various degree changes of the attention function are found in patients with type 2 diabetes in all age groups. As for the speech activity test it is worth marking that the results were reduced in all patients, as a rule, due to phonetic mediated associations lowering testifying subcortical - frontal dysfunction. Difficulties in carrying out the abstract concepts were set at 25% of patients with type 2 diabetes and they expressed in inability to carry out the comparative and generalized analysis. It is worth marking that test results "The delayed reproduction" were reduced in all age groups. Considering that the observed patients with type 2 diabetes with reduced delayed

SP42-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

reproduction, saved objects recognition, it is possible to assume subcortical - frontal dysfunction. Patients with type 2 diabetes in general saved orientation in space and time. We revealed that sleep disorders are very widespread among patients with type 2 diabetes. It is necessary to mark that studies of phenomena in sleep disorder in patients with type 2 diabetes, according to literature, are generally focused on respiratory disorders and "restless legs” syndrome. The prevalence of an insomnia at patients with comorbid somatic diseases increases up to 50-75%. [15]. In our research more than half of patients with type 2 diabetes suffer from insomnia - 77, 9%. In the previous researches it is revealed that patients noticed difficulties in sleep maintenance [16], in our research in structure of sleep disorders the disturbances connected with sleep maintenance prevailed. Patients marked that they had a superficial sleep with easy awakening and the subsequent difficult repeated sleep initialization. At the patients suffering from an insomnia decrease of quantity the delta – sleep is noted that can lead to

development of insulin resistance and glucose metabolism disturbance [17]. In our research when carrying out the

correlation analysis we did not find significant correlation connection between the frequency and expression degree

of insomnic disturbances and carbohydrate metabolism indicators (HbA1c). Direct positive correlation link between HbA1c and disease duration (r=0,289; p=0, 01), levels of situational (r=0,190; p=0, 05) and personal (r=0,178; p=0, 05) anxiety is established. The degree of expression of an insomnia by results of PSQI had positive correlation connection with age (r=0,179; p=0, 01), levels of situational (r=0,374; p=0, 01) and personal (r=0,383; p=0, 01) anxiety, and also indicators of depressive symptoms expression (BDI) - (r =0,564; p=0, 01). Negative correlation connection between average values of insomnia expression and such brain cognitive functions as visually – constructive skills (r=-0,371; p=0, 01) and attention (r=-0,370; p=0, 01) is established. We found out that high level of personal anxiety and depression symptoms expression are independent predictors of development of insomnia in patients with type 2 diabetes.

CONCLUSIONS

1. Cognitive functions of a brain by results of neuropsychological testing were reduced in all age groups at patients with type 2 diabetes and are characterized by retardation of intellectual activity rate, reduction of speech fluency, depression of attention concentration and memory disturbances of dynamic character.

2. By results of testing using a questionnaire (PSQI) and scales (ISI, ESS) recommended by Consensus

Guidelines (2008) on a sleep disorder insomnic disturbances meet in more than 50% of cases among type 2 diabetes patients. The insomnia of mild and moderate expression degree at patients with type 2 diabetes prevailed.

3. In clinical phenomenology of insomnia presomnic disturbances (latency augmentation for sleeping) and intrasomnic deviations prevail (difficulties in sleep maintenance, in the form of frequent night awakenings with subsequent difficult repeated sleep initiation).

4. Insomnia negatively influences on cognitive functions of a brain such as attention and visual and constructive skills.

REFERENCES 1. Petersen R.C., Smith G., Waring S. et al. Mild cognitive impairment: clinical characterization and outcome. Arch.

Neurol. 1999; 56:303-308. 2. Gregg W.E, Brown A.A. Cognitive and Physical Disabilities and Aging – Related Complications of Diabetes.//

Clinical Diabetes. – 2003. – Vol.21 – P.113-118. 3. Zakharov V.V. The All-Russian research program of epidemiology and therapy of cognitive impairment at elderly age

("Prometheus")//Nevrol.journal - 2006. – Т.11 – С27-32. 4. Shestakova М.V. Diabetes mellitus at elderly age: the peculiarities in clinics, diagnostics and treatment//Consilium-

medicum – 2002- Т.4.-№10.-С115-119. 5. Reaven GM, Thompson LW, Nahum D, Haskins E 1990 Relationship between hyperglycemia and cognitive function

in older NIDDM patients. Diabetes Care 13:16–21. 6. Munshi M, Grande L, Hayes M, Ayres D, Suhl E, Capelson R, Lin S, Milberg W, Weinger K 2006 Cognitive

dysfunction is associated with poor diabetes control in older adults. Diabetes Care 29:1794–1799. 7. Perlmuter LC, Hakami MK, Hodgson-Harrington C, Ginsberg J, Katz J, Singer DE, Nathan DM 1984 Decreased

cognitive function in aging non-insulin-dependent diabetic patients. Am J Med 77:1043–1048. 8. Messier C 2005 Impact of impaired glucose tolerance and type 2 diabetes on cognitive aging. Neurobiol Aging

26(Suppl 1):26–30. 9. Fontbonne A, Berr C, Ducimetiere P, Alperovitch A 2001 Changes in cognitive abilities over a 4-year period are

unfavorably affected in elderly diabetic subjects: results of the Epidemiology of Vascular Aging Study. Diabetes Care 24:366– 370.

10. Sridhar GR, Madhu K. Prevalence of sleep disturbances in diabetes mellitus. Diabetes Res Clin Pract 1994; 23: 183-186.

11. Beihl DA, Liese AD, Haffner SM. Sleep duration as a risk factor for incident type 2 diabetes in a multiethnic cohort. Ann Epidemiol. 2009;19:351–357.

12. Chao CY, Wu JS, Yang YC, Shih CC, Wang RH, Lu FH, Chang CJ. Sleep duration is a potential risk factor for newly diagnosed type 2 diabetes mellitus. Metabolism. 2011;60:799–804.

SP42-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

13. Chaput JP, Després JP, Bouchard C, Astrup A, Tremblay A. Sleep duration as a risk factor for the

development of type 2 diabetes or impaired glucose tolerance: analyses of the Quebec Family Study. Sleep Med. 2009;10:919– 924.

14. Kannayiram Alagiakrishnan, Nancy Zhao and Ambikaipakan Senthilselvan Montreal Cognitive Assessment Is Superior to Standardized Mini-Mental Status Exam in Detecting Mild Cognitive Impairment in the Middle-Aged and Elderly Patients with Type 2 Diabetes Mellitus BioMed Research International Volume 2013 (2013), Article ID 186106, 5 pages;

15. TaylorD., MalloryLJ.,LichseinKL, Durrence HH. Comorbidity of chronic insomnia with medical problems. Sleep 2007; 30:213-8.

16. Skomro RP, Ludwig S, Salamon E, Kryger MH Sleep complaints and restless legs syndrome in adult type 2 diabetics. Sleep Med. 2001 Sep; 2(5):417-22.

17. Spiegel K, Tasali E, Leproult R, Van Cauter E. Effects of poor and short sleep on glucose metabolism and obesity risk. Nat Rev Endocrinol. 2009 May; 5(5):253-61.

SP42-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

The study of changes level of liver enzymes and blood platelets before and 72 hours after

phlebotomy

1Yadollah Hajhashemi Varnosfaderani,

2 Dr. Mohammad Fazilati,

3 Jalal Moradian,

4

Anahita Asadolahi mashadian

1MSC of Biochemistry ,Department of biology , Pyame noor university,Isfahan,Iran,yhashemi45@yahoo.com,

2 Department

of biology , Pyame noor university, P.O .Box 19395-3697,Tehran,Iran, mfazilati@yahoo.com,3

3MSC of Biochemistry Department of biology, Pyame Noor University

Jalal.moradian@gmail.com, Isfahan, Iran, 4MSC of Biochemistry Department of biology, Islamic Azad university, Falavarjan branch Isfahan,Iran,Anaham168@yahoo.com

Abstract

Phlebotomy is an Arabic traditional treatment method in Islamic medicine that derived from older method

called cupping in China traditional medicine [1, 2]. In traditional medicine cupping means to create a notch on

special parts of body skin with a tool such as cupping. This method is done for special treatment effect [4, 5].

Phlebotomy is a treatment for a wide range of different diseases and it is effective for preventing some diseases

[5, 6]. Sampling was done randomly among 100 patients at phlebotomy centers. Level changes of liver enzymes

before and after phlebotomy and also level changes of blood platelets before and after phlebotomy in both

experimental and control groups were studied. Data analysis was done by SPSS software and T-test by regarding

variables. Findings show that level of liver enzymes (AST and ALT) before and after phlebotomy and level of

blood platelets (PLT) change before and after phlebotomy.

Key words: liver enzymes, blood platelets, phlebotomy Introduction

Phlebotomy is an Arabic traditional treatment method in Islamic medicine that derived from older method called

cupping in China traditional medicine [1, 2]. In traditional medicine cupping means to create a notch on special parts of body skin with a tool such as cupping. This method is done for special treatment effect [4, 5]. Phlebotomy is a

treatment for a wide range of different diseases and it is effective for preventing some diseases [5, 6]. An experiment was done among 70 patients with chronic headache. Results show that severity of diseases was decreased 66%

among those patients that had done phlebotomy after three months. Also those patients that had done phlebotomy

suffered less than other patients [7, 8]. There are studies on effectiveness of phlebotomy on backache, migraine and neural headaches that show that this method was effective in reducing such pains [9, 10, and 11].Side effects are:

transforming infectious diseases such as HIV and hepatitis, bleeding and its complications, scar on body, increase

risk of blood clots, (stroke because of phlebotomy on neck) and acquired hemophilia. Also recently American researchers obtain positive effect of phlebotomy on reduction of Ferritin and nonalcoholic fatty liver disease

[12].Aminotransferases are liver enzymes that cause catalyst of chemical reactions in cells in which amine group transforms from Donor molecule to receptor molecule. That is why they are called aminotransferase. The other name

for Aminotransferases is Transaminase. Aspartate aminotransferase enzyme (AST) is called Transaminase

Agzalvastykserum (SGOT) and Alanine aminotransferase (ALT) is known as Glutamic pyruvic transaminase serum (SGPT). In summary SGOT=AST, SGPT=AST [14, 13]. Platelets or Thrombocytes are flat elements that are present

in blood and they are smaller than other blood cells. These structures contain enzymes that cause blood coagulation

and its main role is prevention of bleeding and getting out of red blood cells from a vein. Thrombocytopenia means reduction the number of blood platelets. The number of platelets from 150000 to 400000 per cubic millimeter of

blood is normal for adults and less than 15000 show the lack of platelets. Platelets above 45000 show Thrombocytosis disease and less than 150000 show thrombocytopenia [15]. Phlebotomy should not be done for these

groups: babies from the birth to four months, people having lack of blood platelets, individuals with short time

hypertension, infection on the location of phlebotomy [4, 2]. Phlebotomy is useful in treatment of some diseases such as hypertension (high blood fat), non-insulin dependent diabetes, nervous headaches and migraines, skin

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

diseases such as acne, psoriasis, drug , food and season allergies, drug addiction, coronary artery disease, complications of menopause, menstrual pain and some infectious diseases, hormonal and endocrine conditions. It should be mention that phlebotomy not only is used for treating some diseases but also it is useful in prevention of diseases and strengthening the body against disease through stimulating the immune system. So it can be said that phlebotomy is preventive role as same as vaccination [2, 16]. Because the vast use of phlebotomy in treating most of diseases, doctors recommendation, sayings of Imams, Islamic medicine and traditional medicine and by regarding wide effects of phlebotomy on the body and internal organs such as the liver, kidneys, eyes, gastrointestinal tract and etc., the purpose of the present research is to study changes level of liver enzymes (ALT, AST) and blood platelets (PLT) before and 72 hours after phlebotomy. Material and method

Manufacturing company

Manufacturing Country

Material/ tool

Hetich

Germany

Centrifuge

Mindray

China Auto analyzer BS-400

Mindray

China

Cell counterBC-5150

Fajr research

Iran Freezer, 20 degree of centigrade

Transferpette

Germany Fixed Volume Micropipette

Ultra Q China Yellow Tip.200μl

Ultra Q China Blue Tip.1000μl

Lifen

China

Latex gloves

Iran

Iran 100 g Cotton

Emad

Iran

Epimax

MediPlus

China K2EDA Tubes

MediPlus

China Clot Activator With Gel Tubes

Greiner bio-one

Austria

Vacuette Visio Plus Needle

Ultra Q

China

Test tube 12*75MM.PP

BioSystems

Spain

Kit ALT

BioSystems Spain

Kit AST

BioSystems Spain Controls

BioSystems Spain

Calibrator

Mindray China M-52DILUENT solution

Mindray China

M-52LM Solution

Mindray China

M-52LN Solution

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Mindray China

M-52DIFF Solution

Research population includes patients that refer phlebotomy centers in Isfahan in 2016. Regarding referred benefits of traditional medicines based on regulation of biochemical compounds, control of endocrine and hormone secretion regulation, regulation enzymes, the treatment of liver disorders, purpose of study is determined based on changes

level of Aminotransferase in liver and platelets changes after phlebotomy. Necessary information is obtained before phlebotomy and the subjects with drug addiction or any other drugs were excluded of study. This is cross-sectional research and 100 subjects that have done phlebotomy were studied. Bloodletting was done through piercing vein and the arms that had hematoma or scar was not sampled. Used needle was G11/221. Vacuum tubes contain gel and clot

activator with volume of5 milliliter to collect blood for enzyme tests and vacuum tubes contain 3 milliliter EDTA.K2 to collect blood for platelet test were used. After selection of subjects, clot sample and EDTA sample were taken and transferred to laboratory. 72 hours after phlebotomy, sampling was done on the same subject. Although delay in the transfer of the office cupping to lab was short, but with observance cool circle and keeping in cold box during transfer that was less than one hour, it helped keep of analytes in same condition. Serum should be separated from

clot quickly for measuring ALT and AST. Separation serum from sample cells is done by centrifuge. Samples containing anticoagulant EDTA.K2 do not need separation and they should be become homogeneous before analysis.

After testing, serum samples keep in freezer in -20 C for one month. Samples contained anticoagulant kept in refrigerator in 2-8 C after measuring platelets for 24 hours. ALT and AST tests and platelets count were done on samples and the obtained results were reported for every one before and after phlebotomy. Data analysis was done by SPSS Software and T-test. Then significance or not significance was determined. Results

Table1. Level of liver enzyme AST before and after phlebotomy

Subjects Before After phlebotomy phlebotomy

1 26 23

2 29 17

3 25 22

4 35 31

5 17 17

6 25 24

7 28 23

8 19 16

9 37 25

10 22 20

11 29 31

12 19 17

13 29 27

14 24 19

15 22 20

16 26 25

17 34 33

18 20 19

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

19 19 18

20 25 19

21 18 17

22 20 20

23 21 18

24 21 20

25 22 20

26 20 19

27 23 21

28 21 19

29 21 18

30 23 13

31 39 37

32 41 39

33 27 25

34 26 24

35 22 20

36 48 44

37 19 18

38 22 22

39 39 36

40 17 12

41 22 16

42 18 16

43 24 20

44 29 28

45 20 18

46 15 15

47 28 22

48 24 24

49 15 14

50 18 21

51 15 14

52 19 16

53 31 26

54 14 12

55 29 29

56 42 38

57 33 28

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

58 28 27

59 16 15

60 27 21

61 35 32

62 29 28

63 26 25

64 35 21

65 50 43

66 37 29

67 25 21

68 22 20

69 25 17

70 77 65

71 26 29

72 12 11

73 25 20

74 46 40

75 41 34

76 22 21

77 34 30

78 16 16

79 25 24

80 29 24

81 20 16

82 29 24

83 21 20

84 27 31

85 24 17

86 28 27

87 23 19

88 24 23

89 24 20

90 25 25

91 32 33

92 22 23

93 23 20

94 27 25

95 33 33

96 20 17

97 19 18

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

98 23 19

99 19 17

100 20 20

Table 1 show that level of liver enzyme AST has decreased after phlebotomy.

Table2. Level of liver enzyme ALT before and after phlebotomy

Subjects Before phlebotomy After phlebotomy

1 21 20

2 38 34

3 14 12

4 24 26

5 29 28

6 38 37

7 42 41

8 21 18

9 40 35

10 27 25

11 60 56

12 17 16

13 41 32

14 18 16

15 31 29

16 46 39

17 36 36

18 21 18

19 15 13

20 23 21

21 21 21

22 38 32

23 39 35

24 29 25

25 25 22

26 25 22

27 40 29

28 22 20

29 25 21

30 37 36

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

31 66 54

32 71 63

33 11 5

34 62 58

35 18 15

36 79 71

37 28 22

38 31 28

39 80 71

40 20 16

41 23 18

42 20 15

43 39 31

44 42 38

45 16 15

46 14 12

47 29 25

48 40 37

49 12 12

50 26 27

51 22 19

52 22 18

53 73 65

54 12 10

55 75 71

56 37 20

57 68 57

58 44 43

59 10 10

60 25 20

61 50 47

62 58 42

63 21 21

64 28 24

65 81 70

66 38 27

67 24 21

68 25 22

69 22 19

70 60 40

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

71 32 31

72 22 24

73 39 32

74 48 37

75 61 51

76 19 15

77 24 25

78 28 27

79 38 37

80 45 40

81 21 17

82 42 34

83 27 24

84 57 55

85 27 14

86 41 32

87 18 15

88 28 26

89 31 28

90 45 39

91 36 31

92 30 26

93 31 30

94 42 39

95 35 35

96 21 18

97 17 14

98 23 21

99 20 21

100 37 36

Table 2 shows that level of liver enzyme ALT has decreased after phlebotomy.

Table3. Level of PLP before and after phlebotomy

Subjects Before After phlebotomy phlebotomy

1 275 283

2 234 247

3 207 191

4 194 201

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

5 159 213

6 192 203

7 289 314

8 228 217

9 293 207

10 231 187

11 247 279

12 133 142

13 166 160

14 191 198

15 215 269

16 188 205

17 182 188

18 176 180

19 238 270

20 222 258

21 172 188

22 244 280

23 273 302

24 216 219

25 122 131

26 209 218

27 184 181

28 224 212

29 244 267

30 140 138

31 127 144

32 155 154

33 219 225

34 264 298

35 211 260

36 166 173

37 209 251

38 260 265

39 250 259

40 182 188

41 247 230

42 212 248

43 245 241

44 245 271

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

45 279 310

46 192 188

47 254 259

48 198 195

49 122 132

50 162 155

51 225 235

52 138 147

53 235 245

54 194 214

55 234 252

56 158 168

57 208 225

58 251 288

59 216 223

60 166 218

61 253 274

62 207 229

63 154 268

64 258 295

65 169 174

66 270 277

67 173 185

68 248 265

69 177 204

70 304 314

71 303 337

72 202 198

73 252 263

74 289 275

75 152 162

76 154 151

77 198 210

78 174 207

79 193 201

80 265 288

81 211 203

82 237 204

83 192 186

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

84 247 279

85 138 141

86 165 160

87 191 198

88 193 187

89 215 269

90 187 204

91 182 189

92 194 187

93 215 255

94 188 217

95 182 180

96 176 177

97 239 265

98 221 247

99 163 187

100 241 253

Table 3 shows that level of blood platelets increases after phlebotomy.

120

100

lev

el 80

60

AS

T

40

20

0

1 6 11

16

21

26

31

36

4 1

46

51

56

61

66

71

76

81

86

91

96

Sick people

Sick people Before cupping After cupping

Diagram1: variations of liver enzyme AST before and after phlebotomy

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

lev

el

ALT

120

100

80

60

Sick people

Before cupping

40 After cupping

20

0

1

6

11

16

21

26

31

36

41

46

51

56

61

66

71

76

81

86

91

96

Sick people

Diagram2: variations of liver enzyme ALT before and after phlebotomy

lev

el

PLT

700 600 500 400 300 200 100

0

1

6

11

16

21

26

31

36

41

46

51

56

61

66

71

76

81

86

91

96

Sick people

Before cupping After cupping

Digram3: variations of blood platelets (PLP) before and after phlebotomy

Discussion

Results show that amount of liver enzymes ALT and AST decrease after phlebotomy and amount of blood platelets increase. Aminiyan et al performed a case-control research (2008) titled “the study of variations liver enzymes in confronting with organic solvents among painters of industrial unit in Tehran. They found that regarding 62 painters in contact with organic solvents and 54 painters without contact with solvents, there was no any significant difference in ALT, AST and ALP enzymes among subjects who had usual contact and only after sever and long contact with these solvents, there was significant different. So measurement of these enzymes in order to early

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

detection of effects of nonhalogenated solvents contact is not a good method and more sensitive liver tests should be used [17]. AsadolahZarifkar et al (2010) in a research titled “study of phlebotomy on serum level antibody against antigen HBs

after injection hepatitis B vaccine” and found that immunization by Hepatitis B vaccine in control and experimental

group cause increase production of specific antibody. It seems that phlebotomy among males does not effect on

antibody production [18]. ShariatZade et al (2014) in a research as “study effect of phlebotomy on stress oxidative indices and some blood

factors among subjects with type 2 diabetes” in Arak, found that phlebotomy cause improvement of blood factors in

them and suggested that phlebotomy can be used as a complementary treatment among subjects with type 2 diabetes.

They also found amount of A1C Hemoglobin, fasting blood sugar, blood sugar 2 hours after fasting, triglycerides,

total cholesterol, low density lipoprotein (LDL) and high-density lipoprotein (HLD) increased significantly and

Aspartate transferase show significance decrease among diabetics after cupping (p<0.05) [19]. Amin Afsari et al (2013) in a research as “the study effect of wet cupping on hematology parameters on mice

(BALB/C) at Boo Ali Sina University found that cupping cause increase RBP indices and hematocrit and possibly

can be effective in anemia due to chronic kidney disease. Finally, study effect of cupping on hormone erythropoietin

and its effects on treatment of anemia due to chronic kidney disease [20].

Ahmad et al (2009), by studying effect of phlebotomy on treatment of rheumatoid and its effect on level of some immune factors found that level of white blood cell increased in group treated with phlebotomy [21]. Niyasari et al (2007) reported on a research titled “effect of phlebotomy on lipids concentration” phlebotomy cause

decrease of lipids concentration and it is effective in preventing Atherosclerosis [16]. Bica et al (2008) reported in a research titled “the effect of phlebotomy on diabetes treatment” that phlebotomy can

be effective in treatment of hypertension [22]. Lee et al (2010) suggested in a study “effect of phlebotomy on

rehabilitation stroke patients” that phlebotomy is not effective at rehabilitation stroke patients [23]. Also Fazel et al

(2009) in a research as ”effect of phlebotomy on lipoproteins concentration of serum among patient with high

cholesterol” reported that amount of LDL in both control and experimental groups at the end was less than beginning

[24]. References Naseri M, Rezaeizade H, Chopani R, Anoshirvani M, Editors. 2007. General overview of traditional medicine Iran. 3rded. Tehran: NashrShahr Publication. [In Persian] Cao H, Han M, Li X, Dong SH, Shang Y, Wang Q, et al. 2010. Clinical research evidence of cupping therapy in China: a systematic literature review. Complement Alternat Med. 10. Ahmadi A, Schwebel DC, Rezaei M. 2008. The efficacy of wet-cupping in the treatment of tension and migraine headache. Am J

Chinese Med. 36: 37– 44. Najmabadi M, Editor. 1993. Medical history of Iran and Islamic world. Tehran University Publications; [In Persian] Josep D. 1998. The effect of phlebotomy on plasma glucose and insulin concentration. Diabetes Care. P.85- 90. Khalili SA. 2004. The Situation of phlebotomy and wet cupping in traditional medicine of Iran, IRANIAN JOURNAL OF PHARMACEUTICAL RESEARCH. 3(Supplement 2): 29. Danyali F, VaezMahdavi MR, Ghazanfari T, Naseri M. 2009. Comparison of the biochemical, hematological and immunological factors of "cupping" blood with normal venous blood. Physiology and Pharmacology. 13:78 –87. [In Persian] Cao H, Zhu C, Liu J. 2010. Wet cupping therapy for treatment of herpes zoster: a systematic review of randomized controlled trials. AlternTher Health Med. 16:48-54. VaezMahdavi MR, Ghazanfari T, Aghajani M, Danyali F, Naseri M. 2012. Evaluation of the effects of traditional cupping on the

biochemical, hematological and immunological factors of human venous blood. In: Bhattacharya A, Editor. A compendium of

essays on alternative therapy. 1st ed. USA: InTech Publisher; P.67 – 88. Farhadi K, Schwebel DC, Saeb M, Choubsaz M, Mohammadi R, Ahmadi A. 2009. The effectiveness of wet-cupping for nonspecific low back pain in Iran: a randomized controlled trial. Complement Ther Med. 17:9-15. Pan H. 2005. Thirty-two cases of acne treated with blood-letting puncture, cupping and Chinese-drug facemask. J Tradit Chin Med. 25:270-72.

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 Cao H, Li X, Liu J. 2012. An updated review of the efficacy of cupping therapy. PLoS ONE. 7: e31793. Pratt DS, Kaplan MM. 2005. Evaluation of liver function. In: Braunwald E, Kasper AS, Fauci AL, editors. Harrison’s principles of internal medicine. 21st edition. New York: McGraw-Hill, 1813-17. Lundberg I, Hakanson M. 1985. Normal serum activities of liver enzymes in Swedish paint industry workers with heavy exposure to organic solvents. Br J Ind Med. 42:596-600. Rinder HM, Tomer A. 2009. Platelet production kinetics and Homostasis. In: Simon TL, Snyder EL, Solhem BG, Stowelm CP, Straus RG, Potrides M, editors. Rossi's principles of transfusion medicine. 4th ed. West Sussex, UK: Weilly-Blackwell. 148-67. .Niasari M, Kosari F, Ahmadi A. 2007. The effect of wet cupping on serum lipid concentrations of clinically healthy young men: a randomized controlled trial. The Journal of Alternative and Complementary Medicine. 13(1):79-82. .Aminian A, Sharifian A, Jalali M, Razi M, Ardakani A. 2007. Study of Liver enzyme changes in exposure to organic solvents in painting an industrial unit in Tehran. 2006. Research in Medicine. 31(3); 279-283. ZarifkarA, Amir ghofran Z, Habibi H, Mansori R. 2010. Effect of wet cupping on serum antibodies against antigens HBS after vaccination against hepatitis B. Traditional Islam and Iran. 1:259-63. [In Persian] Shariatzadeh SMA, Malekirad AA, Syadati SM. 2005. Effect of Cupping on Oxidative Stress. Journal of Medicinal News. 4(12): 53-4. Afsahi A, Aini Z, Rezvan H. 2013. The effect of wet cupping of the hematologic parameters in Syrian mice. Research in Medicine. 37(3); 145-150. Ahmed N. 2009. Alloxan diabetes-induced oxidative stress and impairment of oxidative defense system in rat brain: neuroprotective effects of cichoriumintybus. Int J Diabetes & Metabolism. 17:105-9. Bhikha RA. 2008. Pilot Research Project conducted at the University of Western Cape Therapeutic Cupping As Adjunctive Therapy In the treatment Of Diabetes. Hypertension and Osteoarthritis. Lee MS, Choi TY, Shin BC, Han C, Ernst E. 2010. Cupping for stroke rehabilitation: a systematic review. Journal of the neurological sciences. 294(1):70-3. Fazeli A, HossiniVaez Z, Saghebi SA, Esmaeili H. 2010. Effect of cupping on concentration of serum lipoprotein in diseases while hyper blood cholesterol. Nursing Journal of Mashhad medical science university. 13(9):9-18. [Persian]

SP43-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Using Multiplex PCR method for distinguishing the

Aflatoxigenic and Non-Aflatoxigenic strains of

Aspergillus flavus from isolated animal feed

from industrial animal husbandries

*Sepideh Rahimi¹ . Sahar Rahimi²

¹ Department of Plant Biotechnology,Payam Noor University (PNU), P.O.Box, 19395-3697 Tehran, Iran ² Department of Food Science and Technology, Pharmaceutical Sciences branch Islamic Azad University, Tehran,

Iran Phon number: srahimi1919@gmail.com,00982122640051 and Postal code: 0646619395

Abstract

Aflatoxin is improtant among mycotoxins which generally is produced by different species Aspergillus fungi

especially Aspergillus flavus, Aspergillus parasiticus and Aspergillus nomius. Aflatoxins are carsinogenic and

immunosuppressive as they can lead to acute liver damage, cirrhosis of the liver and hepatocarcinoma

induce. Consumption of feed contaminated with fungal exposes human and animals to aflatoxin which is as

an essential threat for human and animals health.

The purpose of present study is to distinguish between Aspergillus flavus aflatoxigenic and non-aflatoxigenic strains by Multiplex PCR and HPLC technique and the expression of two aflatoxin biosynthesis

gene aflO (omtB) and aflQ(ordA) is investigated in 40 strains by Multiplex PCR method.

In this study 40 Aspergillus flavus strain from 67 species of Aspergillus section Falvi from animal feed

rations of 21 industrial animal husbandries of different regions of Tehran and Alborz are studied. After

separation and cultivation in yeast extract sucrose agar (YESA) special environment, separated strains of

Aspergillus fungi got investigated by macroscopic and microscopic methods. For distinguish between

Aspergillus flavus aflatoxigenic and non-aflatoxigenic strains, the expression of two genes of aflatoxigenic

gene cluster aflO and aflQ by Multiplex PCR and HPLC is used. Results showed that from this 40 strains 80%

of samples have aflQ gene and 95% of samples have aflO gene, also only seven strains (1, 3, 5,14, 22, 34,

38) were afatoxin producer fungi and 33 other samples non afatoxin producer fungi and on the other hand

the results of HPLC indicated that these seven strains do not produce entire types of afatoxins. Since

Aspergillus flavus is the main contamination of animal feed rations, it is required to develop a simple, fast,

and sensitive method to recognize aflatoxigenic fungi especially for distinguishing between aflatoxin

producing and non-aflatoxin producing strains from AF. Finally we prevent aflatoxin from entering to

human and animal health cycle.

Keywords: Aflatoxinohenetic, Non-Aflatoxinogenetic, Aspergillus flavus strains, Multiplex PCR, HPLC, Cattel feed

Introduction Fungal growth stored in animals feed is counted as one of important factors which threats human health (Richard et al. 2003). Using contaminated and inappropriate animal feed contributes to disruption in health cycle of animal and people who consume dairies (Humans et al. 2002). Different researches on animal feed have shown that contamination of animal feed by fungal and especially by Aspergillus species leads to aflatoxin production (Bennett and Klich 2003; Kamei and Watanabe 2005). Aflatoxins are counted as fungal secondary metabolites produced easily during growth and storage of animals feed and generally are produced by Aspergillus section Falvi such as Aspergeillus flavus, Aspergillus parasiticus, and Aspergillus nomius (Yu et al. 2000; Ehrlich et al. 2003; Yu et al. 2004; Varga et al. 2009). Goldbatt reported that the death of one hundred thousand of turkeys in England was as result of poultry feed Brazilian peanut meal contamination by Aspergillus mold and aflatoxin production. This disease was due to

SP44-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

produced toxin from Aspergillus flavus fungi on birds feed (Wogan and Pong 1970). This poison in 1961 lead losses resulted from fungi toxin to be center of attention as contamination of foods and factor of disease and even death in human and animals and the years 1960-1975 was the golden period of studies about fungi toxins because scientists did expanded investigations about this toxigenic factors (Bennett and Klich 2003). Aflatoxins in comparison with other fungal toxins are more important because of their carcinogenic effects and producing acute poisoning. From the destroyer effects of aflatoxins, the weakening and destruction of the immune system, genetic mutations, and cancer can be addressed (Chu 1991; Richard et al. 2003). There are four main types of aflatoxins including: AFB1 ،AFG1 ،AFB2, and AFG2. Among these the AFB1 aflatoxin is the most toxic type (Yu et al. 2002; Murphy et al. 2006; Van Egmond et al. 2007; Bennett et al. 2007). From the effective factors in producing aflatoxins the genetic factors and environmental ones like fungi genera, the type of cultivation environment, humidity, temperature, growth, storage, product ventilation, light, carbon source, and PH can be addressed. At least 23 enzyme reaction is involved on the way of aflatoxin synthesis. Synthesis of this toxin occurs through a set of oxidation reactions and revival. The aflatoxin biosynthetic pathway involves approximately 25 genes clustered in a 70 kb DNA region (Bhatnagar et al. 2006; Scherm et al. 2005).

Most of these genes are regulated by special way of protein which gets binded to DNA (aflR) that is produced by aflR (Chang et al. 2005; Yu et al. 1995). Because of toxic and carcinogenic attributes of aflatoxin a fast method is immediately necessary. There are many sensitive and especial methods for recognition of aflatoxigenic fungi in animal feed that Conventional methods for distinguishing between toxigenic and non-

toxigenic isolates in Aspergillus flavus group including fungi cultivation in convenient cultivation environment, extracting the aflatoxins by organic solvents, and monitoring the presence of them through the chromatography techniques such as HPLC (Fente et al. 2001; Abbas et al. 2004; Sforza et al. 2006). The current methods used for assessing aflatoxin presence is time consuming and labor-intensive. The distinguishing systems based on

DNA are defined as strong tools for distinguishing and recognition of aflatoxin fungi production recently .Chain reaction of polymer such as PCR and Multiplex PCR are from the methods for this order (Shapira et al. 1996; Färber et al. 1997; Sweeney et al. 2000; Criseo et al. 2001).Unique DNA sequences of the respective fungal have to be chosen as primer binding sites concluded that genes involved in the aflatoxin biosynthetic pathway (Geisen 1996; Scherm et al. 2005). The purpose of present study is to distinguish between Aspergillus flavus

aflatoxigenic and non-aflatoxigenic strains by Multiplex PCR and HPLC technique and the expression of two aflatoxin biosynthesis gene aflO (omtB) and aflQ(ordA) is investigated in 40 strains by Multiplex PCR method. Materials and Methods Fungal strains and culture The amount of 40 Aspergillus falvus from a set of 67 species of animal feed rations including corn (A), domestic barly (B1), imported barly (B2), wheat bran (D) and soybean meal (E) from 21 barn and silo of industrial husbandry of different regions of Tehran and Alborz provinces is used for this study. The strains got cultivated on Sabouraud dextrose agar cultivation environment (SDA) containing chloramphenicol (to prevent the growth of bacteria and yeasts) and the plates in 28-30 centigrade degree temperature for 3-5 days was incubated. After appearance of colonies, the fungal spores were transmitted to yeasts extract sucrose agar cultivation environment (YESA), all the plates were incubated for one week in temperature of 25 centigrade degree (Samson et al. 2004). Then the grown strains in each plate was investigated macroscopically and microscopically by valuable distinguishing keys (Klich and Pitt 1988). Molecular characterization Detection of Aflatoxin Genes aflO (omtB) and aflQ(ordA) In this study the genes of aflatoxin conventional naming system was used by (Yu et al. 2004; Ehrlich et al. 2005; Cary et al. 2006)the performance of these two gene is shown in Table 1.

Table 1- . Aflatoxin biosynthetic genes and functionsᵃ

Old name New name Enzyme/product Function in the pathway

omtB aflO O-methyltransferase B DHDMST (dihydrodemethylsterigmatocystin) →

DHST (dihydrosterigmatocystin)

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

ordA aflQ Oxydoreductase O-methylsterigmatocystin (OMST) → AFB1 and AFG1,

dihydro-Omethylsterigmatocystin (DHOMST) → AFB2 and AFG2

ᵃClustered pathway genes in aflatoxin biosynthesis (Yu et al. 2004; Ehrlich et al. 2005; Cary et al. 2006)

DNA Extraction

To extract DNA, some microliters of spore suspension of Aspergillus isolate were kept, transferred to the plate containing YESA, and a one-week colony is employed. 500 microliters lysis buffer (containing 1 mollar Tris-HCI (PH=8), 0.5 mollar EDTA (Ph=8) and 7.45 g KCI), a pile of about 60 gr mycelium was added from Aspergillus colony and then crushed by hand and vortex for 45 seconds and finally centrifuged for 10 minutes at 5000 g. The supernatant liquid was transferred to new fresh tube, and 300 microliters cold isopropanol (kept below -20˚C) was added and finally cell lysis and isopropanol were mixed through multiple reversal activities of microtube and centrifuged for 10 minutes at 12000 g. The supernatant liquid was discarded and about 0.8 microliter 70 degree alcohol was added to sediment and after 15 minutes was incubated at 37˚C. Eventually, 50 microliters deionized distilled water was added to the remaining sediment, and then DNA was mixed with distilled water by gently tapping. The resulting liquid is frozen and stored at -20˚C as a pure DNA solution.

PCR Amplification

In present study, two pairs of primers were designed by based on Aspergillus flavus sequences from aflatoxin biosynthesis genes aflQ(ordA) and aflO(omtB) using OLIGO7 software (Scherm et al. 2005). Oligonucleotides are made by Macro-Gene Company. sequence of primers is expressed in Table 2.

Table 2- Sequences of the nucleotide primers used in this study PCR

Primer code Target gene Primer sequences product size Accession no (bp)

AflO-1for 5'- TTACGATTTGATGGAGCAGG -3' aflO(omtB) 358 HM355030.1

AflO-2rev 5'- AGGTTCTCTTGGCTACAG -3'

AflQ-1for 5'- AACATTCTCTGCCTCATCACT -3' aflQ(ordA) 445 Ay510451.1

AflQ-2rev 5'- TCGCTCTGGCTTGAACACC -3'

The amount of 5 micro liter of extracted DNA, 1 micro liter of each of forward and reverse primers, 10 micro liter of PCR ready master mix of Ampliqon company (containing 0.2 U/µl of Taq DNA polymerase, 0.4 milimolar of dATP and dNTP (dTTP, dCTP, dGTP and 3 milimolar of MgCl2) and the required amount of sterile deionized distilled water (ddH2O) was added up to reaching the final volume of 20 micro liter. Because the Annealing temperature of aflO and aflQ genes are 52.4◦c and 57.9◦c respectively, Multiplex PCR is implemented as presented in Table 3.

Table 3- Heat program used for Multiplex PCR

1 cycle 34 cycle 1 cycle

PCR Initial denaturation Denaturation Annealing Extention Final extention

steps

Tm Time Tm Time Tm Time Tm Time Tm Time

aflO, aflQ 95 ◦С 3 min 95 ◦С 30 sec 57◦С 30 sec 72◦С 45 sec 72◦С 5 min

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 Determination of aflatoxin production by chromatography An introduction to the device and standards This study employs YL9100 HPLC apparatus with reversed-phase silica gel column C18 made by YOUNGLIN Company, South Korea (length of column is 250 mm, column diameter is 6.4 mm, particle size is 5 micrometer and

column temperature is 40˚C). Isolated aflatoxins were detected using fluorescence detector at excitation and emission wavelengths of 360 nm and 440 nm, respectively. AFB1, AFG1, AFB2 and AFG2 standards were purchased from Sigma Company. The purchased standards were diluted using acetonitrile and distilled water in five densities for aflatoxins ABF1 and ABG1 (0.4, 1.2, 2.0, 2.8 and 3.6 ngr/ml) and five densities for aflatoxins ABF2 and ABG2 (0.08, 0.24, 0.40, 0.56 and 0.72 ngr/ml) and then used to prepare curve gradation. The immunoaffinity column for aflatoxins is also purchased from Neocolumn Company. Extraction and purification of aflatoxin 10 gr of the grown fungi was added to 90 ml of the extracted solvent, which was a mixture of 80% methanol and distilled water, on YESA medium, and a small amount of NaCl was also added for more solubility. The next step was a final homogenization performed for 3 minutes. The Spike was also undergone the same process with the exception that 10 ml of standard solvent was added to it. The resulting slurry was filtered using Whatman qualitative filter paper, Grade 1. First, immunoaffinity columns were washed by phosphate buffered saline. Then, 10 ml of the purified solution was added to 50 ml PBS and 10 ml distilled water. The obtained solution was mixed, passed through immunoaffinity columns at the speed of 1 ml/min and eventually 100 microliters were injected into HPLC apparatus. Measuring aflatoxin using HPLC Aflatoxins were determined using HPLC system equipped with fluorescence detector. Aflatoxin was regulated at the wavelengths of 360 and 440 nm. The dynamic phase resulted from mixing 132 mg potassium bromide with 385 microliters nitric acid in 1100 ml distilled water and adding it to the compound of 300 ml acetonitrile and 200 ml methanol. Before starting operation, all solvents were filtered by filtration instrument. Before injection, HPLC apparatus was washed twice or three times by acetonitrile and methanol solvents. After that, a mixture of about 100 microliters of five different densities of AFB1 ،AFG1 ،AFB2 and AFG2 was injected into HPLC apparatus using Hamilton syringe, and a calibration curve was drawn. Then, 100 microliters of each passive sample were injected into the apparatus. Each toxin in all passive samples was identified through comparing the ratio of their peak areas with related standards. Each toxin was measured through measuring the area under its peak at retention time and comparing it with standard gradation curve by HPLC apparatus and YL-Clarity software. Results and discussion Morphologic and microscopic characteristics of Aspregillus in the cattle feed All the species of Aspergillus section Flavi gathered from animal feed samples were investigated and cultivated on cultivation environment (SDA) and then 40 Aspergillus falvus strains after about one week was separated in 25◦c on cultivation environment (YESA) (Samson et al. 2004). It is possible to review the shape and the color of surface and back of colonies in plates, structure of mycelium, conidiophores, phialides, shape, size, color of spores and integration of these species by mycology keys and reliable sources (Klich and Pitt 1988; Peterson 2003). Molecular identification of Aspergillus isolates and aflatoxin Production For molecular identification of toxigenic species of separated Aspergillus, the aflatoxinogen genes aflO (omtB) and aflQ(ordA) in animal feed ration was investigated by Multiplex PCR so that the result of Multiplex production showed the creation of 445bp band for aflQ gene and 358bp band for aflO which indicates that from 40 separated Aspergillus flavus strains 32 samples have aflQ gene and 38 samples have aflO gene. It is noteworthy that a standard sample of Aspergillus flavus 5004 in all of the stages was present for positive control (Okoth et al. 2012; Scherm et al. 2005; RAHIMI et al. 2016). Nine strains (1, 2, 3, 5, 13, 14, 22, 34, 38) shows a similar pattern indicating both genes presence and other strains had different patterns. The results obtained by

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

HPLC was investigated. Only seven strains (1, 3, 5, 14, 22, 34, 38) were aflatoxin-producer fungi and other 33 samples were non aflatoxin producer fungi. The HPLC method showed a significant differentiation between aflatoxin producing and non aflatoxin producing Aspergillus flavus. The results obtained with Multiplex PCR and HPLC are compared in Table 4.

Figure 1- The images of gel electrophoresis of Multiplex PCR products for expression of genes aflQ and aflO of Aspergillus

isolated from cattle feed in 2% agarose gel and ladder 1kb

Table 4- This table indicates a comparison between the conventional and molecular methods ( HPLC and Multiplex PCR ) on aflatoxin production

Multiplex PCR

Sample Aflatoxin production by HPLC* method results

Sample Strain No. aflO aflQ

Alfaotoxin types of

Type production Aflatoxin

1:B2 1 + + Positive Aflatoxin B1, B2, G1 and G2

1:B2 2 + + Negative Non-toxic

1:B2 3 + + Positive Aflatoxin B1 and G1

1:E 4 + + Negative Non-toxic

2:B1 5 + + Positive Aflatoxin B1, B2 and G1

2:B2 6 - + Negative Non-toxic

2:E 7 + + Negative Non-toxic

3:B2 8 + + Negative Non-toxic

3:E 9 + + Negative Non-toxic

4:A 10 + + Negative Non-toxic

4:A 11 + + Negative Non-toxic

5:B2 12 + + Negative Non-toxic

5:D 13 + + Negative Non-toxic

5:E 14 + + Positive Aflatoxin B1 and B2

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

6:E 15 + - Negative Non-toxic

7:A 16 + + Negative Non-toxic

7:A 17 + + Negative Non-toxic

7:D 18 + - Negative Non-toxic

8:B1 19 + - Negative Non-toxic

9:A 20 + - Negative Non-toxic

*HPLC: High-performance liquid chromatography.

Sample

Multiplex PCR Aflatoxin production by HPLC* method

results

Sample Strain No. aflO aflQ

Alfaotoxin types of

Type production Aflatoxin

9:B2 21 + + Negative Non-toxic

9:D 22 + + Positive Aflatoxin B1 and B2

9:D 23 - - Negative Non-toxic

9:D 24 + - Negative Non-toxic

10:B1 25 + + Negative Non-toxic

10:E 26 + - Negative Non-toxic

11:A 27 + + Negative Non-toxic

11:E 28 + + Negative Non-toxic

12:B1 29 + + Negative Non-toxic

13:B1 30 + - Negative Non-toxic

13:D 31 + + Negative Non-toxic

14:A 32 + + Negative Non-toxic

15:A 33 + + Negative Non-toxic

15:B2 34 + + Positive Aflatoxin B1, B2, G1 and G2

15:D 35 + + Negative Non-toxic

19:B2 36 + + Negative Non-toxic

19:D 37 + + Negative Non-toxic

20:A 38 + + Positive Aflatoxin B1

20:A 39 - - Negative Non-toxic

20:D 40 + + Negative Non-toxic

Control + + Positive Aflatoxin B1, B2, G1 and G2

*HPLC: High-performance liquid chromatography.

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2 Analysis of chromatograms of HPLC apparatus To determine the aflatoxin content of the Aspergillus flavus aflatoxigenic and non-aflatoxigenic strains, the peak of each aflatoxin (B1, B2, G1 and G2) is detected in the chromatogram of each species through comparing it with retention time of each aflatoxin in the standard chromatogram. Aflatoxin B1 was produced in all Aspergillus flavus aflatoxigenic strains, yet aflatoxin G2 was not produced at all. Aflatoxins B2 and G1 were produced in the most of Aspergillus flavus aflatoxigenic strains (Figure 2).

Figure 2- Chromatograms of aflatoxin (a) Standard chromatogram of aflatoxins ( Total Run Time : 8 min, Retention time for

AFG2: 4.85 min, AFG1: 5.60 min, AFB2: 6.22 min and AFB1: 7.25 min ),(b) Chromatogram of various aflatoxins in a Aspergillus flavus aflatoxigenic strain

The purpose of this study is standardizing and optimizing the Multiplex PCR method for distinguishing between aflatoxinogenic and non aflatoxinogenic strains of Aspergillus flavus which produces aflatoxin by effective genes through biosynthesis. For getting close to this goal we investigated 40 strains of Aspergillus flavus selected from 67 species of animal feed ration of 21 barns and silos of industrial animal husbandries of different regions of Tehran and Alborz provinces as samples of study and a standard strain of Aspergillus flavus 5004 was used as positive control for investigating the HPLC technique and Multiplex PCR method with aflQ (ordA) and aflO(omtB) primers. Results indicated that from these 40 strains 80% of them have aflQ gene and 95% of samples have aflO gene. omtB and ordA are two structural gene in gene cluster in aflatoxin biosynthesis pathway which encode a key enzyme in

SP44-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

the production of aflatoxin. Therefore they are necessary for producing aflatoxin (Yu et al. 2004; Yabe and Nakajima 2004). After extracting and measuring DNA by spectrophotometery method and by nano drops instrument the thermal program of Multiplex PCR cycle was optimized in a determined time by past studies (Geisen 1996; Shapira et al. 1996; Färber et al. 1997; Criseo et al. 2001). The results showed that two used primers formed sharp and separate bands. Other studies indicates the regulation of aflatoxin biosynthesis in Aspergillus species including a complex pattern of positive and negative transcriptional regulatory elements which got effected by environmental and nutritional parameters (Flaherty and Payne 1997; Chang et al. 2000; Takahashi et al. 2002; Ehrlich et al. 2003). The results of HPLC are an emphasis on this topic showing that seven sample of 40 strains of Aspergillus flavus which their both genes are positive, do not produce all types of aflatoxins (AFB1,AFB2,AFG1, and AFG2). The same result was obtained by Multiplex PCR and PCR methods (Shapira et al. 1996; Criseo et al. 2001; RAHIMI et al. 2016). Interpretation of results showed that Multiplex PCR is a sensitive fast and special method in distinguishing aflatoxinogenic models, but this technique (Multiplex PCR) can not differention between toxigenic and nontoxigenic fungi.

Results showed that there is no relationship between obtained results by Multiplex PCR and other conventional methods for non aflatoxin-producing strains. Seemingly producing no aflatoxin is referred to incomplete pattern obtained by Multiplex PCR. This express that different types of mutation may inactive the pathway of biosynthesis of this strains. Geisen in the previous study says that producing no aflatoxin can be due to simple

mutation such as substitution of some bases (Geisen 1996) and Liu and Chu indicated that variety of different physiologic conditions have effect on aflatoxin biosynthesis (Liu and Chu 1998). In this study it was observed that we can get close to Multiplex PCR as a screening test for initial separation by attention to high velocity and sensitivity (100%). Positive samples for more experiments like HPLC was checked and they was an emphasize

on molecular results and differentiation between Aspergillus strains and that most of strains were non toxigenic. Moreover the RT-PCR is a complementary PCR assessing gene presence checking method. Sweeney et al. and Mayer et al. suggested that the presence or lack of mRNA could permit direct differentiation between them (Sweeney et al. 2000; Mayer et al. 2003). In this way the Multiplex RT-PCR method by advantage of a unique answer for expressing several restricted gene in aflatoxin biosynthesis pathway and experimental real-time RT-

PCR can be used for fungi growth kinetics and to presence of designed AFB1 simultaneously. however, none of these methods has yet been applicable to differentiate between toxinogenic and nontoxinogenic strains of Aspergillus flavus group. Conclusions

Since the investigations shows most of used contamination of animal feed is related to toxigenic Aspergillus. Therefore it is need to develop a simple, fast, and sensitive method for distinguishing aflatoxigenc fungi especially for distinguish between aflatoxin producing and non aflatoxin producing strains from AF. Finally we prevent aflatoxin entering to human and animal health cycle. References

Abbas HK, Zablotowicz R, Weaver M, Horn B, Xie W, Shier W (2004) Comparison of cultural and analytical methods for

determination of aflatoxin production by Mississippi Delta Aspergillus isolates. Canadian Journal of Microbiology 50 (3):193-199 Bennett J, Kale S, Yu J (2007) Aflatoxins: background, toxicology, and molecular biology. In: Foodborne diseases. Springer, pp 355-373 Bennett J, Klich M (2003) Mycotoxins. Clinical microbiology reviews 16 (3):497 Bhatnagar D, Cary JW, Ehrlich K, Yu J, Cleveland TE (2006) Understanding the genetics of regulation of aflatoxin production and Aspergillus flavus development. Mycopathologia 162 (3):155-166 Cary JW, Ehrlich KC, Bland JM, Montalbano BG (2006) The aflatoxin biosynthesis cluster gene, aflX, encodes an oxidoreductase involved in conversion of versicolorin A to demethylsterigmatocystin. Applied and environmental microbiology 72 (2):1096-1101 Chang P-K, Horn BW, Dorner JW (2005) Sequence breakpoints in the aflatoxin biosynthesis gene cluster and flanking regions in nonaflatoxigenic Aspergillus flavus isolates. Fungal Genetics and Biology 42 (11):914-923 Chang P-K, Yu J, Bhatnagar D, Cleveland TE (2000) Characterization of the Aspergillus parasiticus major nitrogen regulatory gene, areA. Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression 1491 (1):263-266 Chu FS (1991) Mycotoxins: food contamination, mechanism, carcinogenic potential and preventive measures. Mutation Research/Genetic Toxicology 259 (3-4):291-306

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 Criseo G, Bagnara A, Bisignano G (2001) Differentiation of aflatoxin‐producing and non‐producing strains of Aspergillus flavus group. Letters in Applied Microbiology 33 (4):291-295 Ehrlich K, Yu J, Cotty P (2005) Aflatoxin biosynthesis gene clusters and flanking regions. Journal of Applied Microbiology 99 (3):518-527 Ehrlich KC, Montalbano BG, Cotty PJ (2003) Sequence comparison of aflR from different Aspergillus species provides evidence for variability in regulation of aflatoxin production. Fungal Genetics and Biology 38 (1):63-74 Färber P, Geisen R, Holzapfel W (1997) Detection of aflatoxinogenic fungi in figs by a PCR reaction. International Journal of Food Microbiology 36 (2):215-220 Fente C, Ordaz JJ, Vazquez B, Franco C, Cepeda A (2001) New additive for culture media for rapid identification of aflatoxin-producingAspergillus strains. Applied and Environmental Microbiology 67 (10):4858-4862 Flaherty JE, Payne G (1997) Overexpression of aflR leads to upregulation of pathway gene transcription and increased aflatoxin production in Aspergillus flavus. Applied and Environmental Microbiology 63 (10):3995-4000 Geisen R (1996) Multiplex polymerase chain reaction for the detection of potential aflatoxin and sterigmatocystin producing fungi. Systematic and Applied Microbiology 19 (3):388-392 Humans IWGotEoCRt, Organization WH, Cancer IAfRo (2002) Some traditional herbal medicines, some mycotoxins, naphthalene and styrene. vol 82. World Health Organization, Kamei K, Watanabe A (2005) Aspergillus mycotoxins and their effect on the host. Medical mycology 43 (sup1):95-99 Klich M, Pitt J (1988) Differentiation of Aspergillus flavus from A. parasiticus and other closely related species. Transactions of the British Mycological Society 91 (1):99-108 Liu B-H, Chu FS (1998) Regulation of aflR and its product, AflR, associated with aflatoxin biosynthesis. Applied and environmental microbiology 64 (10):3718-3723 Mayer Z, Färber P, Geisen R (2003) Monitoring the production of aflatoxin B1 in wheat by measuring the concentration of nor-1 mRNA. Applied and Environmental Microbiology 69 (2):1154-1158 Murphy PA, Hendrich S, Landgren C, Bryant CM (2006) Food mycotoxins: an update. Journal of food science 71 (5):R51-R65

Okoth S, Nyongesa B, Ayugi V, Kang'ethe E, Korhonen H, Joutsjoki V (2012) Toxigenic potential of Aspergillus species occurring on maize kernels from two agro-ecological zones in Kenya. Toxins 4 (11):991-1007 Peterson SW (2003) Identification of Common Aspergillus species by MA Klich (2002). Pp. 116. ISBN 90-70-351-46-3. Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. Price€ 28. Cambridge Univ Press, RAHIMI S, SOHRABI N, EBRAHIMI MA, TEBYANIAN M, ZADEH MT, RAHIMI S (2016) STUDYING THE EFFECT OF AFLATOXIN

GENES AFLP AND AFLQ ON ASPERGILLUS FLAVUS AND ASPERGILLUS PARASITICUS IN THE CATTLE FEED USED IN INDUSTRIAL ANIMAL HUSBANDRIES. Acta Medica 32:2091 Richard J, Payne G, eds, Desjardins A, Maragos C, Norred W, Pestka J (2003) Mycotoxins: risks in plant, animal and human systems. CAST Task Force Report 139:101-103 Samson RA, Hoekstra ES, Frisvad JC (2004) Introduction to food-and airborne fungi. vol Ed. 7. Centraalbureau voor Schimmelcultures (CBS), Scherm B, Palomba M, Serra D, Marcello A, Migheli Q (2005) Detection of transcripts of the aflatoxin genes aflD, aflO, and aflP by reverse transcription–polymerase chain reaction allows differentiation of aflatoxin-producing and non-producing

isolates of Aspergillus flavus and Aspergillus parasiticus. International journal of food microbiology 98 (2):201-210 Sforza S, Dall'Asta C, Marchelli R (2006) Recent advances in mycotoxin determination in food and feed by hyphenated chromatographic techniques/mass spectrometry. Mass Spectrometry Reviews 25 (1):54-76 Shapira R, Paster N, Eyal O, Menasherov M, Mett A, Salomon R (1996) Detection of aflatoxigenic molds in grains by PCR. Applied and Environmental Microbiology 62 (9):3270-3273 Sweeney MJ, Pàmies P, Dobson AD (2000) The use of reverse transcription-polymerase chain reaction (RT-PCR) for

monitoring aflatoxin production in Aspergillus parasiticus 439. International Journal of Food Microbiology 56 (1):97-103

Takahashi T, Chang P-K, Matsushima K, Yu J, Abe K, Bhatnagar D, Cleveland TE, Koyama Y (2002) Nonfunctionality of

Aspergillus sojae aflR in a strain of Aspergillus parasiticus with a disrupted aflR gene. Applied and environmental

microbiology 68 (8):3737-3743 Van Egmond HP, Schothorst RC, Jonker MA (2007) Regulations relating to mycotoxins in food. Analytical and bioanalytical chemistry 389 (1):147-157 Varga J, Frisvad J, Samson R (2009) A reappraisal of fungi producing aflatoxins. World Mycotoxin Journal 2 (3):263-277 Wogan GN, Pong RS (1970) Aflatoxins. Annals of the New York Academy of Sciences 174 (2):623-635 Yabe K, Nakajima H (2004) Enzyme reactions and genes in aflatoxin biosynthesis. Applied microbiology and biotechnology 64 (6):745-755 Yu J, Bhatnagar D, Ehrlich KC (2002) Aflatoxin biosynthesis. Revista iberoamericana de micología 19 (4):191-200 Yu J, Chang P-K, Cary JW, Wright M, Bhatnagar D, Cleveland TE, Payne GA, Linz JE (1995) Comparative mapping of aflatoxin pathway gene clusters in Aspergillus parasiticus and Aspergillus flavus. Applied and Environmental Microbiology 61 (6):2365-2371 Yu J, Chang P-K, Ehrlich KC, Cary JW, Bhatnagar D, Cleveland TE, Payne GA, Linz JE, Woloshuk CP, Bennett JW (2004) Clustered pathway genes in aflatoxin biosynthesis. Applied and environmental microbiology 70 (3):1253-1262 Yu J, Woloshuk CP, Bhatnagar D, Cleveland TE (2000) Cloning and characterization of avfA and omtB genes involved in aflatoxin biosynthesis in three Aspergillus species. Gene 248 (1):157-167

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Effect of photodynamic therapy with toluidine

blue photosensitizer on nonsurgical management

of peri-implant mucosal inflammation

Atabak Kashefi Mehr 1, Reza Pourabbas

2, Maryam Saadat Khajeh*

3

1 BDS, DDS, assistant profesor, Dental and Periodontal Research Center, Tabriz University of Medical Sciences, Tabriz, Iran,

E-mail: kashefimehra@tbzmed.ac.ir

2 BDS, DDS, Professor, Dental and Periodontal Research Center, Tabriz University of Medical Sciences, Tabriz, Iran, E-mail:

rpourabbas@yahoo.com

*3 Corresponding author, DDS, post graduate student of periodontics, Dental and Periodontal Research Center, Tabriz

University of Medical Sciences, Tabriz, Iran, E-mail: memarian@tabrizu.ac.ir

Abstract

Background: One of the growing problems of osteo-integrated implants is peri-implant inflammation,

treatment of which is controversial. It seems that only mechanical debridement for treatment of peri-

implantitis patients with indication of nonsurgical treatment is not sufficient and in most cases an additional

anti-infective treatment is recommended. Using photodynamic therapy (PDT) for bacterial decontamination of

the implant surface is recently developed. The purpose of this clinical trial is to compare the use of PDT with

toluidine blue photosensitizer and mechanical debridement alone, in nonsurgical management of peri-implant

mucosal inflammation.

Material and methods: After selecting patients according to inclusion and exclusion criteria, and obtaining

informed consent, they will be randomly assigned to either the intervention or control groups. After scaling and

root planning, patients in test group will receive additional sessions of photodynamic therapy. In the control

group, patients will be treated by mechanical debridement only. Assessment of inflammatory clinical markers

will be done in all patients at the beginning of the trial, 2 weeks and 12 weeks later.

Results: BOP was significantly reduced (P< 0.05) in both groups from baseline to 12 weeks after treatment. In

comparison between two groups, there was significant difference observed (P< 0.01) in favor of PDT group. Lower PDD (P< 0.05) was seen in both groups at 12 weeks follow-up in respect to the baseline.

Conclusions: Adjunctive PDT in conjunction with mechanical treatment is more effective in BOP resolution with no difference in PPD reduction between groups.

Keywords: peri-implant mucositis, photo-dynamic therapy, toluidine blue photosensitizer, clinical assessments.

Introduction

Dental implants due to their high success rate are increasingly used for oral rehabilitation in partial or complete edentulous patients (1). But one of the associated complications is peri-implant inflammatory reaction which occurs in 6-10% of the inserted implants (2-5). Peri-implant inflammatory disease includes two pathologic types of peri-implant mucositis and peri-implantitis. The inflammation which is limited in the neighboring mucosa of implant is the characteristic of peri-implant mucositis (6). Whereas peri-implantitis is the inflammatory injury causing bone loss and may lead to loss of implant (6-7). Multiple studies reported the same microbial etiology for peri-implantitis and periodontitis (1,8,9,10) and accumulation of microbial plaque on the surface of the implant is recognized as the main etiologic factor of peri-implantitis (11-14) .

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

The main objective of treatment in peri-implantitis is the removal of microbial plaque (11) which is possible through surgical and non-surgical protocols. In the condition of peri-implant mucosal inflammation (PIMI), non-surgical therapy with a precise mechanical debridement combined with appropriate antimicrobial approaches may thoroughly resolve the inflammation. Anti-infective regime is an important component of treatment (15) and maintenance in peri-implantitis patients. Antiseptics such as chlorhexidine is utilized widely. Antibiotics is given in severe cases, but their adverse effect and development of resistant species, proposed alternative antimicrobial approaches; photodynamic therapy as a light activated killing method is one of the options (15). Application of the photodynamic therapy (PDT) for bacterial decontamination of implant surfaces affected with peri-implantitis has recently spread. In this technique a photosensitizer which fixes to the biofilm bacteria is used that with laser radiation, produces cytotoxic singlet oxygen gas, able to destroy the bacterial cell wall. Results of systematic review showed that using photodynamic therapy with lethal light sensitivity range for bacteria is probable without injury to the implant surface (16). PDT method compared to laser radiation alone is more effective in bacterial biofilm elimination. In the study of Dortbudak et al. pathogens present in the sulcus around peri-implantitis affected implants were reduced significantly after PDT adjacent to mechanical debridement (17). Especially the photo synthesizer of toluidine blue "O" (TBO) in 0.1 mg/ml is considered to be highly effective when activated by light emitting diodes. TBO interacts with LPS of bacterial species more than methylene blue (18). Results of a histomorphometric research demonstrated that bacterial decontamination via PDT with toluidine blue "O" as a photosensitizer on implanted discs with smooth or rough surfaces in rats, concluded in better results compared to other decontamination method in duration of 7 days (19). Hence, the objective of this clinical trial is to evaluate effect of PDT with TBO photosensitizer combined with mechanical debridement on nonsurgical management of peri-implant mucosal inflammation, considering clinical parameters. Materials and methods

The current study is a clinical trial conducted on 50 male and female patients (ages 29 to 70 years; mean 57). The study procedure was approved by ethical committee of Tabriz University of medical science. Patients were treated by one or multiple implants that had the criteria listed below. Inclusion criteria

Patients older than 18 years old, patients with peri-implant mucositis (probing depth 3-6 mm, bleeding on probing (BOP), no soft tissue recession with or without minimum bone resorption ( ≤ 2 mm) in periapical radiography) and implants in function for more than one year, were included in this study. Exclusion criteria Patients: 1- with uncontrolled systemic disease; 2- smoking; 3- with active periodontal disease; 4- pregnant or breastfeeding; 5- taking radiotherapy of neck & head; 6- with drug and alcohol abuse; 7- ingesting systemic antibiotics within the last 3 months; 8- with a history of continuous use of drugs that alter the hard and soft tissue conditions (phenytoin, cyclosporine, calcium channel blockers, bisphosphonates, NSAIDs,...); 9- pocket depth greater than 6 mm; 10- receiving any treatment for peri-implant mucosal inflammation (PIMI) within last 3 months; 11- indication for prophylactic systemic antibiotics; 12- affected by infectious diseases such as AIDS, hepatitis and tuberculosis were not entered in the study. After receiving instructions about the study goals, patients gave their written informed consent. Evaluations in all patients were done after supra structure delivery and function of at least one year. Clinical evaluations

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 The following parameters were assessed at the baseline for all patients: BOP (percentage of positive bleeding in 6 sites for each implant: mid-buccal, mesio-buccal, disto-buccal, mid-oral and mesio-oral), pocket probing depth (PPD) and radiography evaluation to be confident of no bone loss in any case. After the baseline assessments patients were placed in either test or control groups; patient in control group received hygiene instructions and removal of microbial plaque and calculus using the ultrasonic scaling instrument (Piezon ® 250, E.M.S. Electro medical systems SA, Nyon, Switzerland) with metal tips and titanium curettes.

Subjects of the test group took an additional PDT beside mechanical debridement. This task was done by a PDT device including diode laser (Handylaser sprint dental, RJ-laser, Winden, Germany) with a wavelength of 638 nm and a power density of 150 mW. Dye TBO was applied from apical to coronal of peri-implant pocket and left there for 30 seconds. Afterwards pocket irrigation with 3% Hydrogen peroxide was performed. Each pocket was radiated by laser for 10 seconds. Patients undergo PDT in multiple sessions at times of immediately after mechanical debridement, 2 weeks and 12 weeks later. Clinical evaluations were repeated 2 weeks after treatment and 12 weeks after treatment in each group. Null hypothesis

No statistically significant differences are detected with respect to the clinical (e.g. BOP and PPD) between two treatment methods (i.e. mechanical debridement group vs. photodynamic therapy group). Statistical Data analysis

Statistical analysis was performed using a MATLAB 2014 software. Data were presented as means and standard deviation (SD) for each variable. Unpaired student test was used to compare measured clinical parameters in the test group and control group. In the final decision, Cochran–Mantel–Haenszel test (CMH) permitted comparison of the clinical data in both

treatment groups.

Paired student's test and the Wilcoxon signed rank test were performed to calculate significance level (or

) for each

group between baseline, 2 weeks and 12 weeks assessments. After the calculation, it was set at = 0.05.

Results 50 subjects were engaged for the study, who had at least one implant with peri-implantitis. They were divided into two groups of 25 subjects. Table 1 summarizes the baseline demographic characteristics of the subjects. Pocket probing depth Table-2 shows the mean values SD of PPD at the base line and after 2 weeks and 12 weeks. Figure 1A shows the

percentiles of PPD. At baseline, the mean PDD value measured 4.35 mm in

median levels and the 25 and 75±

±0.75 in the photodynamic therapy group. ± 0.74

the mechanical debridement group and to 3.95

The reduction of PDD was statistically significant (P< 0.05) in both groups (mechanical debridement group: 1.4 mm and photodynamic therapy group: 1.3 mm) between baseline and 12 weeks follow-up; But when comparing the results between two groups, there was no significant difference observed (P> 0.05). The mean values ± SD of BOP is summarized in Tab le 3. Figu re 1B presents the median levels and the 25 and 75 percenti les of BOP. Bleeding on probing At baseline, the mean BOP value measured 75.9 ±15.4 percent in the mechanical debridement group and to 68.9 ± 23.7 percent in the photodynamic therapy group. The reduction of BOP was statistically significant (P< 0.05) in both groups (mechanical debridement group: 50.5% and photodynamic therapy group: 53.3%) between baseline and 12

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

weeks after therapy. When comparing the results between two groups, there was significant difference observed (P< 0.01). Discussion

Peri-implant disease may have multi-factorial etiology that is generally believed resulting from exaggerated host immune response to antigens of plaque bacteria. The aim of the current study is to evaluate clinical changes, using adjunctive photodynamic therapy for treatment of peri-implant mucositis. Our results showed improvement of clinical parameters (BOP, PPD) after treatment of peri-implant mucositis either by OHI plus mechanical debridement or adjunctive PDT with mechanical debridement. Additional benefit in resolving BOP was seen in PDT group. Recent studies reported the positive effects of using laser as adjunctive treatment of peri-implantitis,≥ but laser is not a substitute for implant surface debridement. Diode laser and Nd:YAG as adjunctive therapy in non-surgical treatment of peri-implantitis where effective in reducing bacterial population of pockets 4mm depth around implants (16). Both lasers were influential in disturbing chemical bond of calculus to root and implant surface.

In previous studies, BOP is known as the main diagnostic factor of peri-implant mucositis. So that absence of BOP is interpreted to resolution of peri-implant inflammation and considered as the endpoint in non-surgical treatment of peri-implant mucositis (11). The results of our research demonstrated more reduction of BOP in test group, it means that PDT with TBO as a photo sensitizer improves the effect of nonsurgical treatment of peri-implant mucositis. These findings are compatible with Schwarz et al. study who reported significant reduction of BOP using adjunctive treatments (e.g. Er:YAG and glycine power air polishing) to remove plaque (20-21). Bassetti et al. in the clinical trial demonstrated improvements in clinical, microbiological and host-derived parameters using adjunctive PDT or LDD combined with optimal plaque control (22). Oppositely, recent outcomes of a randomized clinical trial show that adjunctive delivery of minocycline microspheres or PDT to the non-surgical mechanical debridement of peri-implantitis lesions had comparable clinical outcomes (reduction in bleeding sites and PPD) after 6 months (23). Also in the study of De Angelis et al. clinical parameters of peri-implant disease shows no significant differences in mechanical debridement either with or without adjunctive PDT (24). In a recent systematic review adjunctive therapy did not improve effect of professional plaque removal in reducing BOP, GI and PPD; and supporting the concept that OHI with professional mechanical debridement is accepted as standard treatment to resolve peri-implant inflammation (25). There was no significant difference in PPD reduction between 2 groups in our study and PDT is no more effective than mechanical debridement. Again reviewing the results of Schwarz study, it is concluded that unlike BOP, such improvement was not seen in PPD reduction comparing test and control groups, similar to what is seen in the present study. This occurs following the fact that non-surgical peri-implantitis treatments either mechanical debridement alone or combined with different adjunctive therapies do not have the expected efficacy (11). It must be considered that reduction of pocket depth after treatment is related to many different factors such as soft tissue thickness, vertical position of implant or implant-abutment connection design. Conclusion

Outcomes of our randomized clinical trial indicated that both treatment modalities lead to improvements in clinical parameters over time. Adjunctive photodynamic therapy of peri-implant mucositis has a significant effect in resolving BOP levels, but had no additive effect in reducing PPD. References

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Arakawa H, Uehara J, Hara ES et al. Matrix metalloproteinase-8 is the major potential collagenase in active peri-implantitis. J Prosthodont Res. 2012 Oct;56(4):249-55. Berglundh T, Persson L, Klinge B. A systematic review of the incidence of biological and technical complications in implant

dentistry reported in prospective longitudinal studies of at least 5 years J Clin Periodontol. 2002;29 Suppl 3:197-212; discussion 232-3. Ferreira SD, Silva GL, Cortelli JR, Costa JE, Costa FO. Prevalence and risk variables for peri‐implant disease in Brazilian subjects

J Clin Periodontol. 2006 Dec;33(12):929-35. Roos-Jansåker AM, Renvert H, Lindahl C, Renvert S. Nine‐to fourteen‐year follow‐up of implant treatment. Part III: factors

associated with peri‐implant lesions. J Clin Periodontol. 2006 Apr;33(4):296-301.

Brägger U, Aeschlimann S, Bürgin W, Hämmerle CH, Lang NP. Biological and technical complications and failures with fixed partial dentures (FPD) on implants and teeth after four to five years of function. Clin Oral Implants Res. 2001 Feb;12(1):26-34.

Poli PP, Cicciu M, Beretta M, Maiorana C. Peri-implant mucositis and peri-implantitis: Current understanding of their diagnosis, clinical implications and a report of treatment using a combined therapy approach J Oral Implantol. 2017 Feb;43(1):45-50. doi:

10.1563/aaid-joi-D-16-00082. Epub 2016 Oct 19. Nguyen-Hieu T, Borghetti A, Aboudharam G. Peri-implantitis: from diagnosis to therapeutics. J Investig Clin Dent. 2012

May;3(2):79-94. doi: 10.1111/j.2041-1626.2012.00116.x. Epub 2012 Mar 1. Karoussis IK, Salvi GE, Heitz-Mayfield LJ, Brägger U, Hämmerle CH, Lang NP. Long‐term implant prognosis in patients with and

without a history of chronic periodontitis: a 10‐year prospective cohort study of the ITI® Dental Implant System Clin

Oral Implants Res. 2003 Jun;14(3):329-39. Emrani J, Chee W, Slots J. Bacterial colonization of oral implants from nondental sourcesClin Implant Dent Relat Res. 2009 Jun;11(2):106-12. doi: 10.1111/j.1708-8208.2008.00101.x. Epub 2008 Jul 24. Schwarz F, Schmucker A, Becker J. Efficacy of alternative or adjunctive measures to conventional treatment of peri-implant

mucositis and peri-implantitis: a systematic review and meta-analysis. Int J Implant Dent. 2015 Dec;1(1):22. Epub 2015 Aug 13.

Renvert S, Polyzois I. Risk indicators for peri‐implant mucositis: a systematic literature review. J Clin Periodontol. 2015 Apr;42

Suppl 16:S172-86. doi: 10.1111/jcpe.12346. Schwarz F, Mihatovic I, Golubovic V, Eick S, Iglhaut T, Becker J. Experimental peri‐implant mucositis at different implant

surfaces. J Clin Periodontol. 2014 May;41(5):513-20. doi: 10.1111/jcpe.12240. Epub 2014 Mar 16. Javed F, Al-Hezaimi K, Salameh Z, Almas K, Romanos GE. Proinflammatory cytokines in the crevicular fluid of patients with peri-implantitis Cytokine. 2011 Jan;53(1):8-12. doi: 10.1016/j.cyto.2010.08.013. Epub 2010 Sep 25. Reza Pourabbas, Atabak Kashefimehr, Nasrin Rahmanpour, Zohreh Babaloo, Anil Kishen, Howard C. Tenenbaum, Amir

Azarpazhooh, Effects of Photodynamic Therapy on Clinical and Gingival Crevicular Fluid Inflammatory Biomarkers in Chronic

Periodontitis: A Split-Mouth Randomized Clinical Trial, Journal of Periodontology, September 2014, Vol. 85, No. 9, Pages 1222-

1229. Vohra F., et al. Efficacy of mechanical debridement with adjunct antimicrobial photodynamic therapy for the management of peri-implant diseases: a systematic review. Photochem Photobiol Sci. 2014 Aug;13(8):1160-8. doi: 10.1039/c4pp00083h. Dörtbudak O, Haas R, Bernhart T, Mailath-Pokorny G. Lethal photosensitization for decontamination of implant surfaces in the

treatment of peri‐implantitis. Clin Oral Implants Res. 2001 Apr;12(2):104-8. 18- Eick S1, Markauskaite G, Nietzsche S, Laugisch O, Salvi GE, Sculean A. Effect of photoactivated disinfection with a light-emitting diode on bacterial species and biofilms associated with periodontitis and peri-implantitis. Photodiagnosis Photodyn

Ther. 2013 May;10(2):156-67. Salmeron S. et al. Laser therapy as an effective method for implant surface decontamination: a histomorphometric study in rats J Periodontol. 2013 May;84(5):641-9. doi: 10.1902/jop.2012.120166. Epub 2012 Jun 9. Schwarz F. et al. Clinical evaluation of an Er: YAG laser for nonsurgical treatment of peri‐implantitis: a pilot study. Clin Oral

Implants Res. 2005 Feb;16(1):44-52. Schwarz F, Bieling K, Bonsmann M, Latz T, Becker J. Nonsurgical treatment of moderate and advanced periimplantitis lesions: a controlled clinical study. Clin Oral Investig. 2006 Dec;10(4):279-88. Epub 2006 Sep 13. Bassetti M. et al. Anti‐infective therapy of peri‐implantitis with adjunctive local drug delivery or photodynamic therapy: 12‐ month outcomes of a randomized controlled clinical trial. Clin Oral Implants Res. 2014 Mar;25(3):279-87. doi: 10.1111/clr.12155. Epub 2013 Apr 8. 23- Sch€ar, D., Ramseier, C.A., Eick, S., Arweiler, N.B., Sculean, A. & Salvi, G.E. (2013) Anti-infective therapy of peri-implantitis

with adjunctive local drug delivery or photodynamic therapy: Sixmonth outcomes of a prospective randomized clinical trial.

Clinical Oral Implants Research 24: 104–110. 24- De Angelis N1, Felice P, Grusovin MG, Camurati A, Esposito M. The effectiveness of adjunctive light-activated disinfection (LAD) in the treatment of peri-implantitis: 4-month results from a multicentre pragmatic randomised controlled trial. Eur J Oral Implantol. 2012 Winter;5(4):321-31. Jepsen S. et al. Primary prevention of peri‐implantitis: Managing peri‐implant mucositis. J Clin Periodontol. 2015 Apr;42 Suppl

16:S152-7. doi: 10.1111/jcpe.12369.

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 Conflict of Interest

The authors hereby declare that they have actively participated in this work and preparation of the manuscript and have read the contents of this manuscript. The authors declare that they have no conflict of interest.

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Tables

Table 1- Demographic characteristics of the study subject at baseline

all Mechanical Debridement Photodynamic therapy (Test

(Control Group) group)

Number of subject 50 25 25

Gender (males/females) 18/32 8/17 10/15

Mean age (years) (range) 57 54(29-58) 60(43-70)

Table 2. Mean pocket probing depth (mm) ± SD each implant at baseline and after 2 and12 weeks baseline 2 weeks 12 weeks

Mechanical Debridement 4.35

3.15 2.95 *

Group (N=25)

Photodynamic therapy Group 3.95

3.10 2.65 *

(N=25)

* Statistically significant change from base line to 12 weeks.

Table 3. Mean number of

bleeding on probing (%)

±

SD at baseline and after 2 and 12 weeks

Baseline 2 weeks 12 weeks

Mechanical Debridement Group 75.9 15.4

30.4 10 25.4 * ‡

(N=25)

Photodynamic therapy Group 68.9 23.7 28.5 20.1

15.6 * ‡

(N=25)

* Statistically significant change from base line to 12 weeks.

‡ Statistically significant change with each other.

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 Figure legends Figures

(A)

(B) Figure 1. The median levels and the 25 and 75 percentiles of clinical measurement, A) PPD in the mechanical debridement group

(control group) and in the photodynamic therapy group (test group), * P< 0.05 compared with baseline, B) BOP in the mechanical debridement group (control group) and in the photodynamic therapy group (test group), * P< 0.05 compared with

baseline, ** P< 0.01 compared with each other.

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

SP45-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Impact of an information booklet on knowledge and skills of mothers of children with Cerebral Palsy

Iman Badran1, Tapti Bhattacharjee

2, Vailshali Shiddarth

3

1. Bharati Vidyapeeth Deemed University, College of Nursing, Dhankawadi, Pune 411043.

2. Bharati Vidyapeeth Deemed University, College of Nursing, Dhankawadi, Pune 411043.

3. Ganpatrao Adke College of Nursing. Affiliated to MUHS. Dwarke, Nasik, Maharashtra,

India 422001.

ABSTRACT Background Children with Cerebral Palsy (CP) likely to put extra demand on their family members as well as

healthcare system, social and educational services. Parents cannot overcome all of the complex and wide range

of needs by only a single model of disability, neither the medical nor the social one. The aim of this study was

to evaluate the effectiveness of an information booklet on knowledge and skills of mothers toward care of their

CP child. Design: A single group quasi-experimental design was utilized for this study (pre-posttest format).

Setting: This study was conducted at four private hospitals located in Pune (India). Subjects: The sample was

consisted of 100 mothers who is living and providing daily care to a child aged 1 to 14 years suffering from CP.

Tools: Knowledge and self-reported practice questionnaires were used before and after administration of an

information booklet developed by researchers based on collected data and related literature. The study lasted

from 2013 to 2017.

Results: Knowledge: showed 9.6 (76%) of subjects belonged to poor knowledge score during pretest. This

increased to average knowledge score i.e. 14.3 (73%) in posttest.

Skills: 83.2 (92%) of mothers gained average skills (Score 34%-66%) at posttest. The t-value for these

comparisons was (15.5) and (32.9) and is considered to be statistically significant (p<0.05) respectively.

Conclusion: Information booklet was an effective approach in improving the knowledge and skills of mothers cared for CP child. It is recommended that all health care providers should include mothers in their child’s

practice and rehabilitation programs.

Key words: Cerebral Palsy (CP), Knowledge, Skill, Mother, Information booklet.

1) Introduction

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Most children benefit from healthy childhood with little help from health care services. However, some

children face difficulties in their early childhood and need extensive healthcare resources over a period of time.

Cerebral Palsy (CP) is one such developmental disorder that begins in early childhood as a set of movement

restrictions that arise from disorders of the developing central nervous system.

1 Though the cause of

developmental disabilities is understood and is preventable but proven methods of prevention are not

implemented in the developing countries. There are few family-based services and limited access to suitable

resources.

2,3 Illiteracy, misconception about the disease and associated complications of CP revealed to be a

major reason for the lack of awareness in parents in identifying children who would subsequently be diagnosed with CP.

4 When parents discover that their child has a chronic disease, they begin a journey that takes them into

a life that is mostly filled with strong tough decisions, emotion components, interaction with various

professionals, specialists and ongoing need for knowledge and services. At first, parents may feel alone and

isolated and not know where to look up for available information, support, assistance, knowledge. Aside from

challenging experiences among parents and children with CP, there is an adverse effect on family function as

well.

5 Lack of parental involvement in educational actions causes non-compliance with the treatment of their

child as well as affects rehabilitation outcomes and decision-making. To promote better understanding of the child’s condition the families should be informed about the diagnosis, treatment, and prognosis so that parents

will be more secure about their child’s health care and relief from stress arises from ignorance and

uncertainty.6,7

There is a paucity of an evidence-based intervention aimed to evaluate the impact of the

intervention on the parental skills concerning CP.8 Thus, the purpose of present enquiry to determine the

mother’s knowledge and skills of their CP child and to evaluate the impact of an information booklet on

mothers. A booklet has been developed to educate the mothers of children diagnosed with CP.

2) Materials and Methods

2.1. Definition of an information booklet

Information Booklet refers to the learning materials arranged by the investigator toward CP, which was

handed to the mothers. The Information Booklet consisted of information related to the following items of care

in children with CP: Introduction to CP, Carrying & Positioning, Communication, Feeding, Everyday

Activities, Use of assistive devices, and seizure.

2.2. Study subject

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

The study was carried out on a purposive sampling based on the belief of investigator’s knowledge about a

population used to decide purposely to select the variety of mothers. The inclusion criteria were mothers who is

living with the child and providing daily care of a 1-14 years old child suffering from CP. Mother who

understand English, or Marathi, and registered in one of the four selected hospitals of Pune. A total of 100

mothers fulfilled these criteria and were included in the study.

2.3. Study Design

Quantitative research technique, one-group Pretest-Posttest design is best suited for this experimental study. A

total of 100 mothers participated in the study. Mothers who has previously received information through formal

training programs on the care of CP child, mother taking care of more than one chronically ill patient in the

family, and mothers who is taking care of child with co-morbidity were excluded from the study.

2.4. Data collection tool:

The researchers developed knowledge and self-reported practice questionnaires for data collection. The

structured questionnaire included three parts. The first part was for the demographic data that is: Part I:

Demographic profile: Section one was prepared to collect general information about child, Health Status of the

child and facts about mothers.

Facts about child: facts about child such as sex, date of birth, the cause of CP, associated condition, and other

sibling affected: Health Status of the child: Such as Frequency distribution of child based on the Health Status

of the child with CP according to mothers i.e. how many times has your child had to visit the doctor or the

hospital, How would you rate your child's overall health. Facts about mothers: facts about mothers such as

sex, date of birth, type of relationship to child, marital status, education level, work status, monthly income,

type of family, residence, how many days per week responsible for caregiving activities, family history of CP,

previous exposure of information towards CP.

Part II: Knowledge Questionnaire: Knowledge Questionnaires used to assess the knowledge of mothers in

relation to care of child with CP. The investigator developed this tool. Knowledge questionnaires consist of a

multiple-choice question with 4 options (a. b. C. d.). Each correct answer was given a score of one and any item

that the mother did not attempt or omitted during the assessment was given score zero. The questionnaire

consisted of thirty-three items. The questionnaire included knowledge about general aspects of CP, carrying &

positioning, communication, everyday activities, feeding, use of assistive device, and seizure.

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Part III: Self-reported practice questionnaire: Self-reported practice questionnaire for assessment of skills

of mothers in relation to care of a child with CP at selected events. The skills were grouped into five

dimensions: Carrying & Positioning, Communication, Feeding, Activity of daily living, and Use of assistive

devices.

2.5. Validity and reliability

All questionnaires were translated into Hindi and then content validated by a panel of twenty nine experts. They were from medical surgical nursing, a pediatrician and statistician. All expert’s recommendations were

performed, and the tools were finalized accordingly. The reliability for both Knowledge Questionnaires and

self-reported practice were assessed using test-retest method. The stability of the questionnaires assessed using

Pearson’s Correlation Coefficient, which was 0.96 for Knowledge and 0.98 for Self-reported practice

questionnaires.

2.6. Pilot study

A pilot study was carried out on 10 mothers representing 10% of the main study sample. The aim was to test

the practicability and feasibility of the tools and to determine the time needed to fill up the forms. Since no

modifications were done in the tools. These subjects were included in the main study sample.

2.7. Intervention

The study was done during the period Feb 2013 to August 2017. The researchers set the schedule to meet with

each mother individually. Starting from KEM hospital, about 2-4 samples were collected followed by

Deenanath Mangeshkar hospital, Bharati hospital and Sancheti hospital. After conducting administrative

permission from the respective hospitals, the head of departments of selected hospitals were contacted and

scope of study was explained. After receiving the permission from administration authority, mothers of children

with CP from different shifts were selected based on researchers own judgment and if needed, necessary

changes were made in consultations with the head of each department. In all selected hospitals, one to one

instruction was made in pediatrics and rehabilitations departments of selected hospitals in Pune city. The

consent form was collected from the 100 mothers of children with CP. In assessment phase, Mothers was

requested to fill the facts about the child, facts about the mother, followed by pre-test i.e. Knowledge

Questionnaire and self-reported practice. The assessing time range from 40 to 60 minutes to identify mother’s

knowledge and skills. In implementation phase, on the same day, Information Booklet was given to the

experimental group. Based on the collected data and the related literature; the researchers developed the

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2 information booklet which covers information on Carrying & Positioning, Communication, Feeding, Activity of

Daily Living, and Use of Assistive Device and seizure. The evaluation phase was done at the end of the 7th

day;

the post-test was conducted by filling same Knowledge Questionnaire and self-reported practice Questionnaire.

2.8. Statistical analysis

Data entry and statistical analysis were done using SPSS statistical version 17.0 statistical software package.

Qualitative categorical variables were compared using paired t-test. In order to identify the relationship between

knowledge and skills correlation coefficient analysis was done after testing for normal distribution, SD or

absolute and relative frequencies. Statistical significance was considered at p-value <0.05.

2.9. Administrative design and Ethical consideration

An ethical review was granted from the institutional Ethics Committee of the Bharati Vidyapeeth University

of Medical College, Pune. The researchers approached eligible mothers individually, explained to them the

study objectives and tools and invited them to participate. Those who agreed gave a written informed consent

after being briefed about their rights, to refuse or withdraw at any time with no negative consequences. They

were assured that any information obtained would be confidential and used for the research purpose only. The

study procedures could not inflict any harm on participants.

3) Results

3.1. Characteristics of participants:

Section I: This section reported the distribution on the Facts about child, health status of the child according

to mothers and facts about mothers.

Table 1 presents Facts about Child: Most of the children with CP were boys (75%), Majority of children

with CP was in the age group of 1-2 years. According to mothers the major cause of CP in their children was

after birth (37%), and Limb shortening were the most associated condition (48%).

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Table 1. Frequency distribution of child with CP based on Facts about child

n=100 Fact about Child Percentage

Gender

Male 75%

Female 25%

Age

0-1 year 12%

1-2 years 33%

2-3 years 21%

3-5 years 16%

5-10 years 11%

Above 10 years 7%

Cause of CP

Before birth 9%

During birth 30%

After birth 37%

Don’t know 24% Associated conditions

Intellectual disability 13%

Seizures & epilepsy 18%

Vision difficulties 15%

Sensory issues 40%

Limb shortening 48%

Hearing loss 1%

Dental problem 1%

Spatial awareness 1%

Table 2 illustrate Health Status of the child according to their mothers: According to mothers, (28%) these

children had to visit a doctor or hospital once during the past one month and (25%) of children with CP did not

visit any doctor or hospital during past one month. mothers rated the overall health status of their children as

Good, Very Good and Fair (42%), (23%) and (20%) respectively.

Table 2. Frequency distribution of child with CP based on health status

n=100 Facts about child Frequency

How many times has your child had to visit the doctor or the hospital during past 1 month

Admitted > 7 days 1%

Admitted < 7 days 12%

3 or more times 16%

Twice 18%

Once 28%

None 25%

How would you rate your child's overall health during past 1 month

Very Poor 3%

Poor 3%

Fair 20%

Good 42%

Very Good 23%

Excellent 9%

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Table 3 displays Facts about Mothers: Most of mothers were in the age group of up to 30 years. Majority of

mothers were married (97%). It was also seen that most of the respondents were belong to primary school 32%.

A large number of subjects were homemakers 84%. 97% of subjects do not have any family history of CP.

None of study subjects had previous exposure of caring for a CP patient and nor previous exposure of

information regarding CP. 85% of mothers rated had no previous exposure of information regarding CP.

Table 3. Frequency distribution of subjects according to the Facts about mothers

n=100 Facts about Mothers Percentage

Age

Up to 30 years 56%

30-35 years 28%

35-40 years 9%

40-45 years 3%

Above 50 years 4%

Marital status

Married 97%

Unmarried 1%

Divorce 1%

Widow 1%

What is the highest level of school you have completed

Primary school 32%

Secondary school 16%

Higher secondary 21%

Graduate 15%

Post graduate 15%

No formal education 1%

Which of the following best describes your current work status?

Unemployed 84%

Private employee 10%

Government employee 5%

Daily wages 1%

Monthly income

<5000 20%

5,001-10000 13%

10,001-15,000 13%

>15,000 54%

Family history of CP

Yes 3%

No 97%

Previous exposure of information regarding CP

Yes 15%

No 85%

3.2. Analysis of the data related to the effectiveness of an information booklet on knowledge of mothers of children

with CP: Table 4 demonstrates (76%) of mothers belongs to poor category (Score 0-11) while only (24%) of mothers

found in an average category (Score12-22) during pretest. Meanwhile, after implementation of the program,

statistically significant improvements are shown in all areas of knowledge, reaching (73%) of mothers had average

(Score 12-22) and (26%) had poor knowledge (Score 0-11).

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Table 4. Overall distribution of pre-test and post-test knowledge level of mothers of children with CP

n=100

Pre-test Post-test Knowledge

Freq % Freq %

Poor (Score 0-11) 76 76% 26 26%

Average (Score 12-22) 24 24% 73 73%

Good (Score 23-33) 0 0% 1 1%

Skills Pre-test Post-test

Freq % Freq %

Poor (Score <34%) 95 95% 8 8%

Average (Score 34%-66%) 5 5% 92 92%

Good (Score >=67%) 0 0% 0 0%

Table 5 shows there was a significant increase in the mean knowledge from (9.6) during pretest to (14.3)

during posttest with a standard deviation of (3.3) and (3.5) respectively. The difference is significant at (99%)

confidence interval. t-value for this test was (15.5) and p-value for this comparison was 0.000, which is small

(less than 0.005).

Table 5. Mean of overall knowledge level of mothers of children with CP before and after the

administration of an information booklet

n=100 Knowledge Mean SD t-test df P-value

Pre-test 9.6 3.3 15.5 99 0.000

Post-test 14.3 3.5

Skill Mean SD t-test df P-value

Pre-test 62.5 6.7 32.9 99 0.000

Post-test 83.2 7.4

3.3. Analysis of the data related to the effectiveness of an information booklet on skills of mothers of children with

CP: This section analyzed under the following two parts:

A) Comparison of overall skills of mothers of children with CP

B) Comparisons of item-wise gain in skills among mothers

Concerning the overall skills of mothers, in the same table 4 views that (95%) of subjects belong to the poor

skills toward care of child with CP with the scoring of less than (Score<34%) during pre-test towards care of

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

child with CP. Meanwhile, the same table indicates statistically significant improvement in overall areas of

reported skills at the post intervention phase, reaching majority (92%) of the samples had average (Score 34%-

66%) while only (8%) had poor skills (Score <34%) during post-test. Researcher applied paired t-test for the

effect of information booklet on the skills of mothers. In the same table 5 there is a significant increase in the

mean skills score from (62.5) to (83.2). The t-value is found to be (32.9) and is considered to be statistically

significant (p<0.005).

Table 6 depicts item-wise skills of mothers before and after administration of an information booklet in 5

items: carrying & positioning, communication, feeding, activities of daily living, and use of assistive device.

There was statistically improvement in all domains of reported skills at the post-intervention phase. The

corresponding calculated p-value for these comparisons was smaller which was significance at the level of (p-

value< 0.005).

Table 6. Item-wise paired t-test for the effect of an information booklet on the skills

of mothers of children with CP

n=100

Item-wise Mean SD t-test df p-value

Carrying & Positioning Pre-test 14.6 3.2

21.6 99

0.000

Post-test 20.1 3.2

Communication Pre-test 16.3 3.6

20.8 99

0.000

Post-test 21.7 3.7

Feeding Pre-test 9.0 1.4

19.3 99

0.000

Post-test 11.8 1.5

Activity of daily living Pre-test 14.4 2.5

19.9 99 0.000

Post-test 19.1 2.5

Pre-test 8.3 2.4

Use of Assistive Device 11.3 99 0.000

Post-test 10.5 2.4

3.4. Analysis of the correlation between knowledge and skills of mothers of children with CP. Figure 1 illustrates

the accuracy and direction of the linear relationships between two datasets. Scatter plot shows the correlation between mother’s knowledge and skills that are calculated via correlation coefficient (Pearson

r=0.25, p<0.005). The significance of this correlation was tested (t=2.5) at 98 degrees of freedom. The

corresponding p-value was (0.006) the positive correlation between knowledge and skills is significant.

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Fig. 1. Correction between knowledge and skills of mothers of children with CP

3.5. Analysis of data related to the association of selected demographic variables with knowledge and skills of mothers of children with CP. In order to find the association, the data is analyzed using Fisher’s exact test.

Only current work status of mothers has a statistically relationship with the knowledge level of mothers

regarding care of child with CP (p-value<0.005).

4) Discussion

This study was carried out to test the research hypothesis that mother’s knowledge and skills towards care of

CP children will significantly improve after implementation of custom-tailored educational intervention. The

findings lead to acceptance of this hypothesis since the mother’s knowledge as well as self-reported practices

demonstrated considerable ameliorations. Further, linear relationship between two variables analysis confirmed

the perfect positive impact on knowledge and skills of mothers after intervention on the scores of these

parameters. The prevalent characteristics of the community where was conducted, with high prevalence of the

illiteracy, unemployment, and low income. These characteristics would certainly have a negative impact on the

levels of their knowledge and skills, which turned to be inadequate and deficit before implementation of the

study intervention. Concerning CP children there were more boys as previous study conducted in the United

States where the prevalence of CP was high among boys and boy/girl ratio was 1.4:1.

9 Mother’s knowledge on

their CP child is deficit. Even one session of educational program can significantly improve parental knowledge and empower the parents to help their child in handling this chronic life-long condition. However, caregiver’s

knowledge can be significantly improve by single-session education program to know about all core common

issues of their child’s disorder.10

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

The findings of this study revealed that there was a considerable gain in the knowledge of mothers as

evidenced by an increase in the mean knowledge scores during post-test. This finding is in line with the results

of the survey study on knowledge of students regarding CP with concept map showed effective improvement in

the knowledge of students towards CP.

11 furthermore, the findings of this study help us to concluded the overall

skills of mothers severely lacking gaps and research-based intervention such as an information booklet impact

positively on overall skills of mothers of children with CP. This result is in agreement with the findings of the

study on improving the care provided to hemiplegics CP children by their family caregivers with the illustrative

booklet concluded that the educational program was effective in improving knowledge and practices of

caregivers of children with CP.

12 Additionally, the item-wise mean skills of mothers showed that the use of

information booklet significantly increased in each item i.e. (Carrying & Positioning, Communication, Feeding,

Activity of daily living, and Use of assistive devices). The primary focus for management of the child with CP

is to promote optimal function; to foster the acquisition of new skills; to maintain general health; to train and

assist mothers, to participate, to prevent, and treat the complications of the disorders.

13 Teaching self-care

activities such as clothing, eating, toileting, etc. improves the quality patterns of care and reduces the stress on

the caregivers.14

The item-wise mean skills score in use of assistive device was less prominent compare to other domains which is in

line with the results of the study by (Kling A. et al., 2010) the mothers reported very low competency in use of

assistive devices, suggesting that information and training activities are one strategy to use

to increase caregiver’s knowledge about range of assistive devices.

15 The feeding scores is also critical in

mothers of CP children. This confirms the study by (Martinez B. et al., 2012) the feeding problems in CP

children is usual as a result of oral motor dysfunction, which creates a real challenge for parents.16

The implementation of the current intervention led to positive correlation between knowledge and skills scores

of mothers i.e. more the knowledge better the skill which could be due to the fact that the mother’s interest and

motivation in the gaining of the knowledge and skill regarding care of child with CP. This is in accordance with

the previous studies conducted by (Ahmed Soad et al., 2015) they investigated a highly correlation between

knowledge and practice scores among caregivers. Caregivers who are aware of issues and special needs of their

family are best known to devote assistance.17

Significant association was found between unemployed status and knowledge of mothers regarding care of

child with CP. This can be explained by the fact that unemployment helps mothers better manage the demands

placed on them while employed caregivers have an ideal opportunity to frequently access to workplace

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

counseling and information programs.18

Our finding did not reveal a significant association between socio-

demographic characteristics and reported skills of mothers of children with CP.

5. Conclusion and Recommendation

The study has documented that an information booklet taking mothers current work status into consideration impact positively on mother’s level of knowledge and skills; consequently, such measures should be involved as

a part of the management topics and health care providers should encounter and included mothers in their

practice and rehabilitation programs thus helps in providing adequate service to the mothers. The benefits of the

program are achieved regardless the current work status of these mothers. However, these findings must take

into account the study limitations. These are mainly regarding the study design, which is lack of control group

made it difficult to limit the effect of extraneous variables effectively. Another limitation is the restriction to

only one instructional module strategy that is Information Booklet which was very difficult to isolate the self-

instructional module from those of other sources like mass media, friends, Internet, magazine etc. In view of the

study findings, it is recommended that all health care providers should encounter and included mothers in their

practice and rehabilitation programs. There should be health facilities that educate mothers regarding

interventions to be provided for a CP child at home.

6. Reference

1. Raina P, O'Donnell M, Rosenbaum P, Brehaut J, Walter SD, Russell D, Swinton M, Zhu B, Wood E. The health

and well-being of caregivers of children with cerebral palsy. Pediatrics. 2005 Jun 1; 115(6):e626-36.

Doi:10.1542/peds.2004-1689

2. Karande S, Mehta V, Kulkarni M. Impact of an education program on parental knowledge of specific learning

disability [Internet]. Indian Journal of Medical Sciences.2007Jul; 61(7). Doi:10.4103/0019-5359.33189

3. Maulik PK, Darmstadt GL. Childhood disability in low-and middle-income countries: overview of screening,

prevention, services, legislation, and epidemiology. Pediatrics. 2007 Jul 1; 120(Supplement 1):S1-55.

4. Motion S, Northstone K, Emond A, Stucke S, Golding J. Early feeding problems in children with cerebral palsy.

Developmental Medicine & Child Neurology.2002 Jan; 44:40-43. Doi:10.1111/j.1469-8749.2002.tb00257.x

5. Carlsson M, Olsson I, Hagberg G, Beckung E. Behavior in children with cerebral palsy and with and without

epilepsy. Developmental Medicine & Child Neurology. 2008 Oct; 50(10):784-89. Doi: 10.1111/j.1469-

8749.2008.03090.x

6. Ribeiro M.F, Barbosa M.A, Porto C.C. [Cerebral palsy and Down Syndrome: level of parental knowledge and

information]. Ciência & Saúde Coletiva.2011Apr; 16(4): 2099-2106. Available from:

http://www.ncbi.nlm.nih.gov/pubmed/21584451

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

7. Huang Y.P, Kellett U.M, St John W. Cerebral palsy: experiences of mothers after learning their child’s diagnosis.

Journal of Advanced Nursing.2010 Jun;66(6):1213-21. Doi:10.1111/j.1365-2648.2010.05270.x

8. Arora S.K, Aggarwal A, Mittal H. Impact of an Educational Film on Parental Knowledge of Children with Cerebral

Palsy. International Journal of Pediatrics. 2014 Mar; 2014 (573698):1-4. Doi:

http://dx.doi.org/10.1155/2014/573698

9. Yeargin-Allsopp M, Braun KV, Doernberg NS, Benedict RE, Kirby RS, Durkin MS. Prevalence of cerebral palsy

in 8-year-old children in three areas of the United States in 2002: a multisite collaboration. Paediatrics. 2008 Mar;

121(3):547-54.

10. Karande S, Mehta V, Kulkarni M. Impact of an education program on parental knowledge of specific learning

disability [Internet]. Indian Journal of Medical Sciences.2007Jul; 61(7). Doi:10.4103/0019-5359.33189

11. Davis D.K. A study to assess the effectiveness of teaching with concept map regarding knowledge on

cerebral palsy among III B.Sc. nursing students in a selected nursing college, Bangalore [Doctorate

dissertation]. Karnataka: Rajiv Gandhi University of Health Sciences; 2013.145p.

12. Allah ES, Awady SE, Hameed HS. Improving the care provided to Hemiplegics Cerebral Palsy Children by Their

family caregivers: An Intervention study. Journal of American Science. 2012; 8(2):730-7. . Available from:

http://www.jofamericanscience.org/journals/am-sci/am0802/102_10559am0802_730_737.pdf

13. Jones M.W, Morgan E, Shelton J.E. Primary care of the child with cerebral palsy: A review of systems (part

II). Journal of Pediatric Health Care. 2007Jul; 21(4): 226-237. Doi:10.1016/j.pedhc.2006.07.003

14. Razavi Afzal Z, Rassafiani M, Sarfraz Z, Malekpour M, Salehi M.a survey on caregiver’s knowledge about

special caring for 1 to 5 years-old children with cerebral palsy and their compliance with these practice. Journal

of Research in Rehabilitation Sciences 2013; 9(4):618-28.

15. Kling A, Campbell P.H, Wilcox J. Young children with physical disabilities: Caregiver perspectives about assistive

technology. Infants & Young Children.2010, 23(3):169-183. Available from:

https://depts.washington.edu/isei/iyc/23.3_Kling.pdf

16. Martinez-Biarge M, Diez-Sebastian J, Kapellou O, et al. Predicting motor outcome and death in term

hypoxic-ischemic encephalopathy. Neurology 2011; 76:2055e61. Available from:http://www.pdcen.org/wp-

content/uploads/2015/12/CEN_Dec15_Feeding_and_communication_impairments.pdf

17. Ahmed S, Dein Soheir B.E, Shenuda M, Mohamed A. Home Care Offered by Family Caregivers to Preschool

Children, Suffering From Hemiplegic Cerebral Palsy. Journal of Biology, Agriculture and

Healthcare.2015;5(4):65-72. Available from:

http://iiste.org/Journals/index.php/JBAH/article/view/20219/20694

18. Coughlin J. Estimating the impact of caregiving and employment on well-being. Center for Health Research,

Healthways, Incorporated; 2010. Available from:

SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

http://www.nasuad.org/sites/nasuad/files/hcbs/files/196/9797/Estimating_the_Impact_of_Caregiving_and_Emplo

yment_on_Well-Being.pdf SP46-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

The Impact of Demographic Factors and Professional Quality of Life on Caring Ability of

Nurses in Intensive Care Units (ICUs)

Marziye Mohammadi1, Ramin badihi

2*, Hamid Peyrovi

3

1 MSc, is a critical care nurse working in Isfahan, Iran.

2 MA, is PhD student of Demography, Department of social sciences, Tehran University. (ramin.badihi@ut.ac.ir)

3 PhD, is a professor of nursing in the Nursing Care Research Center, Iran University of Medical Sciences, Tehran, Iran. *Corresponding author Abstract

Background and Purpose: The ability of nurses to care in ICU may be affect by unique features. The

professions that is associated with physical health and human’s life Are always stressful and affect

quality of life in staffs. The aim of this study was to examine relationship between the professional

quality of life’s dimensions and demographic characteristics on caring ability of intensive care

nurses.

Methods: In this cross-sectional analytical study, 282 Employed nurses in the general ICU and

surgical ICU of hospitals in Tehran were selected using G-Power Software by two-stage cluster

sampling method. Data collection tools included demographic data form, questionnaire of caring

ability and Professional quality of life questionnaire Edition 5. Data analysis was conducted in SPSS

software version 18 using correlation coefficients and linear regression equations.

Results: The professional quality of life explains 5/28% of changes caring ability. The dimension of

compassion satisfaction of professional quality of life has direct and significant correlation with the

caring ability and compassion fatigue from professional quality of life has significant and reverse

correlation with the caring ability. These two dimensions predict 33% of changes in caring ability of

nurses. There was observed no significant relationship between secondary traumatic stress and

caring ability. Job burnout had significant inverse relations with the caring ability. Two variables of

compassion satisfaction predict 35% of changes in caring ability in positive way and job burnout in

negative way. There is a significant difference between marital status of single class and marital

status of other classes with caring ability (sig= 0.021). There is a significant difference between

marital status of Married class and Marital status of other classes with caring ability (sig= 0.028).

Among nurses working in private and public sectors was observed significant differences in caring

ability (sig= 0.017.) Single class of marital status and work in private hospitals explain 0.5% of

changes in caring ability.

Conclusion: enhance the compassion satisfaction and reduce job burnout of professional quality of life of nurses is more effective in providing better and qualified care.

Key words: professional quality of life, caring ability, compassion fatigue, compassion satisfaction, demographic variables.

SP47-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Introduction

The patient care is one of the main elements of community health care system and is the main duty

of nurse. Caring is as an essential value on personal and professional lives of nurses and it is

inevitable components of nursing professional activities. (15) By definition of Mayrof, the caring is

helping others to grows themselves and reach actuality. (13) The "human care" theory of Jeane

Watson emphasized on moral and spiritual dimensions of care. (15) The important issue that should

always be considered in care delivery, is providing qualified care and consequently, satisfaction of

people receiving care. (8) Quality of patient care and its result is largely dependent on the caregiver.

Patient and patient care are both stressful. Caring for a long period of time, care for patients with

chronic diseases, elderly patients, patients dying and patients who are unable to communicate, are

stressful. (15) This issue in intensive care unit that patients life is more dependent on the care

provided by nurses, is more important (9) and the ability of nurses in providing care is of the

prerequisites to ensure quality of care. Caring ability is the ability to provide care to others. (14) The

need for emotional care and compassion, especially when they are sick and, more specifically, in a

difficult and incurable disease, is one of the emotional needs of humans. This need, especially in

times of illness, is satisfied mainly by nurses. One of the expected features from care providers to

others is "Sympathy". This sympathy may put nurses at risk of secondary traumatic stress symptoms

progression. (10) Nursing is one of the most intense professions. Nurse due to the fact that in their

professional are in charge of circadian monitoring the patients are continually exposed to multiple

stressors. (7) ICU nurses more than nurses in other sectors are subjected to job stress. Of the main

stress in the intensive care unit can mention necessary to work with advanced technology, problems

related to communication, faced with ethical issues, disagree with nurse managers, observing

mortality, insufficient information, work pressures and lack of access to professional ideals. Based on

the study of oncology nurses in Brazil, five stressors including seeing the suffering of others and

unable to help, heavy workload, the lack of equipment, lack of managers effort in tricky situations

and nurse's mistakes were reported. (17) Prerequisite for qualified care is nurse's enjoyment of the

physical, mental and spiritual health and appropriate mental vitality and freshness and in other

words desirable quality of work life. (2) Quality of work life is the qualities that a person as helper

feels in his work. Quality of work life has both positive and negative aspects. Positive aspects of

quality of work life are called as "compassion satisfaction" and negative aspects of it are called as

"compassion fatigue". "Compassion Satisfaction" is positive benefits which members of the

professions that help is considered their essential component gain from working with suffering or

traumatized people and is degree of feeling of success at work. On the other hand, high and

continuous communication with patients and family members may create problems for nurse’s

conditions that is so-called "compassion fatigue". (3) Compassion fatigue is a state of fatigue and

impaired performance in employees who tolerate pressure and emotionally. Fatigue from sympathy

occurs for those are affected by injuries to others. Specific symptoms of compassion fatigue include

re-experiencing the traumatic events, intrusive thoughts, avoidance of recalling events, sleep

disorders, irritability, anxiety and loss of hope. (6) Has long job burnout in nurses taken into

consideration, but concepts of compassion fatigue and secondary traumatic stress and their effects

on caregivers is unknown. (12) This clinical phenomenon have been raised as concerning issue,

because it can have negative effects on the ability of caregivers to provide services and maintain

personal and professional relationships. (1) Stam (2002) showed that a person may be suffering

fatigue from compassion, and in the same time, gained the positive benefits from sympathy.

"compassion Satisfaction " can improve harmful effects of "compassion fatigue" and "job burnout". (16) As nurses are the largest group of providing services in health system should have a good SP47-

18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

quality of working life to be able to provide care in the optimal form to care patients. (2) The fact

that how is professional quality of life of ICU nurses been the subject of several studies. While

gaining information in this regard is valuable, the question that arises, is that how is the relationship

between professional quality of life in nurses with their ability to care? Considering that being with

patients can affect the professional quality of life for nurses in both positive and negative way, this

question arises as to what degree of "compassion satisfaction " and "compassion fatigue" may

increase or decrease the ability of nurses to provide care? . The aim of this study was to examine the

relationship between the professional quality of life’s dimensions and demographic characteristics

on caring ability of intensive care nurses. Analysis method

This quantitative-analytical research was done in hospitals of Tehran city. The study population

included all the nurses in adult intensive care units (general ICU and surgical ICU) in hospitals in 22

districts of Tehran. Initially 30 ICU were selected with two-stage cluster sampling method and then

from each ICU 10 nurses who worked at least one month in a intensive care units were selected and

entered the study through a systematic random sample. Questionnaire of demographic

characteristics (include age, marital status, work experience, gender, work experience in ICU,

income, work hours, work in private hospitals, tend to work in intensive care units, education, and

the dominant shift). Questionnaire of Professional quality of life Edition 5 and Questionnaire of

caring ability were given to the nurses and necessary explanations on how to complete it were given.

Questionnaire of Professional quality of life Version 5 includes three subgroups of job burnout,

secondary traumatic stress and compassion satisfaction. Content validity was used to evaluate the

validity of the questionnaire of Professional quality of life and the caring ability. The amount of Alpha

was calculated for the questionnaire of caring ability 0.74 and 0.78 for PQOL. To measure the

association between independent variables on the dependent variable based on the data collected,

initially in bivariate relations amount of correlation between each of the independent variables and

the dependent variable (caring ability) was examined with appropriate correlation tests. In the next

step demographic variables, Professional quality of life and its aspects and subscales were placed in

five proposed regression model in connection with the dependent variable (caring ability of nurses)

and the results were analyzed. Findings

In order to insert variables in the regression model, the independent variables were separately

assigned in a bivariate relationship with variable caring ability of nurses. Based on the obtained

values and significance level among demographic variables only variable of working in private

hospital in the F test with sig= 0.017 has significant relationship with variable of caring ability. So the

caring ability of nurses with their working in private hospitals has correlation in a positive direction.

Other demographic variables do not correlate with the caring ability. Variable of Professional quality

of life, both dimensions of compassion satisfaction and compassion fatigue, Professional quality of

life and subscales of compassion fatigue that include secondary Traumatic stress and job burnout,

have totally significant correlation with the caring ability of nurses in intensive unit in hospitals.

Although nurses' marital status variable as a nominal four values variable with sig= 0.991 in chi-

square test and sig= 0.078 in analysis of variance does not have correlation with the caring ability of

nurses, but as a dummy variable to enter the regression equation with the underlying class of spouse

deceased, in F test single class with sig= 0.021 and married class with sig= 0.028 has significant

difference with caring ability of nurses. Therefore, single nurses and Married nurses have significant

difference with other nurses in terms of marital status in their ability to care of patients. (Table 1) SP47-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Table 1. analysis of variance test (F) two-dimensional variables correlation (apparent) Marital status

with the ability to care of nurses Sig F Meane Square Marital status

0.021 5.328 1490.843 Groups of singles and non-singles 0.028 4.859 1348.704 groups of married and non-married 0.293 1.108 312.220 Groups of divorced and non-divorced

Investigation of bivariate relationships show that, nurses employment in private hospitals, dummy

variable of marital status classes, Professional quality of life and its subscales and dimensions as

variables influencing the caring ability of nurses have condition to enter regression models. In five

suggested regression model Professional quality of life, its dimensions and subscales with

demographic variables of ICU Nurses were in connection with the caring ability. In order to

respectively variables that most correlated with the dependent variable remain in the model up to

0.05 error rate, stepwise method was used in regression models. In order to measure the effects of

demographic variables in predicting the caring ability of nurses in intensive care unit of hospital, in

first regression model demographic variables entered as independent variables into regression

equation and the variable of caring ability of nurses as dependent variable. In this model,

demographic variables working in private hospitals and single class, dummy variable of marital status

in the F-test with sig= 0.006 remained in the model and have significant relationship with caring

ability of nurses in intensive care unit. So nurses differences in terms of age, sex, education, income,

work experience, work experience in intensive care unit, willingness to work in intensive care units

and hours worked per month and prevailing shifts do not have much impact on predicting their

caring ability. As in the statistical coherence tests also there was observed no correlation between

mentioned variables and the caring ability of ICU nurses. Due to the variable beta coefficients in the

private sector with a beta value of -0.194 for the caring ability has more robust relationship

compared to variable of single nurses’ class with beta value of - 0.140 for their caring ability in a

negative direction. Despite remaining two variables of single class and marital status dummy variable

and working in private hospitals in the model, these two variables only explain 5/0% of changes in

variable of caring ability. The contribution of these two variables in predicting the caring ability is

very little compared to other variables. The first regression model equation is as follows: (caring ability) Y= 192.95 – 6.415 (Work in the private hospital) – 4.526 (class of Single Marital

Status)

Regression equation show that those who work in private hospitals -6.415 have less caring ability

than those who do not work in a private hospital, also single nurses - 4.526 have less caring ability

than nurses that spouse deceased. In the second model the demographic variables that remained in

the regression equation in the first model entered regression equation along with the independent

variables of nurse's Professional quality of life and dependent variable of the caring ability of nurses.

In this model, only variable of Professional quality of life of nurses remain in the model and the

demographic variables entered in the model come out of the equation. In the Pearson correlation

test also variable of Professional quality of life with sig= 0.000 had the highest level of correlation

with the variable of caring ability of nurses compared with the demographic variables in the model.

So regression model was test results of correlation between demographic independent variables in

the model, Therefore the regression model confirms test results of correlation between

demographic independent variables and variable of Professional quality of life with variable of the

caring ability of nurses. In this model, variable of Professional quality of life of nurses explain 24.3%

of changes in the caring ability of nurses. The beta value of 0.493 indicates that Professional quality

of life have direct and significant relationship and with their caring ability of nurses in the intensive

SP47-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

care units of the hospital. So nurses in intensive care units that have high Professional quality of life are more able to take care of patients. The second regression model equation is: (Caring ability) Y= 113.735 + 0.508 (Professional quality of life)

In order to control the effects of demographic variables in third model, variable of Professional

quality of life that in the second model was the only predicting variable that remained in the model,

alone entered the regression equation to specify its impact on predicting caring ability of ICU nurses

as the main variable of research. Based on results of this model, variable of Professional quality of

life of nurses explain 5/28% of changes in the caring ability of nurses to care. Regression equation

based on this model is: (Caring ability) Y= 127.553 + 0.570 (Professional quality of life)

Considering that variable of Professional quality of life is formed of two indicators of compassion

satisfaction and compassion fatigue, in order to assess the predictive power of these two dimensions

of Professional quality of life of nurses, in the fourth model, two indexes of compassion satisfaction

and compassion fatigue entered the regression equation as predictor variables and the dependent

variable of caring ability. In this model, both dimensions of Professional quality of life of nurses have

remained in equation. The amount of 0.454 for beta statistic of variable of compassion satisfaction

dimension showed positive and direct relationship between compassion satisfaction and caring

ability of nurses and the amount of beta - 0.182 for compassion fatigue dimension shows inverse and

significant relationship between compassion fatigue and the caring ability, this means that increased

compassion fatigue of nurses, will cause to decrease their caring ability in intensive care units. The

difference in beta statistic for the two dimensions of Professional quality of life shows a stronger

relationship between the satisfaction of sympathy and the ability to care of nurses in a positive

direction relative to the relationship between compassion fatigue and caring ability in negative

direction. Considering the beta value equal to 1.047 for the dimension of compassion satisfaction

and B equal to - 0.256 for compassion fatigue to the extent that the compassion satisfaction can

increase the caring ability of nurses, an increase of compassion fatigue can't reduce the caring ability

of nurses. Two dimensions of compassion satisfaction and compassion fatigue, Professional quality

of life explain 33% of changes in the caring ability of nurses. This value shows that almost a third of

nurse's caring ability in intensive care units .depends on dimensions of their Professional quality of

life and about two thirds of the changes are explained by other factors. The fourth regression model

equation is: (Caring ability) Y= 160.784 + 1.147 (compassion satisfaction) – 0.256 (compassion fatigue)

According to the distinction between two concepts of job burnout and secondary traumatic stress in

that secondary traumatic stress is experienced after an extreme or periodic conflict or a traumatized

person, and job burnout is a process not an event. (4) In addition, secondary traumatic stress is

associated with rapid symptomatic relief but job burnout is associated with a longer period of

symptoms and more resistance for recovery. (11) In the fifth regression model more detailed aspects

of Professional quality of life of nurses entered the equation to also evaluate the effect of these

detailed aspects on the caring ability of nurses. In this model, three predictive variables of

compassion satisfaction, job burnout and secondary traumatic stress as subscale of Professional

quality of life of nurses and variable of caring ability as the dependent variable were in the

regression model. In this model, secondary traumatic stress variable have been removed from

model. This means that secondary traumatic stress dimension is not related to the caring ability of

nurses. Two variables of compassion satisfaction and job burnout from sub-indicators of

SP47-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Professional quality of life have remained in the regression model. Based on stats from third model

can be deduced that compassion Satisfaction in nurses with beta value of 0.349 still have positive

and direct relationship with the caring ability. Also job burnout with the beta value of - 0.290 has a

significant relationship in negative direction with the caring ability. But the intensity of relation

between the compassion satisfactions with the caring ability of nurses in a positive direction is more

than the intensity of relationship between job burnout and the caring ability of nurses in the

negative direction. So intensive care units nurses can reduce negative effects of their job burnout on

their caring ability by implementing strategies to increase their compassion satisfaction. Two

dimensions of compassion satisfaction and job burnout of detailed aspects of Professional quality of

life of nurses predict 9/34% of changes in caring ability of nurses. This amount reflects the fact that

more than a third of the change in the caring ability of nurses is due to changes in compassion

satisfaction and their job burnout. Dimension of secondary traumatic stress in t tests with sig= 0.277

has no relation with caring ability of nurses. The regression equation of this model is as follows: (caring ability) Y= 175.832 + 0.806 (compassion satisfaction) – 0.766 (job burnout)

Comparing regression models shows that in the first model, the amount of R= 0.277 means that

there is not very strong relationship between assessed demographic variables and caring ability of

nurses and the regression model has no conform with the data. In this model predicting two

variables of working in private hospitals and marital status (single) for nurse's caring ability is 0.5%

and the relation is weak and in negative direction. By entering the Professional quality of life as the

main predictive variable in model along with demographic variables, the predictive power of the

model increased with the amount of R= 0.493 that reflects the stronger relationship between the

variable of Professional quality of life and the caring ability of nurses. Model has a good fit and

demographic variables are out of the equation. Variable of Professional quality of life predicts 3/24%

of changes in caring ability. In the third model Professional quality of life alone entered the

regression equation and with the amount of R= 0.534 improves model fitting compared to the

second model that had entered regression equation with demographic variables. Increasing the

amount of R2 and the amount of beta from second model to the third is due to the correlation

between demographic variables with Professional quality of life. Absence of demographic variables

in the third model relative to the second model increases 4.2% of the variance predicting

Professional quality of life and strengthens Professional quality of life of nurses and their caring

ability by the amount of 0.041 with controlling the effects of demographic variables. In the fourth

model that two main aspects of Professional quality of life entered the regression equation more

correlation was observed between Professional quality of life and caring ability of nurses. The

amount of R= 0.574 indicates a good fit of regression model with the data. These two dimensions

explain about a third of changes in nurse's caring ability. In the fifth model in comparison satisfaction

with fourth model more detailed aspects of Professional quality of life entered the equation,

Dimension of secondary traumatic stress, although had significant relationship with the caring ability

in Pearson correlation with sig = 0.000, but in regression equation had no significant relationship

with caring ability of nurses and was removed from the equation. Departure of this variable from the

equation brought model fit to the best possible condition considering the studied variables with the

amount of R= 0.591. Two dimensions of compassion satisfaction and job burnout approximately

predict 35% of changes in the caring ability. The strongest relationship between Professional quality

of life and the caring ability with the beta amount of 0.534 was observed in third model and the

greatest prediction coefficient in regression equation for variable of compassion satisfaction was

obtained in fourth model with amount of B equal to 1.047. Thus increasing the Professional quality

of life of nurses in dimensions of compassion satisfaction and in the second stage reducing amount

SP47-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

of job burnout has an important role in increasing nurses caring ability regardless of differences in their demographic characteristics. Discussion and conclusion Much research about the caring ability of nurses, dimensions and factors affecting it is done. The

results of this study showed that the age, gender, experience, experience in intensive care units, ,

willingness to work in intensive care units, the monthly salary, hours worked during the month,

education and the prevailing shift do not have difference in caring ability of nurses in intensive care

units and there was observed no correlation between mentioned variables with the caring ability.

The nurses who work in intensive care units of private hospitals compared to other nurses of

intensive units also intensive care unit nurses who were single compared to nurses who their spouse

is decreased have lower ability to care. The results of the correlation tests also approved these

changes. However, the contribution of these two dummy variables in predicting the changes in

caring ability of nurses was minimal. The demographic differences in intensive care unit nurses have

little effect on the caring ability for these patients. Running the second to fifth linear regression

model, can improve strong relationship between the professional quality of life of nurses and their

caring ability. This variable explains 28.5% of changes in caring ability of nurses. Login aspects of

professional quality of life of nurses that includes compassion satisfaction and compassion fatigue

caused to enrich relationship. So that compassion satisfaction increases caring ability for intensive

care unit nurses and compassion fatigue reduces the caring ability of nurses. These two dimensions

of professional quality of life predict 33% of changes in nurse's caring ability. Minor aspects of

professional quality of life that includes compassion satisfaction, job burnout and secondary

traumatic stress have positive correlation with the caring ability for nurses in relation. However, the

entry of these three predictive variables to model, secondary traumatic stress variable comes out

from the model. In other words, between the increase and decrease of secondary traumatic stress,

with the caring ability of nurses was observed no significant correlation. Two variables of compassion

satisfaction in a positive direction and job burnout in the negative direction affect on the caring

ability of nurses so that these two variables predict 35% of changes in caring ability. It is necessary in

future research, theoretical models other than the Mayrof model be tested in order to recognize the

existence of other dimensions of professional quality of life and its impact on the caring ability. In

addition, 65% changes in nurses caring ability is caused by other factors that understanding these

factors and how they impact on the caring ability of nurses needs further investigation. However, the

professional quality of life based on Mayrof model explains more than a third of caring ability of

nurses. Based on the study findings of Yoder in 2010, situations that nurses described as a stimulus

for compassion fatigue and job burnout included patient care, system problems and individual

behaviors. Nurses reported several cases that had experienced of during patient care, physical,

emotional, financial threats or imminent death. The system problems included a large number of

patients, a lot of tasks for nurses, the patients' illness and overwork per day. Individual problems

included inexperience, lack of energy and ignoring the signs of serious illness. (17). Based on results

of this research it is suggested that in recruiting nurses and applying them in intensive care units,

considering their demographic differences is not so necessary in the caring ability of nurses. But also

planning on increasing the compassion satisfaction and reduce compassion fatigue especially to

provide solutions to reduce job burnout can lead enhance the caring ability of nurses working in

intensive care units. Is also recommended that caring ability and professional quality of life of nurses

be measured periodically by instruments used in this study to prevention and the necessary steps be

taken if needed. Acknowledgments The authors would like to thank all participants in the study. SP47-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

References 1- Abendroth M, Flannery J. Predicting the Risk of Compassion Fatigue: A Study of Hospice Nurses. Journal of Hospice and Palliative Nursing .(2006); 8(6): 346-356. 2- Allaf Javadi M, Parandeh A, Ebadi

A, Haji Amini Z. Comparisson of life quality between special care units and internal-surgical nurses.

Iranian Journal of Critical Care Nursing. (2010); 3(3):113-117. 3- Avila P. Predicting the risk of Compassion fatigue: An Empirical study of registered nurses at

Teaching Hospitals In: 6th

Annual Graduate Medical Education Resident Scholary Activity and Research Symposium,15 April. Indiana University Health Ball Memorial Hospital: Development of

Medical Research for physicians and staff at IV Health Ball Memorial Hospital. (2011(. 4-Farber BA. (1983).Introduction: A critical perspective on burnout. In: Farber B A. (Ed.), Stress and burnout in the human sevice prefessions, pergamon, New York, 1-20. 5- Fathi M. Incidence rate and sources of stress among nurses worKing in intensive care unit of kurdistan university of medical sciences. Faslnameh shenakht. (2002); 2(4): 19. 6- Frank DI, Karioth SP. (2006). Measuring Compassion Fatigue in Public Health Nurses Providing Assistance to Hurricane Victims. Southern Online Journal of Nursing Research. (2006);7(4):2-13. 7- Ghasemi A, Attar M. Intensity of job stressors of nurses in hospitals cities of Babol, Sari and Behshahr. (2007). Available from: www.betsa.ir. 8- Haghighi Khoshkho N. The quality of nursing care from nurses and patients viewpoints in the

teaching hospitals of Tabriz university of medical science. [Dissertation],Tabriz university of medical

science. (2004). 9- Hay D,Oken D.The psychological stresses of Intensive Care Unit Nursing. psychosomatic medicin. (1972);34(2). 10- Kaladow JK.Caring for the Caregivers: Factors Contributing to Secondary Traumatic Stress in

Oncology Nurses. Academic Dissertation for the Degree of Doctor of Philosophy, Indiana University.

(2010). 11- Lydon P. (2009) On the Compassionate Helper: Emotional Outcomes in volunteers listening to

the Distressed and Despairing. Academic Dissertation for the Degree of Master of Psychology,

University of Liverpool. 12- Mangoulia P, Fildissis G, Koukia E, Alevizopolous G, Katostaras T. Factors Associated With Compassion Fatigue Among ICU Nurses in Greece. Critical Care. .(2010); 15(1). 13- Mayeroff M. On caring.Harper and Row, New York.(1971). 14- Nkongho N.The Caring Ability Inventory.In: measurement of nursing outcomes.In: Strickland OL

and Dilorio C. springer.(2003); New York:184-98. 15- Peery AI. Caring and Burnout in Registered Nurses: What ,s the Connection. Academic Dissertation for the Degree of Doctor of Education, North Carolina State University.(2006). 16- Rashotte J, Fothergill-Bourbonnais F and Chamberlain M. pediatric intensive care nurses and their grief experiences: A phenomenological study. Heart and Lung. . (1997); 26: 372-386. 17- Yoder EA. Compassion Fatigue in Nurses. Applied Nursing Research. .(2010); 23: 191-197

SP47-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Prioritizing the Factors Affecting the Operation

and Maintenance of Medical Equipment in Iran

Hospitals based on AHP Model

Nassibeh Alinejad 1, Ghahraman Mahmoudi

2, Fatemeh Dabaghi

2

1. M.SC of Health Services Management, Sari Branch, Islamic Azad University, Sari, Iran

2. Hospital Management Research Center, Department of Health Services Management, Sari Branch, Islamic Azad University, Sari, Iran

Mahmoudi Ghahraman: Email:ghahraman48@yahoo.com

Abstract

Background and Aims: Today, medical equipment maintenance and management plays a great role in

favorable performance of hospitals. Because widespread use of technology in the field of hospital, Extensive

maintenance been inevitable. This study aimed to Recognition and Prioritize factors affecting the medical

equipment maintenance in hospitals of Iran Based Analytic Hierarchy Process.

Methods: The present study is a descriptive cross-sectional study conducted in 2016. About 88 members of

the medical equipment users and management hospitals in a number of hospitals in Iran were selected using

census method. For data gathering questionnaire was used that consist 6 part facilities, purchase, economic,

human, structural and technical that its Validity has been proved by experts and its reliability as due to the

Cronbach's alpha was proved. Then, the collected data using AHP model, and Expert choice software was

analyzed.

Results: Based on Analytical Hierarchy Process, among six groups of factors, purchasing factors ranks first with

0.221 weight and facilities with a weight of 0.058 was ranked last. In factors purchases needs assessment

factors in the purchase of equipment, Committees Order and Applying the life span expenditure Rank first and

third respectively.

Conclusion: According to results, Committee Order, Continuous monitoring of equipment performance during

calibration process and scheduled preventive maintenance system and training of human resources required Leading to increased productivity of medical equipment in hospitals.

Keywords: Maintenance Management, Medical Equipment, AHP, Hospitals

Introduction

In today's modern hospitals, medical equipment have become one of the integral elements and about 3.1 to about half of the projected cost was allocated to this sector hospitals. Today, the medical community in diagnostic, treatment, equipment, advanced technology has become increasingly reliable. The utilization of this equipment requires the equipment, that is ready to operate most of his life and kept healthy. The time for preventive maintenance before the failure will be the most important (1). Having medical equipment adequate numbers of good quality and experienced personnel to operate machines, hospital management positions in providing the best health care and hospital services for early diagnosis and proper guarantees. Current evidence shows the lack of maintenance leads to poor performance and maintenance of medical equipment, ineffective, hospital revenues have declined and patients confused and leads to a waste of money and time for them. On the other hand the replacement and repair of equipment, imposes enormous cost to hospitals (2).

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 Ensure the proper operation and effective medical devices and clinical trials conducted safely, this is standard equipment, and mechanization approval of medical equipment is of particular importance and this is due to the vital role this equipment, pay attention than ever before and the need for an accurate, comprehensive and macro-management in the field of medical equipment is needed (3). According to studies conducted in Iran is for maintenance and repairing of medical equipment to the amount of 10-20% of the purchase price in the budget estimated (4). According to Kendall more than 60% of medical equipment maintenance facilities do not exist in some countries they are left unused that you can use applications that referred to this to be resolved. These programs include: 1. Maintenance combined with medical device 2. Control medical equipment 3. Choosing the purchase of medical equipment and trained technicians root Medical facilities (5).

In developing countries and even developed, medical and hospital equipment in terms of usability, maintenance is not a good situation as a result, this leads to a waste of resources in the country's health (6). Therefore, along with preventive maintenance program can reduce the cost of repairs from 45 to 50% (7). The Ministry of Health in 1394, approximately 60 billion cost of repair and service, maintenance, replacement and improvement of medical equipment is standard (8). In this regard, Walsh says by creating an efficient maintenance system and the right to preserve these assets and increase equipment effectiveness (9). Khalaf et al also showed a study on survival and longevity of equipment, equipment maintenance program plays an important role (10).

Optimal performance of medical equipment and hospital management increasing role in modern plays, why technology in the field hospital widely used, and extensive maintenance is inevitable. One of the conditions appropriate technology from the perspective of the World Health Organization, issue and maintenance of medical equipment and the medical equipment maintenance management will be important in this regard (11). It is the management of medical equipment in hospitals and it is essential to pay attention to the first step in this regard to recognizing medical equipment maintenance management. In this context, the aim of this study is done to identify the most important factors affecting the operation and maintenance of medical equipment, to identify and prioritize the factors discussed to determine the priorities presented programs more practical and more practical. Methodology

This study in term of purpose was applied and descriptive and on the field was performed. Also according to that data by questionnaire and a few it was just a field. The study population included all experts and officials of medical equipment (N = 88), buy authorities and hospital administrators were stationed in hospitals in Iran so that two hospitals from the north, south two hospitals, two hospitals and two hospitals from the West and East were selected. In this study, patients were enrolled census and sampling was done. Data collection tools included a questionnaire consisted of two parts. The questionnaire included questions that respondents' demographic characteristics such as age, sex, education, marital status, work experience in the sector, and examining the side. The second part of the questionnaire to prioritize the most important factors affecting the operation and maintenance of medical equipment was designed. In such a way, it made questionnaire consisting of 48 questions. 8 questions to assess the technical, economic factors 8 questions, 8 questions structural factors, 8 question of facilities, 8 questions and 8 questions of human factors were considered buying factors. Since at this stage utilizes AHP method paired comparison was made between the criteria; a large number of criteria was compared to the number and thus completing the questionnaire, for example, time-consuming and difficult, therefore, according to experts in the field, 8 criteria for each of the groups of technical, economic, buy, structural, and human resources were selected. The subjects were asked to rate each criterion of the study compared to other criteria and its importance relative to other factors determined. On a scale of very important, very important, important, somewhat important, and which were identical with the numbers 9, 7, 5, 3 and 1 were shown. Validity by

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

ten specialists was confirmed. Its reliability during data collection using Cronbach's alpha was performed on 20% of the sample size and the quality factor of over 70% was achieved for all the components. After obtaining a study validity and reliability as well as in hospitals, the questionnaires electronically or the presence of the samples was studied. The completed questionnaires into the software Expert Choice were coded and entered. Finally, based on pairwise comparisons were performed in the application environment. Findings

Out of 88 samples, 63% of men and 37% were women. In the variable age group 29% of the subjects in the group 30-20, 31% in 40-31 and 40 percent of them were in the 50-41 group. In 42% of the samples varied work experience 10.1 years, 36% were 20-11 and 22% in 30-21 years. 5% of the variable type of education degree, 63 percent of Bachelor, 27% MA and 5% were PhD. Marital status in 37% of samples were single and 63% were married. Prioritize the factors shown in Table facilities. Based on the Analytic Hierarchy Process and paired comparisons of features, the maximum weight or priority to alternative proprietary operating systems for devices subject to additional preventive maintenance, weighing 0.226 and the lowest weight or priority of the tracing agent business processes related to equipment and installed in Sections 0.048 weight (Table 1).

Table 1: weight of each of the facilities, see samples

Operating weight Symbol Factors

0.17 F1 Purchased or application programming proper preventive maintenance

0.148 F2 Preparation checklist to evaluate each machine cases

0.226 F3 Allocate additional alternative devices for devices subject to preventive maintenance

0.197 F4 Installation guides and using machines

0.062 F5 Taking into account the optimal space for devices

0.087 F6 Installation of warning systems for devices

0.061 F7 Catalogue data extraction device and insert the Manual

0.048 F8 Drawing business processes in sectors related to equipment and installation

Among the eight factors under investigation in economic factors, the highest rank of funding to conduct in-service training of medical devices users 0.221 weights and the lowest priority to research related to the allocation of sufficient expertise in this regard was 0.049 weights (Table 2).

Table 2: Weight economic factors from the perspective of each of the samples

Operating Symbol Factors

weight

0.168 E1 Funding for the training of hospital personnel and senior managers of hospitals and experts in the

medical equipment sector

0.183 E2 Create a separate depreciation account for medical equipment preventive maintenance

0.221 E3 Funding to conduct in-service training of medical devices users

0.116 E4 Funding for preventive maintenance knowledge and further studies on how to implement its optimal

0.049 E5 Allocating adequate funding for research and research expertise in this regard,

0.148 E6 Assign a separate budgetary line for implementing preventive maintenance

0.050 E7 Funding for preventive maintenance and how to run seminars to introduce different levels

0.065 E8 Funding for cost-effectiveness in the field of equipment

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Based on Analytical Hierarchy Process in between 8 the human factor, holding of in-service training for medical devices users and the organizational culture of each hospital preventive maintenance to localize the highest and lowest rankings and gained weight (Table 3). Table 3: human factors, see the weight of each sample

Operating weight Symbol Factors

0.182 M1 Conviction managers of departments and hospitals to implementing preventive maintenance

0.234 M2 Conducting in-service training for medical devices users

0.223 M3 Hiring experienced and familiar with preventive maintenance on medical equipment engineering

sector hospitals

0.168 M4 Continuing education each device users on how to apply the preventive maintenance task

0.050 M5 Continuous follow-up ministry and hospital administrators about the program

0.070 M6 Designing an effective incentive system to better manage equipment

0.034 M7 Organizational culture survey for localizing each hospital preventive maintenance

0.040 M8 Notifications preventive maintenance personnel about the loss of jobs, they are not.

Based on Analytical Hierarchy Process in the eighth structural factors, factors associated with companies executing preventive maintenance in hospitals and examine the contracts with them and prepared to perform preventive maintenance procedures and guidelines at the beginning of each device and emphasized respect and the continuance of the highest and lowest rankings and gained weight (Table 4).

Table 4: the weight of each structural causes of visibility samples

Operating Symbol Factors

weight

0.224 S1 Communicating with the operator of the hospital's preventive maintenance and

examine the contracts with them

0.162 S2 Plan the perfect time to devote time to relax devices for specific maintenance

measures

0.098 S3 Conference familiarity with preventive maintenance and the need for its

implementation by the Ministry of Home

0.125 S4 Providing computer software to insert the device application and registration

data related to each hospital

0.164 S5 Preparing perform preventive maintenance procedures and guidelines at the

beginning of each device and emphasized respect and continuity

0.11 S6 Safety during maintenance and cleaning activities in mind by users and experts

and emphasized respect them

0.070 S7 Organizational structure responsible for the proper formation and maintenance

of hospitals and health deputy chancellors of universities

0.047 S8 Culture to implement preventive maintenance of macro-level ministries to

hospital

Based on Analytical Hierarchy Process in the eighth buying agent, agents need assessment in the purchase of equipment, establishment of committees buying and using life span expenditure ranked first, second and third, respectively (Table 5).

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Table 5: The weight of each factor buy from view samples

Operating Symbol Factors

weight

0.197 P1 Needs assessment in the purchase of equipment

0.224 P2 Committees Order

0.141 P3 Applying the life span expenditure

0.055 P4 Continuity and uniformity of new medical devices in compliance with previous

devices

0.073 P5 Specification and features tailored to the needs of operators and determining the range

of capabilities of medical devices

0.093 P6 Calculation of depreciation expense and the remaining costs

0.107 P7 Attention to quality when purchasing equipment

0.111 P8 Taking into account the after-sales service equipment companies

Based on Analytical Hierarchy Process in the eight technical factors, the overall operating plan for the medical equipment was ranked first (Table 6).

Table 6: technical factors see the weight of each sample

Operating Symbol Factors

weight

0.300 T1 For the overall planning of medical equipment

0.077 T2 Coordination and Communications Manager of medicine and medical equipment

0.097 T3 Monitor the movement of medical devices in hospitals

0.171 T4 Monitor performance contracting companies representatives referred to the hospital

by Head of the Department of Biomedical Engineering

0.142 T5 See and timely medical engineering lead to periodic inspections

0.100 T6 Timely delivery for the repair of the devices that are out

0.068 T7 Forecast spare parts

0.044 T8 Supply and installation information of each device categories

Based on Analytical Hierarchy Process, in between six groups of factors, weighing 0.221 purchasing agent first place and operating facilities were ranked last with a 0.058 weight (Table 7).

Table 7: The weight of each factor from the perspective of samples

Operating Symbol Factors

weight

0.058 Facilities Facilities

0.159 Economic Economic

0.192 Human Human

0.165 Structural Structural

0.221 Purchase Buy

0.204 Technical Technical

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Figure 1: View of overall priorities Discussion and conclusion:

Medical equipment the hospital is one of the three main pillars and the optimal management can reduce costs and

provide effective care for patients effectively. Therefore preventive maintenance of medical equipment management

cycle plays an important role and its requirements, stock management, documenting maintenance, database creation

and maintenance management system will be computerized medical equipment Repair of medical equipment and

information. Khalaf (12), Hamdi et al (2) Jamshidi et al. (13) also emphasized on preventive maintenance and it

makes it easy to access, increase durability and lifetime and knows efficiency and reduce the cost of future medical

devices. The six groups of factors, including facilities, human, structural, buy and technical experts who select and

prioritize the medical equipment was based on the viewpoints of experts. It also factors in different studies as key

factors in the maintenance and management of medical devices are known. For example, the findings Ground

showed that factors affecting the medical equipment maintenance Buy factors, economic factors, human factors and

educational factors (14). In Jadidi et al study (15) as well as management of medical equipment in the US, Britain,

Germany, Canada, Australia, Ireland, Sweden and Italy, which have successful experiences in the management of

medical equipment have been specified pattern, review and 6 groups of structural factors, purchasing, control,

maintenance, training and distribution as factors affecting management and maintenance of medical equipment were

introduced which is consistent with the results of the selection factors. Among the eight factor influencing the

purchase, needs assessment factors in the purchase of equipment, committees buying and using life span expenditure

ranked first and third respectively. Ground study of the four variables influencing customer purchase decisions,

includes quality, price, promotion and distribution, quality as the first priority and price as the second priority,

changing customer-buying decision. The study showed that low price products may the satisfaction of the customer,

but a customer who cares about quality, not satisfaction (14). Turani also study the importance of purchasing agents,

among the factors purchases such as needs assessment and development techniques extend the life of the most

important factors (16). Bahaduri providing the appropriate research collaborates based on need as the most

important factor and price as the least important factor influencing consumer purchasing behavior (17) which in this

case is consistent with the results of this study. However, the results of some studies about the results of this study

have differences is buying factors. For example, in 2005 concluded Pardeshi buy were the most significant factors

affecting the rush certification requirements, buy with optimal rate, purchase of equipment according to the needs,

purchasing the right equipment (18). It also showed Grandstorm, health information technology tools in many situations, such as buying new equipment, implementation of new methods of treatment and financial programs can be used. Means of health information

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

technology as a useful tool in medical equipment purchasing decisions are based on standards and scientific evidence (19). Based on the results of this study and studies referred to convenient shopping and proper medical equipment medical equipment is the most important factor in the management and the prevention of future problems (20). Lack of attention to factors affecting the purchase of medical equipment; provide appropriate services for hospitals will be faced with problems (21). As the defect in any of the stages of production, distribution or use of medical equipment, medical errors are increased. According to the standards of medical equipment, reduce the deficit (22). The results of this study and other studies on the importance of proper maintenance management component purchasing the medical equipment refers in hospitals In the meantime, addressing the committee to buy and according to the technique of survival equipment, including factors that have been cited in studies. Based on the results obtained in structural factors, factors associated with companies executing preventive maintenance in hospitals and to examine the contract with them and prepared to perform preventive maintenance procedures and guidelines at the beginning of each device and emphasized respect and continuance of the highest and lowest rankings and gained weight. In this regard, the establishment of necessary structures with the formation of engineering & management units of hospital medical equipment is necessary. Khalaf findings (12) creating the appropriate structure of hospital medical equipment is adamant that the results of this study are consistent. Nooritajer et al (21) a biomedical engineering units in hospitals and recognition of the performance of the managers of hospitals, is necessary to increase the efficiency and effectiveness of medical devices that are in line with the results of this study.

Among the eight factors under investigation in economic factors, most rated operating funding to conduct in -service training of medical devices users and the lowest priority to research related to the allocation of sufficient funds specialize in this direction. Facilities factors, the maximum weight or priority of proprietary operating systems for

devices subject to additional preventive maintenance successor weighing 0.226 and the lowest weight or priority of the tracing agent business processes associated with the equipment and installation was 0.048 parts by weight. Based on the results Ishida (23) due to factors such as the provision of after-sales service and training in the purchase of equipment failure and will prevent excess spending. As well as access to appropriate medical equipment, on patient

satisfaction and provide optimal service and performance is affected hospitals and lack of appropriate facilities such as equipment and facilities related to its operation, bad, such as radiology and diagnostic devices like patient's stay is increased (24). In addition, quality after-sales service including delivery and proper installation, the buyer satisfaction, willingness to buy again and recommend it to friends and acquaintances seller has a positive impact

(25). All studies mentioned favor results from the present study were agreed. In this area, as well as results, appropriations particular in the area of equipment maintenance, support courses required for medical equipment maintenance and studies on the cost effectiveness of the equipment can be effective as an important factor in the economic sphere.

Among the 8 factors affecting human factors, factors holding in-service training for medical devices users and the organizational culture of each hospital preventive maintenance to localize the highest and lowest rankings and gained weight. Education, pillars and background provide hospital medical equipment management. The training in university-level education (clinical engineers), teaching hospitals (operators) continuing education (annual) training records with engineers, technicians and operators will be provided. Yanjiang et al (26) user training by hospital biomedical engineering unit for correct function and optimal use of essential device is considered. Biomedical Engineering tendency bioelectric training in Iran, bio-mechanical and biological material cannot be conducive to the effective management of hospital medical equipment, modules of study because it is not consistent with the medical equipment management activities and the purpose of education is to produce medical equipment. If clinical engineering training curriculum based on the International Federation of Biomedical Engineering clinic, to gain engineering skills, management and technology departments at hospital.

Based on Analytic Hierarchy Process and opinions of samples, the eight technical factors, planning for the general operating medical equipment was ranked first. Ameriuon et al also an important aspect of medical equipment management, there is a specific plan for the medical equipment. As well as research in hospitals is also planning destroyer regarding management of medical equipment as the most important factor that the results of this study were similar in the two studies mentioned. However, Tasan (27) As for the management of medical equipment in hospitals of Iran University of Medical Sciences also showed due to the necessity of planning in the management of medical equipment, develop and promote policies to integrate management of medical equipment in equipment maintenance management planning, including initial actions based on the Analytic Hierarchy Process and paired

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 comparisons of features, the maximum weight or priority to alternative proprietary operating systems for devices subject to additional preventive maintenance and the lowest weight or priority of the tracing agent business

processes in sectors related to the equipment and installation. These results are consistent with the results Figal in 2003 and China in 2010. Hosseini in their study in 2012 showed there are alternative supplies in times of crisis can prevent the former from too much pressure devices and to reduce the cost of repairs. Overall, the results showed that among the factors affecting the management and maintenance of medical equipment, purchasing agents receive

priority over other factors. As a first step in the process of purchasing medical equipment medical equipment management cycle should be managed in the correct format to prevent many future problems in the maintenance of prevent and control programs. In the first phase, a needs assessment should be accurate and true and then to select, must be considered such as benchmarking, based cost analysis, cost analysis done lifetime and stock management.

The findings Taylor and ackson (28) also emphasized this point. But Liljgron and Osvalder research (29) evaluation and the purchase of medical systems by distributing questionnaires operator and the application of knowledge engineering methods include identifying step usability testing is necessary and knows in Iran, it very time consuming and are not allowed. On the other hand Ogawa et al (30) the role and importance of after-sales services considered the most important factor in the purchase of medical equipment that in developed countries due to the

after-sales service is an integral part of the equipment, the problem is less severe.

Results showed that among the factors affecting the medical equipment maintenance, factors associated with the purchase of medical equipment had the highest priority, therefore, it is suggested to officials and policy makers to take measures such as the selection committee and purchase equipment, continuous monitoring of equipment performance during calibration process and scheduled preventive maintenance system and training of human resources required for this unit according to the International Federation of the subjects for clinical engineering training in universities do. Acknowledgment Hereby, all staff and managers participating in the study will be appreciated. References 1. Bin T. Some Problems and Countermeasures for Medical Equipment Maintenance Management [J]. Chinese Medical

Equipment Journal. 2010;1:040. 2. Hamdi N, Oweis R, Zraiq HA, Sammour DA. An intelligent healthcare management system: a new approach in work-order

prioritization for medical equipment maintenance requests. Journal of medical systems. 2012;36(2):557-67. 3. Benson R, Burnet N, Williams M, Tan L. An audit of clinic consultation times in a cancer centre: implications for national

manpower planning. Clinical Oncology. 2001;13(2):138-43. 4. Sadaghiani E. Assessing health care services and hospital standards. Tehran Moeen publication. 1997:36. 5. Taghipour S, Banjevic D, Jardine AK. Prioritization of medical equipment for maintenance decisions. Journal of the

Operational Research Society. 2011;62(9):1666-87. 6. Banta HD. Medical technology and developing countries: the case of Brazil. International journal of health services. 1986;16(3):363-73. 7. Ameriyoon A, Hamze Aghaei B, Mohebi H. Assessing the medical equipment maintenance management at two Hospitals

military in contery. Journal Mil Med. 2007;9(3):189-95. 8. Sadaghiani E. Medical Education and Health Care. Tehran: Elmi va Farhangi Press; 1997. 9. Hasper jr k. Centralized maintenance responsibilities: a case study. Journal of clinical engineering. 1991;16(3):191-206. 10. Amerioun A, Tofighi S, Zaboli R. Assessing the medical equipment maintenance management at Selected Hospitals Affiliated

with the medical sciences universities in Tehran (2003-2005 .)Journal of Health Administration. 2006;9(23):17-24. 11. Gong-ping L. Standardization of maintenance and management of medical equipments [J]. Information of Medical

Equipment. 2003;3:027. 12. Khalaf A. Maintenance model for minimizing risk and optimizing cost-effectiveness of medical equipment in Palestine. Journal of Clinical Engineering. 2004;29(4):210-7. 13. Jamshidi A, Rahimi SA, Ait-Kadi D, Ruiz A. A comprehensive fuzzy risk-based maintenance framework for prioritization of

medical devices. Applied Soft Computing. 2015;32:322-34. 14. Geravand A, Nouraee M, Saee- Arsi I. Effect of Mix Marketing on Purchase and Satisfaction of Customers in Cooperative

Companies. Cooperation. 2010;3(21):25-33.

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 15. Nasiripour AA, Jadidi R. Designing a model of medical equipment management for Iranian hospitals, 2007. Arak Medical

University Journal. 2008;11(1):97-108. 16. Tourani S, Chegini Z, Mosadeghrad A. Prioritizing factors influencing purchase of medical equipment in selected hospitals in

Tehran using analytic hierarchy process model. Journal of Health Administration (JHA). 2015;18(59):Pe55-Pe65. 17. Bahadori M, Sadeghifar J, Ravangard R, Salimi M, Mehrabian F. Priority of Determinants Influencing the Behavior of

Purchasing the Capital Medical Equipments using AHP Model. World Journal of Medical Sciences. 2012;7(3):131-6. 18. Pardeshi GS. Medical equipment in government health facilities: Missed opportunities. Indian journal of medical sciences. 2005;59(1):13. 19. Grundstrom J, Friberg S, Medin E. PMD39 MINI-HTA TRENDS FOR MEDICAL DEVICES IN THE NORDICS. Value in health. 2011;14(3):A85. 20. Jadidi Ra, Bayati A, Arab Mr. The effect of medical equipment maintenance management system implementation on Valie–

Asr hospital costs situated in Arak: 2006. Arak University of Medical Sciences Journal. 2008;11(4):41-8. 21. Noori Tajer M, Dabaghi F, Mohamadi R, Haghani H. A survay of maintenance and cost of medical equipment in hospitals

associated of Iran university of medical sciences and health services (2000-2001). Razi Journal of Medical Sciences.

2002;9(30):445-54. 22. Tavakoli H, Karami M, Rezai J, Esfandiari K, Khashayar P. When renewing medical equipment is necessary: a case report. International journal of health care quality assurance. 2007;20(7):616-9. 23. Ishida K, Hirose M, Fujiwara K, Tsuruta H, Ikeda N. Analysis of medical equipment management in relation to the mandatory

medical equipment safety manager (MESM) in Japan. Journal of healthcare engineering. 2014;5(3):329-46. 24. Yaghoubi M, Karimi S, Ketabi S ,Javadi M. Factors affecting patients' length of stay in Alzahra hospital based on hierarchical

analysis technique. Director General. 2011;8(3):11-24. 25. Fazlzadeh A, Bagherzadeh F, Mohamadi P. How after-sales service quality dimensions affect customer satisfaction. African

journal of business management. 2011;5(17):7658-63. 26. Yanjiang J, Guanghao W, Huibing L, Hong L. The research on equipment purchasing demonstration and management [J]. Experimental Technology and Management. 2009;5(1):6-16. 27. Tasan M. Study of the status of the tourism and transport services market in the countries members of the D-8 Group, MSc

Thesis. Tehran: Faculty of human sciences, Tarbiat modares University; 2006. 28. Taylor K, Jackson S. A medical equipment replacement score system. Journal of Clinical Engineering. 2005;30(1):37-41. 29. Liljegren E, Osvalder A-L. Cognitive engineering methods as usability evaluation tools for medical equipment. International

Journal of Industrial Ergonomics. 2004;34(1):49-62. 30. Ogawa Y, Nakata Y, Tominaga T. Post-purchase reassessment and improvement of neuroendoscope holder: Importance of

physician-manufacturer communication. Technology and Health Care. 2014;22(2):297-301.

SP48-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Investigation of Crown Lengthening Procedure on

Dimensions of Supra Crystal Gingival Tissues

Asu Hamzehei1, 2

, Nader Ayubian3*

1. Graduate of Dentistry, Periodontology Group, Dentistry Faculty, Islamic Azad University Tehran Branch, Iran

2. Dorsan Dentistry Clinic, Tehran, Iran

3. Associate Professor, Periodontics, Azad Islamic University Tehran Branch, Iran

Abstract

Sub gingival extensive caries, crown fracture, and presence of previous exfoliation line at sub deep gingival areas make impossible the accessibility to correct prosthesis treatments. In these cases, to facilitate restorative treatments and avoidance from periodontal damage, clinical crown lengthening is recommended.

MATERIALS AND MEHOD: This clinical study included 17 patients (15 female, 2 male-mean age 32.5 years) with 20 teeth (bicuspids and first molars of maxilla and mandible) which needed surgical exposure for proper

restorative treatment. Following clinical parameters were recorded two weeks after initial periodontal treatments: • Gingival index (GI), (silness and loe) (17) • Probing depth (PD) at interproximal surfaces • Bone level (BL) was measured via transgingival probing (TGP) fr om reference stent to the alveolar bone crest after local

anesthesia. • Direct bone level (DBL) measured from stent to alveolar bone crest during surgery after flap elevation.

• Supraosseouse gingiva (SOG) was measured from the tip of interdental papilla to the alveolar bone crest. • Biologic width (BW) by subtracting PD from SOG.• Keratinized gingiva (KG) the distance from midbuccal gingival margin to MGJ.

After two month of healing the parameters including GI, PD, SOG. BL and BW were measured again.

Results: During the study period GI had an statistically reduction (1.00 to 0.48 ±0.35 (p=0.001).The amount of

KG at the base line and two month post-surgery were 5_+0.85 and 4.15_+0.9 mm respectively (p=0.001).The

mean PD values recorded at interproximal sites at the base line and two month later were 2.34 _+0.51 mm and

1.87_+0.5mm respectively (p 0.05). The FGM at base line ,immediately after suturing and two month later were

4.07_+1.36mm,5.46_+1.15mm and 5.16_+1.1 mm respectively(p=0.004). The mean BL at base line and two

month later were 5.85_+0.92mm and 7.69_+0.82mm respectively (p=0.001).The mean DBL at base line was

5.89-+0.93mm.There was a correlation between BL at base line and DBL immediately before flap elevation

(r=0.99). The mean DBL at base line and immediately after osseous surgery were 5.89_+0.93mm and

7.55_+0.83mm respectively.(p=0.001). The mean bone reduction was 1.69 _+0.52mm. The mean SOG at

interproximal site at base line was 3.87_+0.7mm and two month post-surgery was 3.22_+ 0.5mm(p=0.001).The

mean BW at base line and two month post-surgery were 1.52_+0.51mm and 1.35_+0.5mm respectively

(p=0.192).We found the mean tissue regrowth at interproximal sites as 3.22_+0.5 mm. Mean reduction of PD,

BW and SOG were 0.47 mm(p=0.016), 0.17mm (p=0.192) and 0.65 mm (p=0.001) respectively. The mean

distance from reference point of stent to free gingival margin on buccal surface was4.07 _+ 1.36 mm at base

line. Immediately after suturing and two month post operation these parameters were 5.46_+1015 mm and

5.16 _+1-1 mm respectively (p=0.004).

Conclusion: Within the limitation of our study, we found the following conclusions: following surgical crown

lengthening vertical dimension of SOG after two month healing significantly decreased. During two month

period of healing interproximal gingival tissue showed coronal regrowth equal to3.22mm.TSP is a reliable and

accurate technique for measuring the apico coronal dimension of SOG.

Key words: Supra osseous gingiva (SOG), Periodontal parameters, periodontal dimensions and biologic width.

SP49-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Introduction

It is necessary to keep periodontium health for success of repaired teeth and at the same time successful prosthesis treatments need scrape of tooth by certain scrape line to be easily accessible to molding and provide appropriate

control of plaque for patients (1, 2)

.

Extensive sub gingival caries, crown fracture, and presence of scrape line of previous failed restorations in deep sub gingival areas make it impossible to access correct prosthesis treatments. In such conditions, attempt to access to healthy tissue of tooth results in extension of scrape to deep sub gingival parts in limitation of biologic width which

finally results in gingivitis and losing periodontal attachments and degradation of bone (3, 4, 5, 6, 7).

In these cases, to facilitate restorative treatments and avoid periodontal damage, clinical crown lengthening procedure is recommended (8, 9).

Amount of picking bone while crown lengthening procedure to reform biologic width and being exposed of enough

tissue from healthy teeth to 2.5-5 mm restorative treatments has been reported (9, 10).

Clinical investigations related to changes of supra crystal soft tissues following crown lengthening procedure had

different results (11, 12, 13, 14).

Findings of some researches indicate that amount of biologic width is stable and amount of supra crystal soft tissue after crown lengthening procedure will be with the same size of before the operation whereas other researches

indicate that position of margin of gum was stable following repair and coronali growth of gingival tissues was

minimum (16)

and amount of supra crystal soft tissues will decrease following crown lengthening procedure (17, 18).

These different results can be due to variety of biologic width, different surgical techniques and periodontal biotype (19).

Not considering conditions of supra osseous gingiva (SOG) before and after operation and the variety which there is in biologic width and using a stable and pre-determined amount for all patients can cause undesirable

surgical results (15).

This research aims to compare dimensions of supra osseous gingiva (SOG) of each tooth and 2 months after crown lengthening procedure to determine whether SOG changes following crown lengthening procedure or not? And whether SOG of each tooth can be used as a standard to determine amount of bone operation? To this purpose, the above-mentioned research was performed in patients referring to periodontics unit of Islamic Azad University Tehran Branch who needed crown lengthening procedure in 1387.

Materials and methods

According to the fact that PD, BW, KG, BL, DBL, and SOG were quantitative and according to Smirnov-kolmogrov test followed two-sectional normal distribution, compare Paired samples T.test was used before and after surgery and for GI, because its distribution was not normal, Wilcoxon Singned Ranks Test was used and for FGM, because comparison was in 3 time sections, ANOVA test was used.

Findings

In this study, performed experimentally on 20 samples (teeth) in 17 patients (15 women and 2 men) with average age of 32.5 in Islamic Azad University Tehran Branch, amount of supra crystal gingival tissue was compared before and two months after crown lengthening procedure. Amount of periodontal parameters including GI, KG, and PD is indicated in Table 1. Amount of KG before crown lengthening procedure and after 2 months was 5 ± 0.85 mm and 4.15 ± 0.9 mm, respectively (P < 0.005) which decrease amount was 0.47 mm.

BL amount before and 2 months after operation was 5.85 ± 0.92 mm (P<0.001). DBL amount before picking bone was 5.89 ± 0.93 mm and DBL amount immediately after picking bone was 7.55 ± 0.83 mm, meaning amount of picking bone was 1.69 ±0.52 mm.

SP49-18

(14, 15)

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Difference of DBL amount after picking bone with BL after two months was 0.13 ± 0.32 mm meaning amount of degradation of bone during two-month repair was not clinically considerable.

Table 2 indicates amount of amount of exposition of tissue of teeth immediately after surgery and 2 months after it. From the table, amount of exposition of healthy tissue of tooth immediately after surgery was 1.41 ± 0.84 mm and 2 months later was 1.08 ± 0.74 mm which this difference was meaningful (P = 0.002) (Diagram 2).

Amount of biologic width before surgery and 2 months later was 1.52 ± 0.51 mm and 1.35 ± 0.5 mm (P = 0.192) meaning amount of biologic width had decreased 2 months after repair.

BL amount before surgery was 5.85 ± 0.92 mm and immediately after flap by directly measuring surface of bone (DBL) was 5.89 ± 0.93 mm (Diagram 3). Correlation among BL results before surgery and immediately after preparing flap indicates reliability of the TSP method comparing measuring surface of bone directly (Pearson correlation 0.99).

FGM amount before the operation was 4.07 ± 1.36 mm and immediately after stitch 5.46 ± 1.15 mm and 2 months later 5.16 ± 1.01 mm (P < 0.001) meaning 2 months after repair, on the average, margin of gum had 0.3 ± 0.41 mm coronali growth (Diagram 4).

Table 1- Distribution of investigated samples according to variables and times of evaluation

SOG KG BW DBL BL FGM PD GI variable

Time of pursuit

±0/7 ±0/85 ±0/51 ±0/93 ±0/92 ±1/36 ±0/51 1±0 Before surgery

3/87 5 1/52 5/89 5/85 4/07 2/34

±0/83 ±1/15 Immediately after the

7/55 5/46 surgery

±0/5 ±0/9 ±0/5 ±0/82 ±1/1 ±0/5 ±0/48 2 months after surgery

3/22 4/15 1/35 7/69 5/16 1/87 0/35

0/001 ≥0/001 0/192 ≥0/001 ≥0/001 0/004 0/016 ≥0/001 P value

Table 2- Amount of exposition of tooth of crown lengthening procedure according to pursuit time

Mean±SD Amount of exposition of tooth

1/41± 0/84 Immediately after the operation* 1/08±0/74 Two months later**

0/002 P value

*amount of exposition of tooth immediately after the operation – before FGM operation – Immediately after FGM operation

**amount of exposition of tooth 2 months after the operation – 2 months after FGM operation- immediately after FGM operation

Conclusion

The present study considering its limitations indicated that:

1. TSP is an accurate method to measure position of alveolar bone crest and determine SOG epico coronali dimensions.

2. Height of SOG to epico coronali after crown lengthening procedure was decreased, whereas biologic width of tooth before and after crown lengthening procedure do not change.

SP49-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

3. Amount of BW before operation can be a guide to determine amount of picking bone during crown lengthening procedure. References

1. Bader JD , Rozier RG , Mcfall wt , Ramsey DL . Effect of crown margins on periodontal conditions in regularly attending

patients. j prosthet Dent 1991 Jan ; 65(1):75-9 .

2. Bader JD, Rozier RG , Mcfall wt . The effect of crown receipt on measures of gingival status. J Dent Res 1991 oct; 70(10); 1386-89

3. Newcomb G . The relationship between the location of sub gingival crown margins and gingival inflammation. J

periodontal 1994 Mar ; 45(3):151-54 .

4. Maynard JG, Wilson RD. Physiologic dimensions of the periodontium significant to restorative dentists’ j periodontal

1979 AP; 50( ):70-174.

5. Nevins M , skurow HM . The intracrevicular restorative margin, the biologic width, and maintenance of the gingival margin. int j periodontics restorative Dent 1984 ; 4(3) : 30-49 .

6. Carnevale G , freni sterrantino S , Di febo G . Soft and hard tissue wound healing following tooth preparation to the alveolar crest. Int J periodontics restorative Dent 1983; 3(6):36 -53.

7. Tal H , soldinger m Dreiangel A , pitaru s . Responses to periodontal injury in the dog: Removal of gingival attachment

and supracrestal placement of amalgam restorations int j periodontics Restorative Dent 1988; 8(3) : 45-55

8. Palomo F , kopczyk RA . Rationale and methods for crown lengthening. J AM Dent Assoc 1978 Feb; 96(2): 257-60. Rosenberg Es , Garber DA , Evian GI . Tooth lengthening procedures. Compendium continuing Educ Dent 1980 May-jun; 1(3): 161-72.

9. Wagenberg BD , Eskow RN , Langer B . Exposing adequate tooth structure for restorative dentistry. Int j periodontics restorative Dent 1989; 9(5) : 322-31

10. Gargiulo AW, wentz FM , orban B . Dimensions and relations of the dentogingival junction in humans. J periodontal 1961; 32:261-67

11. Van der valden u . Regeneration of the interdent soft tissues following denudation procedures. J clin periodontal 1982

Nov; 9(6):455-59 .

12. Pontoriero R, Carnevale G . Surgical crown lengthening: A 12-month clinical wound healing study. J periodontol 2001

Jul; 72(7):841-48.

13. Lanning SK , Waldrop TC , Gunsolley IC , Maynard JG . Surgical crown lengthening: Evaluation of the Biological width. J periodontol 2003 AP; 74(4):468 – 74.

14. Smukler H , chaibi M . Periodontal and dental considerations in clinical crown extension: A rational basis for treatment.

Int j periodontics restorative Dent 1997 oct ; 17(5) : 464-77 .

15. Bragger u , louchenauer D , lang NP . Surgical lengthening of the clinical crown. J clin periodontal 1992 Jan; 19(1): 58-

63

16. Perez JR , smukler H , Nunn ME . Clinical Evaluation of the supraosseous gingival before and after crown lengthening. J periodontol 2007 jun ; 78(6):1023-30

.

17. Oakley E , Rhyu IC , karatsas S , Santiago L, Nevins M , Caten J . Formation of the biologic width following crown lengthening in nonhuman primates. int j periodontics restorative Dent 1999 Dec ; 19(6):529-41

SP49-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

18. Vasek js , Gher ME , Assad DA . The dimensions of the human dentogingival junction. int j periodontics restorative

Dent 1994 Apr ; 14(2) : 154-65 20 .

19. Löe H , Silenss j . Periodontal disease in pregnancy, prevalence and severity. Acta o dontol scand 1963 Dec; 21: 533-51.

20. Rusell MJ. Relationship between alveolar bone levels measured at surgery, estimated by transgingival probing and

clinical attachment level measurements. J clin periodontal 1989 Feb; 16(2): 18_6.

SP49-18

Annals of Tropical Medicine & Public Health-Special Issue February 2018 Vol 2.2

Investigation of the Actual Costs of Provided

Services in a Health Unit (Health House) in

Kurdistan Province and Proposing a Model for

Credit Allocation in the Health Sector

Seifollah Moradi1*,

Hiwa Farughi 2

1-(responsible author)*: PhD student in business management (DBA), Industrial management institute, west branch, and assistant of management and resource development, University of medical sciences of Kurdistan, Sanandaj, Iran , Moradi5000@yahoo.com 2-PhD in industrial engineering, assistant professor and faculty member of engineering faculty, University of Kurdistan,

Sanandaj, Iran , hfarughi@gmail.com

Abstract

The issue of cost analysis in health care activities is one of the managers’ concerns and health provision

with an acceptable quality has been always emphasized by the highest political authorities and policy

makers of the country. This study was performed to determine the actual costs of provided services in a

health unit (health house) in Kurdistan province and to propose a model for credit allocation in the health

sector. It is a descriptive-analytical study and also a sectional and retrospective study which was carried out

in 2014. Besides, it could be considered as a study for implementation a method or an applicable-scientific

system. The activities which are studied in this investigation as the health house services include: family

health, environmental health, occupational health, health education, communicable diseases, non-

communicable diseases, and school health. Statistical population is 614 health houses and the sample size

was determined as 236 health houses, considering significance level of 5% and using Cochran formula. The

data was collected through the standard check lists and were evaluated to be normal by Kolmogorov–

Smirnov test. Grayson model was referred for activity-based costing procedures and Excel 2016 and SPSS

23 software were applied. The obtained results illustrate that eight of ten research hypotheses are

significant and the significance level is higher than 5% for all parameters. The costs of provided services

related to family health, occupational health, school health, and also communicable/non-communicable

diseases are greater than the expected costs of standard services and are also significant (P<0.05) with

correlation coefficients of 0.822, 0.407, 0.256, 0.94, and 0.792, respectively. The costs of provided services

related to environmental health, health education, and maintenance of health house building are less than

the expected costs of standard services and are not significant (P>0.05) with correlation coefficients of

0.825, 0.969, and 0.083, respectively. Finally, according to the research results it was found out that the

spent costs of service provision in the health house does not match the allocated credits and the

considered costs of family, occupational, and school health as well as communicable/non-communicable

diseases are insufficient and do not meet people’s expectations, especially in rural areas. Therefore,

managers and experts in the health sector (official and operational) may thoughtfully revise the strategic

and operational planning in the service provision manners. Conducting similar researches in other health

houses across the country is recommended.

Keywords: Actual costs, Cost analysis, Health house, Provided services, Credit, Kurdistan Introduction

All countries allocate some of their national income to the preservation of community health care and its

improvement. The amount of financial sources which are allocated in this regard and the provided health level for the

communities are important issues. The health system performance is highly varied across the world; countries are not

placed at equal positions and there is a noticeable difference among them. There are countries which do not manage

their health system in an appropriate manner; however they benefit a similar social income

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

level. In the other hand, other countries offer a better performance while spending much less health expenditure compared to similar countries. The performance measurement and consequently determination of health system efficiency per expense unit have been always disputed (Naghavi et al., 2005). On the one side, countries spend more finances on the health care as they earn more income, not as more health

care is required. Although the idea that health care is non-relevant to the health care demands or has an inverse relation to it, is against the personal experiences. Because when individuals get sick, they spend more expenses

on the health care (economy and health, 2005). There are considerable differences regarding the decisions made

about the expenditure amount which is necessary for a particular person’s health care or the finance amount required for the preservation and continuation of services (economy and health, 2005). Providing people with an

easy access to the most common and fundamental services, considering the climate and population data, have

been always noticed by the health system in all countries and they attempted to transfer the health services where people live and work; each country has adopted a specific strategy; health houses has been defined in

Iran, considering some criteria, as the most local unit to provide services in the health care system. Each health house depending on the geographic conditions, particularly access roads and population, has included one or

more villages for the defined service provision. All the services are provided by a trained Behvarz (rural health-

care worker) who is the person in charge of operating the daily activities. Behvarz requires physical spaces with a defined standard structure in the health house building to offer health services. It is an important issue that

applying a proper structure brings about service continuation. Thus, managers must pay more attention to the

structure selection and above all consider the features such as durability, ease of application, possibility of their provision and preservation at a national and local level (Pilehroudi, 1999).

The expenses spent on the health plans could be estimated per each service and be expanded, due to the adjustments and considering the demands, and the provided service price might be changed due to the materials price and wage amount, etc.; however the health services could not be clearly estimated. Health care services are a responsibility for the government and no one could be deprived from such services and the payments for services in health houses are zero in Iran. Data gathering and analysis on the expense plans offer very useful information regarding the different health service types. This information indicates the financial sources amount required for the plan continuity and is also beneficial in examining the staff in providing primary health care, more efficient application of devices, transportation vehicles, and other sources. There are some items in health care which their value cannot be necessarily achieved by their price; and some inputs could be found that no or a few expenses are spent on them for their provision (Shadpour, Jamshidbeigi, 1999).

Determination of the actual costs of a service enables managers to decide regarding the plans continuation in the governmental section or devolves the authority to private sector, or selling services accompanied with the insurance offices; in the other side, determination of the actual costs is one of the important priorities for university of medical sciences; therefore, this investigation was conducted according to Grayson model for the first time in this province. Grayson model is superior to other models in this investigation since it can lead to more accurate and reasonable estimations rather than the traditional methods and is introduced in the following. This study hopes to provide the logical and effective answers in order to adopt proper strategies for continuity or amendment of health care processes, with budget prioritization in various regions to be utilized by the province senior managers. This research has been performed in a health care unit (health house) in Kurdestan province to determine the actual costs of provided services and propose a model for credit allocation in the health care sector. Research hypotheses The cost of family health services in health houses of Kurdistan province is less than the estimatedcost. The cost of environmental health services in health houses of Kurdistan province is more than the estimated cost. The cost of occupational health services in health houses of Kurdistan province is less than the estimated cost. The cost of health education services in health houses of Kurdistan province is less than the estimatedcost.

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

The cost of communicable diseases services in health houses of Kurdistan province is more than the estimated cost. The cost of non-communicable diseases services in health houses of Kurdistan province is more than the estimated cost. The cost of School health services in health houses of Kurdistan province is less than the estimatedcost. The cost of personnel in health houses of Kurdistan province is less than the estimated cost. The cost of maintenance in health houses of Kurdistan province is less than the estimated cost. The cost of other items (dressing wounds) in health houses of Kurdistan province is more than the estimated cost. Study method:

The financial processes of services are realized and proper actions could be taken through the required controls

to increase the efficiency and productivity of health centers. First, cost pools and then cost factors are determined for a health unit as human resource costs, energy costs, overhead costs, investment costs, and depreciation costs; in the following step, cost factors are allocated to the relevant cost pools and at last the obtained costs are sum up and the actual costs of the provided services in a health unit are estimated. The available documents in health houses were utilized for financial data collection. Since this study is limited to a

specific province, it is of the case study type and also based on a retrospective study because the cost values of the year 2014 were used in the actual costs calculation. The statistical population in this study is health houses across Kurdistan province whose number was 614 at the research execution time. The sample size was selected as 236 health houses using Cochran formula. The collected data were evaluated to be normal using

Kolmogorov–Smirnov test. Subsequently, parametric or nonparametric methods were utilized based on demand and also the hypotheses were evaluated by the relevant software and statistical tests. Grayson model was used for activity-based costing procedure. Hence, the indirect overhead was calculated for each service and the actual costs were estimated by summing up the indirect overhead, direct overhead, supplies costs and wages. In order to enrich the research results by using experts’ opinions mountainous and impassable roads of some

regions in the province and difficulty of transportation, tight time of study, high costs of research, and spread of

research population. Sample size was obtained by Cochran formula (limited population) which is a proper

decision-making model and was applied for sampling purpose in this research. The parameter replacement in the formula is as below: ( )2

N =

22

1

( )

− 1

Cochran formula 1 + N ( 2

(1.96)2 ∗ 0.5 ∗ 0.5

N = 1 (0.05) 2

= 236

(1.96)2. 0.5 ∗ 0.5 − 1)

1 + 614 ( (0.05)2

The sample size was found to be 236 health houses, considering significance level of 5%. This sample size in Kurdistan province indicates that this number must be relatively divided across the towns and thus the health houses number of each town (research sample) was selected respect to their population and depending villages.

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Table 1: Number of research samples (health houses) and the covered population, divided by towns in 2014.

Total number

Number of

Covered

Number of

Number of Behvarz

Number of

Town name of studied covered satellite according to the occupied

population

health houses

households villages

organizational chart Behvarz

Baneh 22 161 724 3 2 2

Bijaar 32 121 475 2 2 1

Dehgolan 14 309 1180 1 2 2

Divandareh 25 195 898 1 2 2

Sarvaabad 15 288 1038 1 2 2

Saghez 37 147 695 2 2 2

Sanandaj 30 291 1084 1 2 2

Ghorveh 21 271 1055 1 2 2

Kamyaran 21 295 916 2 2 2

Marivaan 19 175 798 1 2 2

Total 236 2253 8863 17 21 20

Service costs H1

Costs of family health service processes H2

Costs of environmental health services H3

The actual cost of a

Costs of occupational health services H4

Costs of health education

H5 The estimated cost of

health unit

Costs of communicable diseases services

H6

services

(health house)

Costs of non-communicable diseases services expenses H7

Costs of school health services expenses H8

Costs of maintenance expenses H9

Costs of personnel expenses H10

Figure 1- Research conceptual model (Ting zu et al., 2010) Grayson model was used in the operational process of the research. Grayson model is superior to other models in this investigation since it can lead to more accurate and reasonable estimations rather than the traditional methods which is considered in the following section of this study to provide logical and effective answers to adopt proper strategies for continuity or amendment of health care processes, with budget prioritization in various regions to be utilized by the province senior managers. Hence, according to this model the indirect overhead was calculated for each service and the actual costs were estimated by summing up the indirect overhead, direct overhead, supplies costs and wages. Findings

Table 2: the average number of provided and expected services in the studied health houses in 2014

Average number of

Average number of

Service Ratio of Percent of

Symbol Service name number expected to

provided services expected services Total

difference provided

H1 family health 23900/8 39286/1 15385/3 1/64 51/0

H2 Environmental health 13409/9 14143/9 734 1/05 28/6

H3 Occupational health 807/1 1576/4 769/3 1/95 1/7

H4 Health education 1945/6 1945/6 0 1/00 4/2

H5 Communicable Diseases 3203/5 3228/1 24/6 1/01 6/8

H6 Non-communicable

2845/9 2920/5

74/6 1/03

6/1

Diseases

H7 School health 666/1 1168/1 502 1/75 1/4

H8 Personnel 0 0 0 0/00 0/0

H9 Maintenance 0 0 0 0/00 0/0

H10 Other items 90/1 0 -90/1 0/00 0/2

Total Sum 46869 64268/7 17399/7 1/37 100

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Figure 2- comparison of the average number of provided and expected services in the studied heath houses in 2014.

Table 3: comparison of percentage difference between the provided and expected service numbers in the studied health

houses, divided by towns in 2014

Town name

Number of provided

Number of expected

Difference from the standard

Percentagedifference

services

services from total

Baneh 3529 6000 2471 10

Bijaar 2789 4144 1355 5/5

Dehgolan 5104 9491 4387 17/7

Divandareh 3805 6288 2483 10/0

Sarvaabad 5198 7730 2532 10/2

Saghez 3582 4961 1379 5/6

Sanandaj 4084 6330 2246 9/1

Ghorveh 4084 7016 2932 11/8

Kamyaran 4896 7484 2588 10/4

Marivaan 4048 6477 2429 9/8

Province 41119 65921 24802 100

Table 4: comparison of difference percentage between the provided and expected service prices in the studied health houses, divided by towns in 2014

Town name Provided service prices (Rials)

Baneh 5,099,755 Bijaar 4,668,781 Dehgolan 3,741,904 Divandareh 4,032,982 Sarvaabad 4,019,683 Saghez 4,487,001 Sanandaj 3,294,065 Ghorveh 3,910,351 Kamyaran 3,479,944

expected service prices

Difference from the

Difference percentage from total

(Rials)

standard

3,234,248 -1,865,507 13/1

3,293,675 -1,375,106 9/6

2,040,635 -1,701,269 11/9

2,639,031 -1,393,951 9/8

3,017,696 -1,001,987 7/0

2,961,694 -1,525,307 10/7

2,036,453 -1,257,612 8/8

2,231,110 -1,679,241 11/8

2,307,587 -1,172,357 8/2

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Marivaan 4,065,543 2,772,802 -1,292,741 9/1 Province 40800009 26534931 -14,265,078 100

Table 5: comparison of percentage difference between the prices of provided and expected standard service in the studied health houses, divided by towns in 2014

Price of standard provided

Priceof expected

Difference from the

Town name standard service Percentage difference from total

service (Rials) standard

(Rials)

Baneh 6,590,435 7,436,058 845,623 11/7

Bijaar 6,301,180 6,977,108 675,928 9/3

Dehgolan 5,005,494 4,214,246 -791,248 -10/9

Divandareh 4,763,459 5,389,392 625,933 8/7

Sarvaabad 4,787,059 4,880,508 93,449 1/3

Saghez 5,667,275 5,826,096 158,821 2/2

Sanandaj 4,267,368 4,135,957 -131,411 -1/8

Ghorveh 4,837,806 6,294,765 1,456,959 20/1

Kamyaran 4,142,033 7,379,332 3,237,299 44/8

Marivaan 4,939,938 6,002,673 1,062,735 14/7

Province 51302047 58536135 7,234,088 100

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Table 6- actual costs averages of health care services in the studied health houses in 2014

Price of

Price of

Price of Price of

provided- expected- The difference between The difference between The difference between prices The difference between prices

provided expected

Symbol Service name standard standard prices of provided and prices of provided-standard of expected-standard and of expected-standard and

services services

services services expected services (Rials) and provided services (Rials) provided services (Rials) expected services (Rials)

(Rials) (Rials)

(Rials)

(Rials)

Maternity care 91823 17852 176070 34231 -73971 84247 -57592 16379

Pregnancy care 29535 23583 40985 32725 -5952 11450 3190 9142

Healthy Child Care 87058 65862 153348 116013 -21195 66290 28956 50151

H1 Elderly health care 523229 523229

731172 731172

0 207943

207943 207943

Permanent health care 190472 133277 251879 176245 -57194 61407 -14226 42968

Family health care 65195 35392 104093 56509 -29802 38898 -8686 21117

H2

Environmental health 51323

40728

65819

52231

-10596

14496

907 11503

care

H3 Occupational health care 768264 386963 1021925 514729 -381300 253662 -253534 127766

H4 Health education 352110 352110 453200 453200 0 101089 101089 101089

H5 Communicable diseases 248950 248943 347672 347662 -7 98722 98711 98719

H6

Non-communicable 198484

137937

259587

180400

-60547

61102

-18084 42463

diseases

H7 School health 931493 545645 1214986 711709 -385847 283493 -219784 166063

H8 Saff

H9 Maintenance

H10 Other items (dressing

284562

1933215

1648653

wounds)

Miscellaneous The difference between total costs of the health house

Sum of all the health house costs 3822497 2511522 4820735 5340040 201659041

Town name Total number of the satellite villages in Total number of the Behvarz according to the

Total number of the occupied Behvarz in the studied health houses

the studied health houses

organizational chart in the studied health houses

Average of Kurdistan province 373 454 417

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

6,002,673

4,939,938 7,379,332

4,142,033

6,294,765

4,065,543 4,837,806

4,135,957

3,479,944

4,267,368

3,910,351 5,667,275

5,826,096

3,294,065 4,880,508

2,772,802 4,787,059

4,487,001

2,307,587

5,389,392

4,019,683 2,231,110 4,763,459

2,036,453

4,214,246

4,032,982 2,961,694 5,005,494

3,741,904 3,017,696 6,977,108

2,639,031 6,301,180

4,668,781 2,040,635

3,293,675 6,590,435 7,436,058

5,099,755 3,234,248

Provided service prices expected service prices Difference from the standard Difference percentage from

(Rials) (Rials) total

BanehBijaarDehgolan DivandarehSarvaabadSaghezSanandaj GhorvehKamyaranMarivaan

Figure 3- comparison of prices among the provided, expected, standard, and expected standard in the studied health houses,

divided by towns in 2014 Results: The results obtained by the research and inferential test (hypotheses test) are described as below:

First hypothesis: the cost of family health services in health houses of Kurdistan province is less than the estimated cost. The results illustrate that the data spread of provided services costs is higher than the expected costs of standard services; this means that some solutions must be considered regarding the costs of family health services. Besides, the correlation coefficient between two variables is 0.822 in this hypothesis; however, based on t-test, the significance level is greater than 5%. Thus, this hypothesis is rejected and in other words the costs of provided services is greater than the expected costs of standard services; i.e. the average cost of provided services is greater than the expected cost of standard services. Second hypothesis: the cost of environmental health services in health houses of Kurdistan province is greater than the estimated cost. The results showed that the data spread of the provided services costs is much higher than the expected costs of standard services; there is no significant correlation coefficient between two variables; i.e. the correlation coefficient value is very low and equals 0.44. Based on the t-test, this hypothesis is rejected with the significance level of 0.825 (greater than the significance level of 0.05). In other words, the cost of environmental health services is less than the expected cost of standard services. Third hypothesis: the cost of occupational health services in health houses of Kurdistan province is less than the estimated cost. The results showed that the correlation coefficient between two variables of provided service costs and expected standard service costs is 0.407 and insignificant. The data spread between two variables is

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

not noticeably different. In addition, the third hypothesis is rejected based on t-test with the significance level of 0.14 which is greater than 5%. In other words, the cost of provided services related to occupational health services is greater than the expected cost of standard services. Forth hypothesis: the cost of health education in health houses of Kurdistan province is less than the estimated cost. The results showed that the data spread related to the provided services costs is nearly higher than the expected costs of standard services and there is a significant correlation coefficient of 0.969 between two abovementioned variables. Also, t-test indicates that the significance level with value of 0.001 is less than 5%. Thus, the forth hypothesis is accepted and the average cost of provided services is less than the expected cost of standard services. Fifth hypothesis: the cost of communicable diseases in health houses of Kurdistan province is greater than the estimated cost. The results pointed out that there is no problem regarding data spread and the correlation coefficient between two variables of provided service costs and expected standard service costs is 0.940 and significant. T-test also shows that the fifth hypothesis is accepted with the significance level of 0.04; i.e. the cost of provided services is greater than the expected cost of standard services.

Sixth hypothesis: the cost of non-communicable diseases in health houses of Kurdistan province is greater than the estimated cost. The results showed that the data spread related to the provided services costs is higher than the expected costs of standard services and there is a significant correlation coefficient of 0.792 between two abovementioned variables. Also, t-test indicates that the sixth hypothesis is accepted with the significance level of 0.01; i.e. the cost of provided services related to non-communicable diseases is greater than expected cost of standard services. Seventh hypothesis: the cost of school health in health houses of Kurdistan province is less than the estimated cost. The results showed that the data spread related to the provided services costs is higher than the expected costs of standard services and the correlation coefficient between two variables is 0.631 and significant; t-test shows that the seventh hypothesis is rejected with the significance level of 0.256; i.e. the cost of provided services is greater than expected cost of standard services.

Eighth and ninth hypotheses: the results show that there is no need for hypothesis test and statistical data is reliable in the strength of observation. Tenth hypothesis: the maintenance cost of health houses is greater than the estimated cost. The results pointed out that there is no problem regarding data spread in the provided service costs and the correlation coefficient between two variables of the provided services costs and expected costs of standard services is insignificant (value of 0.083). Based on t-test, the tenth hypothesis is rejected with the significance level of 0.163; i.e. the cost of provided services related to maintenance of health houses is less than expected cost of standard services. Summary and conclusion: At first, Kolmogorov–Smirnov test was used to investigate the hypothesis of data normality. The results show

that eight of ten research hypotheses are significant and the significance level is higher than 5% for all

parameters. Thus, these variables have a normal distribution. Also, eighth and ninth hypotheses which are

related to the staff and maintenance costs have significance level of less than 5% for all parameters. Therefore,

these variables did not have a normal distribution. Since the statistical data of abovementioned hypotheses

regarding the costs of provided services and the expected costs of standard services were equal, running the non-

parametric test is invalid and it could be revealed that the eighth and ninth hypotheses does not need to be

tested. According to the normal distribution of collected data, the parametric t-test was used for hypotheses 1, 2,

3, 4, 5, 6, 7, and 10. Research recommendations:

1. Due to the necessity of health care service provision and limitation of resources, the efficient usage and maximum effectiveness should be considered by planners and policy-makers.

2. It is totally obvious that the academic course of health care economy in all universities is necessary to enable applicable researches and planning.

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

3. Constant training of staff, especially financial planning managers in the areas of costing procedures and accounting is recommended. 4. Budget allocation for continual similar researches in various universities is suggested. 5. Re-arrangement of primary care to satisfy society needs. 6. Improvement of service quality in various centers.

7. Attention to the public coverage, people-oriented services, general health care policies, and proper guidance according to the world health care reports.

8. Change of education system in various sections of primary health care (health care team, family physician, suppliers, etc.) 9. Conducting applicable researches in P.H.C system and applying their results.

10. Interaction of policy makers with academic experts and people representatives for various plans of staff motivation in different P.H.C levels and considering their demands.

11. According to the monthly data collection in various levels of the network, the required forms of costing procedures could be designed accompanied with them to enable easy access to the required information.

12. Contribution of software engineers in this research type is necessary in order to design the required software. Research constraints:

The research was confronted with a number of constraints like mountainous and impassable roads of some regions in the province and difficulty of transportation, tight time of study, high costs of research, and spread of research population. Acknowledgments

This paper is retrieved from PhD dissertation of the responsible author and was financially supported by research and technology department of university of medical sciences and health care in Kurdistan province. The paper authors would like to acknowledge the experts in subsidiary departments of the University for their Cooperation with the research team. References

Mousavi S A, Khorvash F, Fathi H, Fadai H, Hadianzarkeshmoghadam Sh. Survey the Average of Cost in out Patient and Imaging in Alzahra Hospital and Comparing with Service's Tariff. Health Information Management 2010; 7(2): 241. Razavi O. Cost bed day cost services in the hospital bed 256 khoramAbad in 1999. Proceedings of the First National Conference on Resource Management in Hospital 2002; Tehran, Iran; 2002. Maher A. System design cost when health care treatment center social security organization. Proceedings of the First National Conference on Resource Management in Hospital 2002; Tehran, Iran; 2002. Jacobs P. Instructor's Manual for the Economics of Health and Medical Care. New York (NY): Aspen Publishers;1996. Modares Sadeghi H. Assessment and comparison of health education services related to University of Medical Sciences Isfahan. Proceedings of the First National Conference on Resource Management in Hospital 2002; Tehran, Iran; 2002. Montoya AC. Measuring the performance of hospital and health centers WHO. Distoicts systems. Division of strengthening of health services 1994. Majidpoor A. A comparative assessment of educational hospital special treatment in the first six months 2001-2002. Proceedings of the First National Conference on Resource Management in Hospital 2002; Tehran, Iran;2002. Mosadegh rad MA. General Manager Health Care. Tehran: Dibagaran, 2002. Asayesh M. Familiarity with the health care system Gargah Ashnayypzshkan training and manpower plans included health professionals providing services with the health system. Tehran: Publications Shahid Beheshti University of Medical Sciences, 1994. Mir seyed Olyan M. Comparison of hospital stay and hospital costs of natural and low-weight babies.[MSc Thesis]. Tehran: School of Public Health, Tehran University of Medical science, 1993. Malek Afzali H. Writing on the developments in medical sciences. Proceedings of the Conference officials and medical universities Health Organization Regional Ministry of Health and Medical Education. 1993; Tehran, Iran; 1993.

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2

Goodarzi GH. Calculation of bed day costs and cost of services in Imam Khomeini Hospital in First Half Year 2003. [BSc Thesis]. Tehran, Tehran University of Medical science. 2003. Aeenparast ,A.Feasibility of estimating cost of diagnostic radiology and sonography services by using activity based costing.Payesh.Journal of the Iranian Institute for Health Sciences Research. 2014 Ahmadi Jahan Abad F, Mosharaf Zadeh Kh, Davari K, Parisay Z, Dianati Kh, Abravan J. Cost-analysis in health & medication services in health sector of Kohgiluyeh & Boyerahmad province. Armaghan Danesh Journal 2005; 10:83-93[Persian] Newbrander W, Barnum H, Kutzin J. Hospital Economics and Financing in Developing Countries. WHO; Geneva, 1992 http://apps.who.int/iris/bitstream/10665/61095/1/WH O_SHS_NHP_92.2.pdf Cooper R, Activity based costing. Translated by Azizi A. Modares A. 4th E dition, Accounting and Auditing Research

Cente: Tehran, 2006[Persian] Rajabi A. The role of activity based costing system in hospital services in Iran. Iranan Red crescent Medical Journal 2008; 10:89-94 Alaei SH. The per capita cost of higher education in Iran and its evolution in the 72-67 years. 2th Edition, Management and Planning Organization: Tehran, 1995 Naderi M. Presentation of activity based costing (ABC) to calculate the cost of bed days in hospital, Dr Fayyaz bakhsh section, [thesis], Tehran: Emam Hossein University, 2006 [Persian] Samir zaman, Cost Analysis for Hospital care the case of Embaba Hospital CAIRO , Egypt, 1993.8. Danzon M.,Nicholson S. Productivity in pharmaceutical-biotechnology:the role of experience and alliances,2004. Abdul Majid, J. and M. Sulaiman (2008).“Implementation of Activity Based Costing in Malaysia: A Case Study of Two

Companies”. Asian Review of Accounting, Vol. 16, Issue. 1, pp. 39-55.3, pp. 94-105. Duh, R. R.; Lin, W. Th.; and W. Y. Wang (2009). “The Design and Implementation of Activity-Based Costing: A Case

Study of a Taiwanese Textile Company”. International Journal of Accounting and Information Management, Vol. 17, Issue.

1, pp. 27-52. Goeree, R.; Gafni, A.; Hannah, M.; Myhr,T.; and G. Blackhouse (1999). “Hospital Selection for Unit Cost Estimates in

Multicentre Economic Evaluations: Does the Choice of Hospitals Make a Difference?”. Pharmacoeconomics, Vol.15, pp. 561-572. Gunasekaran, A. (1999). “A Framework for the Design and Audit of an Activity Based Costing System”. Managerial

Auditing Journal, Vol. 14, Issue. 3, pp.118-126. Gunasekaran, A.; Marri, H. B.; and Y. Y.Yusuf (1999). “Application of Activity-Based Costing: Some Case

Experiences”.Managerial Auditing Journal, Vol. 14,Issue. 6, pp. 286-293. Hundal, M. S. (1997). “Product Costing: a Comparison of Conventional and Activity-Based Costing Methods”.Journal of

Engineering Design, Vol. 8,Issue. 1, pp. 91-103. Innes, J. (1995). “ABC: A follow-Up Survey of CIMA Members”. Management Accounting, US: July/August, pp. 50-1. Innes, J.; Mitchell, F.; and T. Yoshikawa (1994). Activity Costing for Engineers. Chichester, UK: John Wiley and SonsLtd.Joshi, P. L. (1998). “An Exploratory Study of Activity Based Costing Practices and Benefits in Large Size Manufacturing Companies in India”. Accounting and Business Review, Vol. 5, Issue. 1, pp. Aird, B. (1996). “Activity-Based Cost Management in Health Care – Another Fad?”. International Journal of Health Care

Quality Assuranc, Vol. 9, Issue. 4, pp. 16-19. Capettini, R.; Chow, Ch. W.; and A. H. McNamee (1998). “One the Need and Opportunities for Improving Costing and Cost

Management in Health Care Organizations”. Managerial FinanceVol. 24, Issue. 1, pp. 46-59. Chen, Z. and L. Wang (2007). “A Generic Activity-Dictionary Based Method for Product Costing in Mass Customization”. Journal of Manufacturing Technology Management, Vol. 18, Issue. 6, pp.678-700. Cinquini, L. and F. Mitchell (2005). “Success in Management Accounting: Lessons from the Activity-Based

Costing/Management Experience”. Journal of Accounting & Organisational Change, Vol. 1, pp. 63-78. Cohen, S. and E. Kaimenaki (2011). “Cost Accounting Systems Structure and Information Quality Properties: An Empirical

Analysis”. Journal of Applied Accounting Research, Vol. 12, Issue. 1, pp. 5-25. Cokins, G. (1997). “If Activity Based Costing Is the Answer, What Is

the Question?”. IEE Solutions, Vol. 29,Issue. 8, pp. 39-42. Dalci, I.; Tanis, V.; and L. Kosan (2010). “Customer Profitability Analysis With Time Driven Activity-Based Costing: A

Case Study in a Hotel”. International Journal of Contemporary Hospitality Management, Vol. 22, Issue. 5, pp. 609-637.

Driver, M. (2001). “Activity-Based Costing: a Tool for Adaptive and Generative Organizational Learning?”. The Learning

Organization, Vol. 8, Issue.(2011). “Data-Driven Budget Reductions: a Case Study. The Bottom Line”.Managing Library Finances, Vol. 24,Issue. 1, pp. 24-34. Schneeweiss, Ch. (1998). “On the Applicability of Activity Based Costing as a Planning”. International Journal of

Production Economics, Vol. 54, Issue. 3,pp. 277-284. Shank, K. J. and V. Govindarajan, (1993). Strategic Cost Management. New York: The Free Press, Oxford. Sohal, S. A. and W. Chung (1998). “Activity Based Costing in Manufacturing: Two Case Studies on Implementation”. Integrated Manufacturing Systems, Vol. 9, Issue. 3, pp. 137-147. Tollington, T. and Ph. Wachter (2001). “ABC/TA for Internet Retail Shopping”.International Journal of Retail and Distribution Management, Vol. 29, Issue.4, pp. 149-155. Turney, B. B. P. (1996). Activity Based Costing: The Performance Breakthrough. London: CLA. 65-78.

SP50-18

Annals of Tropical Medicine & Public Health-Special Issue January 2018 Vol 2.2 Kaplan, S. R. (1984). “Yesterday's Accounting Undermines Production”. Harvard Business Review, July-August,pp. 95-101. Kingcott, T. (1991). “Opportunity-Based Accounting: Better than ABC”.Management Accounting, US: October, pp. 36-37. Lere, J. (2000). “Activity-Based Costing: a Powerful Tool for Pricing”. Journal of Business and Industrial Marketing, Vol. 15, Issue. 1, pp. 23-33. Morakul, S. and H. F. Wu (2001). “Cultural Influences on the ABC Implementation in Thailand's Environment”. Journal of Managerial Psychology, Vol. 16, Issue. 2, pp. 142-158. Mostaque, H. and A. Gunasekaran (2001).“Activity-Based Cost Management in Financial Services Industry”. Managing Service Quality, Vol. 11, Issue. 3, pp.213-223. Novack, D. D.; Paulos, A.; and St. G. Clair

9