issn 1948-0210 world journal of - microsoft€¦ · world journal of stem cells world j stem cells...

Published by Baishideng Publishing Group Inc

World Journal of Stem CellsWorld J Stem Cells 2016 October 26; 8(10): 306-366

ISSN 1948-0210 (online)

EDITORS-IN-CHIEFTong Cao, SingaporeOscar Kuang-Sheng Lee, Taipei

ASSOCIATE EDITORSWei Cui, LondonPaul Lu, La JollaYuko Miyagoe-Suzuki, TokyoSeyed J Mowla, TehranKai C Sonntag, MassachusettsBao-Hong Zhang, Greenville

GUEST EDITORIAL BOARD MEMBERSChia-Ning Chang, TaichungChuck Ching-Kuey Chao, TaoyuanChie-Pein Chen, TaipeiFu-Chou Cheng, TaichungIng-Ming Chiu, JhunanAkon Higuchi, TaoyuanHossein Hosseinkhani, Taipei Yu-Chen Hu, HsinchuYen-Hua Huang, TaipeiJyh-Cherng Ju, TaichungSteven Shoei-Lung Li, KaohsiungFeng-Huei Lin, Zhunan Town Shing-Hwa Liu, TaipeiJui-Sheng Sun, TaipeiTzu-Hao Wang, TaoyuanYau-Huei Wei, New Taipei CityKuo-Liang Yang, HualienChao-Ling Yao, Chung-Li City

MEMBERS OF THE EDITORIAL BOARD

Argentina

Federico J Benetti, Santa Fe

Luis E Politi, Bahia Blanca

Australia

Michael K Atkinson, BrisbanePeter M Bartold, South AustraliaJeremy M Crook, VictoriaSimon A Koblar, South AustraliaKuldip S Sidhu, SydneyPaul J Verma, Clayton VicErnst J Wolvetang, BrisbaneCory J Xian, South AustraliaXin-Fu Zhou, Adelaide

Austria

Ludwig Aigner, SalzburgFerdinand Frauscher, InnsbruckRegina Grillari, ViennaMariann Gyongyosi, ViennaGünter Lepperdinger, InnsbruckPeter Valent, Vienna

Belgium

Yves Beguin, LiegeMieke Geens, BrusselsNajimi Mustapha, Brussels

Brazil

Niels OS Camara, Cidade UniversitáriaArmando DM Carvalho, BotucatuKatherine AT de Carvalho, CuritibaRegina CDS Goldenberg, Rio de Janeiro

Irina Kerkis, Sao PauloAna H da Rosa Paz, Porto AlegreLuís C De Moraes Sobrino Porto, Rio de Janeiro RJRodrigo Resende, Belo HorizonteNaiara Z Saraiva, Jaboticabal

Canada

Borhane Annabi, QuebecLong-Jun Dai, VancouverConnie J Eaves, VancouverSantokh Gill, OttawaJeffrey T Henderson, TorontoRosario Isasi, QuebecXiaoyan Jiang, VancouverSeung U Kim, VancouverWilliam A King, GuelphRen-Ke Li, TorontoZubin Master, EdmontonChristopher Naugler, CalgaryDominique Shum-Tim, QuebecJean-Francois Tanguay, QuebecKursad Turksen, OttawaLisheng Wang, Ontario

China

Xiu-Wu Bian, ChongqingAndrew Burd, Hong KongKai-Yong Cai, ChongqingCHI-KAI Chen, Shantou Ling-Yi Chen, TianjinFu-Zhai Cui, Beijing Yong Dai, Shenzhen Yu-Cheng Dai, NanchangLi Deng, ChengduJian Dong, Shanghai

I

Editorial Board2016-2019

The World Journal of Stem Cells Editorial Board consists of 700 members, representing a team of worldwide experts in infectious diseases. They are from 44 countries, including Argentina (2), Australia (9), Austria (6), Belgium (3), Brazil (9), Canada (16), China (73), Cyprus (2), Czech Republic (5), Denmark (6), Ecuador (1), Egypt (2), Finland (3), France (19), Germany (32), Greece (1), Hungary (3), India (10), Iran (9), Ireland (3), Israel (10), Italy (52), Japan (54), Jordan (1), Malaysia (1), Mexico (1), Morocco (1), Netherlands (6), Norway (2), Portugal (1), Romania (1), Russia (3), Singapore (19), Slovakia (1), South Korea (44), Spain (16), Sweden (3), Switzerland (5), Thailand (1), Tunisia (1), Turkey (5), United Arab Emirates (1), United Kingdom (28), and United States (229).

WJSC|www.wjgnet.com February 26, 2016

Jian-Xin Gao, Shanghai Zhi-Liang Gao, GuangzhouZi-Kuan Guo, Beijing Zhong-Chao Han, TianjinLing-Ling Hou, BeijingYi-Ping Hu, ShanghaiJian-Guo Hu, BengbuJian-Hua Huang, YinchuanDong-Sheng Huang, GuangzhouJin-Jun Li, ShanghaiJun Dou, NanjingJiu-Hong Kang, ShanghaiDong-Mei Lai, ShanghaiAnskar Yu-Hung Leung, Hong KongGui-Rong Li, Hong KongXiang-Yun Li, BaodingXiao-Rong Li, TianjinZong-Jin Li, TianjinGang Li, Hong KongQizhou Lian, Hong KongHong Liao, NanjingKai-Yan Liu, Beijing Lei Liu, ChengduPauline Po-Yee Lui, Hong KongCai-Ping Ren, ChangshaRen-Hua Wu, ShantouChun-Meng Shi, ChongqingShu-Ren Zhang, BeijingGuan-Bin Song, ChongqingJing-He Tan, TananJin-Fu Wang, Hangzhou Tie-Qiao Wen, ShanghaiJi Wu, ShanghaiRuian Xu, XiamenXue-Tao Pei, BeijingChuan Ye, GuiyangYi-Jia Lou, HangzhouXi-Yong Yu, GuangzhouHao Zhang, Beijing Yun-Hai Zhang, HefeiLei Zhao, WuhanXiao-Gang Zhong, NanningBo Zhu, ChongqingZhong-Min Zou, Chongqing

Cyprus

Pantelis Georgiades, NicosiaNedime Serakinci, Nicosia

Czech Republic

Eva Bártová, BrnoPetr Dvorak, BrnoJaroslav Mokry, Hradec KraloveJakub Suchánek, Hradec Kralove Holan Vladimir, Videnska

Denmark

Basem M Abdallah, OdenseSoren P Sheikh, OdenseLin Lin, TjelePoul Hyttel, Frederiksberg CMorten Meyer, BlommenslystVladimir Zachar, Aalborg

EcuadorPedro M Aponte, Quito

Egypt

Mohamed A Ghoneim, MansoraAlaa E Ismail, Cairo

Finland

Jukka Partanen, HelsinkiPetri Salven, HelsinkiHeli TK Skottman, Tampere

France

Ez-Zoubir Amri, Nice CedexBernard Binetruy, MarseillePhilippe Bourin, ToulouseAlain Chapel, Fontenay-Aux-RosesYong Chen, ParisDario Coleti, ParisChristelle Coraux, ReimsAnne C Fernandez, Montpellierloic Fouillard, ParisNorbert-Claude Gorin, ParisEnzo Lalli, ValbonneGwendal Lazennec, MontpellierNathalie Lefort, EvryLaurent Lescaudron, NantesDavid Magne, Villeurbanne CedexMuriel Perron, OrsayXavier Thomas, LyonAli G Turhan, VillejuifDidier Wion, Grenoble

Germany

Nasreddin Abolmaali, DresdenJames Adjaye, BerlinHalvard Bonig, FrankfurtSven Brandau, EssenChristian Buske, MunichDenis Corbeil, DresdenHassan Dihazi, GoettingenThomas Dittmar, WittenJuergen Dittmer, HalleFrank Edenhofer, BonnUrsula M Gehling, HamburgAlexander Ghanem, BonnEric Gottwald, KarlsruheGerhard Gross, BraunschweigKaomei Guan, GoettingenChristel Herold-Mende, HeidelbergJorg Kleeff, MunichGesine Kogler, DusseldorfSteffen Koschmieder, MunsterNan Ma, RostockUlrich R Mahlknecht, Homburg/SaarUlrich Martin, HannoverKurt P Pfannkuche, CologneMichael Platten, HeidelbergArjang Ruhparwar, HeidelbergHeinrich Sauer, Giessen

Richard Schafer, TübingenNils O Schmidt, HamburgSonja Schrepfer, HamburgDimitry Spitkovsky, CologneSergey V Tokalov, DresdenWolfgang Wagner, Aachen

Greece

Nicholas P Anagnou, Athens

Hungary

Andras Dinnyes, GodolloBalazs Sarkadi, BudapestFerenc Uher, Budapest

India

Anirban Basu, Haryana Chiranjib Chakraborty, VelloreGurudutta U Gangenahalli, DelhiMinal Garg, LucknowDevendra K Gupta, New Delhi Asok Mukhopadhyay, New Delhi Riaz A Shah, KashmirPrathibha H Shetty, Navi Mumbai Anjali Shiras, MaharashtraMalancha Ta, Bangalore

Iran

Hossein Baharvand, TehranMohamadreza B Eslaminejad, TehranIraj R Kashani, Tehran Mansoureh Movahedin, TehranGhasem Hosseini Salekdeh, TehranMasoud Soleimani, TehranMohammad M Yaghoobi, Ostandari St.KermanArash Zaminy, Rasht

Ireland

Frank P Barry, GalwayLeo Quinlan, GalwayRalf M Zwacka, Galway

Israel

Nadir Askenasy, Petah TiqwaZeev Blumenfeld, HaifaBenayahu Dafna, Tel Aviv Benjamin Dekel, Tel HashomerDan Gazit, JerusalemGal Goldstein, Tel-HashomerEran Meshorer, Jerusalem Rachel Sarig, RehovotAvichai Shimoni, Tel-HashomerShimon Slavin, Tel Aviv

Italy

Andrea Barbuti, Milan

IIWJSC|www.wjgnet.com February 26, 2016

IIIWJSC|www.wjgnet.com

Carlo A Beltrami, UdineBruno Bonetti, VeronaPaola Bruni, FlorenceLaura Calzà, BolognaGiovanni Camussi, TurinDomenico Capone, NaplesFrancesco Carinci, FerraraCarmelo Carlo-Stella, MilanClotilde Castaldo, NaplesAngela Chambery, CasertaFrancesco Dieli, Palermo Massimo Dominici, ModenaMassimo De Felici, RomeStefania Filosa, NaplesGuido Frosina, GenovaUmberto Galderisi, NaplesPompilio Giulio, MilanoAntonio Graziano, NapoliBrunella Grigolo, BolognaAnnalisa Grimaldi, VareseAngela Gritti, MilanEnzo Di Iorio, ZelarinoAlessandro Isidori, PesaroGiampiero Leanza, TriesteEnrico Lucarelli, BolognaMargherita Maioli, Sassari Ferdinando Mannello, Urbino Tullia Maraldi, ModenaGianvito Martino, MilanMonica Mattioli-Belmonte, AnconaFabrizio Michetti, RomaGabriella Minchiotti, Naples Roberta Morosetti, RomeGianpaolo Papaccio, NapoliFelicita Pedata, FlorenceMaurizio Pesce, MilanAnna C Piscaglia, RomeVito Pistoia, GenovaFrancesca Pistollato, Ispra Alessandro Poggi, GenoaCaterina AM La Porta, MilanDomenico Ribatti, BariGiampiero La Rocca, PalermoSergio Rutella, RomeSonia Scarfì, GenoaArianna Scuteri, MonzaLuca Steardo, RomeGianluca Vadalà, RomaMaria T Valenti, VeronaCarlo Ventura, RavennaStefania Violini, Lodi

Japan

Manabu Akahane, Nara Yasuto Akiyama, ShizuokaTomoki Aoyama, Kyoto Sachiko Ezoe, OsakaYusuke Furukawa, TochigiMasayuki Hara, OsakaEiso Hiyama, Hiroshima Kanya Honoki, KashiharaYuichi Hori, Kobe Susumu Ikehara, Osaka Masamichi Kamihira, FukuokaYonehiro Kanemura, OsakaHiroshi Kanno, Yokohama Masaru Katoh, Tokyo Eihachiro Kawase, Kyoto Isobe,Ken-ichi, Nagoya

Toru Kondo, Sapporo Toshihiro Kushibiki, Osaka Tao-Sheng Li, NagasakiYasuhisa Matsui, SendaiTaro Matsumoto, Tokyo Hiroyuki Miyoshi, Ibaraki Hiroyuki Mizuguchi, Osaka Hiroshi Mizuno, TokyoTakashi Nagasawa, KyotoKohzo Nakayama, Nagano Tetsuhiro Niidome, Kyoto Toshio Nikaido, Toyama Shoko Nishihara, TokyoHirofumi Noguchi, OkinawaTsukasa Ohmori, Tochigi Katsutoshi Ozaki, Tochigi Kumiko Saeki, Tokyo Kazunobu Sawamoto, Aichi Goshi Shiota, YonagoMikiko C Siomi, Tokyo Yoshiaki Sonoda, Osaka Takashi Tada, Kyoto Miyako Takaki, NaraShihori Tanabe, Tokyo Kenzaburo Tani, Fukuoka Shuji Toda, Saga Atsunori Tsuchiya, NiigataShingo Tsuji, OsakaKohichiro Tsuji, TokyoAkihiro Umezawa, Tokyo Hiroshi Wakao, Sapporo Yoichi Yamada, Aichi Takashi Yokota, Kanazawa Yukio Yoneda, KanazawaKotaro Yoshimura, Tokyo Katsutoshi Yoshizato, HigashihiroshimaLouis Yuge, Hiroshima

Jordan

Khitam SO Alrefu, Karak

Malaysia

Rajesh Ramasamy, Serdang

Mexico

Marco A Velasco-Velazquez, Mexico

Morocco

Radouane Yafia, Ouarzazate

Netherlands

Robert P Coppes, GroningenChristine L Mummery, LeidenVered Raz, LeidenBernard AJ Roelen, UtrechtMarten P Smidt, UtrechtFrank JT Staal, Leiden

Norway

Zhenhe Suo, Oslo

Berit B Tysnes, Bergen

Portugal

Inês M Araújo, Coimbra

Romania

Mihaela C Economescu, Bucharest

Russia

Igor A Grivennikov, Moscow Sergey L Kiselev, MoscowSerov Oleg, Novosibirsk

Singapore

Yu Cai, Singapore Jerry Chan, SingaporeGavin S Dawe, SingaporePeter Droge, Singapore Seet L Fong, Singapore Boon C Heng, SingaporeYunhan Hong, Singapore Chan Woon Khiong, Singapore Chan Kwok-Keung, SingaporeYuin-Han Loh, Singapore Koon G Neoh, Singapore Steve KW Oh, SingaporeKian K Poh, Singapore Seeram Ramakrishna, SingaporeHerbert Schwarz, SingaporeWinston Shim, SingaporeVivek M Tanavde, SingaporeShu Wang, Singapore

Slovakia

Lubos Danisovic, Bratislava

South Korea

Kwang-Hee Bae, Daejeon Hyuk-Jin Cha, Seoul Jong Wook Chang, Seoul Kyu-Tae Chang, Chungcheongbuk-do Chong-Su Cho, SeoulSsang-Goo Cho, Seoul Myung Soo Cho, Seoul Kang-Yell Choi, Seoul HO Jae Han, GwangjuMyung-Kwan Han, JeonjuChanyeong Heo, GyeonggidoKi-Chul Hwang, Seoul Dong-Youn Hwang, SeongnamSin-Soo Jeun, Seoul Youngjoon Jun, Gyeonggi-doJin Sup Jung, Yangsan SiJi-Won Jung, ChungbukKyung-Sun Kang, Seoul Gilson Khang, JeonjuYoon Jun Kim, Seoul

February 26, 2016

IVWJSC|www.wjgnet.com

Byung Soo Kim, SeoulHyo-Soo Kim, SeoulMoon Suk Kim, Suwon Jong-Hoon Kim, SeoulHaekwon Kim, Seoul Hoeon Kim, Daejeon Sang Gyung Kim, Daegu Song Cheol Kim, SeoulKwang-Bok Lee, Chonbuk Dong Ryul Lee, SeoulSoo-Hong Lee, Gyunggi-do Younghee Lee, ChungbukJong Eun Lee, SeoulDae-Sik Lim, DaejeonKyu Lim, DaejeonDo Sik Min, PusanJong-Beom Park, SeoulByung Soon Park, Seoul Gyu-Jin Rho, Jinju Chun Jeih Ryu, SeoulSun Uk Song, IncheonJong-Hyuk Sung, SeoulJong-Ho Won, Seoul Seung Kwon You, Seoul

Spain

Luis MA Aparicio, A Coruna Angel Ayuso-Sacido, ValenciaFernando Cobo, GranadaJuan AM Corrales, Granada Sabrina C Desbordes, BarcelonaRamon Farre, Barcelona Damian Garcia-Olmo, Madrid Boulaiz Houria, Granada Juan M Hurle, SantanderAntonia A Jiménez, Granada Marta M Llamosas, AsturiasPablo Menendez, GranadaMaria D Minana, Valencia Eduardo Moreno, MadridFelipe Prosper, NavarraManuel Ramírez, Madrid

Sweden

M Quamrul Islam, LinkopingStefan Karlsson, LundRachael V Sugars, Huddinge

Switzerland

Thomas Daikeler, BaselAnis Feki, Geneva Sanga Gehmert, BaselSabrina Mattoli, BaselArnaud Scherberich, Basel

Thailand

Rangsun Parnpai, Nakhon Ratchasima

Tunisia

Faouzi Jenhani, Monastir

TurkeyKamil C Akcali, Ankara Berna Arda, AnkaraAlp Can, Ankara Y Murat Elcin, AnkaraErdal Karaoz, Kocaeli

United Arab Emirates

Sherif M Karam, Al-Ain

United Kingdom

Malcolm R Alison, LondonCharles Archer, CardiffDominique Bonnet, LondonKristin M Braun, London Nicholas R Forsyth, HartshillRasmus Freter, Oxford Hassan T Hassan, Scotland David C Hay, EdinburghWael Kafienah, Bristol Francis L Martin, LancasterStuart McDonald, London Pankaj K Mishra, WolverhamptonAli Mobasheri, Sutton Bonington Michel Modo, LondonDonald Palmer, LondonStefano Pluchino, MilanJulia M Polak, LondonStefan A Przyborski, DurhamJames A Ross, EdinburghAlastair J Sloan, CardiffVirginie Sottile, NottinghamPetros V Vlastarakos, StevenageHong Wan, LondonChristopher M Ward, ManchesterHeping Xu, AberdeenLingfang Zeng, LondonRike Zietlow, Cardiff

United States

Gregor B Adams, Los AngelesArshak R Alexanian, MilwaukeeAli S Arbab, DetroitKinji Asahina, Los AngelesAtsushi Asakura, MinneapolisPrashanth Asuri, Santa ClaraCraig S Atwood, MadisonDebabrata Banerjee, New BrunswickDavid W Barnes, LawrencevilleSurinder K Batra, OmahaAline M Betancourt, New OrleansJohn J Bright, IndianapolisBruce A Bunnell, CovingtonMatthew E Burow, New OrleansRebecca J Chan, IndianapolisAnthony WS Chan, AtlantaJoe Y Chang, HoustonG Rasul Chaudhry, RochesterCaifu Chen, Foster CityKe Cheng, Los Angeles, Herman S Cheung, Coral GablesKent W Christopherson II, Chicago

David W Clapp, IndianapolisClaudius Conrad, BostonCharles S Cox, HoustonRonald G Crystal, New YorkHiranmoy Das, ColumbusDouglas Dean, LouisvilleBridget M Deasy, PittsburghWeiwen Deng, Grand RapidsGoberdhan Dimri, EvanstonDavid Dingli, RochesterJuan Dominguez-Bendala, MiamiSergey V Doronin, Stony BrookFu-Liang Du, VernonGary L Dunbar, PleasantTodd Evans, New YorkToshihiko Ezashi, ColumbiaVincent Falanga, ProvidenceZhongling Feng, CarlsbadMarkus Frank, BostonMohamed A Gaballa, Sun CityG Ian Gallicano, WashingtonYair Gazitt, San AntonioYong-Jian Geng, HoustonJorge A Genovese, Salt Lake CityMehrnaz Gharaee-Kermani, Ann ArborAli Gholamrezanezhad, BaltimoreJoseph C Glorioso, PittsburghW Scott Goebel, IndianapolisBrigitte N Gomperts, Los AngelesKristbjorn O Gudmundsson, FrederickPreethi H Gunaratne, HoustonYan-Lin Guo, HattiesburgRobert G Hawley, WashingtonTong-Chuan He, ChicagoMary JC Hendrix, ChicagoCharles C Hong, Pierce AveYiling Hong, DaytonCourtney W Houchen, Oklahoma CityGeorge TJ Huang, BostonJing Huang, BethesdaJohnny Huard, PittsburghJaclyn Y Hung, San AntonioLorraine Iacovitti, PhiladelphiaTony Ip, WorcesterD Joseph Jerry, AmherstKun-Lin Jin, NovatoLixin Kan, ChicagoWinston W Kao, CincinnatiPartow Kebriaei, HoustonMary J Kelley, PortlandSophia K Khaldoyanidi, San DiegoMahesh Khatri, WoosterJaspal S Khillan, PittsburghKatsuhiro Kita, GalvestonMikhail G Kolonin, HoustonPrasanna Krishnamurthy, ChicagoMarlene A Kristeva, Van Nuys John S Kuo, MadisonMark A LaBarge, BerkeleyUma Lakshmipathy, CarlsbadHillard M Lazarus, Shaker HeightsTechung Lee, BuffaloXudong J Li, CharlottesvilleShaoguang Li, WorcesterJianxue Li, BostonXiao-Nan Li, HoustonShengwen C Li, OrangeMarcos de Lima, HoustonP Charles Lin, NashvilleChing-Shwun Lin, San FranciscoZhenguo Liu, Columbus

February 26, 2016

V February 26, 2016WJSC|www.wjgnet.com

Su-Ling Liu, Ann ArborNing Liu, MadisonAurelio Lorico, Las VegasJean-Pierre Louboutin, PhiladelphiaQing R Lu, DallasBing-Wei Lu, StanfordNadya L Lumelsky, BethesdaHong-Bo R Luo, BostonHinh Ly, AtlantaTeng Ma, TallahasseeKenneth Maiese, NewarkDebra JH Mathews, BaltimoreRobert L Mauck, PhiladelphiaGlenn E Mcgee, New YorkJeffrey A Medin, MilwaukeeLucio Miele, JacksonRobert H Miller, ClevelandDavid K Mills, RustonMurielle Mimeault, OmahaPrasun J Mishra, BethesdaKalpana Mujoo, HoustonMasato Nakafuku, CincinnatiMary B Newman, ChicagoWenze Niu, DallasChristopher Niyibizi, HersheyJon M Oatley, PullmanSeh-Hoon Oh, GainesvilleShu-ichi Okamoto, La JollaNishit Pancholi, ChicagoDeric M Park, CharlottesvilleGregory Pastores, New YorkMing Pei, MorgantownDerek A Persons, MemphisDonald G Phinney, JupiterJohn S Pixley, RenoDimitris G Placantonakis, New YorkGeorge E Plopper, TroyMark EP Prince, Ann ArborApril Pyle, Los AngelesMurugan Ramalingam, GaithersburgGuangwen Ren, New BrunswickBrent A Reynolds, GainesvilleJeremy N Rich, ClevelandShuo L Rios, Los AngelesAngie Rizzino, Omaha,

Fred J Roisen, LouisvilleRouel S Roque, HendersonCarl B Rountree, HersheyClinton T Rubin, MadisonDonald Sakaguchi, AmesPaul R Sanberg, TampaMasanori Sasaki, West HavenStewart Sell, AlbanyIvana de la Serna, ToledoArun K Sharma, ChicagoSusan G Shawcross, ManchesterJinsong Shen, DallasAshok K Shetty, New OrleansYanhong Shi, DuarteSongtao Shi, Los AngelesVassilios I Sikavitsas, NormanIgor I Slukvin, MadisonShay Soker, Winston SalemHong-Jun Song, BaltimoreEdward F Srour, IndianapolisHua Su, San FranciscoJun Sun, RochesterTao Sun, New YorkKenichi Tamama, ColumbusMasaaki Tamura, ManhattanTetsuya S Tanaka, UrbanaDean G Tang, SmithvilleHugh S Taylor, New HavenJonathan L Tilly, BostonJakub Tolar, MinneapolisDeryl Troyer, ManhattanKent KS Tsang, MemphisScheffer C Tseng, MiamiCho-Lea Tso, Los AngelesLyuba Varticovski, BethesdaTandis Vazin, BerkeleyQi Wan, RenoShu-Zhen Wang, BirminghamLianchun Wang, AthensGuo-Shun Wang, New OrleansYigang Wang, CincinnatiZack Z Wang, ScarboroughCharles Wang, Los AngelesLimin Wang, Ann ArborZhiqiang Wang, Duarte

David Warburton, Los AngelesLi-Na Wei, MinneapolisChristof Westenfelder, Salt Lake CityAndre J van Wijnen, WorcesterMarc A Williams, RochesterJ Mario Wolosin, New YorkRaymond C Wong, IrvineJoseph C Wu, StanfordLizi Wu, GainesvilleWen-Shu Wu, ScarboroughSean M Wu, BostonPing Wu, GalvestonXiaowei Xu, PhiladelphiaYan Xu, PittsburghMeifeng Xu, CincinnatiDean T Yamaguchi, Los AngelesJun Yan, LouisvillePhillip C Yang, Stanford Feng-Chun Yang, IndianapolisXiao-Feng Yang, PhiladelphiaXiaoming Yang, SeattleShang-Tian Yang, ColumbusYouxin Yang, BostonJing Yang, OrangeKaiming Ye, FayettevillePampee P Young, NashvilleJohn S Yu, Los AngelesHong Yu, MiamiSeong-Woon Yu, East LansingHui Yu, Pittsburgh Xian-Min Zeng, NovatoMing Zhan, BaltimoreChengcheng Zhang, TexasYing Zhang, BaltimoreQunzhou Zhang, Los AngelesYan Zhang, HoustonX. Long Zheng, PhiladelphiaPan Zheng, Ann ArborXue-Sheng Zheng, CharlestownJohn F Zhong, Los AngelesXianzheng Zhou, MinneapolisBin Zhou, BostonFeng C Zhou, Indianapolis

Contents Monthly Volume 8 Number 10 October 26, 2016

� October 26, 2016|Volume 8|�ssue 10|WJSC|www.wjgnet.com

THERAPEUTIC ADVANCES306 StemcelltherapyforthetreatmentofLeydigcelldysfunctioninprimaryhypogonadism

Peak TC, Haney NM, Wang W, DeLay KJ, Hellstrom WJ

REVIEW316 Updateonacutemyeloidleukemiastemcells:Newdiscoveriesandtherapeuticopportunities

Stahl M, Kim TK, Zeidan AM

332 Stem/progenitorcellsandobstructivesleepapneasyndrome-newinsightsforclinicalapplications

Micheu MM, Rosca AM, Deleanu OC

ORIGINAL ARTICLE

Basic Study

342 Modelacupuncturepoint:Bonemarrow-derivedstromalstemcellsaremovedbyaweakelectromagnetic

field

Emelyanov AN, Borisova MV, Kiryanova VV

355 CharacterizationandgeneticmanipulationofprimedstemcellsintoafunctionalnaïvestatewithESRRB

Rossello RA, Pfenning A, Howard JT, Hochgeschwender U

FLYLEAF

ABOUT COVER

EDITORS FOR THIS ISSUE

Contents

��

AIM AND SCOPE

October 26, 2016|Volume 8|�ssue 10|WJSC|www.wjgnet.com

World Journal of Stem CellsVolume 8 Number 10 October 26, 2016

EDITORIALOFFICEXiu-Xia Song, DirectorFang-Fang Ji, Vice DirectorWorld Journal of Stem CellsBaishideng Publishing Group Inc8226 Regency Drive, Pleasanton, CA 94588, USATelephone: +1-925-2238242Fax: +1-925-2238243E-mail: [email protected] Desk: http://www.wjgnet.com/esps/helpdesk.aspxhttp://www.wjgnet.com

PUBLISHERBaishideng Publishing Group Inc8226 Regency Drive, Pleasanton, CA 94588, USATelephone: +1-925-2238242Fax: +1-925-2238243E-mail: [email protected] Desk: http://www.wjgnet.com/esps/helpdesk.aspxhttp://www.wjgnet.com

PUBLICATIONDATEOctober 26, 2016

COPYRIGHT© 2016 Baishideng Publishing Group Inc. Articles published by this Open-Access journal are distributed under the terms of the Creative Commons Attribution Non-commercial License, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited, the use is non-commercial and is otherwise in compliance with the license.

SPECIALSTATEMENTAll articles published in journals owned by the Baishideng Publishing Group (BPG) represent the views and opinions of their authors, and not the views, opinions or policies of the BPG, except where other-wise explicitly indicated.

INSTRUCTIONSTOAUTHORShttp://www.wjgnet.com/bpg/gerinfo/204

ONLINESUBMISSIONhttp://www.wjgnet.com/esps/

NAMEOFJOURNALWorld Journal of Stem Cells

ISSNISSN 1948-0210 (online)

LAUNCHDATEDecember 31, 2009

FREQUENCYMonthly

EDITORS-IN-CHIEFTong Cao, BM BCh, DDS, PhD, Associate Profes-sor, Doctor, Department of Oral Sciences, National University of Singapore, Singapore 119083, Singapore

Oscar Kuang-Sheng Lee, MD, PhD, Professor, Medical Research and Education of Veterans General Hospital-Taipei, No. 322, Sec. 2, Shih-pai Road, Shih-pai, Taipei 11217, Taiwan

EDITORIALBOARDMEMBERSAll editorial board members resources online at http://www.wjgnet.com/1948-0210/editorialboard.htm

Editorial BoardMember ofWorld Journal of StemCells ,MikhailGKolonin,

PhD,AssociateProfessor,Director,DepartmentofMetabolicandDegenerative

DiseasesResearch, Jr.DistinguishedUniversity Chair inMetabolicDisease

Research,TheBrownFoundationInstituteofMolecularMedicine,Universityof

TexasHealthScienceCenteratHouston,Houston,TX77030,UnitedStates

World Journal of Stem Cells (World J Stem Cells, WJSC, online ISSN 1948-0210, DOI: 10.4252), is a peer-reviewed open access academic journal that aims to guide clinical practice and improve diagnostic and therapeutic skills of clinicians. WJSC covers topics concerning all aspects of stem cells: embryonic, neural, hematopoietic, mesenchymal, tissue-specific, and cancer stem cells; the stem cell niche, stem cell genomics and proteomics, and stem cell techniques and their application in clinical trials. We encourage authors to submit their manuscripts to WJSC. We will give priority to manuscripts that are supported by major national and international foundations and those that are of great basic and clinical significance.

World Journal of Stem Cells is now indexed in PubMed, PubMed Central.

I-V EditorialBoard

Responsible Assistant Editor: Xiang Li Responsible Science Editor: Xue-Mei GongResponsible Electronic Editor: Huan-Liang Wu Proofing Editorial Office Director: Xiu-Xia SongProofing Editor-in-Chief: Lian-Sheng Ma

INDEXING/ABSTRACTING

THERAPEUTIC ADVANCES

306 October 26, 2016|Volume 8|Issue 10|WJSC|www.wjgnet.com

Stem cell therapy for the treatment of Leydig cell dysfunction in primary hypogonadism

Taylor C Peak, Nora M Haney, William Wang, Kenneth J DeLay, Wayne J Hellstrom, Department of Urology, School of Medicine, Tulane University, New Orleans, LA 70112, United States

Author contributions: All the authors contributed to the manuscript.

Conflict-of-interest statement: The authors declare no conflicts of interest regarding this manuscript.

Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/

Manuscript source: Invited manuscript

Correspondence to: Wayne J Hellstrom, MD, Department of Urology, School of Medicine, Tulane University, 1430 Tulane Ave. 8642, New Orleans, LA 70112, United States. [email protected]: +1-504-9883361Fax: +1-504-9885059

Received: May 3, 2016Peer-review started: May 3, 2016First decision: June 13, 2016Revised: July 27, 2016Accepted: August 27, 2016Article in press: August 29, 2016Published online: October 26, 2016

AbstractThe production of testosterone occurs within the Leydig cells of the testes. When production fails at this level from either congenital, acquired, or systemic disorders,

Submit a Manuscript: http://www.wjgnet.com/esps/Help Desk: http://www.wjgnet.com/esps/helpdesk.aspxDOI: 10.4252/wjsc.v8.i10.306

World J Stem Cells 2016 October 26; 8(10): 306-315ISSN 1948-0210 (online)

© 2016 Baishideng Publishing Group Inc. All rights reserved.

the result is primary hypogonadism. While numerous testosterone formulations have been developed, none are yet fully capable of replicating the physiological patterns of testosterone secretion. Multiple stem cell therapies to restore androgenic function of the testes are under investigation. Leydig cells derived from bone marrow, adipose tissue, umbilical cord, and the testes have shown promise for future therapy for primary hypogonadism. In particular, the discovery and utilization of a group of progenitor stem cells within the testes, known as stem Leydig cells (SLCs), has led not only to a better understanding of testicular development, but of treatment as well. When combining this with an understanding of the mechanisms that lead to Leydig cell dysfunction, researchers and physicians will be able to develop stem cell therapies that target the specific step in the steroidogenic process that is deficient. The current preclinical studies highlight the complex nature of regenerating this steroidogenic process and the problems remain unresolved. In summary, there appears to be two current directions for stem cell therapy in male primary hypogonadism. The first method involves differentiating adult Leydig cells from stem cells of various origins from bone marrow, adipose, or embryonic sources. The second method involves isolating, identifying, and transplanting stem Leydig cells into testicular tissue. Theoretically, in-vivo re-activation of SLCs in men with primary hypogonadism due to age would be another alternative method to treat hypogonadism while eliminating the need for transplantation.

Key words: Stem cell therapy; Leydig cells; Primary hypogonadism; Stem Leydig cells; Testosterone; Bone marrow-derived stem cells; Adipose-derived mesenchymal stem cells

© The Author(s) 2016. Published by Baishideng Publishing Group Inc. All rights reserved.

Core tip: Although clinicians are capable of treating primary hypogonadism with exogenous testosterone,

Taylor C Peak, Nora M Haney, William Wang, Kenneth J DeLay, Wayne J Hellstrom


Peak TC et al . Stem cells treat Leydig cell dysfunction in hypogonadism

there is no therapy that mimics its physiologic release. Two current directions exist for stem cell therapy in male primary hypogonadism. The first method involves differentiating adult Leydig cells from stem cells of various origins from bone marrow, adipose, or embryonic sources. The second method involves isolating, identifying, and transplanting stem Leydig cells (SLCs) into testicular tissue. Re-activation of SLCs in men with primary hypogonadism due to age would also be an alternative method. As researchers are better able to replicate the differentiation process of androgenic tissue, treatments will hopefully follow.

Peak TC, Haney NM, Wang W, DeLay KJ, Hellstrom WJ. Stem cell therapy for the treatment of Leydig cell dysfunction in primary hypogonadism. World J Stem Cells 2016; 8(10): 306-315 Available from: URL: http://www.wjgnet.com/1948-0210/full/v8/i10/306.htm DOI: http://dx.doi.org/10.4252/wjsc.v8.i10.306

INTRODUCTIONTestosterone is an essential hormone that is required for normal male physiologic development. It not only plays a role in the growth of genital organs in utero, but also initiates spermatogenesis, as well as the development of secondary sexual characteristics during puberty (Figure 1). Low testosterone, otherwise known as hypogonadism, can result from a primary defect within the testes or secondarily from a disruption in the hypothalamicpituitarygonadal (HPG) axis.

Primary hypogonadism can result from a number of disorders, the most common of which is Klinefelter’s syndrome, which occurs in one in every 2500 adult males[1]. Other disorders can be separated into those that are congenital, those that are acquired, and those related to systemic conditions (Figure 2). Congenital disorders, that frequently are associated with hypogonadism, include, among others, myotonic dystrophy, Down syndrome, bilateral cryptorchidism, defects in testosterone biosynthetic enzymes, and luteinizing hormone receptor mutations. Acquired disorders include dysfunction related to aging, trauma, orchitis, and testicular failure secondary to radiation or exposure to chemotherapy. Systemic disorders include chronic liver disease, chronic kidney disease, sickle cell, and vasculitides. Agerelated dysfunction, in particular, has become an intensely debated subject as physicians continue to discuss how to properly diagnose and treat hypogonadal men. This debate has led researchers to better understand the role of testosterone in the aging male, and to appreciate just how common this deficiency is in the general population. For example, in the Hypogonadism in Males study, researchers found that when using a testosterone threshold of 300 ng/dL to define hypogonadism, the overall prevalence of androgen deficiency in men over 45 years of age was 38.7%[2].

The detrimental effects that hypogonadism can have on patients are multiple. Symptomatically, patients can experience fatigue, depressed mood, decreased libido, erectile dysfunction, infertility, alterations in body composition, and decreased cognitive function. Furthermore, there is evidence to suggest that hypogonadal patients are at an increased risk for coronary artery disease, cerebral vascular disease, and metabolic syndrome[35]. Though numerous testosterone formulations have been developed, none are fully capable of replicating the physiological patterns of testosterone secretion from within the testes. With an understanding of Leydig cell development, and an appreciation for the mechanisms that lead to their dysfunction in some of the more commonly encountered etiologies of primary hypogonadism, we can utilize the recent advances in stem cell therapy to provide a longlasting treatment.

NORMAL LEYDIG CELL DEVELOPMENTLeydig cells, in the testicle, produce testosterone. They are present in clusters in the interstitium between seminiferous tubules within the testes, totaling 700 million cells. They constitute 2%4% of testicle volume. The development of Leydig cell function comprises three stages, corresponding to the triphasic development of plasma testosterone levels (Figure 2)[6,7]. It begins in the sixth to seventh week of gestation, when fetal Leydig cells begin producing testosterone[8]. This occurs independent of luteinizing hormone (LH), from the anterior pituitary, and human chorionic gonadotropin (hCG), which is secreted from the placenta[7,9]. After seven weeks, however, hCG and LH are required for Leydig cells to produce enough testosterone for masculinization of the external genitalia[10]. The proliferation and differentiation of Leydig cells continues until 19 wk, at which time cells undergo regression[11]. The second stage begins after birth in the neonatal period, at which time a second testosterone surge occurs that is associated with the development of a second wave of Leydig cells that reach a peak at three months of age[12]. These cells are believed to be a mixture of developing Leydig cells and fetal Leydig cells. Thereafter, regression of fetal Leydig cells occurs, reaching a nadir at one year of age[13]. In addition, immature Leydig cells remain within the interstitium of the testes until activated during the third stage of development that occurs during puberty[13,14]. With the onset of puberty, the immature Leydig cells, visualized surrounding the outer peritubular layer of the seminiferous tubules and vasculature of the interstitial tissue, undergo a cytological transformation that allows for a significant production of testosterone in an LHdependent manner[15]. This rise in testosterone will then lead to the development of secondary sexual characteristics and sexual reproduction.

STEM LEYDIG CELLS Despite the wellunderstood, temporal progression of


Leydig cell maturation, the origin of Leydig cells had not been fully elucidated. We now know that stem Leydig cells (SLCs) do exist, and that they are critical to the maturation process. This has been understood through studies that demonstrated the repopulation of adult Leydig cells in rat testes after being depleted by the alkylating agent, ethane dimethanesulfonate

(EDS)[1618]. In further support of this theory, it has been shown that the regeneration of cells does not result from quiescent progenitor cells that have already differentiated into Leydig cell lineage, but rather true stem cells that remain undifferentiated and have the ability to proliferate for extended periods of time without expressing Leydig cell markers[19]. In attempting to

Figure 1 Testosterone biosynthetic pathway. FSH: Follicle stimulating hormone; LH: Luteinizing hormone; HDL: High-density lipoprotein; StAR: Steroidogenic acute regulatory protein.

Figure 2 Various possible causes of primary hypogondism.

FSH releaseLH release

Leydig (interstitial) cells

Interstitialspace

Seminiferoustubule

Testosteronerelease

Leydig cellScarB1HDL

StAR Cholesterol

Cholesterol

Pregnonelone

Mitochondria

Endoplasmic reticulum

Pregnonelone Progesterone

Androstenediol Testosterone

DHEA 4-Androstenediol

P450c17(17.20-lyase)

P450c17(17.20-lyase)

P450c17(17 a-hydroxylase) P450c17

(17 a-hydroxylase)17 a-OH-

pregnonelone17 a-OH-

pregnonelone

Causes of primary hypogonadism

Congenital Acquire disorders Systemic disorders

Klinefelter syndrome (XXY)

Myotonic dystrophy

Uncorrected cryptorchidism

Noonan syndrome

Bilateral congenital anorchia

Polyglandular autoimmune syndrome

Testosterone biosynthetic

enzyme defects

Congenital adrenal hyperplasia

Complex genetic syndromes

Down syndrome

Luteinizing hormone receptor mutation

Bilateral surgical castration or

trauma

Orchitis

Drugs (Spironolactone, ketoconazole,

abiraterone, enzalutamide, alcohol,

chemotherapy agents)

Ionizing radiation

Chronic liver disease

Malignancy (Lymphoma,

testicular cancer)

Chronic kidney disease

Sickle cell disease

Aging

Spinal cord injury

Vasculitis, infiltrative disease

(Amyloidosis, leukemia)



isolate these stem cells in rat models, researchers have not clearly identified the location of these cells. Some studies provide evidence to suggest that they exist within the interstitium as the pericytes and vascular smooth muscle cells along the vessel walls[2022]. Others point towards a peritubular location, lying on the surface of the seminiferous tubules[19,23,24].

To highlight the vascular hypothesis, Davidoff et al[22] demonstrated that after destroying mature Ledyig cells, regeneration was preceded by a proliferation of nestinexpressing vascular smooth muscle cells and pericytes. Expression of nestin, an intermediate filament protein, has not only been observed in stem cells in the nervous system, but in other tissues, including the testes. The proliferating cells in this study were then capable of conversion into steroidogenic Leydig cells. Evidence for the transdifferentiation into Leydig cells was based on the coinciding expression of nestin with steroidogenic genes in newly generated Leydig cells.

In order to elucidate the peritubular hypothesis, it is important to understand that the peritubular compartment contains myofibroblasts, testicular peritubular cells (TPCs), and extracellular matrix[25]. Specifically, the TPCs contribute to testicular function by secreting paracrine factors and components of the extracellular matrix[26]. In Stanley et al[19] researchers isolated cells expressing plateletderived growth factor receptora, but not 3βhydroxysteroid dehydrogenase (3βHSDneg) from the testes of EDStreated adult rats. These were later determined to be the SLC. To localize these cells, the seminiferous tubules and interstitium were physically separated and cultured. During culture, the 3βHSDneg cells on the tubule surfaces underwent divisions, eventually expressing 3βHSD and producing testosterone. Removal of these testosteroneproducing cells from the tubule surfaces, followed by further culture of the stripped tubules, resulted in their reappearance. In contrast, the interstitial compartment did not develop 3βHSDpos cells or produce testosterone when cultured. The fact that functional Leydig cells are able to differentiate in the absence of interstitium suggests that macrophages and cells associated with blood vessels in the interstitial compartment (vascular smooth muscle cells, pericytes) may not be critical for the development of new Leydig cells, as suggested in some previous studies. These results were further corroborated in a study using human TPCs[27]. In this study, researchers demonstrated that these cells expressed pluripotency markers, SLC markers, and steroidogenic genes involved in the biosynthesis of sex steroids. Furthermore, these cells were activated to express steroidogenic enzymes that led to the production of pregnenolone and progesterone. Testosterone was not produced, but this may highlight the fact that these progenitor cells have not fully differentiated into a Leydig cell lineage.

It should be noted that the discrepancies in the location of these stem cells might result from differing conditions within the testicular tissue. It may be that SLCs reside in both peritubular and interstitial locales,

as suggested by Chen et al[28]. For example, Leydig cell regeneration has been shown to occur more rapidly around regressed tubules than near tubules with normal spermatogenesis[29]. Likewise, in testes with normal spermatogenesis, regeneration appears to occur in proximity to both tubules and the interstitial blood vessels[30]. A third plausible hypothesis that researchers have put forth is that the adult Leydig cells differentiate not from stem cells, but rather from myoid cells, vascular smooth muscle cells, or pericytes that have transdifferentiated[28].

LEYDIG CELL DYSFUNCTIONUnderstanding the mechanisms that cause Leydig cell dysfunction will ultimately lead researchers and physicians to develop therapies that target the specific step or steps in the steroidogenic process that has been damaged, whether it is at the level of the adult Leydig cell, the Leydig stem cell, or beyond. In an attempt to further elucidate these mechanisms, we will cover those disease states that have been comprehensively studied in the lab, and those that may one day be amenable to stem cell therapy. For example, some congenital and systemic disorders leading to hypogonadism often lead to dysfunction at multiple levels in the HPG axis. Our focus will remain specifically at the level of the testis. Likewise, primary hypogonadism due to genetic mutations or enzymatic deficiencies would not be amenable to autologous stem cell transplant because the stem cells themselves would carry the mutation and/or deficiency.

Despite Klinefelter’s Syndrome being the most common abnormality of sex chromosomes that invariably leads to testicular failure, researchers have not determined what the mechanisms are that underlie the global degeneration of testicular tissue. In a recent study by D’Aurora et al[31] researchers conducted testicular gene expression profiling by a whole genome microarray approach using testicular tissue from patients with Klinefelter’s Syndrome. They found that the genes responsible for increased apoptotic processes were overexpressed. Furthermore, the data suggested that the disregulation of genes involved in the inflammation process were responsible for the high degree of fibrosis that is described in the testicular involution process of patients. They also identified the overexpression of genes central to the steroidogenic activity of the Leydig cells. This finding supports the recently demonstrated increase of intratesticular testosterone concentrations in Klinefelter patients in comparison to control patients[32]. Thus, the low testosterone serum levels commonly seen in these patients could be related to an altered release of the hormone into the bloodstream. Researchers have not yet determined whether the altered release is due to the decreased testicular vasculature commonly seen in these patients, or if it is due to some active transporter that might be involved in testosterone release from Leydig cells[32]. If it is indeed an issue of



vasculature, then a cellbased therapy that regenerates not only Leydig cells but also the entire testicular microenvironment may be necessary. However, if an active transporter within the Leydig cell is identified then a more cell-specific approach would be feasible.

Interestingly, primary hypogonadism secondary to aging does not result from a loss of Leydig cells. Instead, studies have indicated that it is Leydig cell function that is lost through a process that is independent of LH secretion[33,34]. Indeed, when LH is administered in vitro to Leydig cells from aged rats, testosterone production remains significantly below that of cells from young rats[35]. Because the steroidogenic process involves a complex interplay of biochemical pathways, researchers have proposed a number of mechanisms responsible for the decreased function[36].

Critical to function is the interaction between LH, its receptor on the Leydig cell, and the subsequent production of 3’,5’cyclic adenosine monophosphate (cAMP) initiating the steroidogenic process. Researchers have demonstrated a coupling defect of the LH receptor to adenylate cyclase, reducing cAMP production and directly inhibiting testosterone synthesis[37]. There is also evidence to suggest that increased oxidative stress plays a critical role, not only in the abovementioned uncoupling defect, but also in cell membrane stability. With increasing age, cells experience increased levels of reactive oxygen species (ROS), due in part to the decreased levels of free radicalscavenging proteins[3841]. With increased ROS, lipid peroxidation within the Leydig cell leads to a destruction of membrane stability[42]. Because steroidogenesis depends on this stability for cholesterol transport, testosterone synthesis is inhibited. Other studies have shown that arachidonic acid positively regulates the effects of LH on steroidogenesis[43,44]. It, however, can be metabolized by cyclooxygenase 2 (COX2). It has been suggested that with increased levels of COX2 in aged Leydig cells, there is a reduction in arachidonic acid, and thus testosterone[45]. Further corroborating the oxidative stress hypothesis, researchers have determined that phosphorylation of p38 mitogenactivated protein kinase (MAPK), may serve as the mediating interaction between increased oxidative stress and decreased steroidogenesis[46]. Relating COX2 inhibition to this theory, it is possible that phosphorylated p38 MAPK increases COX2 synthesis, in turn inhibiting steroidogenic function, although this has not been evaluated in Leydig cells[28,47].

Hypogonadism is frequently found in men who have undergone chemotherapy. While far less evidence explains how Leydig cells are affected, AlBader et al[48] studied how bleomycin, etoposide, and cisplatin affected the HPG axis in a rat model. They found that chemotherapy induced both Leydig cell hyperplasia and degenerative changes in Leydig cells after exposure. These degenerative changes persisted after 63 d. The question remains as to whether the observed hyperplasia resulted from activated SLCs. Given that the degenerative changes persisted after recovery, this might suggest

that the chemotherapy permanently altered the SLCs. This would stand in contrast to the aging SLCs, which remain quiescent and genomically stable throughout life. Critical to an understanding of these degenerative changes, researchers measured the testicular oxidative stress, which was found to be significantly increased at the end of the chemotherapy, but returned to a normal level after the recovery time. This study went further to evaluate the expression of steroidogenic genes. They found that the two genes critical for completion of the testosterone biosynthesis pathway were downregulated, namely 17βhydroxysteroid dehydrogenase and 3βhydroxysteroid dehydrogenase, thus explaining the decreased testosterone levels at the end of chemotherapy. Even after the recovery time, the chemotherapy still had inhibitory effects on the transcription of these genes. However, testosterone levels did not show any significant differences with the control group, most likely due to unaffected steroidogenic acute regulatory protein (StAR) expression in the testis, which actually indicated a trend to increase. The StAR protein mediates transmembrane cholesterol transport in mitochondria, an essential ratelimiting step in testosterone synthesis[49].

Radiation also alters Leydig cell function. Sivakumar et al[50] evaluated the mechanism behind radiationinduced dysfunction by culturing Leydig cells and exposing them to different doses of fractioned gamma radiation. Researchers found that radiation exposure inhibited Leydig cell steroidogenesis in a dosedependent manner. They found that at higher doses, radiation exposure impaired Leydig cell steroidogenesis by affecting LH signal transduction at the level of both pre and postcAMP generation. Just as in the chemotherapytreated model, radiation seems to directly alter the steroidogenic pathways of the Leydig cells. However, it has not been determined how radiation affects SLCs. To fully design effective therapies, it will be important to understand the pathologic effects of radiation on SLCs. This will determine the point in the process at which time therapy will intervene.

STEM CELL THERAPYMultiple stem cell therapies to restore androgenic function of the testes are under investigation (Table 1). Leydig cells derived from bone marrow, adipose tissue, umbilical cord, and the testes have shown promise in future therapy for primary hypogonadism. An initial study by Lue et al[51] injected unfractionated bone marrow cells into the seminiferous tubules and testicular interstitium of mice. The results demonstrated that the murine bone marrow cells had the potential to differentiate into germ cells, Sertoli, and Leydig cells in vivo. However, it was unknown which precursor cell from the bone marrow differentiated into each end testicular cell type. Lo et al[52] demonstrated that murine testicular stem cells, isolated from the interstitial space of the testis and transplanted into the interstitial



Ref. Stem cells used Study type Design Results

Lo et al[52] Mouse mixed testicular stem cells (SP) containing

spermatogonial, leydig cell, and myoid stem

cells

In vivo SCs were injected into the testes of sterile sertoli-cell only transgenic mice and transgenic mice with a

targeted deletion of 4-kb pairs of the LH receptor gene

SP cell transplanted mice had increased time-dependent serum testosterone and spermatogenesis

compared to non-SP cell transplanted mice

Yazawa et al[53] Rat BM-MSCs In vivo BM-MSCs were injected into the testes of 3-wk old Sprague-Dawley rats

BM-MSCs differentiated into steroidogenic cells similar to Leydig

cellsMouse MSCs MSCs were transfected with Sf-1 followed by treatment

with cAMP and cultured in Iscova’s MEM or DMEM with 10% fetal calf serum

Transfected cells differentiated into Leydig cells

Lue et al[51] Unfractionated mouse bone marrow stem cells

In vitro SCs were injected into the testes of busulfan treated mice and c-kit mutant homozygous mice

SCs differentiated into Leydig, Sertoli, and germ cells after 12 wk. Though

germ cells were lacking in c-kit mutant mice

Gondo et al[63] Mouse AMCs In vitro AMCs and BMCs were transfected with SF-1 and cultured with Medium A

AMCs were more likely to differentiate into adrenal-type

steroidogenic cells with increased production of corticosterone

Mouse BMCs BMCs were more likely to differentiate into gonadal-type

steroidogenic cells with increased production of testosterone

Yazawa et al[54] Human BM-MSCs In vitro BM-MSCs were transfected with LRH-1 followed by treatment with cAMP and cultured in DMEM with

10% fetal calf serum

Transfected cells expressed CYP17 and produced testosterone

Yazawa et al[55] UC-MSCs In vitro UC-MSCs were transfected with SF-1 followed by treatment with cAMP and cultured in DMEM/Ham’s

F-12 supplemented with 0.1% BSA

Transfected cells differentiated into cells with similar characteristics to

granulosa-luteal cells Wei et al[62] Human UC-MSCs In vitro UC-MSCs and BM-MSCs were transfected with SF-1

and cultured in the presence of cAMPDifferentiated UC-MSCs had higher expression of steroidogenic mRNAs.

They also secreted significantly greater amounts of testosterone and

cortisol than BM-MSCs

Human BM-MSCs

Yazawa et al[64] Rat BM-MSCs In vivo BM-MSCs were transplanted into prepubertal testes MSCs were able to differentiate into steroidogenic Leydig cells in vivo. SF-1 expression was also detected

Yang et al[56] Rat ADSCs In vivo ADSCs were injected into Sprague-dawley rats that had been treated with D-gal (aging model) or saline

(control) for 8 wk

ADSCs migrated to damaged areas, reduced the number of apoptotic

Leydig cells, and upregulated enzymes to increase testosterone levels in the testis in those treated

with D-gal Yang et al[58] Mouse ESCs In vivo ESCs were cultured with cAMP, SF-1, and FSK. These

derived Leydig-like cells were then injected into Sprague-dawley rats treated with EDS

FSK enhanced the differentiation of mESCs into Leydig-like cells. Subsequent treatment with these newly differentiated cells led to

increased testosterone levels in EDS-treated rats

Hou et al[57] Human BM-MSCs In vitro Experimental - BM-MSCs were cultured in conditional medium with different concentrations of HMG/LH

Control - BMSCs were cultured in FBS in DMEM medium with normal sodium

Experimental culture medium induced the differentiation of BMSCs

into Leydig cells

Zhang et al[59] Rat SLCs In vitro SLCs were cultured in a seminiferous tubule model using media containing NGF. The proliferative

capacity of SLCs, along with testosterone production, and steroidogenic gene/protein expression was

measured

NGF significantly promoted the proliferation of stem Leydig cells and also induced steroidogenic enzyme

gene expression and 3β-HSD protein expression

Odeh et al[60] Rat SLCs In vitro SLCs were cultured on the surfaces of seminiferous tubules in a media containing PDGF-AA or PDGF-BB for up to 4 wk. SLC proliferation and differentiation

were measured

Both PDGF-AA and PDGF-BB stimulated SLC proliferation during the first week of culture. After this first week, PDGF-AA had a stimulatory effect on SLC differentiation. PDGF-BB began

inhibiting differentiation after this first week

Table 1 Summary of preclinical trials showing successful differentiation of various stem cell lines into steroidogenic Leydig-like cells



space of LH receptor knockout mice, yielded a time dependent production of testosterone in a hypogonadal murine model. Yet, these cells were derived from a side population and contained stem cells of multiple lineages including spermatogonial stem cells, SLCs, and possibly myoid stem cells. As in the previous study, it was difficult to determine which cell lineage led to the final end testosteronesecreting cell.

Yazawa et al[53] injected murine bone marrowderived mesenchymal cells (BMSCs) into murine testis and demonstrated their differentiation into Leydig cells. They also demonstrated that the same murine BMSCs, when cultured in vitro with steroidogenic factor 1 (SF1) followed by cAMP stimulation, underwent differentiation into Leydig cells. However, when this group cultured human BMSCs with SF1 followed by cAMP, the cells differentiated into humanderived steroidogenic cells that preferentially produced glucocorticoids, rather than testosterone. Furthermore, when the group injected human BMSCs into murine testis, the cells did not survive long enough for analysis. Researchers hypothesized that the differing steroidogenic products observed in the mouse and human BMSCs were due to heterogeneous populations of stem cells that had different differentiation potentials. Thus, the mouse BMSCs had already committed to the gonadal lineage, whereas the human BMSCs were already committed to the adrenal lineage. This group later demonstrated that human BMSC differentiation into steroidogenic cells was possible with cAMP and liver receptor homolog1 (LRH1), rather than cAMP and SF1, indicating another possible regulator of Leydig stem cell differentiation[54]. Interestingly, when this group used the method of SF1 and cAMP on umbilical cord bloodderived MSCs, these steroidogenic cells had similar characteristics of granulosaluteal cells[55]. These studies highlighted the fact that stem cells from multiple species have the potential to differentiate into different types of steroidogenic cells.

Yang et al[56] administered adiposederived mesenchymal stem cells (ADSCs) into the caudal vein of a Dgalactose aging rat model. Dgalactose accelerates aging and causes symptoms simulating natural senescence, thus creating an ideal pathophysiological model for evaluating stem cell therapy. This group found that ADSCs migrated to damaged areas of the testes, reduced the number of apoptotic Leydig cells, and

increased serum testosterone. The authors suggested that the ADSCs might prevent ROS production and reduce SLC apoptosis. Supporting this line of reasoning, they found that the increased testicular lipid peroxidation in the aged model was reversed by a subsequent increase in antioxidant enzymes after ADSC therapy. As has been observed in other disease states treated by ADSCs, the mechanism of action is more likely due to a secretion of cytokines and growth factors, with little direct effect on stem cell differentiation. As proof, only a few ADSCs differentiated into new Leydig cells based on labeling and 3βHSD expression, while serum testosterone concentrations increased progressively. The immunohistochemical results of the present study suggest that the treatment effect of ADSCs is mediated, at least in part, by a decrease in intracorporal tissue apoptosis and increase in sinusoidal endothelial cells.

Researchers have also been able to manipulate the hormonal milieu to induce the differentiation of human BMSCs into Leydig cells in vitro. By using a medium containing human menopausal gonadotropin/luteinizing hormone, hCG, plateletderived growth factor, and interleukin1a, they were able to promote the differentiation of human BMSCs into Leydig cells. However, the cells exhibited senescence and, thus, androgen decline after three weeks of culture. These results highlight the aforementioned problem that Leydig cells are mitotically inactive and that the primary immature Leydig cells lose their desired characteristics during prolonged cultures[57]. Using murine embryonic stem cells, one study used SF1, 8bromoadenosine3’,5’cyclic monophosphate (8BrcAMP), and forskolin to direct differentiation towards Leydig like cells. In vitro, these cells produced progesterone and testosterone. When injected into EDStreated rat testes, these cells improved serum testosterone levels. However, this research group was plagued by a difficulty in obtaining a large enough number Leydiglike cells given that they do not proliferate as readily as the undifferentiated cells[58]. Despite using different stem cells reservoirs, bone marrow, and embryonic stem cells, neither group was able to produce mitotically active Leydig cells.

And while there have been numerous studies evaluating the use of stem cells from various tissue origins to regenerate mature Leydig cells, few have attempted to reactivate SLCs. However, there are select studies that in exploring the mechanisms that underlie the SLC

Li et al[61] Rat SLCs In vitro SLCs were cultured on the surface of seminiferous tubules to assess the ability of factors from the

seminiferous tubules to regulate their proliferation and their subsequent entry into the Leydig cell lineage

SLC proliferation was stimulated by DHH, FGF2, PDGF, and activin.

Differentiation was activated by DHH, lithium-induced signaling,

and activin, and inhibited by TGF-β, PDGF-BB, and FGF2

BM-MSCs: Bone marrow-derived mesenchymal stem cells; AMCs: Adipose derived mesenchymal cells; BMCs: Bone marrow cells; UC-MSCs: Umbilical cord mesenchymal stem cells; ADSCs: Adipose-derived mesenchymal stem cells; ESCs: Embryonic stem cells; SLCs: Stem leydig cells; LH: Luteinizing hormone; HMG: Human menopausal gonadotropin; FBS: Fetal bovine serum; PDGF-AA: Platelet-derived growth factor alpha; DHH: Desert hedgehog; FGF: Fibroblast growth factor; LRH-1: Liver receptor homolog-1; SF-1: Steroidogenic factor-1; BSA: Bovine serum albumin; cAMP: Cyclic adenosine monophosphate; EDS: Ethane dimethanesulfonate; NGF: Nerve growth factor.



maturation process, have found growth factors that lead to reactivation. An initial study explored the role of nerve growth factor (NGF) during SLC differentiation[59]. They found that in an in vitro model, NGF significantly promoted the proliferation of SLCs and also induced steroidogenic enzyme gene expression and 3βHSD protein expression. Another group evaluated plateletderived growth factor alpha (PDGFAA) and beta (PDGFBB)[60]. They found that both ligands stimulated SLC proliferation during the first week of culture. After this first week, PDGFAA had a stimulatory effect on SLC differentiation. In contrast PDGFBB, began inhibiting differentiation after this first week. Corroborating some of the results of this study, another group developed an in vitro system of cultured seminiferous tubules to assess the ability of factors from the seminiferous tubules to regulate the proliferation and differentiation of SLCs[61]. SLC proliferation was stimulated by Desert hedgehog (DHH), basic fibroblast growth factor (FGF2), plateletderived growth factor (PDGF), and activin. Differentiation of the stem cells was activated by DHH, lithiuminduced signaling, and activin, and inhibited by TGFβ, PDGFBB, and FGF2. Building upon these initial studies, it will be necessary to evaluate these growth factors in an in vivo animal model.

CONCLUSIONThere appears to be two current directions for stem cell therapy in male primary hypogonadism. The first method involves differentiating adult Leydig cells from stem cells of various origins from bone marrow, adipose, or embryonic sources. The second method involves isolating, identifying, and transplanting SLCs into testicular tissue. The first method’s shortcomings that should be resolved in future studies include decoding and promoting stem cells to become testosteroneproducing steroidogenic cells and improving the mitotic activity of differentiated Leydig cells. One study compared steroidogenic cells from BMSC to those of umbilical cord mesenchymal stem cells and found that umbilical cord mesenchymal stem cells have a greater steroidogenic potential[62]. However, as previously mentioned, the addition of SF1 and cAMP in vitro to umbilical cord stem cells has been shown to yield cells resembling granulosaluteal cells, not Leydiglike cells[55]. Another study demonstrated that the addition of SF1 and cAMP to ADSCs yielded cells that preferentially produced corticosterone, rather than testosterone[63]. Undoubtedly much remains unknown about the cellular environment needed to produce specific steroidogenic cell types[64]. Additionally, this type of therapy may not be durable due to adult Leydig cell senescence and androgen production decline. Younger patients who have undergone premature Leydig cell dysfunction due to chemotherapy and radiation may find long-term success with the transplantation of cells with more regenerative capacity. Alternatively, in the aging population, it might be feasible to differentiate mesenchymal stem cells into

SLCs. If this strategy would address the issue of growth arrest, the use of mesenchymal stem cells may be in the best interest of these patients, whose SLCs are likely damaged. Finally, there are also concerns about the delivery of SF1, which is currently performed episomally or virally. Efforts are underway to determine a method of genefree delivery of inducing SF1 and LRH1 expression[64,65].

The second method for stem cell therapy involves the transplantation of SLCs into hypogonadal testicular tissue, with the idea that this therapy’s regenerative capacity will be selffulfilling and could be used for younger patients. However, it is currently troubled by the technique for identification and isolation of SLCs, which is in its infancy[66]. Additionally, if the transplant were to be autologous in these men, SLCs could be extracted prior to chemotherapy and radiation, as it is likely that these treatments irreversibly damage SLCs. However, another method that has been proposed includes harvesting SLCs in the hypogonadal male, and then amplifying and differentiating these cells into adult Leydig cells in vitro, then transplanting autologously into the same man[66]. Theoretically, the in vivo reactivation of SLCs in men with primary hypogonadism due to age would be an alternative method to treat hypogonadism, while eliminating the need for transplantation.

These proposed mechanisms all have the advantage of being subject to physiologic cues, standing in contrast to the current option of a lifetime of exogenously administered testosterone. Current and future research collaborations in the field of male hypogonadism and the regeneration of steroidogenic tissue will influence which modalities will become clinical realities for this patient population.

REFERENCES1 Bojesen A, Juul S, Gravholt CH. Prenatal and postnatal prevalence

of Klinefelter syndrome: a national registry study. J Clin Endocrinol Metab 2003; 88: 622-626 [PMID: 12574191 DOI: 10.1210/jc.2002-021491]

2 Mulligan T, Frick MF, Zuraw QC, Stemhagen A, McWhirter C. Prevalence of hypogonadism in males aged at least 45 years: the HIM study. Int J Clin Pract 2006; 60: 762-769 [PMID: 16846397 DOI: 10.1111/j1742-1241.2006.00992.x]

3 Yeap BB, Hyde Z, Almeida OP, Norman PE, Chubb SA, Jamrozik K, Flicker L, Hankey GJ. Lower testosterone levels predict incident stroke and transient ischemic attack in older men. J Clin Endocrinol Metab 2009; 94: 2353-2359 [PMID: 19351733 DOI: 10.1210/jc.2008-2416]

4 Araujo AB, Dixon JM, Suarez EA, Murad MH, Guey LT, Wittert GA. Clinical review: Endogenous testosterone and mortality in men: a systematic review and meta-analysis. J Clin Endocrinol Metab 2011; 96: 3007-3019 [PMID: 21816776 DOI: 10.1210/jc.2011-1137]

5 Levine GN, D’Amico AV, Berger P, Clark PE, Eckel RH, Keating NL, Milani RV, Sagalowsky AI, Smith MR, Zakai N. Androgen-deprivation therapy in prostate cancer and cardiovascular risk: a science advisory from the American Heart Association, American Cancer Society, and American Urological Association: endorsed by the American Society for Radiation Oncology. CA Cancer J Clin 2010; 60: 194-201 [PMID: 20124400 DOI: 10.3322/caac.20061]



6 Svechnikov K, Landreh L, Weisser J, Izzo G, Colón E, Svechnikova I, Söder O. Origin, development and regulation of human Leydig cells. Horm Res Paediatr 2010; 73: 93-101 [PMID: 20190545 DOI: 10.1159/000277141]

7 Habert R, Lejeune H, Saez JM. Origin, differentiation and regulation of fetal and adult Leydig cells. Mol Cell Endocrinol 2001; 179: 47-74 [PMID: 11420130 DOI: 10.1016/S0303-7207(01)00461-0]

8 Tapanainen J, Kellokumpu-Lehtinen P, Pelliniemi L, Huhtaniemi I. Age-related changes in endogenous steroids of human fetal testis during early and midpregnancy. J Clin Endocrinol Metab 1981; 52: 98-102 [PMID: 6450220 DOI: 10.1210/jcem-52-1-98]

9 Kremer H, Kraaij R, Toledo SP, Post M, Fridman JB, Hayashida CY, van Reen M, Milgrom E, Ropers HH, Mariman E. Male pseudohermaphroditism due to a homozygous missense mutation of the luteinizing hormone receptor gene. Nat Genet 1995; 9: 160-164 [PMID: 7719343 DOI: 10.1038/ng0295-160]

10 Rabinovici J, Jaffe RB. Development and regulation of growth and differentiated function in human and subhuman primate fetal gonads. Endocr Rev 1990; 11: 532-557 [PMID: 2292242 DOI: 10.1210/edrv-11-4-532]

11 Haider SG. Cell biology of Leydig cells in the testis. Int Rev Cytol 2004; 233: 181-241 [PMID: 15037365 DOI: 10.1016/S0074-7696(04)33005-6]

12 Prince FP. The triphasic nature of Leydig cell development in humans, and comments on nomenclature. J Endocrinol 2001; 168: 213-216 [PMID: 11182757 DOI: 10.1677/joe.0.1680213]

13 Nistal M, Paniagua R, Regadera J, Santamarìa L, Amat P. A quantitative morphological study of human Leydig cells from birth to adulthood. Cell Tissue Res 1986; 246: 229-236 [PMID: 3779804]

14 Prince FP. Ultrastructural evidence of mature Leydig cells and Leydig cell regression in the neonatal human testis. Anat Rec 1990; 228: 405-417 [PMID: 2178325 DOI: 10.1002/ar.1092280406]

15 Chemes HE, Gottlieb SE, Pasqualini T, Domenichini E, Rivarola MA, Bergadá C. Response to acute hCG stimulation and steroidogenic potential of Leydig cell fibroblastic precursors in humans. J Androl 1985; 6: 102-112 [PMID: 3886616]

16 Molenaar R, de Rooij DG, Rommerts FF, Reuvers PJ, van der Molen HJ. Specific destruction of Leydig cells in mature rats after in vivo administration of ethane dimethyl sulfonate. Biol Reprod 1985; 33: 1213-1222 [PMID: 3000465 DOI: 10.1095/biolreprod33.5.1213]

17 Kerr JB, Donachie K, Rommerts FF. Selective destruction and regeneration of rat Leydig cells in vivo. A new method for the study of seminiferous tubular-interstitial tissue interaction. Cell Tissue Res 1985; 242: 145-156 [PMID: 4042133]

18 Chen H, Huhtaniemi I, Zirkin BR. Depletion and repopulation of Leydig cells in the testes of aging brown Norway rats. Endocrinology 1996; 137 : 3447-3452 [PMID: 8754773 DOI: 10.1210/endo.137.8.8754773]

19 Stanley E, Lin CY, Jin S, Liu J, Sottas CM, Ge R, Zirkin BR, Chen H. Identification, proliferation, and differentiation of adult Leydig stem cells. Endocrinology 2012; 153: 5002-5010 [PMID: 22865373 DOI: 10.1210/en.2012-1417]

20 Davidoff MS, Middendorff R, Müller D, Holstein AF. The neuroendocrine Leydig cells and their stem cell progenitors, the pericytes. Adv Anat Embryol Cell Biol 2009; 205: 1-107 [PMID: 19711572]

21 Kerr JB, Bartlett JM, Donachie K, Sharpe RM. Origin of regenerating Leydig cells in the testis of the adult rat. An ultrastructural, morphometric and hormonal assay study. Cell Tissue Res 1987; 249: 367-377 [PMID: 3040255 DOI: 10.1007/BF00215521]

22 Davidoff MS, Middendorff R, Enikolopov G, Riethmacher D, Holstein AF, Müller D. Progenitor cells of the testosterone-producing Leydig cells revealed. J Cell Biol 2004; 167: 935-944 [PMID: 15569711 DOI: 10.1083/jcb.200409107]

23 Ge RS, Dong Q, Sottas CM, Papadopoulos V, Zirkin BR, Hardy MP. In search of rat stem Leydig cells: identification, isolation, and lineage-specific development. Proc Natl Acad Sci USA 2006; 103: 2719-2724 [PMID: 16467141 DOI: 10.1073/pnas.0507692103]

24 Landreh L, Stukenborg JB, Söder O, Svechnikov K. Phenotype and steroidogenic potential of PDGFRα-positive rat neonatal

peritubular cells. Mol Cell Endocrinol 2013; 372: 96-104 [PMID: 23545158 DOI: 10.1016/j.mce.2013.03.019]

25 Cigorraga SB, Chemes H, Pellizzari E. Steroidogenic and morphogenic characteristics of human peritubular cells in culture. Biol Reprod 1994; 51: 1193-1205 [PMID: 7888497 DOI: 10.1095/biolreprod51.6.1193]

26 Schell C, Albrecht M, Mayer C, Schwarzer JU, Frungieri MB, Mayerhofer A. Exploring human testicular peritubular cells: identification of secretory products and regulation by tumor necrosis factor-alpha. Endocrinology 2008; 149: 1678-1686 [PMID: 18187550 DOI: 10.1210/en.2007-1064]

27 Landreh L, Spinnler K, Schubert K, Häkkinen MR, Auriola S, Poutanen M, Söder O, Svechnikov K, Mayerhofer A. Human testicular peritubular cells host putative stem Leydig cells with steroidogenic capacity. J Clin Endocrinol Metab 2014; 99: E1227-E1235 [PMID: 24684461 DOI: 10.1210/jc.2013-4199]

28 Chen H, Stanley E, Jin S, Zirkin BR. Stem Leydig cells: from fetal to aged animals. Birth Defects Res C Embryo Today 2010; 90: 272-283 [PMID: 21181888 DOI: 10.1002/bdrc.20192]

29 O’Shaughnessy PJ, Morris ID, Baker PJ. Leydig cell re-generation and expression of cell signaling molecules in the germ cell-free testis. Reproduction 2008; 135: 851-858 [PMID: 18502897 DOI: 10.1530/REP-07-0529]

30 Yan W, Kero J, Huhtaniemi I, Toppari J. Stem cell factor functions as a survival factor for mature Leydig cells and a growth factor for precursor Leydig cells after ethylene dimethane sulfonate treatment: implication of a role of the stem cell factor/c-Kit system in Leydig cell development. Dev Biol 2000; 227: 169-182 [PMID: 11076685 DOI: 10.1006/dbio.2000.9885]

31 D’Aurora M, Ferlin A, Di Nicola M, Garolla A, De Toni L, Franchi S, Palka G, Foresta C, Stuppia L, Gatta V. Deregulation of sertoli and leydig cells function in patients with Klinefelter syndrome as evidenced by testis transcriptome analysis. BMC Genomics 2015; 16: 156 [PMID: 25879484 DOI: 10.1186/s12864-015-1356-0]

32 Tuttelmann F, Damm OS, Luetjens CM, Baldi M, Zitzmann M, Kliesch S, Nieschlag E, Gromoll J, Wistuba J, Simoni M. Intratesticular testosterone is increased in men with Klinefelter syndrome and may not be released into the bloodstream owing to altered testicular vascularization- a preliminary report. Andrology 2014; 2: 275-281 [PMID: 24574169 DOI: 10.1111/j.2047-927.2014.00190.x]

33 Chen H, Hardy MP, Huhtaniemi I, Zirkin BR. Age-related decreased Leydig cell testosterone production in the brown Norway rat. J Androl 1994; 15: 551-557 [PMID: 7721657 DOI: 10.1002/j.1939-4640.1994.tb00498.x]

34 Sokanovic SJ, Janjic MM, Stojkov NJ, Baburski AZ, Bjelic MM, Andric SA, Kostic TS. Age related changes of cAMP and MAPK signaling in Leydig cells of Wistar rats. Exp Gerontol 2014; 58: 19-29 [PMID: 25019473 DOI: 10.1016/j.exger.2014.07.004]

35 Wang C, Sinha Hikim AP, Lue YH, Leung A, Baravarian S, Swerdloff RS. Reproductive aging in the Brown Norway rat is characterized by accelerated germ cell apoptosis and is not altered by luteinizing hormone replacement. J Androl 1999; 20: 509-518 [PMID: 10452595 DOI: 10.1002/j.1939-4640.1999.tb02550.x]

36 Chen H, Ge RS, Zirkin BR. Leydig cells: From stem cells to aging. Mol Cell Endocrinol 2009; 306: 9-16 [PMID: 19481681 DOI: 10.1016/j.mce.2009.01.023]

37 Chen H, Liu J, Luo L, Zirkin BR. Dibutyryl cyclic adenosine monophosphate restores the ability of aged Leydig cells to produce testosterone at the high levels characteristic of young cells. Endocrinology 2004; 145: 4441-4446 [PMID: 15231695 DOI: 10.1210/en.2004-0639]

38 Chen H, Cangello D, Benson S, Folmer J, Zhu H, Trush MA, Zirkin BR. Age-related increase in mitochondrial superoxide generation in the testosterone-producing cells of Brown Norway rat testes: relationship to reduced steroidogenic function? Exp Gerontol 2001; 36: 1361-1373 [PMID: 11602210 DOI: 10.1016/S0531-5565(01)00118-8]

39 Chen H, Irizarry RA, Luo L, Zirkin BR. Leydig cell gene expression: effects of age and caloric restriction. Exp Gerontol 2004; 39: 31-43 [PMID: 14724062 DOI: 10.1016/j.exger.2003.09.021]



40 Duan T, Fan K, Chen S, Yao Q, Zeng R, Hong Z, Peng L, Shao Y, Yao B. Role of peroxiredoxin 2 in H2O2-induced oxidative stress of primary Leydig cells. Mol Med Rep 2016; 13: 4807-4813 [PMID: 27082744 DOI: 10.3892/mmr.2016.5147]

41 Matzkin ME, Miquet JG, Fang Y, Hill CM, Turyn D, Calandra RS, Bartke A, Frungieri MB. Alterations in oxidative, inflammatory and apoptotic events in short-lived and long-lived mice testes. Aging (Albany NY) 2016; 8: 95-110 [PMID: 26805572 DOI: 10.18632/aging.100875]

42 Cao L, Leers-Sucheta S, Azhar S. Aging alters the functional expression of enzymatic and non-enzymatic anti-oxidant defense systems in testicular rat Leydig cells. J Steroid Biochem Mol Biol 2004; 88: 61-67 [PMID: 15026084 DOI: 10.1016/j.jsbmb.2003.10.007]

43 Ronco AM, Moraga PF, Llanos MN. Arachidonic acid release from rat Leydig cells: the involvement of G protein, phospholipase A2 and regulation of cAMP production. J Endocrinol 2002; 172: 95-104 [PMID: 11786377 DOI: 10.1677/joe.0.1720095]

44 Wang XJ, Dyson MT, Mondillo C, Patrignani Z, Pignataro O, Stocco DM. Interaction between arachidonic acid and cAMP signaling pathways enhances steroidogenesis and StAR gene expression in MA-10 Leydig tumor cells. Mol Cell Endocrinol 2002; 188: 55-63 [PMID: 11911946 DOI: 10.1016/S0303-7207(01)00748-1]

45 Chen H, Luo L, Liu J, Zirkin BR. Cyclooxygenases in rat Leydig cells: effects of luteinizing hormone and aging. Endocrinology 2007; 148: 735-742 [PMID: 17068133 DOI: 10.1210/en.2006-0925]

46 Abidi P, Zhang H, Zaidi SM, Shen WJ, Leers-Sucheta S, Cortez Y, Han J, Azhar S. Oxidative stress-induced inhibition of adrenal steroidogenesis requires participation of p38 mitogen-activated protein kinase signaling pathway. J Endocrinol 2008; 198: 193-207 [PMID: 18417530 DOI: 10.1677/JOE-07-0570]

47 Nakamura T, Sakamoto K. Reactive oxygen species up-regulates cyclooxygenase-2, p53, and Bax mRNA expression in bovine luteal cells. Biochem Biophys Res Commun 2001; 284: 203-210 [PMID: 11374891 DOI: 10.1006/bbrc.2001.4927]

48 Al-Bader M, Kilarkaje N. Effects of bleomycin, etoposide and cisplatin treatment on Leydig cell structure and transcription of steroidogenic enzymes in rat testis. Eur J Pharmacol 2015; 747: 150-159 [PMID: 25523482 DOI: 10.1016/j.ejphar.2014.12.006]

49 Rone MB, Fan J, Papadopoulos V. Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states. Biochim Biophys Acta 2009; 1791: 646-658 [PMID: 19286473 DOI: 10.1016/j.bbalip.2009.03.001]

50 Sivakumar R, Sivaraman PB, Mohan-Babu N, Jainul-Abideen IM, Kalliyappan P, Balasubramanian K. Radiation exposure impairs luteinizing hormone signal transduction and steroidogenesis in cultured human leydig cells. Toxicol Sci 2006; 91: 550-556 [PMID: 16569731 DOI: 10.1093/toxsci/kfj178]

51 Lue Y, Erkkila K, Liu PY, Ma K, Wang C, Hikim AS, Swerdloff RS. Fate of bone marrow stem cells transplanted into the testis: potential implication for men with testicular failure. Am J Pathol 2007; 170: 899-908 [PMID: 17322375 DOI: 10.2353/ajpath.2007.060543]

52 Lo KC, Lei Z, Rao ChV, Beck J, Lamb DJ. De novo testosterone production in luteinizing hormone receptor knockout mice after transplantation of leydig stem cells. Endocrinology 2004; 145: 4011-4015 [PMID: 15123536 DOI: 10.1210/en.2003-1729]

53 Yazawa T, Mizutani T, Yamada K, Kawata H, Sekiguchi T, Yoshino M, Kajitani T, Shou Z, Umezawa A, Miyamoto K. Differentiation of adult stem cells derived from bone marrow stroma into Leydig or

adrenocortical cells. Endocrinology 2006; 147: 4104-4111 [PMID: 16728492 DOI: 10.1210/en.2006-0162]

54 Yazawa T, Inanoka Y, Mizutani T, Kuribayashi M, Umezawa A, Miyamoto K. Liver receptor homolog-1 regulates the transcription of steroidogenic enzymes and induces the differentiation of mesenchymal stem cells into steroidogenic cells. Endocrinology 2009; 150: 3885-3893 [PMID: 19359379 DOI: 10.1210/en.2008-1310]

55 Yazawa T, Inaoka Y, Okada R, Mizutani T, Yamazaki Y, Usami Y, Kuribayashi M, Orisaka M, Umezawa A, Miyamoto K. PPAR-gamma coactivator-1alpha regulates progesterone production in ovarian granulosa cells with SF-1 and LRH-1. Mol Endocrinol 2010; 24: 485-496 [PMID: 20133449 DOI: 10.1210/me.2009-0352]

56 Yang C, Du YK, Wang J, Luan P, Yang QL, Huang WH, Yuan L. Transplanted Adipose-Derived Stem Cells Ameliorate Testicular Dysfunction In A D-Galactose-Induced Aging Rat Model. J Cell Physiol 2015; 230: 2403-2414 [PMID: 25728126 DOI: 10.1002/jcp.24970]

57 Hou L, Dong Q, Wu YJ, Sun YX, Guo YY, Huo YH. Gonadotropins facilitate potential differentiation of human bone marrow mesenchymal stem cells into Leydig cells in vitro. Kaohsiung J Med Sci 2016; 32: 1-9 [PMID: 26853168 DOI: 10.1016/j.kjms.2015.10.008]

58 Yang Y, Su Z, Xu W, Luo J, Liang R, Xiang Q, Zhang Q, Ge RS, Huang Y. Directed mouse embryonic stem cells into leydig-like cells rescue testosterone-deficient male rats in vivo. Stem Cells Dev 2015; 24: 459-470 [PMID: 25340537 DOI: 10.1089/scd.2014.0370]

59 Zhang L, Wang H, Yang Y, Liu H, Zhang Q, Xiang Q, Ge R, Su Z, Huang Y. NGF induces adult stem Leydig cells to proliferate and differentiate during Leydig cell regeneration. Biochem Biophys Res Commun 2013; 436: 300-305 [PMID: 23743199 DOI: 10.1016/j.bbrc.2013.05.098]

60 Odeh HM, Kleinguetl C, Ge R, Zirkin BR, Chen H. Regulation of the proliferation and differentiation of Leydig stem cells in the adult testis. Biol Reprod 2014; 90: 123 [PMID: 24740597 DOI: 10.1095/biolreprod.114.117473]

61 Li X, Wang Z, Jiang Z, Guo J, Zhang Y, Li C, Chung J, Folmer J, Liu J, Lian Q, Ge R, Zirkin BR, Chen H. Regulation of semini-ferous tubule-associated stem Leydig cells in adult rat testes. Proc Natl Acad Sci USA 2016; 113: 2666-2671 [PMID: 26929346 DOI: 10.1073/pnas.1519395113]

62 Wei X, Peng G, Zheng S, Wu X. Differentiation of umbilical cord mesenchymal stem cells into steroidogenic cells in comparison to bone marrow mesenchymal stem cells. Cell Prolif 2012; 45: 101-110 [PMID: 22324479 DOI: 10.1111/j.1365-2184.2012.00809.x]

63 Gondo S, Okabe T, Tanaka T, Morinaga H, Nomura M, Takayanagi R, Nawata H, Yanase T. Adipose tissue-derived and bone marrow-derived mesenchymal cells develop into different lineage of steroidogenic cells by forced expression of steroidogenic factor 1. Endocrinology 2008; 149: 4717-4725 [PMID: 18566117 DOI: 10.1210/en.2007-1808]

64 Yazawa T, Imamichi Y, Miyamoto K, Umezawa A, Taniguchi T. Differentiation of mesenchymal stem cells into gonad and adrenal steroidogenic cells. World J Stem Cells 2014; 6: 203-212 [PMID: 24772247 DOI: 10.4252/wjsc.v6.i2.203]

65 Ruiz-Babot G, Hadjidemetriou I, King PJ, Guasti L. New directions for the treatment of adrenal insufficiency. Front Endocrinol (Lausanne) 2015; 6: 70 [PMID: 25999916 DOI: 10.3389/fendo.2015.00070]

66 Zhang Y, Ge R, Hardy MP. Androgen-forming stem Leydig cells: identification, function and therapeutic potential. Dis Markers 2008; 24: 277-286 [PMID: 18525122 DOI: 10.1155/2008/905025]

P- Reviewer: Chen LY, Zhang Q, Zou ZM S- Editor: Qiu S L- Editor: A E- Editor: Wu HL


REVIEW


Update on acute myeloid leukemia stem cells: New discoveries and therapeutic opportunities

Maximilian Stahl, Tae Kon Kim, Amer M Zeidan, Section of Hematology, Department of Internal Medicine, Yale School of Medicine, New Haven, CT 06510-3222, United States

Author contributions: Stahl M and Zeidan AM wrote the first draft of the manuscript; Stahl M, Kim TK and Zeidan AM edited the manuscript.

Conflict-of-interest statement: Amer M Zeidan receives Honoraria from Ariad, Pfizer, Incyte and Celgene. Maximilian Stahl and Tae Kon Kim have no conflict of interests to declare for this article.



Correspondence to: Amer M Zeidan, MBBS, Assistant Professor, Section of Hematology, Department of Internal Medicine, Yale School of Medicine, 300 George Street, New Haven, CT 06510-3222, United States. [email protected]: +1-203-2004363Fax: +1-203-2002360

Received: May 23, 2016 Peer-review started: May 23, 2016 First decision: July 6, 2016Revised: August 11, 2016 Accepted: August 27, 2016Article in press: August 29, 2016Published online: October 26, 2016

AbstractThe existence of cancer stem cells has been well




established in acute myeloid leukemia. Initial proof of the existence of leukemia stem cells (LSCs) was accomplished by functional studies in xenograft models making use of the key features shared with normal hematopoietic stem cells (HSCs) such as the capacity of self-renewal and the ability to initiate and sustain growth of progenitors in vivo . Significant progress has also been made in identifying the phenotype and signaling pathways specific for LSCs. Therapeutically, a multitude of drugs targeting LSCs are in different phases of preclinical and clinical development. This review focuses on recent discoveries which have advanced our understanding of LSC biology and provided rational targets for development of novel therapeutic agents. One of the major challenges is how to target the self-renewal pathways of LSCs without affecting normal HSCs significantly therefore providing an acceptable therapeutic window. Important issues pertinent to the successful design and conduct of clinical trials evaluating drugs targeting LSCs will be discussed as well.

Key words: Leukemia stem cells; Cancer stem cells; Acute myeloid leukemia; Stem cell niche; Xenotrans-plantation; Plerixafor; NF-kB; C-X-C chemokine receptor type 4


Core tip: Leukemia stem cell (LSC) directed therapy targets: (1) Cell surface markers expressed on LSC: CD33, CD44, CD123, CD47, etc. ; (2) Crucial pathways for maintenance of their stemness: NF-kB, PI3K/AKT/mTOR and bcl-2; and (3) Interactions between LSC in the bone marrow niche: LSC mobilization with granulocyte-colony stimulating factor and inhibition of LSC homing to the bone marrow by interrupting the C-X-C chemokine receptor type 4-CXCL12 and VCAM-VLA4 axis.

Maximilian Stahl, Tae Kon Kim, Amer M Zeidan


Stahl M et al . AML stem cells

Stahl M, Kim TK, Zeidan AM. Update on acute myeloid leukemia stem cells: New discoveries and therapeutic opportuni-ties. World J Stem Cells 2016; 8(10): 316-331 Available from: URL: http://www.wjgnet.com/1948-0210/full/v8/i10/316.htm DOI: http://dx.doi.org/10.4252/wjsc.v8.i10.316

INTRODUCTIONDespite extensive research efforts in myeloid malignancies, minimal progress has been made in introducing new effective treatment strategies for acute myeloid leukemia (AML) since the introduction of the anthracyclinecytarabine combination chemotherapy regimens (known as 7 + 3) more than 40 years ago[1]. Despite achieving complete remission (CR) with intensive induction chemotherapy in about 70% of patients with AML, relapse is frequent and the rate of 5year disease free survival is only about 30%40%. It has been long proposed that the high rate of relapse is due to the persistence of a rare subset of malignant cells that are not effectively eliminated by current treatment regimens, the so called leukemia stem cells (LSCs)[24]. LSC were first identified but tumor cells with stem celllike behavior were later found to be also present in a variety of solid tumors[59]. LSC remain the best studied and characterized cancer stem cell (CSC) due to the easy accessibility of tumor tissue for (i.e., blood and bone marrow) and the availability of a number of cell surface markers that allow their prospective identification and isolation by flow cytometry followed by assays to examine their function both in vitro and in vivo[10]. This review will focus on the biology of LSC, the impact they have on current leukemia diagnosis and prognosis and treatment as well as future directions of leukemia therapy based on targeting LSC[6].

CSC VS CLONAL EVOLUTION THEORYIt is now well understood that not only tumors from different patients but also cells within a single tumor are characterized by heterogeneity in terms of the morphology, cell surface markers, genetic variations and response to therapy[11]. Why there is significant variation in genetic and epigenetic abnormalities between different cells or locations within a tumor despite the clonal origin of all tumor cells, is a question that has puzzled researchers for decades. There are essentially two different explanations for this fundamental problem of cancer biology: The hierarchy or CSC model vs the stochastic or clonal evolution model[6]. In the stochastic model, all cells in a tumor have a similar biological function but are heterogeneous (e.g., expression of cell surface markers) because of clonal evolution resulting in small but entirely random/stochastic variations triggered by external and internal factors based on Darwinian principles. Importantly, all cells within the tumor have an equal sensitivity to both

intrinsic (transcription factors and signaling pathways) and extrinsic (host factors, tumor microenvironment and immune response) factors[10]. In the cancer stem cell (CSC) model, a tumor follows the principles of normal, healthy tissue development with a stem cell at the top of the hierarchy, which gives rise to all other cells in the tumor. In this model only these rare population of CSCs are able to initiate tumor growth: They possess selfrenewal capacity and can be isolated from the bulk nontumorigenic population. Importantly, both models appreciate the existence of a CSC but differ in their assessment what cells within the tumor can be CSCs. In the stochastic model CSCs are created randomly and every cell has the potential to be a CSC, whereas in the CSC model only a subset of cancer cells has the potential to behave like a stem cell[11].

Whether the stochastic model or the CSC model best reflects tumorigenesis/leukemogenesis, has significant impact on how cancer/leukemia should be treated[10]. In the stochastic model, the cells within a tumor are relatively homogeneous in terms of genetic makeup and function and therapy can be uniformly directed at the bulk of tumor cells. However, per the CSC model, tumorigenic pathways might operate differently in CSCs compared with the bulk cells and therapy must specifically target the CSCs in order to be truly effective. Most of the current targeted therapies against leukemia and cancer focuses on inhibiting the molecular drivers found in all cancer cells but do not necessarily target CSCs[11].

BIOLOGY OF LSCS CSC characteristicsThe definition of a LSC is adapted from normal HSC: It is a cell that possesses the capacity to selfrenew, proliferates and gives rise to leukemic blasts, which are morphologically homogeneous but biologically heterogeneous[12]. Apart from selfrenewal potential, dormancy/quiescence and a protective stem cell niche are shared characteristics between HSCs and LSCs.

Self-renewal capacity: As the definition of CSCs is a functional definition, CSCs can thus only be defined experimentally by their ability to recapitulate the generation of a continuously growing tumor. Immunodeficient mice, such as the non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mouse and newer generations of xenograft models, are used to functionally define human hematopoietic stem and progenitor cells as well as LSCs[13]. Longterm repopulating cells, thought to be LSC are able to be successfully engrafted in these mice over prolonged periods as well as in secondary recipients[2,14]. Bonnet et al[15] in the John Dick laboratory isolated subpopulations of cells from primary human AML bone marrow based on their immunophenotype and xenotransplanted them into NOD/SCID mice. It demonstrated that the CD34+CD38 expressing subpopulation of AML cells


were capable of being serially transplanted in these immunodeficient mice[15,16]. Reflecting the emphasis on functional assessment, these cells were named as SCID leukemiainitiating cells (SLIC) and are considered the equivalent of LSC.

Symmetrical vs asymmetrical cell division: Similar to HSCs, LSCs have the ability to undergo symmetrical selfrenewing cell division, generating identical daughter stem cells that retain selfrenewal capacity (expansion), or an asymmetrical selfrenewing cell division, resulting in one stem cell and one more differentiated progenitor cell (maintenance)[12,1719]. Normal stem cells are able to switch between symmetrical and asymmetrical division based on the demands of the tissue they are meant to maintain. During early embryogenesis normal stem cells undergo symmetrical cell division in order to expand the total pool of stem cells giving rise to tissues whereas in adult tissues stem cells give rise to mature cells though asymmetrical cell division[19,20]. There is increasing amount of evidence that in CSCs this delicate balance seems to be disturbed in favor of symmetric cell division[19,21,22]. For example, CSCs isolated from ERBB2expressing breast cancer have been demonstrated to prefer symmetric cell division compared to normal breast tissue stem cells[23]. Furthermore, the adenomatous polyposis coli tumor suppressor gene (APC) has been shown to paly a major role in regulating asymmetric cell division in drosophila and its mutational loss is suspected to lead to an expansion of CSCs by symmetric cell division[22,24,25].

Stem cell quiescence and exhaustion: Normal stem cells need to be quiescent to avoid exhaustion of a stem cell pool and to minimize the risk of oncogenic events[26]. In fact, stem cell exhaustion has been described as one reason for aging and as a consequence of the attempt of the body to prevent the development of cancer[27]. Aging leads to an accumulation of DNA damage in all cells of the body, including stem cells, which in turn leads to an increased risk of developing cancer. Aging stem cells are affected by sophisticated mechanisms cells have developed to suppress the development of cancer, mainly induction of senescence and apoptosis, which are mediated through telomere shortening and activation of tumor suppressor genes p16 and p53[2830]. The diminished ability of aging HSC to reconstitute the hematopoietic system is demonstrated by prolonged myelosuppression after cytotoxic chemotherapy in older patients as well as age of the stem cell donor being significantly associated with overall and diseasefree survival after hematopoietic stem cell transplant[31,32].

However, normal stem cells are also required to continuously replenish the cells that are lost in a tissue. In order to fulfill both purposes-avoid exhaustion as well as maintaining the cellular integrity of a tissuestem cells undergo asymmetric cell divisions, which give rise to another stem cell as well as a rapidly dividing progenitor cells. These progenitor cells proliferate quickly for a

limited amount of cell divisions and regenerate all cells in a tissue[33,34].

Similarly, LSCs are quiescent, which explains the difficulties to eradicate LSCs with standard chemotherapies that preferentially target rapid proliferating cells[3537].

Key signaling pathways relevant for retaining stemness: Similar signaling pathways involved in the control of selfrenewal of HSCs are also key elements maintaining stemness in LSCs (Figure 1). Among many others, these pathways include PI3K/Akt/mTOR[38], Wnt/betacatenin[39,40], Hedgehog[41,42], NFkB[43,44], Notch[45] and Bcl2[46,47]. Several drugs targeting these pathways are in different stages of preclinical and clinical development (Figure 1).

Stem cell niche: The bone marrow niche is quintessential for normal HSC to maintain their quiescence but at the same time enable HSC to generate cells in the blood stream to meet the organism’s needs[48]. The stem cell niche is formed by a complex network of different cells including vascular endothelial cells, perivascular mesenchymal cells, megakaryocytes, osteoblastic lineage cells, macrophages and nerve cells[4953]. Dysregulation of the bone marrow niche plays an important role in preventing the detection of LSC by the immune system and protecting LSC from the effects of chemotherapy[48,54]. Similar to normal HSCs, LSCs are retained in the marrow niche by interactions between CXCR4, on stem cells, and CXCL12 (SDF1), on osteoblasts and mesenchymal cells in the bone marrow niche[55,56]. Chemokine interactions through CXCL12 can lead to upregulation of vascular cell adhesion molecule1 (VCAM1) and very late antigen4 (VLA4) expression, which further strengthen LSC retention in the marrow niche[57,58] (Figure 1). The significance of the interaction between LSCs and the protective bone marrow niche is exemplified by the fact that elevated levels of CXCR4 and VLA4 have been associated with poor response to chemotherapy and decreased survival[5961]. Several therapeutic approaches attempt to break the dormancy of LSCs by induction of stem cell cycling with granulocytecolony stimulating factor (GCSF) and inhibition of the CXCR4SDF1 axis involved in LSC retention in the protective bone marrow niche[62,63] (Figure 1).

Identification of LSCs by surface markers Recent studies have shown that LSCs may reside not only in CD34+CD38, but also in CD34+CD38+ and CD34 CD38+ compartments demonstrating the lack of a definitive phenotype for LSCs[6466]. Several studies have shown that the CD34+CD38+ fraction has repopulating ability when immunosuppression is applied[18,67,68]. It was demonstrated that by treating mice with immunosuppressive antibodies, the CD34+CD38+ fraction of AML samples is able to initiate leukemia in immunodeficient mice[64]. Furthermore, by transplanting sorted



fractions of primary NPMmutated AML into immunodeficient mice, it was shown that approximately onehalf of cases had LICs exclusively within the CD34 fraction, whereas the CD34+ fraction contained normal multilineage hematopoietic repopulating cells[66]. Most of the remaining cases had LICs in both CD34+ and CD34 fractions and when samples were sorted based on CD34 and CD38 expression, multiple fractions initiated leukemia in primary and secondary recipients (Table 1).

Heterogeneity within the LSC populationOver the last years several groups have found a wide variety of other markers that appear to be expressed higher in LSCs than normal HSCs[14].

These include CD123, CD96, CLL1, TIM3, CD33, CD13, CD44, CD47 and others[6975] (Table 1). In essence, these studies suggest that leukemogenic activity is not restricted to the CD34+CD38 fraction and there is heterogeneity among patients in leukemogenic cell phenotype. Over the last years, there has been significant advancement in the understanding of the

complexity and heterogeneity of human LSC. Several important observations have been made along the way of discovery.

LSC heterogeneity within a patient: First, there is heterogeneity of the stem cell population within the same patient as not all LSC have the same selfrenewal capacity[10,76]. Use of lentiviral gene marking to track the behavior of individual leukemia initiating cells following serial transplantation has revealed heterogeneity in their ability to repopulate secondary and tertiary recipients and this enabled researchers to classify long term (LTLSC) and short term (STLSC) LSCs[76,77]. LTLSCs are defined by a longtermed persistence in xenotransplantion models given an extensive selfrenewal capacity while STLSCs have a reduced selfrenewal capacity and only a transient repopulation capability in xenotransplantation models.

LSC heterogeneity based on the specific xeno-transplantation model used: The LSC phenotype

Gemtuzumab ozogamicin(mylotarg)Hu5F9-G4

Bortezomib

Parthenolidecelastrol

4-hydroxy-2-nonenal

BKM120CAL-101

GSK21110183MK-2206Perifosine

Sirolimus,everolimus,temsirolimus

OblimersenObatoclax

H90A3D8

CSL360DT388IL3/SL-401MGD006/S80880

Natalizumab

StromalcellVCAM-1

VLA-4

CXCR-4SDF

Homing of LSC inthe bone marrow

niche

Oste

oblas

t

PlerixaforAMD3465

BMS-936564

G-CSF

G-CSF

Blood vesselsEndothelial cells

Bringing LSC in cycle

GCSF-R

CD47

CD33CD44

CD123

Bcl-2IkBa

NF-kBmTOR

PI3K

AKT

Proteasome

Therapy targeting LSC surface markers

Therapy targeting signal transduction

Therapy targeting LSC microenvironment

Figure 1 Leukemia stem cells biology and selected therapeutic strategies/agents targeting leukemia stem cell. Leukemia stem cells (LSC) directed therapy targets cell surface markers expressed on LSC (grey boxes), crucial pathways for maintenance of stemness (orange boxes) and interactions between LSC and the bone marrow niche (white boxes). Important LSC surface markers are CD33, CD44, CD123, CD47. Essential pathways are NF-κB, PI3K/AKT/mTOR and bcl-2. LSC mobilization is accomplished with G-CSF and LSC homing to the bone marrow is regulated by the CXCR4–CXCL12 and VCAM-VLA4 axis. VCAM-1: Vascular cell adhesion protein-1; VLA-4: Very late antigen-4; CXCR4: C-X-C chemokine receptor type 4; SDF: Stromal cell-derived factor 1; PI3K: Phosphatidylinositol-4,5-bisphosphate 3-kinase; AKT: Protein kinase B; mTOR: Mechanistic target of rapamycin; bcl-2: B-cell lymphoma 2; G-CSF: Granulocyte-colony stimulating factor.



depends on what mouse model is used for functional assessment of stem cell properties of human AML cells[14] (Table 1). The bone marrow niche in mice differ from that of humans in terms of architecture, stromal cells, cytokines, growth factors, adhesion molecules and most importantly the immune cell composition, which potentially impairs growth of human HSC or LSC in the mouse bone marrow[78]. Normal HSCs and LSC are therefore more likely to be detected in more highly immunodeficient mice. As different xenotransplantation mouse models display different levels of immunodeficiency they are associated with different levels of engraftment of normal human HSCs and LSCs[6,14]. In nude mice T cells are absent whereas in severe combined immunodeficiency mice (SCID mice) both B and T cells are inactivated. NOD/SCID mice, which harbor defects in T, B, and macrophage activity, support higher levels of human engraftment[14]. NOD/SCID gamma (NSG) mice have almost no murine immune system left as a complete null mutation in the gene encoding the interleukin 2receptor gamma chain blocks NK cell differentiation[79]. Similarly, NK cells can be depleted by treating NOD/SCID mice with antiCD122 antibodies[80]. In creating a supportive bone marrow niche for engraftment of human AML cells not only a suppression of the hosts immune system is essential but

also a recreation of the cytokine environment supporting stem cell selfrenewal and quiescence[14]. This has led to the development of mice models that express human cytokines like human SCF, GMSCF, IL3 and TPO[13,81].

LSC heterogeneity between patients: It has become increasingly evident that the LSC phenotype varies between patients based on the specific subtype of leukemia that they suffer from (Table 1). As mentioned above, the majority of AML cells express CD34, however in AML cells carrying a mutation in NPM1 the CD34+ percentage is very low and LSC activity is exclusively restricted to the CD34 population[66]. Furthermore, specific subtypes of AML (in particular less aggressive subtypes) are significantly more difficult to be engrafted as they may have low progenitor cell frequency or are particularly sensitive to a specific cytokine or cell type missing in the particular xenotransplantation model[14]. For example, AML samples with a t(8;21) translocation were shown to be difficult to be engrafted and found to be dependent on signaling though the TPO/mpl pathway[82,83]. Subsequently, human TPO knockin mice were shown to have improved engraftment for t(8;21) AML samples[84].

Cell of origin of LSCsIt is important to distinguish the concept of the cell of origin from the CSC[10]. The CSC has stem cell like properties and is capable of initiating and sustaining tumor growth, whereas the cell of origin refers to the normal cell in which the initial transforming event occurs. Importantly, cancer and LSCs do not have to arise from a normal stem cell, in fact, it is not entirely clear what the cell of origin for most LSCs is[11,12]. One hypothesis is that LSCs are only able to arise from normal HSCs but not from committed progenitor cells[10,15]. This theory is supported by the observation that LSCs and HSCs share many characteristics like selfrenewal capacity controlled by genes like Bmi1 and PTEN and quiescence[35,85,86]. On the contrary, transformation might occur in a variety of cell types in the hematopoietic hierarchy, including HSCs and committed progenitors[10,87]. Experimental evidence in mice shows that LSCs may arise either through neoplastic changes initiated in normal selfrenewing HSCs or downstream progenitors cells[10,11,88]. Some oncogenes including MOZ-TIF, MLL-AF9 and MLL-ENL can induce LSCs regardless of what target cell population they are expressed in[8890]. Other oncogenes like BCR-ABL, FLT3-ITD, Hoxa9 and Meis1 were found to be oncogenic when expressed in HSCs but not when expressed in progenitor cells[39,89,91]. However, experimental data in murine studies might be confounded by nonphysiologic levels of expression from exogenous promoters, such as transgenes or retroviral vectors[11]. This was demonstrated by the recent finding that in an MLLAF9 knockin model of the same construct shown to initiate disease in both HSCs and progenitor cells by retroviral expression only initiated leukemia from HSCs when expressed from the endogenous MLL

Cell surface markers

Patient samples used Mouse model used

Ref.

CD34+CD38- FAB M1, M4, M5 NOD/SCID [15,16] CD34+CD38+ CN-AML, MLL-ENL NOD/SCID +

IVIG or anti-CD122

[18,64,67,68]

CD34-CD38+ AML with NPM1 mutation

NOD/SCID β-2 microglobulin

NOD/SCID IL2 receptor γ−/− +

IVIG

[66]

CD34+CD123+ FAB M1, M2, M4 NOD/SCID [69] CD34+CD38-CD96+ CK-AML, CBFB-

MYH11,PML-RARA, AML1-ETO,

FAB M4

Rag2-/- IL2RG-/- [70]

CD34+CLL1+ AMLs with FLT3-ITD

NOD/SCID [71]

TIM3+ FAB M1, M2, M4 NOD/Rag1-/- IL2RG-/-

[72]

CD34+CD38- CD33+CD13+

CN-AML, CBF-AML,MLL-ENL

NOD/SCID [73]

Table 1 Markers of leukemia stem cells

FAB: French-American-British classification system; CN: Cytogenetically normal; CK: Cytogenetically complex; MLL-ENL: Mixed-lineage leukemia-eleven nineteen leukemia; NPM1: Nucleophosmin 1; CBFB-MYH11: Core binding factor beta unit-Myosin heavy chain 11; PML-RARA: Promyelocytic leukemia-retinoic acid receptor alpha; AML1-ETO: Acute myeloid leukemia 1 protein- eight twenty one; FLT3-ITD: Fms-like tyrosine kinase 3 Internal tandem duplication; NOD/SCID: Non-obese diabetic/severe combined immunodeficiency; Rag: Recombination activating gene; IL2RG: Interleukin 2 receptor subunit gamma.



promoter[92]. In vivo clonality studies in humans suggest variations in the cells of origin and is was demonstrated that in patients with t(8;21) AML primitive CD34+CD90

CD38 HSC like cells from leukemic bone marrow give rise to normally differentiating progenitors, whereas more mature CD34+CD90CD38+ multipotent progenitor like cells form exclusively leukemic blast colonies[9395]. These observations suggest that the truth about the cell of origin might be reflected by a combination of both theories depicted above: Although the initial genetic mutation might happen in HSCs subsequent events occur in the committed progenitor pool, giving rise to LSCs[11].

IMPACT OF LSC ON CURRENT TREATMENT AND PROGNOSISImpact on prognosisThe LSC burden of AML patient is suggested to be a strong biomarker for clinical outcome in AML[96100]. The ability of cells from AML patients to engraft NOD/SCID mice and the LSC frequency (simplistically characterized as CD34+CD38 frequency) are associated with worse clinical outcomes[99101]. AML patients with greater than 3.5% of CD34+CD38 AML cells show a median relapse free survival of 5.6 mo vs 16 mo in those with a lower percentage of CD34+CD38 cells[96]. Furthermore, poor clinical outcome seems to correlate with the degree to which the LSCs matched normal HSC gene expression[98].

It is noted that it is controversial whether the simplistically phenotypically defined LSC frequency (characterized as CD34+CD38-) in AML is prognostic and correlates with xenograft potential[14]. Also, as described above, LSCs can be found outside of the CD34+CD38 cell fraction. An improved characterization of subpopulations of LSCs is expected to be associated with improved prediction of prognosis.

Impact on current therapiesIt is thought that LSCs have a significant role in the relapse of leukemia as induction chemotherapy targets the bulk of blast cells but not LSC[102]. Minimal residual disease (MRD) is an important determinant for relapse and poor outcomes in AML and it is likely that the MRD cell population contains LSCs[103105]. Thus, in order to improve outcomes in AML, MRD needs to be reduced to prevent disease relapse. LSCs seem to be only minimally affected by traditional chemotherapy[35,106]. Several reasons for chemotherapy resistance have been proposed, which are related to the key features of LSCs discussed above. LSCs are quiescent in the G0 phase of the cell cycle but chemotherapy is only effective in killing rapidly cycling cells[36,37]. LSCs are supported by a stem cell niche in the bone marrow protecting them from the effect of classical chemotherapy[65]. Furthermore, LSCs express high levels of ATP transporters, which are involved in extrusion of chemotherapeutic drugs from

LSCs[107109].To improve survival in AML, traditional chemotherapy

targeting the blast population needs to be combined with therapy specifically targeting LSCs to maintain prolonged remission.

FUTURE DIRECTIONS FOR THERAPYDespite the recent increased interest in LSCs, experimental studies have not been translated into improved survival outcomes for cancer patients. However, several new agents targeting LSC specific surface molecules and pathways as well as the LSC microenvironment remains under different stages of preclinical and clinical development (Table 2 and Figure 1). To rationally design clinical trials testing drugs for efficacy against LSCs, it is important to appreciate the fundamental differences between drug design targeting blast cells and LSCs[102]. Principles and challenges faced by targeting LSCs will be discussed first followed by an overview of various new therapeutic options targeting LSCs.

General principles and challenges faced by targeting LSCsLimiting side effects: As LSCs and HSCs have many similar properties (see above), therapeutic approaches targeting LSCs also have the potential of causing severe side effects by eliminating healthy HSCs. To develop novel therapies with limited side effects, unique properties of LSCs have to be identified[102,110]. While expression of several surface markers is similar between normal HSCs and LSCs (CD34, CD38, CD71 and HLADR), other surface antigens are only displayed on LSCs (CD33, CD90, CD117 and CD123)[110]. Apart from a similar immunophenotype, HSCs and LSCs share many pathways important for maintaining features of “stemness” like quiescence and selfrenewal capacity[111]. Pathways, which are upregulated in LSCs compared to normal HSCs, are the ideal target for therapeutic approaches directed towards LSCs. For example, the active form of NFkB and bcl2, which are associated with antiapoptotic activity in cancer cells, are overexpressed in LSCs compared to normal HSC and drugs targeting both NF-κB and bcl-2 are in clinical development[36,46,112].

Using biomarkers for LSC eradication: To assess the efficacy of investigational therapies targeting LSCs, precise diagnostic methods are needed to assess the quantity of LSCs present in leukemia patients. Unfortunately, current characterization of LSC phenotype is not precise enough to permit realtime tracking of LSCs in vivo[113]. As discussed above, current strategies for purification do not yield functionally homogeneous population: The frequency of LSCs within the CD34+CD38 fraction in AML ranges from 1 in 104 to 1 in 5 × 106 cells and several other populations contain LSCs as well[15]. Functional assessment of LSC frequency with xenotransplantation models offers a



more robust method to evaluate eradication of LSCs but might not be feasible in large clinical trials[102]. Similarly, methods for detecting MRD might guide decisions by detecting patients who do require additional therapy to prevent relapse. However, detecting MRD does not distinguish persistent LSCs, which may cause relapse, from residual blasts and normal HSCs that do not have tumorinitiating activity. Distinguishing residual LSCs from residual blasts might be accomplished by gene expression analysis showing reactivation of selfrenewal

Drug Mechanism Selected clinical trials

Phase Ref.

Therapy targeting cell surface markers GO Anti-CD33

monoclonal antibody

conjugated with

calicheamicin, a potent

antitumor anthracycline

antibiotic

NCT00882102NCT01869803NCT00968071NCT01409161NCT00766116NCT02724163NCT00658814NCT02473146NCT00895934NCT00006265NCT00860639NCT00927498NCT00085709NCT00195000NCT00893399NCT00017589

Phase I-III

[124,126,130,132,133]

Hu5F9-G4 Anti-CD47 monoclonal

antibody

NCT02678338 Phase I

[74,141]

CSL360 Anti-CD123monoclonal

antibody

NCT00401739 Phase I

[69,134]

DT388IL3/ SL-401

Anti-CD123recombinant immunotoxin

created by the fusion of diphtheria toxin with a ligand

targeting the IL-3 receptor

NCT02113982NCT00397579

Phase I-II

[69,134,136]

MGD006/ S80880

Anti-CD3 and CD123 DART

NCT02152956 Phase I

[137]

H90 Anti-CD44monoclonal

antibody

N/A N/A [75,139]

A3D8 anti-CD44monoclonal

antibody

N/A N/A [139]

Therapy targeting LSC-specific molecular pathways Bortezomib Proteasome

inhibitorinhibits the degradation of the IkBa creating an anti-NF-kB

effect

NCT00789256NCT00382954NCT01127009NCT00666588NCT00703300NCT01534260NCT00383474

Phase I-III

[36,143-147,175-177]

Parthenolide Inhibitor of NF-kB

N/A N/A [149]

Celastrol Inhibitor of Hsp90 and by extension NF-

kB

N/A N/A [150]

4-hydroxy- 2-nonenal

Product of lipid

peroxidation, inhibiting the proteasome and NF-kB

function

N/A N/A [151,152]

BKM120 CAL-101

PI3K inhibitors

NCT01396499NCT01833169NCT00710528

Phase I-II

[38,153,154]

Table 2 Emerging therapy targeting leukemia stem cells GSK21110183 MK-2206 Perifosine

AKT inhibitors

NCT00881946NCT01253447NCT01231919NCT00301938

Phase I-II

[38,155-157]

Sirolimus, everolimus, temsirolimus

mTOR inhibitors

NCT01184898NCT01611116NCT01074086NCT01074086NCT01154439NCT00775593NCT02583893NCT01869114NCT01822015

Phase I-II

[38,158]

Oblimersen (Genasense, G3139)

bcl-2 antisense oligodeoxy-nucleotide

NCT00085124NCT00039117NCT00017589

Phase I-III

[46,159,160]

Obatoclax Mesylate (GX15-070MS)

Small molecule bcl-2

inhibitor

NCT00438178NCT00684918NCT00684918

Phase I-II

[161-163]

Therapy targeting the LSC microenvironment G-CSF Mobilization

of LSC from the protective bone marrow

niche - > increased

susceptibility to traditional

chemotherapy

NCT00820976NCT00602225NCT00199147NCT01723657NCT01101880NCT00943943NCT00906945

Phase I-III

[165-168]

Plerixafor (AMD3100)

CXCR4 inhibitor

Decreased homing to the bone marrow

NCT00943943NCT00906945NCT01236144 NCT00512252NCT01319864NCT01352650NCT02416908

Phase I-II

[61,135,178]

AMD3465 CXCR4 inhibitor


N/A N/A [61,135,169,179]

BMS-936564 Anti-CXCR4 antibody

Decreased homing to the

bone marrow

NCT01120457 Phase I

[172]

Natalizumab Anti-VLA4 antibody


N/A N/A [174]

GO: Gemtuzumab ozogamicin; DART: Dual-affinity retargeting molecule; N/A: Not available; LSC: Leukemia stem cell; IkBa: Inhibitor of kappa B alpha; CXCR4: C-X-C chemokine receptor type 4; mTOR: Mechanistic target of rapamycin; G-CSF: Granulocyte-colony stimulating factor.



genes in LSCs but not in blast cells[88,114]. In preclinical development, the recently published Connectivity Map could be investigated for agents that attenuate a stem cell gene signature or induce a differentiated state[115,116].

Timing of LSC targeted therapy: Therapy targeting LSCs is effective in eradicating a small amount of leukemia initiating cells but not the bulk of blasts cells in the blood and bone marrow[102]. By combining drugs eradicating LSCs with standard chemotherapy targeting the bulk of the disease, both the aggressive proliferating process as well as the root of the leukemia can be targeted[117]. An example serves the successful combination of the antiCD33 immunoconjugate antibody gemtuzumab ozogamicin (GO) with standard chemotherapy[118]. This is associated with challenges in a meaningful design of clinical trials in terms of the correct timing of these therapies. LSC targeting therapy can either be given after reduction of the bulk population with standard chemotherapy as remission therapy or concomitant with chemotherapy as an induction regimen[102]. Upfront combination would allow assessing for additive and/or synergistic properties between drugs and would allow targeting of LSCs early on in the disease process, which might improve outcomes[102]. On the other hand, LSC targeted therapy might be particular valuable as postconsolidation therapy as no current postconsolidation intervention has led to improved OS for patients with AML[102,119,120]. LSC targeting therapies have the potential to fill the gap as they eradicate the cells responsible for relapses of AML.

Assessing clinical endpoints: Classical response criteria like CR and hematologic improvement might not be the best parameters to assess the efficacy of therapeutic approaches targeting LSCs as these drugs do not eradicate the bulk of blast cells but rather eliminate the rare population of LSCs[102]. Progressionfree survival (PFS), event free survival and overall survival (OS) may be a more relevant endpoint for assessing the effectiveness of LSC elimination than tumor response as they better account for whether the root of the leukemia has been eliminated[113]. Importantly, while LSC frequency was found to be prognostic for survival, response rates did not correlate with LSC burden[96]. Subsequently, drugs targeting LSCs may show little activity if tested in traditional phase I/II trials as a proper assessment of endpoints relevant for LSCs, like PFS and OS, is generally only feasible in a phase III trial with a larger numbers of patients and longterm followup[113,121].

One example for the importance of assessing relevant endpoints for LSC targeting therapy, is inconsistency of clinical trials evaluating the efficacy of GO[102]. Single agent studies of GO showed overall response rates only approaching 30% at best and GO was voluntarily withdrawn from the United States market in 2010 after a study showed no improvements in outcomes when used in combination therapy as well

as increased fatal toxicity[122124]. In contrast, other large clinical trials showed improvement in outcomes more relevant for therapies targeting LSC eventfree survival, diseasefree survival and OS despite no differences in disease response rates[125128].

Targeting LSC surface moleculesAnti-CD33 antibodies: CD33 is found on LSCs although it is not a consistent feature of all LSCs studied[73,118,129]. As discussed above, there have been conflicting reports surrounding the efficacy and safety of GO and currently GO is not available on the market in the United States or Europe[130]. Apart from the different endpoints studied, there are additional explanations for the discrepancies observed: First, the dose of daunorubicin as the combination partner of GO did vary between trials, although it is known that treatment with daunorubicinbased schedules of 90 mg/m2 for 3 d is more effective than similar schedules with daunorubicin at 45 mg/m2[131]. In the SWOG trial, which questioned the efficacy of GO, single bolus combined with daunorubicin at 45 mg/m2 was studied against a control group with daunorubicin at 60 mg/m2[124]. However, the best effect of GO was seen when higher dose of GO (3 d at 3 mg/m2 for 2 cycles) was added to a daunorubicin regimen of 60 mg/m2 in both comparator groups[126]. Furthermore, GO seems to be quite active in acute promyelocytic leukemia (APL) as APL cells express high levels of CD33[132,133]. These results have prompted calls to reconsider the approval status of GO[130].

Anti-IL-3 receptor (CD123) antibodies: The interleukin3 receptor alpha chain (IL3Rα or CD123) is strongly expressed in CD34+/CD38 LSCs and can be targeted with monoclonal antibodies[69,134]. The blockage of CD123 has pleiotropic antileukemic effects including inhibition of LSC homing to the bone marrow, activation of innate immunity and inhibition of intracellular signaling events[135]. Several different agents targeting CD123 are currently evaluated in clinical trials: CD123 targeting antibodies can either be naked antibodies or be conjugated to toxins (e.g., diphteriod toxin) or chemotherapeutic agents (chemoimmune conjugates) or be the backbone of a bi-specific T cell engager (BITE, e.g., CD3CD123)[134,136,137] (Table 2).

Anti-CD44 antibodies: CD44 regulates interaction between LSCs and the bone marrow niche by controlling cellcell adhesion and cellmatrix interaction through binding to hyaluronic acid, osteopontin, collagens and others[138].

Inhibition of CD44 with monoclonal antibodies was shown to reduce the numbers of LSCs in NOD/SCID mice and to increase the survival of the primary recipient mice as well prevent engraftment into the secondary receipt mice[75,139] (Table 2).

Anti-CD47 antibodies: CD47 is overexpressed on LSCs and high expression of CD47 is associated with



worse outcomes[74]. By interaction with the extracellular region of signalregulatory protein alpha (SIRPα) on phagocytic cells, LSCs deliver a “do not eat me” message to these phagocytic cells[140]. Antibodies blocking the interaction between CD47 and SIRPα promote LSC phagocytosis and are in development (Table 2)[74,141].

Targeting LSC-specific molecular pathwaysNF-kB signaling pathway: Bortezomib is able to suppress the NFkB signaling pathway by inhibiting the destruction of IkB, a cellular inhibitory protein of NFκB, by the ubiquitinproteasome pathway[142]. Several clinical trials are examining the efficacy of Bortezomib targeting AML LSCs (Table 2): Two clinical trials combining Bortezomib with Cytarabine and Anthracyclines resulted in CR rates of 61% and 65%[143,144], whereas other trials that coadministrated Bortezomib with other drugs did not show encouraging CR rates[145147]. Several other inhibitors of NF-κB signaling are in different phases of development (Table 2)[148152].

PI3K/AKT/mTOR pathway: The PI3K/AKT/mTOR pathway is of utmost importance in regulating cellular growth, survival, and metabolism and is frequently dysregulated in cancers and AML[38]. A multitude of PI3K inhibitors[153,154], AKT inhibitors[155157] and mTOR inhibitors[158] is currently investigated for their efficacy targeting LSCs in clinical trials (Table 2).

Bcl-2 pathway: LSCs, similar to other tumor cells, are able to avoid apoptosis due to overexpression of bcl2[46]. Currently, bcl2 inhibition is investigated in clinical trials in form of the bcl2 antisense oligodeoxynucleotide oblimersen[159,160] and the small molecule inhibitor of bcl2 obatoclax[161163] (Table 2).

Targeting the LSC microenvironmentApproaches targeting the interactions of LSCs with the bone marrow niche focus on breaking the dormancy of LSCs in the bone marrow in order to make them sensitive to traditional chemotherapy[62,164].

LSC mobilization: LSC mobilization from the marrow niche can be achieved by nonspecific stimulators like GCSF, Interferonα and Arsenic trioxide[62]. Using the NOD/SCID/IL2rgamma (null) mouse model, Saito et al[165] showed that quiescent human AML LSCs, at first resistant to cytarabine, start proliferating and become susceptible to cytarabine once exposed to GCSF. Combining chemotherapy with GCSF leads to significantly increased survival of secondary recipients after transplantation of leukemia cells compared with chemotherapy alone. Furthermore, they showed that treatment with GCSF before cytarabine did not increase apoptosis of normal HSCs making this approach a particular attractive option for targeting LSCs but at the same time avoiding side effects from depletion of HSCs. The data from clinic trials using GCSF priming

in combination with chemotherapy are conflicting. Löwenberg et al[166] randomized 640 newly diagnosed AML patients to receive cytarabine plus idarubicin with GCSF (321 patients) or without GCSF (319 patients) for the first cycle of induction of chemotherapy. Patients in CR after induction chemotherapy plus GCSF had a higher rate of diseasefree survival than patients who did not receive GCSF (42% vs 33% at four years, P = 0.02), owing to a reduced probability of relapse (relative risk, 0.77; P = 0.04). Other studies did not show a benefit of adding GCSF to traditional chemotherapy regimens[167,168]. These different responses to GCSF might be explained by differences in the group of patients included in these trials[63]. In the trial by Löwenberg et al[166] patients with standardrisk AML benefited from GCSF therapy whereas GCSF did not improve the outcome in the subgroup with an unfavorable prognosis. In the trials without improvement with GCSF, patients had a more unfavorable prognosis based on age, cytogenetic abnormalities or response to previous treatment. Several clinical trials are ongoing to investigate the efficacy of GCSF in combination of chemotherapy in different risk groups of AML (Table 2).

Inhibition of homing: LSC dormancy can be targeted by specifically interrupting the CXCR4CXCL12 and VCAMVLA4 axis as well as inhibiting CD44 and CD123 on LSCs to prevent homing of LSCs to the bone marrow.

CXCR4-CXCL12 axis: SDF1 was shown to promote survival of AML cells, whereas addition of neutralizing CXCR4 antibodies, SDF1 antibodies, or AMD3100 significantly decreased their survival[169]. Furthermore, pretreatment of primary human AML cells with neutralizing CXCR4 antibodies blocked their homing into the BM and spleen of transplanted NOD/SCID/B2mnull mice[169]. Additionally, CXCR4 inhibition with AMD3465 was shown to increase the sensitivity of FLT3mutated leukemic cells to the apoptogenic effects of the FLT3 inhibitor sorafenib[170]. Recently a phase 1/2 study examined the efficacy of the CXCR4 inhibitor plerixafor in combination with mitoxantrone, etoposide, and cytarabine in 52 patients with relapsed or refractory AML[171]. Overall CR was found to be 46% and correlative studies demonstrated a 2fold mobilization in leukemic blasts into the peripheral circulation without evidence of symptomatic hyperleukocytosis or delayed count recovery. BMS936564, a fully human IgG4 monoclonal antibody against CXCR4, exhibits antitumor activity in cytarabineresistant mouse xenograft models of AML and is currently tested in a phase I clinic trial (Table 2)[172].

VCAM-VLA4 axis: Integrin alpha4beta1 (VLA4) mediates adhesion of LSCs to stromal cells and extracellular matrix in the marrow niche and can be blocked by the monoclonal antibody Natalizumab[59,69,173]. AML cells were shown to deadhere from a layer of



immobilized human VCAM1 expressing human stromal cells when exposed to Natalizumab and NSG mice transplanted with human AML cells survived significantly longer when they received intraperitoneal Natalizumab injections[174].

CONCLUSIONAML remains one of the most difficult malignancies to treat. Despite significant advancements in the understanding of disease biology, this has not been translated yet into new treatment modalities improving outcomes. The relapse of AML is frequent and is responsible for the inability to cure AML. LSCs are understood to be the root of relapse and their presence has been found to be prognostic for the disease course. Unfortunately, LSCs are not easy to target as they are quiescent, able to selfrenew and well protected by a supportive bone marrow niche. Furthermore, their inconsistent phenotype and similarity to normal HSCs hamper specific drug development. Nevertheless, a multitude of potential targets have been identified and are currently tested in different phases of clinical and preclinical development. Successful eradication of LSCs will require combination of different strategies including targeting LSC specific surface molecules and pathways as well as interactions of LSCs with the microenvironment. Furthermore, clinical trials have to be designed in a way that they are able to detect a specific effect of LSCs, which is easy to miss in a traditional trial design. Overall, targeting LSCs has the promise to not only effectively reduce disease burden but to eradicate the root of leukemia itself.

REFERENCES1 Roboz GJ. Novel approaches to the treatment of acute myeloid

leukemia. Hematology Am Soc Hematol Educ Program 2011; 2011: 43-50 [PMID: 22160011 DOI: 10.1182/asheducation-2011.1.43]

2 Felipe Rico J, Hassane DC, Guzman ML. Acute myelogenous leukemia stem cells: from Bench to Bedside. Cancer Lett 2013; 338: 4-9 [PMID: 22713929 DOI: 10.1016/j.canlet.2012.05.034]

3 Crews LA, Jamieson CH. Selective elimination of leukemia stem cells: hitting a moving target. Cancer Lett 2013; 338: 15-22 [PMID: 22906415 DOI: 10.1016/j.canlet.2012.08.006]

4 Lutz C, Hoang VT, Buss E, Ho AD. Identifying leukemia stem cells--is it feasible and does it matter? Cancer Lett 2013; 338: 10-14 [PMID: 22820159 DOI: 10.1016/j.canlet.2012.07.014]

5 Ailles LE, Weissman IL. Cancer stem cells in solid tumors. Curr Opin Biotechnol 2007; 18: 460-466 [PMID: 18023337 DOI: 10.1016/j.copbio.2007.10.007]

6 Magee JA, Piskounova E, Morrison SJ. Cancer stem cells: impact, heterogeneity, and uncertainty. Cancer Cell 2012; 21: 283-296 [PMID: 22439924 DOI: 10.1016/j.ccr.2012.03.003]

7 Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and cancer stem cells. Nature 2001; 414: 105-111 [PMID: 11689955 DOI: 10.1038/35102167]

8 Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA 2003; 100: 3983-3988 [PMID: 12629218 DOI: 10.1073/pnas.0530291100]

9 Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano MD, Dirks PB. Identification of human

brain tumour initiating cells. Nature 2004; 432: 396-401 [PMID: 15549107 DOI: 10.1038/nature03128]

10 Wang JC, Dick JE. Cancer stem cells: lessons from leukemia. Trends Cell Biol 2005; 15: 494-501 [PMID: 16084092 DOI: 10.1016/j.tcb.2005.07.004]

11 Dick JE. Stem cell concepts renew cancer research. Blood 2008; 112: 4793-4807 [PMID: 19064739 DOI: 10.1182/blood-2008-08-077941]

12 Clarke MF, Dick JE, Dirks PB, Eaves CJ, Jamieson CH, Jones DL, Visvader J, Weissman IL, Wahl GM. Cancer stem cells--perspectives on current status and future directions: AACR Workshop on cancer stem cells. Cancer Res 2006; 66: 9339-9344 [PMID: 16990346 DOI: 10.1158/0008-5472.CAN-06-3126]

13 Wunderlich M, Chou FS, Link KA, Mizukawa B, Perry RL, Carroll M, Mulloy JC. AML xenograft efficiency is significantly improved in NOD/SCID-IL2RG mice constitutively expressing human SCF, GM-CSF and IL-3. Leukemia 2010; 24: 1785-1788 [PMID: 20686503 DOI: 10.1038/leu.2010.158]

14 Goyama S, Wunderlich M, Mulloy JC. Xenograft models for normal and malignant stem cells. Blood 2015; 125: 2630-2640 [PMID: 25762176 DOI: 10.1182/blood-2014-11-570218]

15 Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med 1997; 3: 730-737 [PMID: 9212098 DOI: 10.1038/nm0797-730]

16 Lapidot T, Sirard C, Vormoor J, Murdoch B, Hoang T, Caceres-Cortes J, Minden M, Paterson B, Caligiuri MA, Dick JE. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 1994; 367: 645-648 [PMID: 7509044 DOI: 10.1038/367645a0]

17 Till JE, Mcculloch EA, Siminovitch L. A stochastic model of stem cell proliferation, based on the growth of spleen colony-forming cells. Proc Natl Acad Sci USA 1964; 51: 29-36 [PMID: 14104600 DOI: 10.1073/pnas.51.1.29]

18 McKenzie JL, Gan OI, Doedens M, Wang JC, Dick JE. Individual stem cells with highly variable proliferation and self-renewal properties comprise the human hematopoietic stem cell com-partment. Nat Immunol 2006; 7: 1225-1233 [PMID: 17013390 DOI: 10.1038/ni1393]

19 Morrison SJ, Kimble J. Asymmetric and symmetric stem-cell divisions in development and cancer. Nature 2006; 441: 1068-1074 [PMID: 16810241 DOI: 10.1038/nature04956]

20 Huttner WB, Kosodo Y. Symmetric versus asymmetric cell division during neurogenesis in the developing vertebrate central nervous system. Curr Opin Cell Biol 2005; 17: 648-657 [PMID: 16243506 DOI: 10.1016/j.ceb.2005.10.005]

21 Boman BM, Wicha MS, Fields JZ, Runquist OA. Symmetric division of cancer stem cells--a key mechanism in tumor growth that should be targeted in future therapeutic approaches. Clin Pharmacol Ther 2007; 81: 893-898 [PMID: 17460605 DOI: 10.1038/sj.clpt.6100202]

22 Powell AE, Shung CY, Saylor KW, Müllendorff KA, Weiss JB, Wong MH. Lessons from development: A role for asymmetric stem cell division in cancer. Stem Cell Res 2010; 4: 3-9 [PMID: 19853549 DOI: 10.1016/j.scr.2009.09.005]

23 Cicalese A, Bonizzi G, Pasi CE, Faretta M, Ronzoni S, Giulini B, Brisken C, Minucci S, Di Fiore PP, Pelicci PG. The tumor suppressor p53 regulates polarity of self-renewing divisions in mammary stem cells. Cell 2009; 138: 1083-1095 [PMID: 19766563 DOI: 10.1016/j.cell.2009.06.048]

24 Yamashita YM, Mahowald AP, Perlin JR, Fuller MT. Asymmetric inheritance of mother versus daughter centrosome in stem cell division. Science 2007; 315: 518-521 [PMID: 17255513 DOI: 10.1126/science.1134910]

25 Yamashita YM, Jones DL, Fuller MT. Orientation of asymmetric stem cell division by the APC tumor suppressor and centrosome. Science 2003; 301: 1547-1550 [PMID: 12970569 DOI: 10.1126/science.1087795]

26 Nakamura-Ishizu A, Takizawa H, Suda T. The analysis, roles and regulation of quiescence in hematopoietic stem cells. Development 2014; 141: 4656-4666 [PMID: 25468935 DOI: 10.1242/



dev.106575]27 Sharpless NE, DePinho RA. How stem cells age and why this

makes us grow old. Nat Rev Mol Cell Biol 2007; 8: 703-713 [PMID: 17717515 DOI: 10.1038/nrm2241]

28 Allsopp RC, Morin GB, DePinho R, Harley CB, Weissman IL. Telomerase is required to slow telomere shortening and extend replicative lifespan of HSCs during serial transplantation. Blood 2003; 102: 517-520 [PMID: 12663456 DOI: 10.1182/blood-2002-07-2334]

29 Kim WY, Sharpless NE. The regulation of INK4/ARF in cancer and aging. Cell 2006; 127: 265-275 [PMID: 17055429 DOI: 10.1016/j.cell.2006.10.003]

30 Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann H, Lu X, Soron G, Cooper B, Brayton C, Park SH, Thompson T, Karsenty G, Bradley A, Donehower LA. p53 mutant mice that display early ageing-associated phenotypes. Nature 2002; 415: 45-53 [PMID: 11780111 DOI: 10.1038/415045a]

31 Lenhoff S, Hjorth M, Westin J, Brinch L, Bäckström B, Carlson K, Christiansen I, Dahl IM, Gimsing P, Hammerström J, Johnsen HE, Juliusson G, Linder O, Mellqvist UH, Nesthus I, Nielsen JL, Tangen JM, Turesson I. Impact of age on survival after intensive therapy for multiple myeloma: a population-based study by the Nordic Myeloma Study Group. Br J Haematol 2006; 133: 389-396 [PMID: 16643445 DOI: 10.1111/j.1365-2141.2006.06042.x]

32 Kollman C, Howe CW, Anasetti C, Antin JH, Davies SM, Filipovich AH, Hegland J, Kamani N, Kernan NA, King R, Ratanatharathorn V, Weisdorf D, Confer DL. Donor characteristics as risk factors in recipients after transplantation of bone marrow from unrelated donors: the effect of donor age. Blood 2001; 98: 2043-2051 [PMID: 11567988 DOI: 10.1182/blood.V98.7.2043]

33 Watt FM, Jensen KB. Epidermal stem cell diversity and quiescence. EMBO Mol Med 2009; 1: 260-267 [PMID: 20049729 DOI: 10.1002/emmm.200900033]

34 Moore N, Lyle S. Quiescent, slow-cycling stem cell populations in cancer: a review of the evidence and discussion of significance. J Oncol 2011; 2011: pii: 396076 [PMID: 20936110 DOI: 10.1155/2011/396076]

35 Terpstra W, Ploemacher RE, Prins A, van Lom K, Pouwels K, Wognum AW, Wagemaker G, Löwenberg B, Wielenga JJ. Fluorouracil selectively spares acute myeloid leukemia cells with long-term growth abilities in immunodeficient mice and in culture. Blood 1996; 88: 1944-1950 [PMID: 8822911]

36 Guzman ML, Neering SJ, Upchurch D, Grimes B, Howard DS, Rizzieri DA, Luger SM, Jordan CT. Nuclear factor-kappaB is constitutively activated in primitive human acute myelogenous leukemia cells. Blood 2001; 98: 2301-2307 [PMID: 11588023 DOI: 10.1182/blood.V98.8.2301]

37 Guan Y, Gerhard B, Hogge DE. Detection, isolation, and stimulation of quiescent primitive leukemic progenitor cells from patients with acute myeloid leukemia (AML). Blood 2003; 101: 3142-3149 [PMID: 12468427 DOI: 10.1182/blood-2002-10-3062]

38 Fransecky L, Mochmann LH, Baldus CD. Outlook on PI3K/AKT/mTOR inhibition in acute leukemia. Mol Cell Ther 2015; 3: 2 [PMID: 26056603 DOI: 10.1186/s40591-015-0040-8]

39 Wang Y, Krivtsov AV, Sinha AU, North TE, Goessling W, Feng Z, Zon LI, Armstrong SA. The Wnt/beta-catenin pathway is required for the development of leukemia stem cells in AML. Science 2010; 327: 1650-1653 [PMID: 20339075 DOI: 10.1126/science.1186624]

40 Lento W, Congdon K, Voermans C, Kritzik M, Reya T. Wnt signaling in normal and malignant hematopoiesis. Cold Spring Harb Perspect Biol 2013; 5: pii: a008011 [PMID: 23378582 DOI: 10.1101/cshperspect.a008011]

41 Mar BG, Amakye D, Aifantis I, Buonamici S. The controversial role of the Hedgehog pathway in normal and malignant hema-topoiesis. Leukemia 2011; 25: 1665-1673 [PMID: 21660044 DOI: 10.1038/leu.2011.143]

42 Irvine DA, Copland M. Targeting hedgehog in hematologic malignancy. Blood 2012; 119: 2196-2204 [PMID: 22223823 DOI: 10.1182/blood-2011-10-383752]

43 Zhou J, Ching YQ, Chng WJ. Aberrant nuclear factor-kappa B

activity in acute myeloid leukemia: from molecular pathogenesis to therapeutic target. Oncotarget 2015; 6: 5490-5500 [PMID: 25823927 DOI: 10.18632/oncotarget.3545]

44 Kagoya Y, Yoshimi A, Kataoka K, Nakagawa M, Kumano K, Arai S, Kobayashi H, Saito T, Iwakura Y, Kurokawa M. Positive feedback between NF-κB and TNF-α promotes leukemia-initiating cell capacity. J Clin Invest 2014; 124: 528-542 [PMID: 24382349 DOI: 10.1172/JCI68101]

45 Liu N, Zhang J, Ji C. The emerging roles of Notch signaling in leukemia and stem cells. Biomark Res 2013; 1: 23 [PMID: 24252593 DOI: 10.1186/2050-7771-1-23]

46 Lagadinou ED, Sach A, Callahan K, Rossi RM, Neering SJ, Minhajuddin M, Ashton JM, Pei S, Grose V, O’Dwyer KM, Liesveld JL, Brookes PS, Becker MW, Jordan CT. BCL-2 inhibition targets oxidative phosphorylation and selectively eradicates quiescent human leukemia stem cells. Cell Stem Cell 2013; 12: 329-341 [PMID: 23333149 DOI: 10.1016/j.stem.2012.12.013]

47 Domen J, Weissman IL. Hematopoietic stem cells need two signals to prevent apoptosis; BCL-2 can provide one of these, Kitl/c-Kit signaling the other. J Exp Med 2000; 192: 1707-1718 [PMID: 11120768 DOI: 10.1084/jem.192.12.1707]

48 Schepers K, Campbell TB, Passegué E. Normal and leukemic stem cell niches: insights and therapeutic opportunities. Cell Stem Cell 2015; 16: 254-267 [PMID: 25748932 DOI: 10.1016/j.stem.2015.02.014]

49 Orkin SH, Zon LI. Hematopoiesis: an evolving paradigm for stem cell biology. Cell 2008; 132: 631-644 [PMID: 18295580 DOI: 10.1016/j.cell.2008.01.025]

50 Butler JM, Nolan DJ, Vertes EL, Varnum-Finney B, Kobayashi H, Hooper AT, Seandel M, Shido K, White IA, Kobayashi M, Witte L, May C, Shawber C, Kimura Y, Kitajewski J, Rosenwaks Z, Bernstein ID, Rafii S. Endothelial cells are essential for the self-renewal and repopulation of Notch-dependent hematopoietic stem cells. Cell Stem Cell 2010; 6: 251-264 [PMID: 20207228 DOI: 10.1016/j.stem.2010.02.001]

51 Crisan M, Yap S, Casteilla L, Chen CW, Corselli M, Park TS, Andriolo G, Sun B, Zheng B, Zhang L, Norotte C, Teng PN, Traas J, Schugar R, Deasy BM, Badylak S, Buhring HJ, Giacobino JP, Lazzari L, Huard J, Péault B. A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell 2008; 3: 301-313 [PMID: 18786417 DOI: 10.1016/j.stem.2008.07.003]

52 Morrison SJ, Scadden DT. The bone marrow niche for haema-topoietic stem cells. Nature 2014; 505: 327-334 [PMID: 24429631 DOI: 10.1038/nature12984]

53 Bruns I, Lucas D, Pinho S, Ahmed J, Lambert MP, Kunisaki Y, Scheiermann C, Schiff L, Poncz M, Bergman A, Frenette PS. Megakaryocytes regulate hematopoietic stem cell quiescence through CXCL4 secretion. Nat Med 2014; 20: 1315-1320 [PMID: 25326802 DOI: 10.1038/nm.3707]

54 Lane SW, Scadden DT, Gilliland DG. The leukemic stem cell niche: current concepts and therapeutic opportunities. Blood 2009; 114: 1150-1157 [PMID: 19401558 DOI: 10.1182/blood-2009-01-202606]

55 Sugiyama T, Kohara H, Noda M, Nagasawa T. Maintenance of the hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell niches. Immunity 2006; 25: 977-988 [PMID: 17174120 DOI: 10.1016/j.immuni.2006.10.016]

56 Ara T, Tokoyoda K, Sugiyama T, Egawa T, Kawabata K, Nagasawa T. Long-term hematopoietic stem cells require stromal cell-derived factor-1 for colonizing bone marrow during ontogeny. Immunity 2003; 19: 257-267 [PMID: 12932359 DOI: 10.1016/S1074-7613(03)00201-2]

57 Juneja HS, Schmalsteig FC, Lee S, Chen J. Vascular cell adhesion molecule-1 and VLA-4 are obligatory adhesion proteins in the heterotypic adherence between human leukemia/lymphoma cells and marrow stromal cells. Exp Hematol 1993; 21: 444-450 [PMID: 7680000]

58 Avecilla ST, Hattori K, Heissig B, Tejada R, Liao F, Shido K, Jin DK, Dias S, Zhang F, Hartman TE, Hackett NR, Crystal RG, Witte L, Hicklin DJ, Bohlen P, Eaton D, Lyden D, de Sauvage F, Rafii S. Chemokine-mediated interaction of hematopoietic progenitors with the bone marrow vascular niche is required for thrombopoiesis. Nat



Med 2004; 10: 64-71 [PMID: 14702636 DOI: 10.1038/nm973]59 Matsunaga T, Takemoto N, Sato T, Takimoto R, Tanaka I, Fujimi

A, Akiyama T, Kuroda H, Kawano Y, Kobune M, Kato J, Hirayama Y, Sakamaki S, Kohda K, Miyake K, Niitsu Y. Interaction between leukemic-cell VLA-4 and stromal fibronectin is a decisive factor for minimal residual disease of acute myelogenous leukemia. Nat Med 2003; 9: 1158-1165 [PMID: 12897778 DOI: 10.1038/nm909]

60 Rombouts EJ, Pavic B, Löwenberg B, Ploemacher RE. Relation between CXCR-4 expression, Flt3 mutations, and unfavorable prognosis of adult acute myeloid leukemia. Blood 2004; 104: 550-557 [PMID: 15054042 DOI: 10.1182/blood-2004-02-0566]

61 Spoo AC, Lübbert M, Wierda WG, Burger JA. CXCR4 is a prognostic marker in acute myelogenous leukemia. Blood 2007; 109: 786-791 [PMID: 16888090 DOI: 10.1182/blood-2006-05-024844]

62 Essers MA, Trumpp A. Targeting leukemic stem cells by breaking their dormancy. Mol Oncol 2010; 4: 443-450 [PMID: 20599449 DOI: 10.1016/j.molonc.2010.06.001]

63 Mikkola HK, Radu CG, Witte ON. Targeting leukemia stem cells. Nat Biotechnol 2010; 28: 237-238 [PMID: 20212485 DOI: 10.1038/nbt0310-237]

64 Taussig DC, Miraki-Moud F, Anjos-Afonso F, Pearce DJ, Allen K, Ridler C, Lillington D, Oakervee H, Cavenagh J, Agrawal SG, Lister TA, Gribben JG, Bonnet D. Anti-CD38 antibody-mediated clearance of human repopulating cells masks the heterogeneity of leukemia-initiating cells. Blood 2008; 112: 568-575 [PMID: 18523148 DOI: 10.1182/blood-2007-10-118331]

65 Ishikawa F, Yoshida S, Saito Y, Hijikata A, Kitamura H, Tanaka S, Nakamura R, Tanaka T, Tomiyama H, Saito N, Fukata M, Miyamoto T, Lyons B, Ohshima K, Uchida N, Taniguchi S, Ohara O, Akashi K, Harada M, Shultz LD. Chemotherapy-resistant human AML stem cells home to and engraft within the bone-marrow endosteal region. Nat Biotechnol 2007; 25: 1315-1321 [PMID: 17952057 DOI: 10.1038/nbt1350]

66 Taussig DC, Vargaftig J, Miraki-Moud F, Griessinger E, Sharrock K, Luke T, Lillington D, Oakervee H, Cavenagh J, Agrawal SG, Lister TA, Gribben JG, Bonnet D. Leukemia-initiating cells from some acute myeloid leukemia patients with mutated nucleophosmin reside in the CD34(-) fraction. Blood 2010; 115: 1976-1984 [PMID: 20053758 DOI: 10.1182/blood-2009-02-206565]

67 Civin CI, Almeida-Porada G, Lee MJ, Olweus J, Terstappen LW, Zanjani ED. Sustained, retransplantable, multilineage engraftment of highly purified adult human bone marrow stem cells in vivo. Blood 1996; 88: 4102-4109 [PMID: 8943843]

68 Hogan CJ, Shpall EJ, Keller G. Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Natl Acad Sci USA 2002; 99: 413-418 [PMID: 11782553 DOI: 10.1073/pnas.012336799]

69 Jordan CT, Upchurch D, Szilvassy SJ, Guzman ML, Howard DS, Pettigrew AL, Meyerrose T, Rossi R, Grimes B, Rizzieri DA, Luger SM, Phillips GL. The interleukin-3 receptor alpha chain is a unique marker for human acute myelogenous leukemia stem cells. Leukemia 2000; 14: 1777-1784 [PMID: 11021753 DOI: 10.1038/sj.leu.2401903]

70 Hosen N, Park CY, Tatsumi N, Oji Y, Sugiyama H, Gramatzki M, Krensky AM, Weissman IL. CD96 is a leukemic stem cell-specific marker in human acute myeloid leukemia. Proc Natl Acad Sci USA 2007; 104: 11008-11013 [PMID: 17576927 DOI: 10.1073/pnas.0704271104]

71 van Rhenen A, van Dongen GA, Kelder A, Rombouts EJ, Feller N, Moshaver B, Stigter-van Walsum M, Zweegman S, Ossenkoppele GJ, Jan Schuurhuis G. The novel AML stem cell associated antigen CLL-1 aids in discrimination between normal and leukemic stem cells. Blood 2007; 110: 2659-2666 [PMID: 17609428 DOI: 10.1182/blood-2007-03-083048]

72 Kikushige Y, Shima T, Takayanagi S, Urata S, Miyamoto T, Iwasaki H, Takenaka K, Teshima T, Tanaka T, Inagaki Y, Akashi K. TIM-3 is a promising target to selectively kill acute myeloid leukemia stem cells. Cell Stem Cell 2010; 7: 708-717 [PMID: 21112565 DOI: 10.1016/j.stem.2010.11.014]

73 Taussig DC, Pearce DJ, Simpson C, Rohatiner AZ, Lister TA, Kelly G, Luongo JL, Danet-Desnoyers GA, Bonnet D. Hematopoietic stem cells express multiple myeloid markers: implications for the origin and targeted therapy of acute myeloid leukemia. Blood 2005; 106: 4086-4092 [PMID: 16131573 DOI: 10.1182/blood-2005-03-1072]

74 Majeti R, Chao MP, Alizadeh AA, Pang WW, Jaiswal S, Gibbs KD, van Rooijen N, Weissman IL. CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells. Cell 2009; 138: 286-299 [PMID: 19632179 DOI: 10.1016/j.cell.2009.05.045]

75 Jin L, Hope KJ, Zhai Q, Smadja-Joffe F, Dick JE. Targeting of CD44 eradicates human acute myeloid leukemic stem cells. Nat Med 2006; 12: 1167-1174 [PMID: 16998484 DOI: 10.1038/nm1483]

76 Hope KJ, Jin L, Dick JE. Acute myeloid leukemia originates from a hierarchy of leukemic stem cell classes that differ in self-renewal capacity. Nat Immunol 2004; 5: 738-743 [PMID: 15170211 DOI: 10.1038/ni1080]

77 Misaghian N, Ligresti G, Steelman LS, Bertrand FE, Bäsecke J, Libra M, Nicoletti F, Stivala F, Milella M, Tafuri A, Cervello M, Martelli AM, McCubrey JA. Targeting the leukemic stem cell: the Holy Grail of leukemia therapy. Leukemia 2009; 23: 25-42 [PMID: 18800146 DOI: 10.1038/leu.2008.246]

78 Manz MG. Human-hemato-lymphoid-system mice: opportunities and challenges. Immunity 2007; 26: 537-541 [PMID: 17521579 DOI: 10.1016/j.immuni.2007.05.001]

79 Shultz LD, Lyons BL, Burzenski LM, Gott B, Chen X, Chaleff S, Kotb M, Gillies SD, King M, Mangada J, Greiner DL, Handgretinger R. Human lymphoid and myeloid cell development in NOD/LtSz-scid IL2R gamma null mice engrafted with mobilized human hemopoietic stem cells. J Immunol 2005; 174: 6477-6489 [PMID: 15879151 DOI: 10.4049/jimmunol.174.10.6477]

80 McDermott SP, Eppert K, Lechman ER, Doedens M, Dick JE. Comparison of human cord blood engraftment between immu-nocompromised mouse strains. Blood 2010; 116: 193-200 [PMID: 20404133 DOI: 10.1182/blood-2010-02-271841]

81 Rongvaux A, Willinger T, Martinek J, Strowig T, Gearty SV, Teichmann LL, Saito Y, Marches F, Halene S, Palucka AK, Manz MG, Flavell RA. Development and function of human innate immune cells in a humanized mouse model. Nat Biotechnol 2014; 32: 364-372 [PMID: 24633240 DOI: 10.1038/nbt.2858]

82 Chou FS, Griesinger A, Wunderlich M, Lin S, Link KA, Shrestha M, Goyama S, Mizukawa B, Shen S, Marcucci G, Mulloy JC. The thrombopoietin/MPL/Bcl-xL pathway is essential for survival and self-renewal in human preleukemia induced by AML1-ETO. Blood 2012; 120: 709-719 [PMID: 22337712 DOI: 10.1182/blood-2012-01-403212]

83 Pulikkan JA, Madera D, Xue L, Bradley P, Landrette SF, Kuo YH, Abbas S, Zhu LJ, Valk P, Castilla LH. Thrombopoietin/MPL participates in initiating and maintaining RUNX1-ETO acute myeloid leukemia via PI3K/AKT signaling. Blood 2012; 120: 868-879 [PMID: 22613795 DOI: 10.1182/blood-2012-03-414649]

84 Chin DW, Watanabe-Okochi N, Wang CQ, Tergaonkar V, Osato M. Mouse models for core binding factor leukemia. Leukemia 2015; 29: 1970-1980 [PMID: 26165235 DOI: 10.1038/leu.2015.181]

85 Lessard J, Sauvageau G. Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells. Nature 2003; 423: 255-260 [PMID: 12714970 DOI: 10.1038/nature01572]

86 Yilmaz OH, Valdez R, Theisen BK, Guo W, Ferguson DO, Wu H, Morrison SJ. Pten dependence distinguishes haematopoietic stem cells from leukaemia-initiating cells. Nature 2006; 441: 475-482 [PMID: 16598206 DOI: 10.1038/nature04703]

87 Griffin JD, Löwenberg B. Clonogenic cells in acute myeloblastic leukemia. Blood 1986; 68: 1185-1195 [PMID: 3535923]

88 Krivtsov AV, Twomey D, Feng Z, Stubbs MC, Wang Y, Faber J, Levine JE, Wang J, Hahn WC, Gilliland DG, Golub TR, Armstrong SA. Transformation from committed progenitor to leukaemia stem cell initiated by MLL-AF9. Nature 2006; 442: 818-822 [PMID: 16862118 DOI: 10.1038/nature04980]



89 Huntly BJ, Shigematsu H, Deguchi K, Lee BH, Mizuno S, Duclos N, Rowan R, Amaral S, Curley D, Williams IR, Akashi K, Gilliland DG. MOZ-TIF2, but not BCR-ABL, confers properties of leukemic stem cells to committed murine hematopoietic progenitors. Cancer Cell 2004; 6: 587-596 [PMID: 15607963 DOI: 10.1016/j.ccr.2004.10.015]

90 Cozzio A, Passegué E, Ayton PM, Karsunky H, Cleary ML, Weissman IL. Similar MLL-associated leukemias arising from self-renewing stem cells and short-lived myeloid progenitors. Genes Dev 2003; 17: 3029-3035 [PMID: 14701873 DOI: 10.1101/gad.1143403]

91 Kvinlaug BT, Chan WI, Bullinger L, Ramaswami M, Sears C, Foster D, Lazic SE, Okabe R, Benner A, Lee BH, De Silva I, Valk PJ, Delwel R, Armstrong SA, Döhner H, Gilliland DG, Huntly BJ. Common and overlapping oncogenic pathways contribute to the evolution of acute myeloid leukemias. Cancer Res 2011; 71: 4117-4129 [PMID: 21505102 DOI: 10.1158/0008-5472.CAN-11-0176]

92 Chen W, Kumar AR, Hudson WA, Li Q, Wu B, Staggs RA, Lund EA, Sam TN, Kersey JH. Malignant transformation initiated by Mll-AF9: gene dosage and critical target cells. Cancer Cell 2008; 13: 432-440 [PMID: 18455126 DOI: 10.1016/j.ccr.2008.03.005]

93 Fialkow PJ, Singer JW, Raskind WH, Adamson JW, Jacobson RJ, Bernstein ID, Dow LW, Najfeld V, Veith R. Clonal development, stem-cell differentiation, and clinical remissions in acute nonlymphocytic leukemia. N Engl J Med 1987; 317: 468-473 [PMID: 3614291 DOI: 10.1056/NEJM198708203170802]

94 Miyamoto T, Weissman IL, Akashi K. AML1/ETO-expressing nonleukemic stem cells in acute myelogenous leukemia with 8; 21 chromosomal translocation. Proc Natl Acad Sci USA 2000; 97: 7521-7526 [PMID: 10861016 DOI: 10.1073/pnas.97.13.7521]

95 Majeti R, Park CY, Weissman IL. Identification of a hierarchy of multipotent hematopoietic progenitors in human cord blood. Cell Stem Cell 2007; 1: 635-645 [PMID: 18371405 DOI: 10.1016/j.stem.2007.10.001]

96 van Rhenen A, Feller N, Kelder A, Westra AH, Rombouts E, Zweegman S, van der Pol MA, Waisfisz Q, Ossenkoppele GJ, Schuurhuis GJ. High stem cell frequency in acute myeloid leukemia at diagnosis predicts high minimal residual disease and poor survival. Clin Cancer Res 2005; 11: 6520-6527 [PMID: 16166428 DOI: 10.1158/1078-0432.CCR-05-0468]

97 Gentles AJ, Plevritis SK, Majeti R, Alizadeh AA. Association of a leukemic stem cell gene expression signature with clinical outcomes in acute myeloid leukemia. JAMA 2010; 304: 2706-2715 [PMID: 21177505 DOI: 10.1001/jama.2010.1862]

98 Eppert K, Takenaka K, Lechman ER, Waldron L, Nilsson B, van Galen P, Metzeler KH, Poeppl A, Ling V, Beyene J, Canty AJ, Danska JS, Bohlander SK, Buske C, Minden MD, Golub TR, Jurisica I, Ebert BL, Dick JE. Stem cell gene expression programs influence clinical outcome in human leukemia. Nat Med 2011; 17: 1086-1093 [PMID: 21873988 DOI: 10.1038/nm.2415]

99 Pearce DJ, Taussig D, Zibara K, Smith LL, Ridler CM, Preudhomme C, Young BD, Rohatiner AZ, Lister TA, Bonnet D. AML engraftment in the NOD/SCID assay reflects the outcome of AML: implications for our understanding of the heterogeneity of AML. Blood 2006; 107: 1166-1173 [PMID: 16234360 DOI: 10.1182/blood-2005-06-2325]

100 Terwijn M, Zeijlemaker W, Kelder A, Rutten AP, Snel AN, Scholten WJ, Pabst T, Verhoef G, Löwenberg B, Zweegman S, Ossenkoppele GJ, Schuurhuis GJ. Leukemic stem cell frequency: a strong biomarker for clinical outcome in acute myeloid leukemia. PLoS One 2014; 9: e107587 [PMID: 25244440 DOI: 10.1371/journal.pone.0107587]

101 Vargaftig J, Taussig DC, Griessinger E, Anjos-Afonso F, Lister TA, Cavenagh J, Oakervee H, Gribben J, Bonnet D. Frequency of leukemic initiating cells does not depend on the xenotransplantation model used. Leukemia 2012; 26: 858-860 [PMID: 21926966 DOI: 10.1038/leu.2011.250]

102 Pollyea DA, Gutman JA, Gore L, Smith CA, Jordan CT. Targeting acute myeloid leukemia stem cells: a review and principles for the

development of clinical trials. Haematologica 2014; 99: 1277-1284 [PMID: 25082785 DOI: 10.3324/haematol.2013.085209]

103 Feller N, van der Pol MA, van Stijn A, Weijers GW, Westra AH, Evertse BW, Ossenkoppele GJ, Schuurhuis GJ. MRD parameters using immunophenotypic detection methods are highly reliable in predicting survival in acute myeloid leukaemia. Leukemia 2004; 18: 1380-1390 [PMID: 15201848 DOI: 10.1038/sj.leu.2403405]

104 Venditti A, Buccisano F, Del Poeta G, Maurillo L, Tamburini A, Cox C, Battaglia A, Catalano G, Del Moro B, Cudillo L, Postorino M, Masi M, Amadori S. Level of minimal residual disease after consolidation therapy predicts outcome in acute myeloid leukemia. Blood 2000; 96: 3948-3952 [PMID: 11090082]

105 van Rhenen A, Moshaver B, Kelder A, Feller N, Nieuwint AW, Zweegman S, Ossenkoppele GJ, Schuurhuis GJ. Aberrant marker expression patterns on the CD34+CD38- stem cell compartment in acute myeloid leukemia allows to distinguish the malignant from the normal stem cell compartment both at diagnosis and in remission. Leukemia 2007; 21: 1700-1707 [PMID: 17525725 DOI: 10.1038/sj.leu.2404754]

106 Costello RT, Mallet F, Gaugler B, Sainty D, Arnoulet C, Gastaut JA, Olive D. Human acute myeloid leukemia CD34+/CD38- progenitor cells have decreased sensitivity to chemotherapy and Fas-induced apoptosis, reduced immunogenicity, and impaired dendritic cell transformation capacities. Cancer Res 2000; 60: 4403-4411 [PMID: 10969785]

107 de Grouw EP, Raaijmakers MH, Boezeman JB, van der Reijden BA, van de Locht LT, de Witte TJ, Jansen JH, Raymakers RA. Preferential expression of a high number of ATP binding cassette transporters in both normal and leukemic CD34+CD38- cells. Leukemia 2006; 20: 750-754 [PMID: 16467867 DOI: 10.1038/sj.leu.2404131]

108 Bunting KD. ABC transporters as phenotypic markers and functional regulators of stem cells. Stem Cells 2002; 20: 11-20 [PMID: 11796918 DOI: 10.1002/stem.200011]

109 de Jonge-Peeters SD, Kuipers F, de Vries EG, Vellenga E. ABC transporter expression in hematopoietic stem cells and the role in AML drug resistance. Crit Rev Oncol Hematol 2007; 62: 214-226 [PMID: 17368038 DOI: 10.1016/j.critrevonc.2007.02.003]

110 Jordan CT. Unique molecular and cellular features of acute myelogenous leukemia stem cells. Leukemia 2002; 16: 559-562 [PMID: 11960332 DOI: 10.1038/sj.leu.2402446]

111 Chen K, Huang YH, Chen JL. Understanding and targeting cancer stem cells: therapeutic implications and challenges. Acta Pharmacol Sin 2013; 34: 732-740 [PMID: 23685952 DOI: 10.1038/aps.2013.27]

112 Guzman ML, Swiderski CF, Howard DS, Grimes BA, Rossi RM, Szilvassy SJ, Jordan CT. Preferential induction of apoptosis for primary human leukemic stem cells. Proc Natl Acad Sci USA 2002; 99: 16220-16225 [PMID: 12451177 DOI: 10.1073/pnas.252462599]

113 Wang JC. Evaluating therapeutic efficacy against cancer stem cells: new challenges posed by a new paradigm. Cell Stem Cell 2007; 1: 497-501 [PMID: 18938746 DOI: 10.1016/j.stem.2007.10.005]

114 Krivtsov AV, Feng Z, Armstrong SA. Transformation from committed progenitor to leukemia stem cells. Ann N Y Acad Sci 2009; 1176: 144-149 [PMID: 19796242 DOI: 10.1111/j.1749-6632.2009.04966.x]

115 Michnick SW. The connectivity map. Nat Chem Biol 2006; 2: 663-664 [PMID: 17108982 DOI: 10.1038/nchembio1206-663]

116 Lamb J, Crawford ED, Peck D, Modell JW, Blat IC, Wrobel MJ, Lerner J, Brunet JP, Subramanian A, Ross KN, Reich M, Hieronymus H, Wei G, Armstrong SA, Haggarty SJ, Clemons PA, Wei R, Carr SA, Lander ES, Golub TR. The Connectivity Map: using gene-expression signatures to connect small molecules, genes, and disease. Science 2006; 313: 1929-1935 [PMID: 17008526 DOI: 10.1126/science.1132939]

117 Huff CA, Matsui WH, Smith BD, Jones RJ. Strategies to eliminate cancer stem cells: clinical implications. Eur J Cancer 2006; 42: 1293-1297 [PMID: 16644203 DOI: 10.1016/j.ejca.2006.01.045]

118 Walter RB, Appelbaum FR, Estey EH, Bernstein ID. Acute myeloid leukemia stem cells and CD33-targeted immunotherapy. Blood 2012; 119: 6198-6208 [PMID: 22286199 DOI: 10.1182/



blood-2011-11-325050]119 Cassileth PA, Lynch E, Hines JD, Oken MM, Mazza JJ, Bennett

JM, McGlave PB, Edelstein M, Harrington DP, O’Connell MJ. Varying intensity of postremission therapy in acute myeloid leukemia. Blood 1992; 79: 1924-1930 [PMID: 1562720]

120 Hewlett J, Kopecky KJ, Head D, Eyre HJ, Elias L, Kingsbury L, Balcerzak SP, Dabich L, Hynes H, Bickers JN. A prospective evaluation of the roles of allogeneic marrow transplantation and low-dose monthly maintenance chemotherapy in the treatment of adult acute myelogenous leukemia (AML): a Southwest Oncology Group study. Leukemia 1995; 9: 562-569 [PMID: 7723385]

121 Jones RJ, Matsui WH, Smith BD. Cancer stem cells: are we missing the target? J Natl Cancer Inst 2004; 96: 583-585 [PMID: 15100335 DOI: 10.1093/jnci/djh095]

122 Sievers EL, Larson RA, Stadtmauer EA, Estey E, Löwenberg B, Dombret H, Karanes C, Theobald M, Bennett JM, Sherman ML, Berger MS, Eten CB, Loken MR, van Dongen JJ, Bernstein ID, Appelbaum FR. Efficacy and safety of gemtuzumab ozogamicin in patients with CD33-positive acute myeloid leukemia in first relapse. J Clin Oncol 2001; 19: 3244-3254 [PMID: 11432892]

123 Bross PF, Beitz J, Chen G, Chen XH, Duffy E, Kieffer L, Roy S, Sridhara R, Rahman A, Williams G, Pazdur R. Approval summary: gemtuzumab ozogamicin in relapsed acute myeloid leukemia. Clin Cancer Res 2001; 7: 1490-1496 [PMID: 11410481]

124 Petersdorf SH, Kopecky KJ, Slovak M, Willman C, Nevill T, Brandwein J, Larson RA, Erba HP, Stiff PJ, Stuart RK, Walter RB, Tallman MS, Stenke L, Appelbaum FR. A phase 3 study of gemtuzumab ozogamicin during induction and postconsolidation therapy in younger patients with acute myeloid leukemia. Blood 2013; 121: 4854-4860 [PMID: 23591789 DOI: 10.1182/blood-2013-01-466706]

125 Burnett AK, Hills RK, Milligan D, Kjeldsen L, Kell J, Russell NH, Yin JA, Hunter A, Goldstone AH, Wheatley K. Identification of patients with acute myeloblastic leukemia who benefit from the addition of gemtuzumab ozogamicin: results of the MRC AML15 trial. J Clin Oncol 2011; 29: 369-377 [PMID: 21172891 DOI: 10.1200/JCO.2010.31.4310]

126 Castaigne S, Pautas C, Terré C, Raffoux E, Bordessoule D, Bastie JN, Legrand O, Thomas X, Turlure P, Reman O, de Revel T, Gastaud L, de Gunzburg N, Contentin N, Henry E, Marolleau JP, Aljijakli A, Rousselot P, Fenaux P, Preudhomme C, Chevret S, Dombret H. Effect of gemtuzumab ozogamicin on survival of adult patients with de-novo acute myeloid leukaemia (ALFA-0701): a randomised, open-label, phase 3 study. Lancet 2012; 379: 1508-1516 [PMID: 22482940 DOI: 10.1016/S0140-6736(12)60485-1]

127 Hills RK, Castaigne S, Appelbaum FR, Delaunay J, Petersdorf S, Othus M, Estey EH, Dombret H, Chevret S, Ifrah N, Cahn JY, Récher C, Chilton L, Moorman AV, Burnett AK. Addition of gemtuzumab ozogamicin to induction chemotherapy in adult patients with acute myeloid leukaemia: a meta-analysis of individual patient data from randomised controlled trials. Lancet Oncol 2014; 15: 986-996 [PMID: 25008258 DOI: 10.1016/S1470-2045(14)70281-5]

128 Burnett AK, Russell NH, Hills RK, Kell J, Freeman S, Kjeldsen L, Hunter AE, Yin J, Craddock CF, Dufva IH, Wheatley K, Milligan D. Addition of gemtuzumab ozogamicin to induction chemotherapy improves survival in older patients with acute myeloid leukemia. J Clin Oncol 2012; 30: 3924-3931 [PMID: 22851554 DOI: 10.1200/JCO.2012.42.2964]

129 Bernstein ID. Monoclonal antibodies to the myeloid stem cells: therapeutic implications of CMA-676, a humanized anti-CD33 antibody calicheamicin conjugate. Leukemia 2000; 14: 474-475 [PMID: 10720144 DOI: 10.1038/sj.leu.2401663]

130 Rowe JM, Löwenberg B. Gemtuzumab ozogamicin in acute myeloid leukemia: a remarkable saga about an active drug. Blood 2013; 121: 4838-4841 [PMID: 23591788 DOI: 10.1182/blood-2013-03-490482]

131 Fernandez HF, Sun Z, Yao X, Litzow MR, Luger SM, Paietta EM, Racevskis J, Dewald GW, Ketterling RP, Bennett JM, Rowe JM, Lazarus HM, Tallman MS. Anthracycline dose intensification

in acute myeloid leukemia. N Engl J Med 2009; 361: 1249-1259 [PMID: 19776406 DOI: 10.1056/NEJMoa0904544]

132 Lo-Coco F, Cimino G, Breccia M, Noguera NI, Diverio D, Finolezzi E, Pogliani EM, Di Bona E, Micalizzi C, Kropp M, Venditti A, Tafuri A, Mandelli F. Gemtuzumab ozogamicin (Mylotarg) as a single agent for molecularly relapsed acute promyelocytic leukemia. Blood 2004; 104: 1995-1999 [PMID: 15187030 DOI: 10.1182/blood-2004-04-1550]

133 Breccia M, Cimino G, Diverio D, Gentilini F, Mandelli F, Lo Coco F. Sustained molecular remission after low dose gemtuzumab-ozogamicin in elderly patients with advanced acute promyelocytic leukemia. Haematologica 2007; 92: 1273-1274 [PMID: 17768126 DOI: 10.3324/haematol.11329]

134 Jin L, Lee EM, Ramshaw HS, Busfield SJ, Peoppl AG, Wilkinson L, Guthridge MA, Thomas D, Barry EF, Boyd A, Gearing DP, Vairo G, Lopez AF, Dick JE, Lock RB. Monoclonal antibody-mediated targeting of CD123, IL-3 receptor alpha chain, eliminates human acute myeloid leukemic stem cells. Cell Stem Cell 2009; 5: 31-42 [PMID: 19570512 DOI: 10.1016/j.stem.2009.04.018]

135 Konopleva MY, Jordan CT. Leukemia stem cells and micro-environment: biology and therapeutic targeting. J Clin Oncol 2011; 29: 591-599 [PMID: 21220598 DOI: 10.1200/JCO.2010.31.0904]

136 Frankel A, Liu JS, Rizzieri D, Hogge D. Phase I clinical study of diphtheria toxin-interleukin 3 fusion protein in patients with acute myeloid leukemia and myelodysplasia. Leuk Lymphoma 2008; 49: 543-553 [PMID: 18297533 DOI: 10.1080/10428190701799035]

137 Al-Hussaini M, Rettig MP, Ritchey JK, Karpova D, Uy GL, Eissenberg LG, Gao F, Eades WC, Bonvini E, Chichili GR, Moore PA, Johnson S, Collins L, DiPersio JF. Targeting CD123 in acute myeloid leukemia using a T-cell-directed dual-affinity retargeting platform. Blood 2016; 127: 122-131 [PMID: 26531164 DOI: 10.1182/blood-2014-05-575704]

138 Zhou J, Chng WJ. Identification and targeting leukemia stem cells: The path to the cure for acute myeloid leukemia. World J Stem Cells 2014; 6: 473-484 [PMID: 25258669 DOI: 10.4252/wjsc.v6.i4.473]

139 Gadhoum Z, Delaunay J, Maquarre E, Durand L, Lancereaux V, Qi J, Robert-Lezenes J, Chomienne C, Smadja-Joffe F. The effect of anti-CD44 monoclonal antibodies on differentiation and proliferation of human acute myeloid leukemia cells. Leuk Lymphoma 2004; 45: 1501-1510 [PMID: 15370200 DOI: 10.1080/1042819042000206687]

140 Jaiswal S, Jamieson CH, Pang WW, Park CY, Chao MP, Majeti R, Traver D, van Rooijen N, Weissman IL. CD47 is upregulated on circulating hematopoietic stem cells and leukemia cells to avoid phagocytosis. Cell 2009; 138: 271-285 [PMID: 19632178 DOI: 10.1016/j.cell.2009.05.046]

141 Liu J, Wang L, Zhao F, Tseng S, Narayanan C, Shura L, Willingham S, Howard M, Prohaska S, Volkmer J, Chao M, Weissman IL, Majeti R. Pre-Clinical Development of a Humanized Anti-CD47 Antibody with Anti-Cancer Therapeutic Potential. PLoS One 2015; 10: e0137345 [PMID: 26390038 DOI: 10.1371/journal.pone.0137345]

142 Shen M, Schmitt S, Buac D, Dou QP. Targeting the ubiquitin-proteasome system for cancer therapy. Expert Opin Ther Targets 2013; 17: 1091-1108 [PMID: 23822887 DOI: 10.1517/14728222.2013.815728]

143 Attar EC, De Angelo DJ, Supko JG, D’Amato F, Zahrieh D, Sirulnik A, Wadleigh M, Ballen KK, McAfee S, Miller KB, Levine J, Galinsky I, Trehu EG, Schenkein D, Neuberg D, Stone RM, Amrein PC. Phase I and pharmacokinetic study of bortezomib in combination with idarubicin and cytarabine in patients with acute myelogenous leukemia. Clin Cancer Res 2008; 14: 1446-1454 [PMID: 18316568 DOI: 10.1158/1078-0432.CCR-07-4626]

144 Attar EC, Johnson JL, Amrein PC, Lozanski G, Wadleigh M, DeAngelo DJ, Kolitz JE, Powell BL, Voorhees P, Wang ES, Blum W, Stone RM, Marcucci G, Bloomfield CD, Moser B, Larson RA. Bortezomib added to daunorubicin and cytarabine during induction therapy and to intermediate-dose cytarabine for consolidation in patients with previously untreated acute myeloid leukemia age 60 to 75 years: CALGB (Alliance) study 10502. J Clin Oncol 2013; 31: 923-929 [PMID: 23129738 DOI: 10.1200/JCO.2012.45.2177]



145 Blum W, Schwind S, Tarighat SS, Geyer S, Eisfeld AK, Whitman S, Walker A, Klisovic R, Byrd JC, Santhanam R, Wang H, Curfman JP, Devine SM, Jacob S, Garr C, Kefauver C, Perrotti D, Chan KK, Bloomfield CD, Caligiuri MA, Grever MR, Garzon R, Marcucci G. Clinical and pharmacodynamic activity of bortezomib and decitabine in acute myeloid leukemia. Blood 2012; 119: 6025-6031 [PMID: 22566605 DOI: 10.1182/blood-2012-03-413898]

146 Lancet JE, Duong VH, Winton EF, Stuart RK, Burton M, Zhang S, Cubitt C, Blaskovich MA, Wright JJ, Sebti S, Sullivan DM. A phase I clinical-pharmacodynamic study of the farnesyltransferase inhibitor tipifarnib in combination with the proteasome inhibitor bortezomib in advanced acute leukemias. Clin Cancer Res 2011; 17: 1140-1146 [PMID: 21233404 DOI: 10.1158/1078-0432.CCR-10-1878]

147 Walker AR, Klisovic RB, Garzon R, Schaaf LJ, Humphries K, Devine SM, Byrd JC, Grever MR, Marcucci G, Blum W. Phase I study of azacitidine and bortezomib in adults with relapsed or refractory acute myeloid leukemia. Leuk Lymphoma 2014; 55: 1304-1308 [PMID: 23952243 DOI: 10.3109/10428194.2013.833333]

148 Guzman ML, Rossi RM, Neelakantan S, Li X, Corbett CA, Hassane DC, Becker MW, Bennett JM, Sullivan E, Lachowicz JL, Vaughan A, Sweeney CJ, Matthews W, Carroll M, Liesveld JL, Crooks PA, Jordan CT. An orally bioavailable parthenolide analog selectively eradicates acute myelogenous leukemia stem and progenitor cells. Blood 2007; 110: 4427-4435 [PMID: 17804695 DOI: 10.1182/blood-2007-05-090621]

149 Hassane DC, Sen S, Minhajuddin M, Rossi RM, Corbett CA, Balys M, Wei L, Crooks PA, Guzman ML, Jordan CT. Chemical genomic screening reveals synergism between parthenolide and inhibitors of the PI-3 kinase and mTOR pathways. Blood 2010; 116: 5983-5990 [PMID: 20889920 DOI: 10.1182/blood-2010-04-278044]

150 Sethi G, Ahn KS, Pandey MK, Aggarwal BB. Celastrol, a novel triterpene, potentiates TNF-induced apoptosis and suppresses invasion of tumor cells by inhibiting NF-kappaB-regulated gene products and TAK1-mediated NF-kappaB activation. Blood 2007; 109: 2727-2735 [PMID: 17110449]

151 Page S, Fischer C, Baumgartner B, Haas M, Kreusel U, Loidl G, Hayn M, Ziegler-Heitbrock HW, Neumeier D, Brand K. 4-Hydroxynonenal prevents NF-kappaB activation and tumor necrosis factor expression by inhibiting IkappaB phosphorylation and subsequent proteolysis. J Biol Chem 1999; 274: 11611-11618 [PMID: 10206970 DOI: 10.1074/jbc.274.17.11611]

152 Siow RC, Ishii T, Mann GE. Modulation of antioxidant gene expression by 4-hydroxynonenal: atheroprotective role of the Nrf2/ARE transcription pathway. Redox Rep 2007; 12: 11-15 [PMID: 17263901 DOI: 10.1179/135100007X162167]

153 Allegretti M, Ricciardi MR, Licchetta R, Mirabilii S, Orecchioni S, Reggiani F, Talarico G, Foà R, Bertolini F, Amadori S, Torrisi MR, Tafuri A. The pan-class I phosphatidyl-inositol-3 kinase inhibitor NVP-BKM120 demonstrates anti-leukemic activity in acute myeloid leukemia. Sci Rep 2015; 5: 18137 [PMID: 26674543 DOI: 10.1038/srep18137]

154 Lannutti BJ, Meadows SA, Herman SE, Kashishian A, Steiner B, Johnson AJ, Byrd JC, Tyner JW, Loriaux MM, Deininger M, Druker BJ, Puri KD, Ulrich RG, Giese NA. CAL-101, a p110delta selective phosphatidylinositol-3-kinase inhibitor for the treatment of B-cell malignancies, inhibits PI3K signaling and cellular viability. Blood 2011; 117: 591-594 [PMID: 20959606 DOI: 10.1182/blood-2010-03-275305]

155 Lu JW, Lin YM, Lai YL, Chen CY, Hu CY, Tien HF, Ou DL, Lin LI. MK-2206 induces apoptosis of AML cells and enhances the cytotoxicity of cytarabine. Med Oncol 2015; 32: 206 [PMID: 26087957 DOI: 10.1007/s12032-015-0650-7]

156 Konopleva MY, Walter RB, Faderl SH, Jabbour EJ, Zeng Z, Borthakur G, Huang X, Kadia TM, Ruvolo PP, Feliu JB, Lu H, Debose L, Burger JA, Andreeff M, Liu W, Baggerly KA, Kornblau SM, Doyle LA, Estey EH, Kantarjian HM. Preclinical and early clinical evaluation of the oral AKT inhibitor, MK-2206, for the treatment of acute myelogenous leukemia. Clin Cancer Res 2014; 20: 2226-2235 [PMID: 24583795 DOI: 10.1158/1078-0432.CCR-13-1978]

157 Krawczyk J, Keane N, Swords R, O’Dwyer M, Freeman CL, Giles FJ. Perifosine--a new option in treatment of acute myeloid leukemia? Expert Opin Investig Drugs 2013; 22: 1315-1327 [PMID: 23931614 DOI: 10.1517/13543784.2013.826648]

158 Altman JK, Sassano A, Platanias LC. Targeting mTOR for the treatment of AML. New agents and new directions. Oncotarget 2011; 2: 510-517 [PMID: 21680954 DOI: 10.18632/oncotarget.290]

159 Moore J, Seiter K, Kolitz J, Stock W, Giles F, Kalaycio M, Zenk D, Marcucci G. A Phase II study of Bcl-2 antisense (oblimersen sodium) combined with gemtuzumab ozogamicin in older patients with acute myeloid leukemia in first relapse. Leuk Res 2006; 30: 777-783 [PMID: 16730060 DOI: 10.1016/j.leukres.2005.10.025]

160 Marcucci G, Moser B, Blum W, Stock W, Wetzler M, Kolitz JE, Thakuri M, Carter T, Stuart RK, Larson RA. A phase III randomized trial of intensive induction and consolidation chemotherapy { /-} oblimersen, a pro-apoptotic Bcl-2 antisense oligonucleotide in untreated acute myeloid leukemia patients >60 years old. J Clin Oncol 2007; 25 (June 20 Supplement): 7012

161 Rahmani M, Aust MM, Attkisson E, Williams DC, Ferreira-Gonzalez A, Grant S. Inhibition of Bcl-2 antiapoptotic members by obatoclax potently enhances sorafenib-induced apoptosis in human myeloid leukemia cells through a Bim-dependent process. Blood 2012; 119: 6089-6098 [PMID: 22446485 DOI: 10.1182/blood-2011-09-378141]

162 Xie C, Edwards H, Caldwell JT, Wang G, Taub JW, Ge Y. Obatoclax potentiates the cytotoxic effect of cytarabine on acute myeloid leukemia cells by enhancing DNA damage. Mol Oncol 2015; 9: 409-421 [PMID: 25308513 DOI: 10.1016/j.molonc.2014.09.008]

163 Schimmer AD, Raza A, Carter TH, Claxton D, Erba H, DeAngelo DJ, Tallman MS, Goard C, Borthakur G. A multicenter phase I/II study of obatoclax mesylate administered as a 3- or 24-hour infusion in older patients with previously untreated acute myeloid leukemia. PLoS One 2014; 9: e108694 [PMID: 25285531 DOI: 10.1371/journal.pone.0108694]

164 Adams GB, Martin RP, Alley IR, Chabner KT, Cohen KS, Calvi LM, Kronenberg HM, Scadden DT. Therapeutic targeting of a stem cell niche. Nat Biotechnol 2007; 25: 238-243 [PMID: 17237769 DOI: 10.1038/nbt1281]

165 Saito Y, Uchida N, Tanaka S, Suzuki N, Tomizawa-Murasawa M, Sone A, Najima Y, Takagi S, Aoki Y, Wake A, Taniguchi S, Shultz LD, Ishikawa F. Induction of cell cycle entry eliminates human leukemia stem cells in a mouse model of AML. Nat Biotechnol 2010; 28: 275-280 [DOI: 10.1038/nbt.1607]

166 Löwenberg B, van Putten W, Theobald M, Gmür J, Verdonck L, Sonneveld P, Fey M, Schouten H, de Greef G, Ferrant A, Kovacsovics T, Gratwohl A, Daenen S, Huijgens P, Boogaerts M. Effect of priming with granulocyte colony-stimulating factor on the outcome of chemotherapy for acute myeloid leukemia. N Engl J Med 2003; 349: 743-752 [PMID: 12930926 DOI: 10.1056/NEJMoa025406]

167 Estey EH, Thall PF, Pierce S, Cortes J, Beran M, Kantarjian H, Keating MJ, Andreeff M, Freireich E. Randomized phase II study of fludarabine + cytosine arabinoside + idarubicin +/- all-trans retinoic acid +/- granulocyte colony-stimulating factor in poor prognosis newly diagnosed acute myeloid leukemia and myelodysplastic syndrome. Blood 1999; 93: 2478-2484 [PMID: 10194425]

168 Milligan DW, Wheatley K, Littlewood T, Craig JI, Burnett AK. Fludarabine and cytosine are less effective than standard ADE chemotherapy in high-risk acute myeloid leukemia, and addition of G-CSF and ATRA are not beneficial: results of the MRC AML-HR randomized trial. Blood 2006; 107: 4614-4622 [PMID: 16484584 DOI: 10.1182/blood-2005-10-4202]

169 Tavor S, Petit I, Porozov S, Avigdor A, Dar A, Leider-Trejo L, Shemtov N, Deutsch V, Naparstek E, Nagler A, Lapidot T. CXCR4 regulates migration and development of human acute myelogenous leukemia stem cells in transplanted NOD/SCID mice. Cancer Res 2004; 64: 2817-2824 [PMID: 15087398 DOI: 10.1158/0008-5472.CAN-03-3693]

170 Zeng Z, Shi YX, Samudio IJ, Wang RY, Ling X, Frolova O, Levis M, Rubin JB, Negrin RR, Estey EH, Konoplev S, Andreeff



M, Konopleva M. Targeting the leukemia microenvironment by CXCR4 inhibition overcomes resistance to kinase inhibitors and chemotherapy in AML. Blood 2009; 113: 6215-6224 [PMID: 18955566 DOI: 10.1182/blood-2008-05-158311]

171 Uy GL, Rettig MP, Motabi IH, McFarland K, Trinkaus KM, Hladnik LM, Kulkarni S, Abboud CN, Cashen AF, Stockerl-Goldstein KE, Vij R, Westervelt P, DiPersio JF. A phase 1/2 study of chemosensitization with the CXCR4 antagonist plerixafor in relapsed or refractory acute myeloid leukemia. Blood 2012; 119: 3917-3924 [PMID: 22308295 DOI: 10.1182/blood-2011-10-383406]

172 Kuhne MR, Mulvey T, Belanger B, Chen S, Pan C, Chong C, Cao F, Niekro W, Kempe T, Henning KA, Cohen LJ, Korman AJ, Cardarelli PM. BMS-936564/MDX-1338: a fully human anti-CXCR4 antibody induces apoptosis in vitro and shows antitumor activity in vivo in hematologic malignancies. Clin Cancer Res 2013; 19: 357-366 [PMID: 23213054 DOI: 10.1158/1078-0432.CCR-12-2333]

173 Zohren F, Toutzaris D, Klärner V, Hartung HP, Kieseier B, Haas R. The monoclonal anti-VLA-4 antibody natalizumab mobilizes CD34+ hematopoietic progenitor cells in humans. Blood 2008; 111: 3893-3895 [PMID: 18235044 DOI: 10.1182/blood-2007-10-120329]

174 Hsieh YT, Jiang E, Pham J, Kim HN, Abdel-Azim H, Khazal S, Bug G, Spohn G, Bonig H, Kim YM. VLA4 Blockade In Acute Myeloid Leukemia. Blood 2013; 122: 3944

175 Naugler WE, Karin M. NF-kappaB and cancer-identifying targets and mechanisms. Curr Opin Genet Dev 2008; 18: 19-26 [PMID: 18440219 DOI: 10.1016/j.gde.2008.01.020]

176 Guzman ML, Rossi RM, Karnischky L, Li X, Peterson DR, Howard DS, Jordan CT. The sesquiterpene lactone parthenolide induces apoptosis of human acute myelogenous leukemia stem and progenitor cells. Blood 2005; 105: 4163-4169 [PMID: 15687234 DOI: 10.1182/blood-2004-10-4135]

177 Liesveld JL, Rosell KE, Lu C, Bechelli J, Phillips G, Lancet JE, Abboud CN. Acute myelogenous leukemia--microenvironment interactions: role of endothelial cells and proteasome inhibition. Hematology 2005; 10: 483-494 [PMID: 16321813 DOI: 10.1080/10245330500233452]

178 Mohty M, Duarte RF, Croockewit S, Hübel K, Kvalheim G, Russell N. The role of plerixafor in optimizing peripheral blood stem cell mobilization for autologous stem cell transplantation. Leukemia 2011; 25: 1-6 [PMID: 21224858 DOI: 10.1038/leu.2010.224]

179 Broxmeyer HE, Orschell CM, Clapp DW, Hangoc G, Cooper S, Plett PA, Liles WC, Li X, Graham-Evans B, Campbell TB, Calandra G, Bridger G, Dale DC, Srour EF. Rapid mobilization of murine and human hematopoietic stem and progenitor cells with AMD3100, a CXCR4 antagonist. J Exp Med 2005; 201: 1307-1318 [PMID: 15837815 DOI: 10.1084/jem.20041385]

P- Reviewer: Kita K, Li ZJ, Ramírez M, Shao R S- Editor: Ji FF L- Editor: A E- Editor: Wu HL


REVIEW


Stem/progenitor cells and obstructive sleep apnea syndrome - new insights for clinical applications

Miruna Mihaela Micheu, Department of Cardiology, Clinical Emergency Hospital of Bucharest, 014461 Bucharest, Romania

Ana-Maria Rosca, Department of Regenerative Medicine, “Nicolae Simionescu” Institute for Cellular Biology and Pathology, 050568 Bucharest, Romania

Oana-Claudia Deleanu, “Carol Davila” University of Medicine and Pharmacy, 050474 Bucharest, Romania

Oana-Claudia Deleanu, “Marius Nasta” Institute of Pneumophtisiology Bucharest, 050159 Bucharest, Romania

Author contributions: All three authors equally contributed to the conception of the paper, the literature review and analysis, drafting and to critically revising and editing the manuscript.

Conflict-of-interest statement: Authors declare no conflict of interests for this article. No financial support.

Open-Access: This article is an openaccess article which was selected by an inhouse editor and fully peerreviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BYNC 4.0) license, which permits others to distribute, remix, adapt, build upon this work noncommercially, and license their derivative works on different terms, provided the original work is properly cited and the use is noncommercial. See: http://creativecommons.org/licenses/bync/4.0/


Correspondence to: Miruna Mihaela Micheu, MD, PhD, Department of Cardiology, Clinical Emergency Hospital of Bucharest, Floreasca street 8, 014461 Bucharest, Romania. [email protected] Telephone: +40722451755

Received: April 19, 2016Peer-review started: April 19, 2016First decision: June 12, 2016Revised: June 25, 2016Accepted: August 15, 2016Article in press: August 16, 2016Published online: October 26, 2016




AbstractObstructive sleep apnea syndrome (OSAS) is a wide-spread disorder, characterized by recurrent upper airway obstruction during sleep, mostly as a result of complete or partial pharyngeal obstruction. Due to the occurrence of frequent and regular hypoxic events, patients with OSAS are at increased risk of cardiovascular disease, stroke, metabolic disorders, occupational errors, motor vehicle accidents and even death. Thus, OSAS has severe consequences and represents a significant economic burden. However, some of the consequences, as well as their costs can be reduced with appropriate detection and treatment. In this context, the recent advances that were made in stem cell biology knowledge and stem cell - based technologies hold a great promise for various medical conditions, including respiratory diseases. However, the investigation of the role of stem cells in OSAS is still recent and rather limited, requiring further studies, both in animal models and humans. The goal of this review is to summarize the current state of knowledge regarding both lung resident as well as circulating stem/progenitor cells and discuss existing controversies in the field in order to identify future research directions for clinical applications in OSAS. Also, the paper highlights the requisite for inter-institutional, multi-disciplinary research collaborations in order to achieve breakthrough results in the field.

Key words: Obstructive sleep apnea syndrome; Conti-nuous positive airway pressure therapy; Lung resident stem/progenitor cells; Circulating stem/progenitor cells; Lung homeostasis


Core tip: Obstructive sleep apnea syndrome (OSAS) is a widespread disorder characterized by recurrent upper airway obstruction during sleep, resulting in severe consequences such as increased risk of cardiovascular disease, stroke, metabolic disorders, occupational errors,

Miruna Mihaela Micheu, Ana-Maria Rosca, Oana-Claudia Deleanu


Micheu MM et al . Stem/progenitor cells and obstructive sleep apnea

motor vehicle accidents and even death. However, the consequences and their costs can be reduced with appropriate detection and treatment. The goal of this review is to summarize the current state of knowledge regarding both lung resident as well as circulating stem/progenitor cells and to discuss existing controversies in the field in order to identify future research directions for clinical applications in OSAS.

Micheu MM, Rosca AM, Deleanu OC. Stem/progenitor cells and obstructive sleep apnea syndrome new insights for clinical applications. World J Stem Cells 2016; 8(10): 332341 Available from: URL: http://www.wjgnet.com/19480210/full/v8/i10/332.htm DOI: http://dx.doi.org/10.4252/wjsc.v8.i10.332

INTRODUCTIONObstructive sleep apnea syndrome (OSAS) is a prevalent condition with serious undesirable consequences and significant economic burden[1-4]. It is characterized by recurrent upper airway obstruction during sleep, due mostly to complete or partial pharyngeal obstruction. As a result, sleep fragmentation and repetitive hypo-xemia occur, leading to excessive daytime sleepiness, activation of sympathetic nervous system, endothe-lial dysfunction and hemodynamic changes. Conse-quently, patients with OSAS are at increased risk of cardiovascular disease, stroke, metabolic disorders, occupational errors, motor vehicle accidents and even death. Health and public consequences, as well as their costs can be reduced with appropriate identification and treatment[2,5].

The current treatment includes the use of continuous positive airway pressure (CPAP) or oral devices which must be worn at night to help normal breathing. How-ever, the use of such devises raises the problem of patients’ adherence to therapy.

Recent development of scientific methods and understandings of stem cell biology have led to an explosion of interest in stem-cell research; consequently, stem cell - based technologies and therapies soon became one of the most rapidly expanding areas, holding a great promise for various medical conditions.

The goal of this review is to summarize the current state of knowledge regarding both lung resident as well as circulating stem/progenitor cells and discuss existing controversies in the field in order to identify future research directions for clinical applications in OSAS.

LUNG RESIDENT STEM/PROGENITOR CELLSSeveral varieties of human lung resident stem/progenitor cells have been isolated and identified both in vivo and in vitro. Broadly, they comprise three major cell types, which are summarized in Table 1: Epithelial

stem/progenitor cells, endothelial progenitor cells (L-EPCs) and mesenchymal stem cells (L-MSCs).

Epithelial stem/progenitor cells Certain cells, which were formerly considered to be differentiated airway or alveolar epithelial cells, have been proved to be able to proliferate and differentiate into other lung epithelial cell types under specific conditions, which suggested that they could be adult lung resident stem/progenitor cells. However, characterization and classification of such cells into a hierarchy could be quite challenging since the terms “stem” and “progenitor” are often used interchangeably[6,7]. Moreover, data describing putative populations of human adult resident epithelial stem/progenitor cells are limited compared with the large body of evidence in animal models. Several cellular markers have been used alone or in various combinations to identify and isolate stem/progenitor cells in adult human lung.

The first to identify airway epithelial basal cells having stem cell properties in human adult lungs was a group of French scientists in 2007[8].

By using fluorescence-activated cell sorting, Hajj and collaborators demonstrated that epithelial basal cells, which resided on human adult airway surface and expressed CD151 and tissue factor were able to generate a fully differentiated mucocilliary and fun-ctional airway epithelium both in vitro and in vivo, while maintaining their self-renewal potential.

One year later, the existence of a resident side population (SP) cells within the human tracheobronchial epithelium was demonstrated for the first time[9]. SP cells were identified by verapamil-sensitive efflux of the DNA-binding dye Hoechst 33342. Within SP fraction, CD45- cells represented 0.12% ± 0.01% of the total epithelial cell population in normal airway. Their epithelial phenotype was confirmed by positive immunohistochemical staining for the epithelial markers cytokeratin-5, E-cadherin, tight junction protein ZO-1 and transcription factor Trp-63 (p63) - mainly isoform ΔNp63. In culture, these cells demonstrated sustained colony-forming and clonogenic capacity as well as well-preserved telomere length over successive passages. Moreover, CD45- SP cells were able to generate a mul-tilayered differentiated epithelium in air-liquid interface culture, endorsing their stem cell capacity.

Cell type Cell markers

Tracheal basal epithelial cells NGFR+/ITGA6+

Type II alveolar cells HTII-280+

Airway epithelial cells CD151+/TF+

Airway epithelial cells SP/CD45-

Lung epithelial cells c-kit+ (CD117) Lung epithelial cells Ecad/Lgr6+

L-MSCs CD73+/CD90+/CD105+

Table 1 Human lung resident stem/progenitor cells

L-MSC: Lung mesenchymal stem cells.


Shortly after, tracheal basal cells have been isolated based on their expression of the markers nerve growth factor receptor (NGFR) and integrin α6 (ITGA6)[10]. When cultured under appropriate conditions, NGFR+/ITGA6+ cells gave rise to three-dimensional aggregates (bronchospheres) containing cells positive for transcri-ption factor Trp-63 and cytokeratin 14 (Krt14), luminal cells (Krt8+) and also ciliated cells. Hence, human basal cells have been proved to be capable of both self-renewal and generation of differentiated progenies.

In a recent study, Barkauskas et al[11] isolated human type II alveolar cells (AT2) using florescence-activated cell sorting based on a biomarker specific to the apical surface of their membrane (HTII-280). When cocultured with fetal human lung fibroblasts, AT2 cells also formed self-renewing three-dimensional colonies (alveolospheres) composed of a single epithelial layer of HTII-280+ cells.

A putative population of c-kit+ human lung stem cells nested in niches in the adult distal airways has been identified and characterized as self-renewing, clonogenic, and multipotent both in vitro and in vivo. When transplanted into damaged mouse lungs, human c-kit+ cells not only engrafted, but they were also able to generate human bronchioles, alveoli, and pulmonary vessels structurally and functionally integrated with the host organism[12]. As appealing as this hypothesis appears - one adult lung cell being capable to give birth to smooth muscle, vasculature, airways and alveoli - it needs further supporting evidence and validation using lineage-tracing during homeostasis and injury[13].

Shortly after description of c-kit+ human lung stem cells, the existence of another population of putative stem cells was reported[14]. These cells were chara-cterized as positive for E-Cadherin and leucine-rich repeat-containing G-protein-coupled receptor 6 (E-Cad/Lgr6+) while being a sub-population of ITGA6+ cells. In culture, clonally derived E-Cad/Lgr6+ cells formed aggregates capable of in vitro indefinite expansion while expressing lung-specific (pulmonary-associated surfactant protein C, Clara cell 10 protein, aquaporin 5), epithelial (E-Cad) and stem cell (Sox9, Lgr5/6, ITGA6) markers. Unlike c-kit+ cells, E-Cad/Lgr6+ were not able to differentiate into mesenchymal or endothelial cells. E-Cad/Lgr6+ single cell transplantations into the kidney capsule generated differentiated bronchioalveolar tissue while retaining the ability to self-renew[14].

Thus, all these data support the involvement of resident lung stem/progenitor cells in tissue homeos-tasis, but also in tissue repair after cellular injury.

L-MSCsSeveral groups have identified human lung resident cells fulfilling criteria for definition of mesenchymal stem cells[15-18]. According to Mesenchymal and Tissue Stem Cell Committee of the International Society for Cellular Therapy criteria, the definition of human MSCs comprises: (1) plastic adherence in standard culture conditions; (2) expression of surface molecules CD73,

CD90 and CD105 in the absence of CD34, CD45, HLA-DR, CD14 or CD11b, CD79a, or CD19 surface molecules as assessed by fluorescenceactivated cell sorter analysis and (3) a capacity for differentiation into osteoblasts, adipocytes, and chondroblasts in vitro[19]. Besides these established and generally accepted criteria, another marker which was used to identify human L-MSCs was the ATP binding cassette G transporter[20].

It is common knowledge that mesenchymal stem cells (MSCs) exhibit high telomerase activity and an extensive secretome that is immunomodulatory, antifibrotic, and trophic for endogenous tissue progenitor cells; this robust evidence supports their role as key players in organ homeostasis and repair following injury, and endorse MSCs as ideal candidates for cell-based therapies. L-MSCs demonstrated characteristics similar to other tissue MSCs including paracrine anti-inflam-matory properties, suppression of T cell proliferation as well as the ability to differentiate to myofibroblasts[15,21].

Studies conducted so far - both in animal and human lung tissue identified MSCs niches colocalized with the alveolar capillary network in the distal lung, suggesting that L-MSCs are anatomically similar to adult angioblasts, pericytes and endothelial precursors[22,23]. The data regarding the perivascular location of L-MSCs are in agreement with previously reported information which indicates that the distribution of MSCs throughout the post-natal organism is related to their existence in a perivascular niche[24-26].

Postnatal endothelial progenitor cells It represent a heterogeneous group of precursor cells, which have been isolated from bone marrow, peripheral and umbilical cord blood, as well as vascular wall, participating in both new blood vessel formation and vascular homeostasis[27-31].

Unfortunately, no specific marker for endothelial progenitor cells (EPCs) has been identified yet. Cells considered being EPCs share distinguishing features as high capacity for self-renewal and regeneration, fast proliferating endothelial colony-forming units and angiogenic properties. The quest for identifying tissue resident EPCs has not been an easy one since the difficulty to discriminate circulating EPCs from bone marrow and tissue resident EPCs.

Currently, the existence of similar cells in the lungs - resident lung EPCs (L-EPCs) - has been highlighted only in animal models. L-EPCs express classical endothelial cell markers (CD31) and display a microvascular phenotype. Furthermore, similarly to circulating and vessel wall-derived EPCs, mouse L-EPCs express CD34, CD133 and VEGFR-2, while rat L-EPCs are negative for CD133. These cells proved to be highly proliferative and capable of renewing the entire hierarchy of endothelial cell growth potentials. Also, L-EPCs are vasculogenic in Matrigel assays in vitro and in vivo[32-34]. These data support the premise that the lung microvasculature is a rich endothelial progenitor niche, with essential role in maintaining vascular homeostasis.



CIRCULATING STEM/PROGENITOR CELLS To this point, mainly two circulating stem/progenitor cell types are envisaged as having a potential for immediate clinical application in relation to OSAS: EPCs and MSCs[35].

Circulating EPCsAs previously mentioned, circulating EPCs are bone marrow derived cells that can be found in peripheral and umbilical cord blood.

The phenotype of an accurate EPC, the reliable methods to assess EPCs’ quantity and quality as well as their functional status are still under debate. In a review published in 2005, Khakoo et al[31] described the EPCs having the following characteristics: (1) they are circulating, bone marrow-derived cells that are functionally and phenotypically distinct from mature endothelial cells; (2) they can differentiate into endothelial cells in vitro, as assessed by expression profiles and functional characteristics and (3) they can contribute to in vivo vasculogenesis and/or vascular homeostasis.

However, since their first mention[27], the definition of EPCs has come under serious dispute, taking into consideration that further studies have shown that the term “EPC” do not define a single cell type, but rather describe various cell types able to differentiate into the endothelial lineage[36-40].

According to the timing of their growth in culture, there are at least two morphologically and functionally different endothelial cell populations that originate from circulating mononuclear cells: The so-called “early” and “late” EPCs. The early EPCs are derived from the monocytes and express hematopoietic markers such as CD45, CD14, CD11b and CD11c, while the late EPCs, which are believed to be a subset of CD14- CD34- KDR- cells do not express CD45 or CD14. Although these two types of cells are different-originated with distinct function in vitro, both of them contribute to in vivo neovascularization in animal models of ischemia[41-43].

The existence of two different EPCs populations in human peripheral blood, one with high proliferative capacity and the other with lower proliferative capacity, both with comparable efficacy in neovascularization in an ischemic limb model was demonstrated also by the work of Hur et al[44]. Early EPCs had spindle shape, their growth in culture peaked at 2 to 3 wk and died at 4 wk, whereas late EPCs with cobblestone shape appeared after 2 to 3 wk in culture, showed exponential growth at 4 to 8 wk, and lived up to 12 wk. Late EPCs was different from early EPCs, having strong expression of VE-cadherin, Flt-1, KDR, and vWF. Late EPCs produced more nitric oxide, incorporated more readily into human umbilical vein endothelial cells monolayer, and formed capillary tubes better than early EPCs. However, early EPCs had a more pronounced in vitro capacity to secrete

angiogenic cytokines [such as and vascular endothelial growth factor (VEGF), IL8] in comparison to late EPCs.

The final touch in the field (till this moment) was added by Sieveking and collaborators, who emphasized the “strikingly different angiogenic properties of different EPCs: Late-outgrowth endothelial cells directly participate in tubulogenesis, whereas early EPCs augment angio-genesis in a paracrine fashion, with implications for optimizing cell therapies for neovascularisation”[45]. As for surface markers, their results are consistent with the previous studies, endothelial antigens (e.g., CD31, CD146, VEGFR-2) being expressed by both early and late EPCs. These two populations could be discriminated by CD14 and CD45 expression, with early EPCs showing high expression of these markers (over 95%) whereas late EPCs did not express either maker.

EPCs are able to migrate to the site of injury and participate directly and indirectly to the development of new blood vessels, therefore having a key role in the maintenance of endothelium integrity and function[46]. Moreover, these cells play an essential role not only in physiological neovascularization, but also in pathological conditions (wound healing, tissue regeneration in ische-mia, tissue remodeling in diabetes mellitus and heart failure, growth of tumors)[47-50]. Studies conducted so far have shown that EPCs’ mobilization from the bone marrow is governed by a multifaceted interaction between cytokines/chemokines, proteinases and cell adhesion molecules[51-55], many of them having abnormal expression in OSAS[56-58].

In order to minimize the potential interfering factors, studies on EPCs in OSAS have been conducted on subjects free of any other known cardiovascular risk factors. OSAS patients and healthy controls were well-matched for age, sex and body mass index; moreover, they had similar blood pressure, fasting blood glucose and total cholesterol levels[59].

Even though, the cumulative results regarding the level of circulating EPCs in OSAS are still under debate, since existing studies have reported heterogeneous data (Table 2).

Five studies out of 11 reported a decrease in EPCs in OSAS patients comparative with healthy controls, either adults or children[60-64]. In contrast with these findings, data from quite similar studies showed that patients suffering of this medical condition had unchanged[65-67] or even increased number of circulating EPCs in peri-pheral blood compared with the control group[68-70].

It is only natural to ask ourselves why there is so much divergence in apparently similar studies. Some possible reasons concerning this heterogeneity have been identified[59]: (1) Different studies measured circulating EPCs by means of different methods: Flow cytometry vs endothelial colony forming units assay; (2) Different investigators used different marker combinations for the assessment of EPCs (Table 2); (3) Different participants: Adults vs children or male vs men and women; (4) Small number of subjects enrolled, as



well as the small number of EPCs circulating in peripheral blood.

Also, taking into consideration the complexity of pathogenic mechanisms involved, it is very possible that - depending upon disease severity and duration - certain mechanisms to prevail.

Potential molecular mechanisms through which OSAS has effects on EPCs were reviewed in the exhaus-tive work of Wang et al[59]. Briefly, intermittent hypoxia and sleep fragmentation which are key features of OSAS act as triggers of oxidative stress, systemic inflammation and sympathetic activation.

While most mechanisms lead to decreased EPCs mobilization and increased cell apoptosis, there are others with stimulating effect as regards mobilization through hypoxia inducible factor 1 (HIF-1) regulatory pathway activation and upregulation of proangiogenic factors including vascular endothelial growth factor, stromal-derived factor-1 and erythropoietin.

But what is the effect of treatment on EPCs? The current gold standard treatment for OSAS is CPAP therapy, which has been demonstrated not only to significantly improve sleep quality, reduce the risk of comorbidities and increase patient quality of life, but also to minimize risks of accidents and injuries[71-74]. By effectively diminishing the intermittent hypoxia episodes, CPAP can prevent the activation of pathogenic mechanism that has been shown to affect EPCs number and function.

As depicted in Table 3, CPAP therapy had opposite consequences on circulating EPCs: Normalization in patients having decreased levels[61-63] - or lessening in patients with high levels[68,70]. One study reported unchanged values before and after treatment[67]. Of course, there is an essential factor to consider when assessing rehabilitation effect: Patients’ adherence to prescribed therapy. Adherence to CPAP treatment is still a critical and complex issue, subjected to the influence of a wide array of factors[75-79]. Poor adherence to CPAP is generally acknowledged as a major limiting factor in treating OSAS, with a negative impact on therapeutic success[80-82]. Studies conducted in the 1990s or even

recently, revealed that approximately 30%-50% of OSAS patients rejected CPAP immediately, the pro-portion of noncompliant patients reaching 80% within a year[83-86].

Circulating MSCsMSCs are located mainly in the bone marrow, but are also found in various tissues and organs. When stimu-lated by specific signals, these cells are mobilized from their perivascular niche into peripheral blood and home to the target tissues where they contribute to local tissue regeneration and homeostasis[87-90].

There is only little evidence regarding the number and function of circulating MSCs in peripheral blood in OSAS; only 3 studies in animal models[91-93], and a single one in humans, in which circulating MSCs could not be detected, probably because their very low number[94].

In an acute rat model of recurrent airway obstru-ctions mimicking OSAS, Carreras et al[91] demonstrated early release of MSCs into circulation, higher mobility, increased adhesion to endothelial cells and enhanced endothelial wound repair in rats subjected to recurrent obstructive apneas (15 s apnea/min for 3 h), as com-pared to the number observed in control animals under normoxia[93]. In addition, in the group of apneic rats subjected to MSCs intravenous injection, MSCs triggered an early systemic antiinflammatory response by decreasing levels of interleukin-1 beta (IL-1β)[92]. This property of MSCs has been confirmed in a chronic murine model of OSAS in which atrial fibrosis has been inhibited by the intravenous administration of MSCs as a result of normalization of IL-1β plasma levels[95].

Considering all this data, one of the main benefits of MSCs therapy in OSAS patients could be the local and systemic antiinflammatory effect. Besides this, exposure to hypoxia upregulates microRNA-486 (miR-486) expression in MSCs resulting in increased production of angiogenic factors (hepatocyte growth factor and VEGF), increased proliferation and reduced apoptosis[96].

One of the challenges for cell therapy is that it requires high numbers and good quality of stem cells.

Ref. Study design EPCs phenotype OSAS effect on EPCs number

de la Peña et al[60] Adults, men, flow cytometry CD34+VEGFR2+ Reduced number Jelic et al[61] Adults, both genders, flow cytometry CD34+CD133+VEGFR2+ Reduced number Jelic et al[62] Adults, both genders, flow cytometry CD34+CD133+VEGFR2+ Reduced number Murri et al[63] Adults, both genders, flow cytometry CD45-CD34+CD133+VEGFR2+ Reduced number Kheirandish-Gozal et al[64] Children, both genders, flow cytometry CD34+CD133+VEGFR2+ Reduced number Martin et al[65] Adults, both genders, flow cytometry CD34+CD133+CD45dim Unchanged number Yun et al[66] Adults, both genders, endothelial colony forming units assay - Unchanged number Simpson et al[67] Adults, men, flow cytometry CD34+KDR+ Unchanged number

CD45-CD34+KDR+

Kizawa et al[68] Adults, men, flow cytometry CD133+CD34+CD202b+CD45- Increased number Lui et al[69] Adults, both genders, flow cytometry CD34+ Increased number Chou et al[70] Adults, both genders, flow cytometry CD34+ Increased number

Table 2 Circulating endothelial progenitor cells studies in patients with obstructive sleep apnea syndrome

EPC: Endothelial progenitor cell; OSAS: Obstructive sleep apnea syndrome.



Among factors impairing the quantity and quality of autologous MSCs is age which is associated with pro-gressive loss of cell proliferation and differentiation potential.

Nevertheless, MSCs cultured under hypoxic condition exhibited enriched self-renewing and proliferation capa-city even in aged donors compared to normal condition. It was shown that, at low O2 concentration (such as 1% O2) MSCs are resistant to apoptosis and do not lose their beneficial paracrine activity, suggesting that they could be transplanted in hypoxia affected tissues without losing their viability or therapeutic properties[97]. In a very recent study, different profiles of hypoxia-inducible miRNA signatures between young and aged MSCs have been identified and demonstrated to tar-get transcriptional activity leading to enhanced cell proliferation and migration, but also to decrease in growth arrest and apoptosis through the activation of multiple signaling pathways. According to donor’s age and culture conditions a therapeutic potential hierarchy of MSCs was established as follows: Young (hypoxia) > young (normoxia) > old aged (hypoxia) > old aged (normoxia)[98].

Another particular aspect concerning MSCs thera-peutic applications is related to their hypoimmunogenic or “immune privileged” status; this unique feature endorses them as suitable candidates for allogeneic transplant.

Human MSCs display low levels of human leukocyte antigen (HLA) major histocompatibility complex class I, lack major histocompatibility complex class II expression and do not express costimulatory molecules CD40, CD80 and CD86[99-101]. Furthermore, these cells have been shown to have immunomodulatory effects on both the innate and adaptive immune system, being able to suppress the activity of a variety of immune cells, including natural killer T cells, dendritic cells, neutrophils, monocytes, macrophages, B and T cells[102-105].

PERSPECTIVES Research regarding the role of SC in OSAS pathology and their potential use in OSAS treatment is still recent and quite limited, requiring further studies in both animal models and humans. Future directions and recom-

mendations to achieve advanced understanding of mechanisms of lung homeostasis and repair have been proposed during expert meetings[106-108]. In this regard, it is necessary to identify additional cell surface markers to characterize lung cell populations but also to refine the nomenclature used for resident and circulating lung stem cells. Additional studies are required to identify and characterize resident lung stem/progenitors cells and their niches comparatively between different lung compartments and also regulatory pathways guiding their behavior. Mechanisms of recruitment, mobilization and homing of circulating or transplanted cells to various lung compartments have to be elucidated based on diseasespecific models (including large animal models).

Maybe the most important take - home messages are those emphasizing the requisite for inter-institutional, multi-disciplinary research collaborations and consor-tiums. A successful stem cell research requires state-of-the art infrastructure and vast resources. Connecting with existing networks, nonprofit respiratory disease foundations and industry could accelerate clinical applications. Also, joining other clinical trials in related disciplines (e.g., cardiovascular disease) would provide valuable data for development of stem cell research-derived therapeutics.

Last but not least, obtained information must be largely disseminated through existing core services, facilities and web links.

REFERENCES1 Young T, Palta M, Dempsey J, Skatrud J, Weber S, Badr S. The

occurrence of sleepdisordered breathing among middleaged adults. N Engl J Med 1993; 328: 12301235 [PMID: 8464434 DOI: 10.1056/NEJM199304293281704]

2 Tarasiuk A, Reuveni H. The economic impact of obstructive sleep apnea. Curr Opin Pulm Med 2013; 19: 639644 [PMID: 24060978 DOI: 10.1097/MCP.0b013e3283659e1e]

3 Isetta V, Negrín MA, Monasterio C, Masa JF, Feu N, Álvarez A, CamposRodriguez F, Ruiz C, Abad J, VázquezPolo FJ, Farré R, Galdeano M, Lloberes P, Embid C, de la Peña M, Puertas J, Dalmases M, Salord N, Corral J, Jurado B, León C, Egea C, Muñoz A, Parra O, Cambrodi R, MartelEscobar M, Arqué M, Montserrat JM. A Bayesian costeffectiveness analysis of a telemedicinebased strategy for the management of sleep apnoea: a multicentre randomised controlled trial. Thorax 2015; 70: 10541061 [PMID: 26310452 DOI: 10.1136/thoraxjnl2015207032]

Ref. Study design EPCs phenotype CPAP effect on EPCs number

Jelic et al[61] Adults, both genders, flow cytometry CD34+CD133+VEGFR2+ Normalized after 4 wk of CPAP Jelic et al[62] Adults, both genders, flow cytometry CD34+CD133+VEGFR2+ Normalized after 4 wk of CPAP Murri et al[63] Adults, both genders, flow cytometry CD45-CD34+CD133+VEGFR2+ Values returned to control values after 1 mo of CPAP Simpson et al[67] Adults, men, flow cytometry CD34+KDR+

CD34+KDR+CD45-Unchanged

Kizawa et al[68] Adults, men, flow cytometry CD133+CD34+CD202b+CD45- Values decreased after 12 wk of CPAP treatment Chou et al[70] Adults, both genders, flow cytometry CD34+ Mobilization ratio in patients with OSAS tended to

decline

Table 3 Circulating endothelial progenitor cells studies in patients with obstructive sleep apnea syndrome treated by continuous positive airway pressure

EPC: Endothelial progenitor cell; OSAS: Obstructive sleep apnea syndrome; CPAP: Continuous positive airway pressure.



4 Jurado-Gámez B, Guglielmi O, Gude F, BuelaCasal G. Workplace accidents, absenteeism and productivity in patients with sleep apnea. Arch Bronconeumol 2015; 51: 213218 [PMID: 25129165 DOI: 10.1016/j.arbres.2014.07.003]

5 Antic NA, Heeley E, Anderson CS, Luo Y, Wang J, Neal B, Grunstein R, Barbe F, LorenziFilho G, Huang S, Redline S, Zhong N, McEvoy RD. The Sleep Apnea cardioVascular Endpoints (SAVE) Trial: Rationale, Ethics, Design, and Progress. Sleep 2015; 38: 12471257 [PMID: 25669180]

6 Rock JR, Hogan BL. Epithelial progenitor cells in lung development, maintenance, repair, and disease. Annu Rev Cell Dev Biol 2011; 27: 493512 [PMID: 21639799 DOI: 10.1146/annurevcellbio100109104040]

7 Weiss DJ. Concise review: current status of stem cells and regenerative medicine in lung biology and diseases. Stem Cells 2014; 32: 1625 [PMID: 23959715 DOI: 10.1002/stem.1506]

8 Hajj R, Baranek T, Le Naour R, Lesimple P, Puchelle E, Coraux C. Basal cells of the human adult airway surface epithelium retain transitamplifying cell properties. Stem Cells 2007; 25: 139148 [PMID: 17008423 DOI: 10.1634/stemcells.20060288]

9 Hackett TL, Shaheen F, Johnson A, Wadsworth S, Pechkovsky DV, Jacoby DB, Kicic A, Stick SM, Knight DA. Characterization of side population cells from human airway epithelium. Stem Cells 2008; 26: 25762585 [PMID: 18653771 DOI: 10.1634/stemcells.20080171]

10 Rock JR, Onaitis MW, Rawlins EL, Lu Y, Clark CP, Xue Y, Randell SH, Hogan BL. Basal cells as stem cells of the mouse trachea and human airway epithelium. Proc Natl Acad Sci USA 2009; 106: 1277112775 [PMID: 19625615 DOI: 10.1073/pnas.0906850106]

11 Barkauskas CE, Cronce MJ, Rackley CR, Bowie EJ, Keene DR, Stripp BR, Randell SH, Noble PW, Hogan BL. Type 2 alveolar cells are stem cells in adult lung. J Clin Invest 2013; 123: 30253036 [PMID: 23921127 DOI: 10.1172/JCI68782]

12 Kajstura J, Rota M, Hall SR, Hosoda T, D’Amario D, Sanada F, Zheng H, Ogórek B, RondonClavo C, FerreiraMartins J, Matsuda A, Arranto C, Goichberg P, Giordano G, Haley KJ, Bardelli S, Rayatzadeh H, Liu X, Quaini F, Liao R, Leri A, Perrella MA, Loscalzo J, Anversa P. Evidence for human lung stem cells. N Engl J Med 2011; 364: 17951806 [PMID: 21561345 DOI: 10.1056/NEJMoa1101324]

13 Lung stem cells: looking beyond the hype. Nat Med 2011; 17: 788789 [PMID: 21738157 DOI: 10.1038/nm0711788]

14 Oeztuerk-Winder F, Guinot A, Ochalek A, Ventura JJ. Regulation of human lung alveolar multipotent cells by a novel p38α MAPK/miR1792 axis. EMBO J 2012; 31: 34313441 [PMID: 22828869 DOI: 10.1038/emboj.2012.192]

15 Lama VN, Smith L, Badri L, Flint A, Andrei AC, Murray S, Wang Z, Liao H, Toews GB, Krebsbach PH, PetersGolden M, Pinsky DJ, Martinez FJ, Thannickal VJ. Evidence for tissueresident mesenchymal stem cells in human adult lung from studies of transplanted allografts. J Clin Invest 2007; 117: 989996 [PMID: 17347686 DOI: 10.1172/JCI29713]

16 Jarvinen L, Badri L, Wettlaufer S, Ohtsuka T, Standiford TJ, Toews GB, Pinsky DJ, PetersGolden M, Lama VN. Lung resident mesenchymal stem cells isolated from human lung allografts inhibit T cell proliferation via a soluble mediator. J Immunol 2008; 181: 43894396 [PMID: 18768898 DOI: 10.4049/jimmunol.181.6.4389]

17 Jakob M, Hemeda H, Janeschik S, Bootz F, Rotter N, Lang S, Brandau S. Human nasal mucosa contains tissueresident immunologically responsive mesenchymal stromal cells. Stem Cells Dev 2010; 19: 635644 [PMID: 19761404 DOI: 10.1089/scd.2009.0245]

18 Bozyk PD, Popova AP, Bentley JK, Goldsmith AM, Linn MJ, Weiss DJ, Hershenson MB. Mesenchymal stromal cells from neonatal tracheal aspirates demonstrate a pattern of lungspecific gene expression. Stem Cells Dev 2011; 20: 19952007 [PMID: 21341990 DOI: 10.1089/scd.2010.0494]

19 Dominici M, Le Blanc K, Mueller I, SlaperCortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop Dj, Horwitz E. Minimal criteria for defining multipotent mesenchymal stromal cells. The

International Society for Cellular Therapy position statement. Cytotherapy 2006; 8: 315317 [PMID: 16923606 DOI: 10.1080/14653240600855905]

20 Zhou S, Schuetz JD, Bunting KD, Colapietro AM, Sampath J, Morris JJ, Lagutina I, Grosveld GC, Osawa M, Nakauchi H, Sorrentino BP. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the sidepopulation phenotype. Nat Med 2001; 7: 10281034 [PMID: 11533706 DOI: 10.1038/nm09011028]

21 Popova AP, Bozyk PD, Bentley JK, Linn MJ, Goldsmith AM, Schumacher RE, Weiner GM, Filbrun AG, Hershenson MB. Isolation of tracheal aspirate mesenchymal stromal cells predicts bronchopulmonary dysplasia. Pediatrics 2010; 126: e1127e1133 [PMID: 20937656 DOI: 10.1542/peds.20093445]

22 Crisan M, Yap S, Casteilla L, Chen CW, Corselli M, Park TS, Andriolo G, Sun B, Zheng B, Zhang L, Norotte C, Teng PN, Traas J, Schugar R, Deasy BM, Badylak S, Buhring HJ, Giacobino JP, Lazzari L, Huard J, Péault B. A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell 2008; 3: 301313 [PMID: 18786417 DOI: 10.1016/j.stem.2008.07.003]

23 Rolandsson S, Andersson Sjöland A, Brune JC, Li H, Kassem M, Mertens F, Westergren A, Eriksson L, Hansson L, Skog I, Bjermer L, Scheding S, WestergrenThorsson G. Primary mesenchymal stem cells in human transplanted lungs are CD90/CD105 perivascularly located tissueresident cells. BMJ Open Respir Res 2014; 1: e000027 [PMID: 25478178 DOI: 10.1136/bmjresp2014000027]

24 da Silva Meirelles L, Caplan AI, Nardi NB. In search of the in vivo identity of mesenchymal stem cells. Stem Cells 2008; 26: 22872299 [PMID: 18566331 DOI: 10.1634/stemcells.20071122]

25 da Silva Meirelles L, Chagastelles PC, Nardi NB. Mesenchymal stem cells reside in virtually all postnatal organs and tissues. J Cell Sci 2006; 119: 22042213 [PMID: 16684817 DOI: 10.1242/jcs.02932]

26 Bluguermann C, Wu L, Petrigliano F, McAllister D, Miriuka S, Evseenko DA. Novel aspects of parenchymalmesenchymal interactions: from cell types to molecules and beyond. Cell Biochem Funct 2013; 31: 271280 [PMID: 23315627 DOI: 10.1002/cbf.2950]

27 Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T, Witzenbichler B, Schatteman G, Isner JM. Isolation of putative progenitor endothelial cells for angiogenesis. Science 1997; 275: 964967 [PMID: 9020076 DOI: 10.1126/science.275.5302.964]

28 Asahara T, Takahashi T, Masuda H, Kalka C, Chen D, Iwaguro H, Inai Y, Silver M, Isner JM. VEGF contributes to postnatal neovascularization by mobilizing bone marrowderived endothelial progenitor cells. EMBO J 1999; 18: 39643972 [PMID: 10406801 DOI: 10.1093/emboj/18.14.3964]

29 Takahashi T, Kalka C, Masuda H, Chen D, Silver M, Kearney M, Magner M, Isner JM, Asahara T. Ischemia and cytokineinduced mobilization of bone marrowderived endothelial progenitor cells for neovascularization. Nat Med 1999; 5: 434438 [PMID: 10202935 DOI: 10.1038/7434]

30 Ingram DA, Mead LE, Tanaka H, Meade V, Fenoglio A, Mortell K, Pollok K, Ferkowicz MJ, Gilley D, Yoder MC. Identification of a novel hierarchy of endothelial progenitor cells using human peripheral and umbilical cord blood. Blood 2004; 104: 27522760 [PMID: 15226175 DOI: 10.1182/blood2004041396]

31 Khakoo AY, Finkel T. Endothelial progenitor cells. Annu Rev Med 2005; 56: 79101 [PMID: 15660503 DOI: 10.1146/annurev.med.56.090203.104149]

32 Alvarez DF, Huang L, King JA, ElZarrad MK, Yoder MC, Stevens T. Lung microvascular endothelium is enriched with progenitor cells that exhibit vasculogenic capacity. Am J Physiol Lung Cell Mol Physiol 2008; 294: L419L430 [PMID: 18065657 DOI: 10.1152/ajplung.00314.2007]

33 Schniedermann J, Rennecke M, Buttler K, Richter G, Städtler AM, Norgall S, Badar M, Barleon B, May T, Wilting J, Weich HA. Mouse lung contains endothelial progenitors with high capacity to form blood and lymphatic vessels. BMC Cell Biol 2010; 11: 50 [PMID: 20594323 DOI: 10.1186/147121211150]



34 Basile DP, Yoder MC. Circulating and tissue resident endothelial progenitor cells. J Cell Physiol 2014; 229: 1016 [PMID: 23794280 DOI: 10.1002/jcp.24423]

35 Almendros I, Carreras A, Montserrat JM, Gozal D, Navajas D, Farre R. Potential role of adult stem cells in obstructive sleep apnea. Front Neurol 2012; 3: 112 [PMID: 22807922 DOI: 10.3389/fneur.2012.00112]

36 Ito H, Rovira II, Bloom ML, Takeda K, Ferrans VJ, Quyyumi AA, Finkel T. Endothelial progenitor cells as putative targets for angiostatin. Cancer Res 1999; 59: 58755877 [PMID: 10606226]

37 Hill JM, Zalos G, Halcox JP, Schenke WH, Waclawiw MA, Quyyumi AA, Finkel T. Circulating endothelial progenitor cells, vascular function, and cardiovascular risk. N Engl J Med 2003; 348: 593600 [PMID: 12584367 DOI: 10.1056/NEJMoa022287]

38 Rohde E, Malischnik C, Thaler D, Maierhofer T, Linkesch W, Lanzer G, Guelly C, Strunk D. Blood monocytes mimic endothelial progenitor cells. Stem Cells 2006; 24: 357367 [PMID: 16141361 DOI: 10.1634/stemcells.20050072]

39 Rohde E, Bartmann C, Schallmoser K, Reinisch A, Lanzer G, Linkesch W, Guelly C, Strunk D. Immune cells mimic the morphology of endothelial progenitor colonies in vitro. Stem Cells 2007; 25: 17461752 [PMID: 17395771 DOI: 10.1634/stemcells.20060833]

40 Yoder MC, Mead LE, Prater D, Krier TR, Mroueh KN, Li F, Krasich R, Temm CJ, Prchal JT, Ingram DA. Redefining endothelial progenitor cells via clonal analysis and hematopoietic stem/progenitor cell principals. Blood 2007; 109: 18011809 [PMID: 17053059 DOI: 10.1182/blood200608043471]

41 Werner N, Junk S, Laufs U, Link A, Walenta K, Bohm M, Nickenig G. Intravenous transfusion of endothelial progenitor cells reduces neointima formation after vascular injury. Circ Res 2003; 93: e17e24 [PMID: 12829619 DOI: 10.1161/01.RES.0000083812.30141.74]

42 Hristov M, Weber C. Endothelial progenitor cells: characterization, pathophysiology, and possible clinical relevance. J Cell Mol Med 2004; 8: 498508 [PMID: 15601578 DOI: 10.1111/j.15824934.2004.tb00474.x]

43 Nagano M, Yamashita T, Hamada H, Ohneda K, Kimura K, Nakagawa T, Shibuya M, Yoshikawa H, Ohneda O. Identification of functional endothelial progenitor cells suitable for the treatment of ischemic tissue using human umbilical cord blood. Blood 2007; 110: 151160 [PMID: 17379743 DOI: 10.1182/blood200610047092]

44 Hur J, Yoon CH, Kim HS, Choi JH, Kang HJ, Hwang KK, Oh BH, Lee MM, Park YB. Characterization of two types of endothelial progenitor cells and their different contributions to neovasculogenesis. Arterioscler Thromb Vasc Biol 2004; 24: 288293 [PMID: 14699017 DOI: 10.1161/01.ATV.0000114236.77009.06]

45 Sieveking DP, Buckle A, Celermajer DS, Ng MK. Strikingly different angiogenic properties of endothelial progenitor cell subpopulations: insights from a novel human angiogenesis assay. J Am Coll Cardiol 2008; 51: 660668 [PMID: 18261686 DOI: 10.1016/j.jacc.2007.09.059]

46 Asahara T, Masuda H, Takahashi T, Kalka C, Pastore C, Silver M, Kearne M, Magner M, Isner JM. Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res 1999; 85: 221228 [PMID: 10436164 DOI: 10.1161/01.RES.85.3.221]

47 Georgescu A. Vascular dysfunction in diabetes: The endothelial progenitor cells as new therapeutic strategy. World J Diabetes 2011; 2: 9297 [PMID: 21860692 DOI: 10.4239/wjd.v2.i6.92]

48 Balaji S, King A, Crombleholme TM, Keswani SG. The Role of Endothelial Progenitor Cells in Postnatal Vasculogenesis: Implications for Therapeutic Neovascularization and Wound Healing. Adv Wound Care (New Rochelle) 2013; 2: 283295 [PMID: 24527350 DOI: 10.1089/wound.2012.0398]

49 Lee PS, Poh KK. Endothelial progenitor cells in cardiovascular diseases. World J Stem Cells 2014; 6: 355366 [PMID: 25126384 DOI: 10.4252/wjsc.v6.i3.355]

50 Moccia F, Zuccolo E, Poletto V, Cinelli M, Bonetti E, Guerra G, Rosti V. Endothelial progenitor cells support tumour growth and

metastatisation: implications for the resistance to antiangiogenic therapy. Tumour Biol 2015; 36: 66036614 [PMID: 26232913 DOI: 10.1007/s1327701538232]

51 Yamaguchi J, Kusano KF, Masuo O, Kawamoto A, Silver M, Murasawa S, BoschMarce M, Masuda H, Losordo DW, Isner JM, Asahara T. Stromal cellderived factor1 effects on ex vivo expanded endothelial progenitor cell recruitment for ischemic neovascularization. Circulation 2003; 107: 13221328 [PMID: 12628955 DOI: 10.1161/01.CIR.0000055313.77510.22]

52 Amano K, Okigaki M, Adachi Y, Fujiyama S, Mori Y, Kosaki A, Iwasaka T, Matsubara H. Mechanism for IL1 betamediated neovascularization unmasked by IL1 beta knockout mice. J Mol Cell Cardiol 2004; 36: 469480 [PMID: 15081307 DOI: 10.1016/j.yjmcc.2004.01.006]

53 Ceradini DJ, Kulkarni AR, Callaghan MJ, Tepper OM, Bastidas N, Kleinman ME, Capla JM, Galiano RD, Levine JP, Gurtner GC. Progenitor cell trafficking is regulated by hypoxic gradients through HIF1 induction of SDF1. Nat Med 2004; 10: 858864 [PMID: 15235597 DOI: 10.1038/nm1075]

54 Smart N, Riley PR. The stem cell movement. Circ Res 2008; 102: 11551168 [PMID: 18497316 DOI: 10.1161/CIRCRESAHA.108.175158]

55 Tousoulis D, Andreou I, Antoniades C, Tentolouris C, Stefanadis C. Role of inflammation and oxidative stress in endothelial progenitor cell function and mobilization: therapeutic implications for cardiovascular diseases. Atherosclerosis 2008; 201: 236247 [PMID: 18599065 DOI: 10.1016/j.atherosclerosis.2008.05.034]

56 Nadeem R, Molnar J, Madbouly EM, Nida M, Aggarwal S, Sajid H, Naseem J, Loomba R. Serum inflammatory markers in obstructive sleep apnea: a metaanalysis. J Clin Sleep Med 2013; 9: 10031012 [PMID: 24127144 DOI: 10.5664/jcsm.3070]

57 De Luca Canto G, PachêcoPereira C, Aydinoz S, Major PW, FloresMir C, Gozal D. Biomarkers associated with obstructive sleep apnea and morbidities: a scoping review. Sleep Med 2015; 16: 347357 [PMID: 25747333 DOI: 10.1016/j.sleep.2014.12.007]

58 Wang J, Yu W, Gao M, Zhang F, Gu C, Yu Y, Wei Y. Impact of Obstructive Sleep Apnea Syndrome on Endothelial Function, Arterial Stiffening, and Serum Inflammatory Markers: An Updated Metaanalysis and Metaregression of 18 Studies. J Am Heart Assoc 2015; 4: pii: e002454 [PMID: 26567373 DOI: 10.1161/JAHA.115.002454]

59 Wang Q, Wu Q, Feng J, Sun X. Obstructive sleep apnea and endothelial progenitor cells. Patient Prefer Adherence 2013; 7: 10771090 [PMID: 24204127 DOI: 10.2147/PPA.S51562]

60 de la Peña M, Barceló A, Barbe F, Piérola J, Pons J, Rimbau E, Ayllón O, Agustí AG. Endothelial function and circulating endothelial progenitor cells in patients with sleep apnea syndrome. Respiration 2008; 76: 2832 [PMID: 17921670 DOI: 10.1159/000109643]

61 Jelic S, Padeletti M, Kawut SM, Higgins C, Canfield SM, Onat D, Colombo PC, Basner RC, Factor P, LeJemtel TH. Inflammation, oxidative stress, and repair capacity of the vascular endothelium in obstructive sleep apnea. Circulation 2008; 117: 22702278 [PMID: 18413499 DOI: 10.1161/CIRCULATIONAHA.107.741512]

62 Jelic S, Lederer DJ, Adams T, Padeletti M, Colombo PC, Factor P, Le Jemtel TH. Endothelial repair capacity and apoptosis are inversely related in obstructive sleep apnea. Vasc Health Risk Manag 2009; 5: 909920 [PMID: 19997572 DOI: 10.2147/VHRM.S8123]

63 Murri M, GarcíaDelgado R, AlcázarRamírez J, FernándezRamos A, Alcaide J, Cardona F, Tinahones FJ. Effect of CPAP on oxidative stress and circulating progenitor cell levels in sleep patients with apneahypopnea syndrome. Respir Care 2011; 56: 18301836 [PMID: 21605479 DOI: 10.4187/respcare.01081]

64 Kheirandish-Gozal L, Bhattacharjee R, Kim J, Clair HB, Gozal D. Endothelial progenitor cells and vascular dysfunction in children with obstructive sleep apnea. Am J Respir Crit Care Med 2010; 182: 9297 [PMID: 20203242 DOI: 10.1164/rccm.2009121845OC]

65 Martin K, Stanchina M, Kouttab N, Harrington EO, Rounds S. Circulating endothelial cells and endothelial progenitor cells in obstructive sleep apnea. Lung 2008; 186: 145150 [PMID: 18401642 DOI: 10.1007/s004080089073y]



66 Yun CH, Jung KH, Chu K, Kim SH, Ji KH, Park HK, Kim HC, Lee ST, Lee SK, Roh JK. Increased circulating endothelial microparticles and carotid atherosclerosis in obstructive sleep apnea. J Clin Neurol 2010; 6: 8998 [PMID: 20607048 DOI: 10.3988/jcn.2010.6.2.89]

67 Simpson PJ, Hoyos CM, Celermajer D, Liu PY, Ng MK. Effects of continuous positive airway pressure on endothelial function and circulating progenitor cells in obstructive sleep apnoea: a randomised shamcontrolled study. Int J Cardiol 2013; 168: 20422048 [PMID: 23453448 DOI: 10.1016/j.ijcard.2013.01.166]

68 Kizawa T, Nakamura Y, Takahashi S, Sakurai S, Yamauchi K, Inoue H. Pathogenic role of angiotensin II and oxidised LDL in obstructive sleep apnoea. Eur Respir J 2009; 34: 13901398 [PMID: 19574336 DOI: 10.1183/09031936.00009709]

69 Lui MM, Tse HF, Mak JC, Lam JC, Lam DC, Tan KC, Ip MS. Altered profile of circulating endothelial progenitor cells in obstructive sleep apnea. Sleep Breath 2013; 17: 937942 [PMID: 23179139 DOI: 10.1007/s1132501207814]

70 Chou KT, Liu CC, Hsu HS, Chang SC, Chen YM, Perng DW, Hsu YT, Lee YC, Hung SC. Nocturnal stem cell mobilization in patients with obstructive sleep apnoea: a pilot study. Eur J Clin Invest 2014; 44: 11891196 [PMID: 25331065 DOI: 10.1111/eci.12353]

71 Deleanu OC, Mălăuţ AE, Nebunoiu AM, Micheu MM, Mihălţan FD. Obstructive sleep apnea syndrome and arterial hypertensiona complicated relationship? The role of controlling blood pressure values in patients with OSAS. Pneumologia 2014; 63: 3643 [PMID: 24800594]

72 Rizzi CF, Ferraz MB, Poyares D, Tufik S. Qualityadjusted lifeyears gain and health status in patients with OSAS after one year of continuous positive airway pressure use. Sleep 2014; 37: 19631968 [PMID: 25325505 DOI: 10.5665/sleep.4250]

73 Karimi M, Hedner J, Häbel H, Nerman O, Grote L. Sleep apnearelated risk of motor vehicle accidents is reduced by continuous positive airway pressure: Swedish Traffic Accident Registry data. Sleep 2015; 38: 341349 [PMID: 25325460 DOI: 10.5665/sleep.4486]

74 Bauters F, Rietzschel ER, Hertegonne KB, Chirinos JA. The Link Between Obstructive Sleep Apnea and Cardiovascular Disease. Curr Atheroscler Rep 2016; 18: 1 [PMID: 26710793 DOI: 10.1007/s118830150556z]

75 Donovan LM, Boeder S, Malhotra A, Patel SR. New developments in the use of positive airway pressure for obstructive sleep apnea. J Thorac Dis 2015; 7: 13231342 [PMID: 26380760 DOI: 10.3978/j.issn.20721439.2015.07.30]

76 Lai AY, Ip MS, Lam JC, Weaver TE, Fong DY. A pathway underlying the impact of CPAP adherence on intimate relationship with bed partner in men with obstructive sleep apnea. Sleep Breath 2016; 20: 543551 [PMID: 26265560 DOI: 10.1007/s1132501512356]

77 Bakker JP, Wang R, Weng J, Aloia MS, Toth C, Morrical MG, Gleason KJ, Rueschman M, Dorsey C, Patel SR, Ware JH, Mittleman MA, Redline S. Motivational Enhancement for Increasing Adherence to CPAP: A Randomized Controlled Trial. Chest 2016; 150: 337345 [PMID: 27018174 DOI: 10.1016/j.chest.2016.03.019]

78 Dudley KA, Patel SR. Disparities and genetic risk factors in obstructive sleep apnea. Sleep Med 2016; 18: 96102 [PMID: 26428843 DOI: 10.1016/j.sleep.2015.01.015]

79 Schwartz SW, Sebastião Y, Rosas J, Iannacone MR, Foulis PR, Anderson WM. Racial disparity in adherence to positive airway pressure among US veterans. Sleep Breath 2016; 20: 947955 [PMID: 26810493 DOI: 10.1007/s1132501613161]

80 Weaver TE, Grunstein RR. Adherence to continuous positive airway pressure therapy: the challenge to effective treatment. Proc Am Thorac Soc 2008; 5: 173178 [PMID: 18250209 DOI: 10.1513/pats.200708119MG]

81 Chai-Coetzer CL, Luo YM, Antic NA, Zhang XL, Chen BY, He QY, Heeley E, Huang SG, Anderson C, Zhong NS, McEvoy RD. Predictors of longterm adherence to continuous positive airway pressure therapy in patients with obstructive sleep apnea and cardiovascular disease in the SAVE study. Sleep 2013; 36:

19291937 [PMID: 24293768 DOI: 10.5665/sleep.3232]82 Yang MC, Huang YC, Lan CC, Wu YK, Huang KF. Beneficial

Effects of LongTerm CPAP Treatment on Sleep Quality and Blood Pressure in Adherent Subjects With Obstructive Sleep Apnea. Respir Care 2015; 60: 18101818 [PMID: 26396261 DOI: 10.4187/respcare.04199]

83 Reeves-Hoche MK, Meck R, Zwillich CW. Nasal CPAP: an objective evaluation of patient compliance. Am J Respir Crit Care Med 1994; 149: 149154 [PMID: 8111574 DOI: 10.1164/ajrccm.149.1.8111574]

84 Engleman HM, Martin SE, Douglas NJ. Compliance with CPAP therapy in patients with the sleep apnoea/hypopnoea syndrome. Thorax 1994; 49: 263266 [PMID: 8202884 DOI: 10.1136/thx.49.3.263]

85 Weaver TE, Maislin G, Dinges DF, Bloxham T, George CF, Greenberg H, Kader G, Mahowald M, Younger J, Pack AI. Relationship between hours of CPAP use and achieving normal levels of sleepiness and daily functioning. Sleep 2007; 30: 711719 [PMID: 17580592]

86 Chen YF, Hang LW, Huang CS, Liang SJ, Chung WS. Polysomnographic predictors of persistent continuous positive airway pressure adherence in patients with moderate and severe obstructive sleep apnea. Kaohsiung J Med Sci 2015; 31: 8389 [PMID: 25645986 DOI: 10.1016/j.kjms.2014.11.004]

87 Liu ZJ, Zhuge Y, Velazquez OC. Trafficking and differentiation of mesenchymal stem cells. J Cell Biochem 2009; 106: 984991 [PMID: 19229871 DOI: 10.1002/jcb.22091]

88 Vanden Berg-Foels WS. In situ tissue regeneration: chemoattractants for endogenous stem cell recruitment. Tissue Eng Part B Rev 2014; 20: 2839 [PMID: 23678952 DOI: 10.1089/ten.TEB.2013.0100]

89 Eggenhofer E, Luk F, Dahlke MH, Hoogduijn MJ. The life and fate of mesenchymal stem cells. Front Immunol 2014; 5: 148 [PMID: 24904568 DOI: 10.3389/fimmu.2014.00148]

90 De Becker A, Riet IV. Homing and migration of mesenchymal stromal cells: How to improve the efficacy of cell therapy? World J Stem Cells 2016; 8: 7387 [PMID: 27022438 DOI: 10.4252/wjsc.v8.i3.73]

91 Carreras A, Almendros I, Acerbi I, Montserrat JM, Navajas D, Farré R. Obstructive apneas induce early release of mesenchymal stem cells into circulating blood. Sleep 2009; 32: 117119 [PMID: 19189787]

92 Carreras A, Almendros I, Montserrat JM, Navajas D, Farré R. Mesenchymal stem cells reduce inflammation in a rat model of obstructive sleep apnea. Respir Physiol Neurobiol 2010; 172: 210212 [PMID: 20594932 DOI: 10.1016/j.resp.2010.05.020]

93 Carreras A, Rojas M, Tsapikouni T, Montserrat JM, Navajas D, Farré R. Obstructive apneas induce early activation of mesenchymal stem cells and enhancement of endothelial wound healing. Respir Res 2010; 11: 91 [PMID: 20604943 DOI: 10.1186/146599211191]

94 Garreta E, Nunez M, Dalmases M, Farre R, Montserrat J, Embid C. Mesenchymal Stem Cells In Peripheral Blood In Obstructive Sleep Apnea Syndrome Patients. Am J Respir Crit Care Med 2013; 187: A3468 [DOI: 10.1164/ajrccmconference.2013.187.1_MeetingAbstracts.A3468]

95 Ramos P, Rubies C, Torres M, Batlle M, Farre R, Brugada J, Montserrat JM, Almendros I, Mont L. Atrial fibrosis in a chronic murine model of obstructive sleep apnea: mechanisms and prevention by mesenchymal stem cells. Respir Res 2014; 15: 54 [PMID: 24775918 DOI: 10.1186/146599211554]

96 Shi XF, Wang H, Xiao FJ, Yin Y, Xu QQ, Ge RL, Wang LS. MiRNA486 regulates angiogenic activity and survival of mesenchymal stem cells under hypoxia through modulating Akt signal. Biochem Biophys Res Commun 2016; 470: 670677 [PMID: 26801559 DOI: 10.1016/j.bbrc.2016.01.084]

97 Burlacu A, Grigorescu G, Rosca AM, Preda MB, Simionescu M. Factors secreted by mesenchymal stem cells and endothelial progenitor cells have complementary effects on angiogenesis in vitro. Stem Cells Dev 2013; 22: 643653 [PMID: 22947186 DOI: 10.1089/scd.2012.0273]

98 Mohd Ali N, Boo L, Yeap SK, Ky H, Satharasinghe DA, Liew



WC, Ong HK, Cheong SK, Kamarul T. Probable impact of age and hypoxia on proliferation and microRNA expression profile of bone marrowderived human mesenchymal stem cells. PeerJ 2016; 4: e1536 [PMID: 26788424 DOI: 10.7717/peerj.1536]

99 Majumdar MK, KeaneMoore M, Buyaner D, Hardy WB, Moorman MA, McIntosh KR, Mosca JD. Characterization and functionality of cell surface molecules on human mesenchymal stem cells. J Biomed Sci 2003; 10: 228241 [PMID: 12595759 DOI: 10.1007/BF02256058]

100 Tse WT, Pendleton JD, Beyer WM, Egalka MC, Guinan EC. Suppression of allogeneic Tcell proliferation by human marrow stromal cells: implications in transplantation. Transplantation 2003; 75: 389397 [PMID: 12589164 DOI: 10.1097/01.TP.0000045055.63901.A9]

101 Klyushnenkova E, Mosca JD, Zernetkina V, Majumdar MK, Beggs KJ, Simonetti DW, Deans RJ, McIntosh KR. T cell responses to allogeneic human mesenchymal stem cells: immunogenicity, tolerance, and suppression. J Biomed Sci 2005; 12: 4757 [PMID: 15864738]

102 Di Nicola M, CarloStella C, Magni M, Milanesi M, Longoni PD, Matteucci P, Grisanti S, Gianni AM. Human bone marrow stromal cells suppress Tlymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002; 99: 38383843 [PMID: 11986244 DOI: 10.1182/blood.V99.10.3838]

103 Aggarwal S, Pittenger MF. Human mesenchymal stem cells

modulate allogeneic immune cell responses. Blood 2005; 105: 18151822 [PMID: 15494428 DOI: 10.1182/blood2004041559]

104 Jiang XX, Zhang Y, Liu B, Zhang SX, Wu Y, Yu XD, Mao N. Human mesenchymal stem cells inhibit differentiation and function of monocytederived dendritic cells. Blood 2005; 105: 41204126 [PMID: 15692068 DOI: 10.1182/blood2004020586]

105 Corcione A, Benvenuto F, Ferretti E, Giunti D, Cappiello V, Cazzanti F, Risso M, Gualandi F, Mancardi GL, Pistoia V, Uccelli A. Human mesenchymal stem cells modulate Bcell functions. Blood 2006; 107: 367372 [PMID: 16141348 DOI: 10.1182/blood2005072657]

106 Weiss DJ, Bertoncello I, Borok Z, Kim C, PanoskaltsisMortari A, Reynolds S, Rojas M, Stripp B, Warburton D, Prockop DJ. Stem cells and cell therapies in lung biology and lung diseases. Proc Am Thorac Soc 2011; 8: 223272 [PMID: 21653527 DOI: 10.1513/pats.201012071DW]

107 Weiss DJ, Bates JH, Gilbert T, Liles WC, Lutzko C, Rajagopal J, Prockop D. Stem cells and cell therapies in lung biology and diseases: conference report. Ann Am Thorac Soc 2013; 10: S25S44 [PMID: 23869447 DOI: 10.1513/AnnalsATS.201304089AW]

108 Weiss DJ, Chambers D, Giangreco A, Keating A, Kotton D, Lelkes PI, Wagner DE, Prockop DJ. An official American Thoracic Society workshop report: stem cells and cell therapies in lung biology and diseases. Ann Am Thorac Soc 2015; 12: S79S97 [PMID: 25897748 DOI: 10.1513/AnnalsATS.201502086ST]

P- Reviewer: Valenti MT, Yao CL S- Editor: Qiu S L- Editor: A E- Editor: Wu HL


ORIGINAL ARTICLE


Model acupuncture point: Bone marrow-derived stromal stem cells are moved by a weak electromagnetic field

Artem N Emelyanov, Laboratory of High Laser and Magnetic Technology, North-Western State Medical University, 191015 St. Petersburg, Russia

Marina V Borisova, Training Laboratory of Physical Chemistry, Institute of Chemistry, St. Petersburg State University, 198504 St. Petersburg, Russia

Vera V Kiryanova, Department of Physical Therapy and Rehabilitation, North-Western State Medical University, 191015 St. Petersburg, Russia

Author contributions: Emelyanov AN designed the research; Emelyanov AN and Borisova MV performed the research; Emelyanov AN, Borisova MV and Kiryanova VV analyzed the data; Emelyanov AN and Kiryanova VV wrote the paper.

Institutional review board statement: The study was reviewed and approved by the North-Western State Medical University Institutional Review Board.

Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of the North-Western State Medical University (IACUC protocol number: 6).

Conflict-of-interest statement: No conflict of interest exists.

Data sharing statement: No additional data are available.



Correspondence to: Artem N Emelyanov, PhD, Senior Researcher, Laboratory of High Laser and Magnetic Technology,




North-Western State Medical University, Kirochnaya street 41, 191015 St. Petersburg, Russia. [email protected]: +7-964-3273960

Received: June 18, 2016Peer-review started: June 21, 2016First decision: July 4, 2016Revised: July 23, 2016Accepted: September 7, 2016Article in press: September 8, 2016Published online: October 26, 2016

AbstractAIMTo show the existence of a structural formative role of magnetic fields (MFs) with respect to biological objects by using our proposed model of an acupoint.

METHODSWe introduced a magnetised 10-100 μT metal rod (needle) into culture dishes with a negatively charged working surface and observed during 24 h how cells were arranged by MFs and by electrical fields (EFs) when attached. Rat and human bone marrow-derived stromal stem cells (rBMSCs and hBMSCs), human nonadherent mononuclear blood cells, NCTCs and A172 cells, and Escherichia coli (E. coli ) were evaluated. The dish containing BMSCs was defined as the model of an acupoint. rBMSCs proliferative activity affected by the needle was investigated. For investigating electro-magnetic field structures, we used the gas discharge visualisation (GDV) method.

RESULTSDuring 24 h of incubation in 50-mm culture dishes, BMSCs or the nonadherent cells accumulated into a central heap in each dish. BMSCs formed a torus (central ring) with an inner diameter of approximately

Basic Study

Artem N Emelyanov, Marina V Borisova, Vera V Kiryanova


Emelyanov AN et al . Magnetic field moves BMSCs

10 mm only upon the introduction of the needle in the centre of the dish. The cells did not show these effects in 35- or 90-mm culture dishes or hydrophobic dishes or rectangular cuvettes. NCTCs and A172 cells showed unstable the effects and only up to two weeks after thawing. Moreover, we observed that the appearance of these effects depended on the season. In winter, BMSCs showed no the effects. GDV experiments revealed that the resonant annular illumination gradually formed from 10 to 18-20 s in polar solutions with and without cell suspension of BMSCs, NCTCs and E. coli when using circular 50-mm dishes, stimulation at 115 V and switching of the electrode poles at 1 kHz. All these data demonstrate the resonant nature of the central ring. Significant influence of MFs on the rBMSC proliferation rate was not observed.

CONCLUSIONBMSCs can be moved by MFs when in the presence of a constant EF and MF, when the cells are in the responsive functional state, and when there is a resonant relationship between them.

Key words: Stem cell movement; Magnetic targeting; Acupuncture; Model acupoint; Frizzled-related protein; Biology resonance; Cytoplasm movement; Glycocalyx


Core tip: On the basis of the literature, we propose the simplest possible model of an acupoint. This model that allowed us to move bone marrow-derived stromal stem cells (BMSCs) using magnetic fields (MFs) without any magnetised nanoparticles. This is a newly identified property of BMSCs, which may be involved in the formation, maintenance and regeneration of tissues and organs. The associated movements of BMSCs may occur via acupoints, and the meridian system may thus control the processes of structural regeneration and be the most ancient regulatory system. Not until the cells become MF amplifiers (resonators) can MFs move the cells. That is possible within our acupoint model.

Emelyanov AN, Borisova MV, Kiryanova VV. Model acupunc-ture point: Bone marrow-derived stromal stem cells are moved by a weak electromagnetic field. World J Stem Cells 2016; 8(10): 342-354 Available from: URL: http://www.wjgnet.com/1948-0210/full/v8/i10/342.htm DOI: http://dx.doi.org/10.4252/wjsc.v8.i10.342

INTRODUCTIONAt present, various types of stem cells (SCs) have been successfully used to rescue acquired or congenital defects in human tissues. Tissue grafts (dermal equivalents, biodegradable polymer-based grafts, etc.) are used for large tissue defects or for correcting the disordered structures of hollow viscera. However,

reproducing the structure of parenchymatous organs (e.g., liver, kidney) has not yet been successful[1].

It has been suggested that the spatial structure of the body and its organs, in their phylogenesis and ontogenesis, were formed not only under the influence of various internal and external physiological factors but also under the influence of certain non-physiological laws of morphogenesis[2]. Influencing the shape during organogenesis was shown in heterotopic transplantation experiments when grafting under the kidney capsule of a Millipore membrane filter folded with mouse bone marrow stem cells on its inner surface. Not until the filter was present and was sufficiently folded did bone structures form[3]. Biological fields are believed to play a significant role in these patterns that influence morphology[4,5]. The nature of these formative fields has been defined in the modern experimental studies[6] and theoretical constructs[7] as an electromagnetic. Influences of electric, magnetic and electromagnetic forces in cells, tissues and the whole organism have been addressed in many papers[8,9]. In particular, there are a number of studies that investigated the effects of electromagnetic fields in the visible and infrared ranges on various types of SCs[10]. However, the influence of the physical forces stated above at physiological doses on the morphogenesis of biological tissues has not been shown.

Cells somehow know how to line up in space, e.g., during in vivo regeneration of surface defects. Their ability to regenerate the external body shape seems amazing, for example, in coelenterates and some vertebrates. That is possible only if there is an EMF mould within at least a very small distance over the surface of the wound, which would determine the direc-tional synthesis of extracellular matrix by the surface cells and then the directional cell movement upon that matrix. It has to be the same in embryo morpho-genesis. To date, no structure responsible for establish-ment of shape-supporting EMFs has been detected in living organisms. The only system that could be qualified for this role is the acupoint and acupuncture channel system. There are many theories about this system, none of which has been completely proven. Moreover, the system has not been proven to exist in the body[11]. However, acupoints are known to have certain anatomical and physiological characteristics[12,13]. In particular, relative to surrounding tissues, acupoints appear to have an elevated electrical potential and a reduced electrical resistance[14,15]. Areas with reduced impedances and higher electric potentials have also been found in plants[16].

In this study, we sought to show that existing EM forces in the body not only can influence the intracellular, interstitial and intra-organ physiological processes but also can significantly affect the structures of organs and tissues. We primarily used SCs in our work because the processes of shaping in the body connect with its regeneration system. As the electrical matrix, we used


culture dishes with a negatively charged working surface because acupoints have heightened electrical potentials. As a magnetic component, we used a magnetised metal rod. From our perspective, such a culture dish with cells placed in it can be considered the simplest model of an acupoint. This model represents a cross-section of an acupoint. The negatively charged surface of the culture dish models the interior of the acupoint. The hydrophobic walls of the dishes model the transition from the inner space of the acupoint to the surrounding tissues.

Thus, the aim of this work was to show the possible structural formative role of EMFs with respect to biological objects. The main objective was to show that EM forces, which are probably present in acupoints, can greatly affect the spatial arrangement of cells that are in the scope of action of the forces.

MATERIALS AND METHODSIsolation and culture of rat bone marrow-derived stromal stem cellsIn total, 8 outbred white rats at 2-6 mo of age were used for all of the experiments (2 years, one rat per season). The rats were maintained from birth at 23 ℃, 50% humidity, with ad libitum access to food and water, and with artificial light from 8:00 to 16:00 and with natural light provided by large windows. Rat bone marrow-derived stromal stem cells (rBMSCs) were isolated as described by Javazon et al[17] with some modifications. Briefly, rats were anesthetised with ethoxyethane and then sacrificed by cervical dislocation in accordance with the guidelines approved by the Institutional Animal Care and Utilisation Committee. BM was collected from the femurs and tibias by inserting a 22-gauge needle into the shaft of the bone and flushing it with phosphate-buffered saline (PBS). Clots of cells were broken by syringing. Next, the cells were loaded onto Histopaque-1077 (Sigma, United States) for density gradient centrifugation (500 × g, 20 min). The cells were collected from the interface, resuspended in PBS and centrifuged at 370 × g for 10 min. After centrifugation, the residual cells were resuspended in Eagle’s minimum essential medium, alpha modification (α-MEM, Sigma, United States) containing 2 mmol/L L-glutamine, 100 U/mL antibiotic-antimycotic (PenStrep, GIBCO, Canada) and 100 mL/L foetal bovine serum (FBS, HyClone, United States) and seeded at 5-7 × 106 cells per 50-mm culture dish. The cells were cultured in a humidified atmosphere of 50 mL/L CO2 at 37 ℃. After cell colonies arose, nonadherent cells were discarded, and adherent cells were grown to 90% confluence in fresh medium. The cells were detached by trypsinisation, harvested by centrifugation at 500 × g for 10 min, counted using a counting chamber, seeded at 5-10 × 103 cell/cm2 into flasks or dishes (passage 1) and placed in a humidified atmosphere of 50 mL/L CO2 at 37 ℃ for amplification. After cells were grown to 70%-80% confluence, they were reseeded.

Isolation and culture of human BMSCsThe procedures were carried out as described by Wolfe et al[18] with some modifications. BM aspirate obtained from 2 healthy adult donors with informed consent was used in this research. Briefly, after the approval of the local Ethics Committee, human BMSCs (hBMSCs) were obtained from a patient selected for the study protocol: 6 mL of BM was aspirated from the posterior iliac crest and supplemented with 100 U/mL heparin for transportation. Within 1 h after aspiration, the extracted BM suspended in 30 mL PBS and centrifuged at 200 × g for 5 min. The residual cells were resuspended in 10 mL PBS and loaded onto Histopaque-1077 (Sigma, United States) for density gradient centrifugation (500 × g, 20 min). The subsequent procedures were the same as for rBMSCs. Unlike rBMSCs, the culture medium was changed once every three days, and after the first medium change, the nonadherent mononuclear cells (mostly leukocytes) were not discarded. They were cultivated in the same fresh medium separately from the BMSCs.

Culture of stable cell lines and Escherichia coliThe two stable cell lines used in the experiments were provided by the Russian Cell Culture Collection of Institute of Cytology of the Russian Academy of Sciences (St. Petersburg). One was NCTC clone 929 of the cell line L (NCTCs, murine fibroblast-like cells from subcutaneous connective tissue), and the other was A-172 cells (human fibroblast-like glioblastoma cells). The cells were recovered from frozen vials and resuspended in Dulbecco’s modified Eagle’s medium (Biolot, Russia) supplemented with 100 mL/L FBS, 2 mmol/L L-glutamine and 100 U/mL antibiotic-antimycotic. The cells were grown in a humidified atmosphere of 50 mL/L CO2 at 37 ℃. After cells were grown to 70%-80 % confluence, they were reseeded.

Escherichia coli (E. coli) was cultured at 37 ℃ in Luria-Bertani culture medium: 10 g/L bactotryptone and 5 g/L yeast extract in 10 g/L aqueous solution of NaCl.

Setting a magnetised metal rod (needle) in the culture dish to produce electromagnetic effects on cells For the experiments, cells at 70%-80% confluence were detached by trypsinisation (2.5 g/L trypsin, 0.2 g/L EDTA: GIBCO, United States) for 2-5 min at 37 ℃, flushed with PBS, harvested by centrifugation at 500 × g for 10 min, resuspended in the appropriate fresh culture medium, and plated at 10 × 103 cell/cm2 in 50-mm culture dishes for the proliferation assay and at 20 × 103 cell/cm2 in culture dishes (diameter, 35 mm, 50 mm, 90 mm) to observe the sites of cell attachment to the bottoms of the culture dishes. The volumes of culture medium per dish were as follows: 2 mL per 35-mm diameter dish, 4 mL per 50-mm dish, 10 mL per 90-mm dish. Those volumes were selected to obtain a 3-mm height of liquid in each type of culture dish. The lids of the culture dishes were replaced with lids with openings for the needles, and magnetised needles were inserted into those openings. The cells were incubated



in a humidified atmosphere of 50 mL/L CO2 at 37 ℃ for 1, 3 or 6 d.

The metal rods were acupuncture needles of surgical steel (Kangnian, China) with a diameter of 0.3 mm and a length of 75 mm (working portion, 35 mm long). Needles of surgical steel are highly resistant to corrosion and do not leave visible traces of metal when introduced into human tissue and left in for at least several days (normal exposure of “buttons” is 3-4 d). Needles were magnetised by a permanent magnet to a residual magnetisation of 10-100 μT.

We also used NunclonTM Δ Surface (NUNC, England) culture dishes. These are ordinary dishes used for culturing cells and possess a hydrophilic bottom surface that has negative carboxyl groups (COO-) chemically attached to the plastic in a uniform distribution. Meanwhile, the vertical, non-working walls of the dish remain hydrophobic. In addition, 14-сm culture dishes were used as “shirts”. Before the experiments, holes the diameter of the needle trough covers of both the culture dishes and the “shirts” were made as follows: In the centre of the “shirt” covers and in the centre or at a certain distance from the centre of the culture dish covers. Before use, the covers and the needles were treated with 700 mL/L ethanol and dried under ultraviolet radiation for at least 10 min. The needle was introduced immediately after cell transfer into the culture dishes. The needles were introduced vertically into the culture dishes, reaching the bottom of the dish. A general view of the culture dish within the “shirt” and with the inserted needle is shown in Figure 1.

Recording the sites of cell attachments to the bottoms of culture dishesCells were stained as described previously[19] with some modifications. Cells were fixed by the addition of 110 g/L glutaraldehyde solution up to a concentration of 10 g/L glutaraldehyde within the culture medium. After gentle shaking for 15 min at room temperature, culture dishes were washed with deionised water and dried.

Cells were stained by the addition of a 1 g/L solution of crystal violet dissolved in 200 mmol/L MES buffer, pH 6. After shaking for 20 min at room temperature, excess dye was removed by extensive washing with deionised water. The culture dishes with stained cells were dried, and then their vertical walls were removed using special cutting pliers. The bottoms of the dishes were scanned using an HP LaserJet 3392 scanner.

In addition, live cells were filmed within culture dishes. We used lenses of 4× and 10× magnification and an ocular magnification of 10×. For more accurately estimating cell attachments, the culture dish bottoms were divided into four concentric regions of equal width and four equal sectors. Images were collected from all concentric areas of each of the four sectors (a total of 16 fields). The photographed fields are shown in Figure 2.

Gas discharge visualisation Pro Camera assayThe gas discharge visualisation (GDV) method was formulated by KG Korotkov in the book “The foundations of GDV-bioelectrography”, which was published in 2001[20]. The GDV method is based on the visualisation of gas discharge-induced photoelectron emission from the surface of an object placed in a high-tension electric field (Kirlian effect). We used a hardware-software complex called the “GDV Pro Camera” (Biotechprogress, Russia, ktispb.eng). A schematic of this device is shown in Figure 3.

A culture dish with either adherent cells or suspend-ed cells at 10 × 103-20 × 103 cell/cm2 in 4 mL of culture medium or PBS was placed onto the transparent electrode of the GDV camera. The ground electrode was then placed vertically in the culture dish to the depth of contact with liquid. The voltage mode was fixed at 90, 115 or 125 V. The frequency at which the poles of the electrodes changed was 1 kHz. The exposure time was varied from 0.6 to 32 s. Photography was carried out in the dark. As controls, GDV was performed using culture

Figure 1 A general view of the culture dish with the needle. The magnetized acupuncture needle is in the center. The needle passes through the cover of the outer dish (the “shirt”), then passes through the cover of the inner dish (the culture dish) and reaches the bottom of the culture dish. The needle is held in an upright position by both the “shirt” cover and the culture dish cover.

Figure 2 The scheme for photographic fields of the bottom of the culture dish. The numbers mark the concentric regions: The central region (1); the area near the central region (2); the area near the fringe region (3); the fringe region (4). The dotted lines divide the bottom into four sectors. Each sector comprises four photographic fields; thus, overall, there are 16 photographed fields for each culture dish.

4

3

2

1

1

2

3

4

4 3 2 1 1 2 3 4



dishes of the different diameters (35 and 50 mm) or with square cuvettes, with culture medium or PBS without cells, with distilled water, and with suspensions of E. coli or nonpolar particles of chalky powder. A general view of the experimental setup is shown in Figure 4. In these GDV experiments, the glow appears to be largely due to photoelectron emission from charged particles within the solutions and to avalanche gas discharges from the bottom of the culture dish.

Statistical analysisStatistical comparisons of rBMSC proliferation were based on the results of three separate experiments with the same incubation time. Cells were detached and counted using a counting chamber. The result is expressed as the mean value ± standard error. Statistical significance of differences between the needle-exposed group and the needle-free control group was performed using Student’s t test and the Wilcoxon-Mann-Whitney U test, P = 0.05.

RESULTSProliferation experimentsFirst, we investigated the effects of the magnetised rod (needle) on the proliferation of rBMSCs. rBMSCs, 10000 cells/cm2 (passages 2-3) were placed in culture

dishes of 20 cm2 (50 mm diameter). Needles were introduced into the centre of each dish, and the dishes were incubated for 1, 3 or 6 d. Then, the cells were photographed and counted. As a control, rBMSCs were grown without the needles. We did not observe any significant differences between the experimental and control cells (Table 1).

Photographing of living unstained cellsThe cells were directly photographed in culture dishes after their incubation. When rBMSCs were cultured for 6 d, they formed a monolayer over which small, rounded cells (approximately 1 μm diameter) were clearly visible. Figure 5A shows that these cells are unevenly arranged on the dish bottom. There are few cells near the needle in region 1. There are more cells in areas 2 and 3, and the number of cells decreases again in region 4, along the outer edge of the dish. After incubating the cells with a needle for 3 d, a similar pattern emerged. However, the small cells were almost entirely eliminated after the third passage. When using hBMSCs, similar results were obtained. On cultivating BMSCs for a day with the needle spread BMSCs were obtained unevenly distributed too. Because the cells do not have time to reproduce any during a day we increased the

Exposure time (d)

The average of three independent replicates of the experiment (the number of cells is ×

103/cm2 ± SE)

Experimental t statistic

Standard t statistic (t st)

Experimental U statistic Standard U statistic (U st)

Experiment Control 1 10.77 ± 3.31 10.67 ± 1.28 0.06 tst = 2.78 when the

number of degrees of freedom k = 4 and

P = 0.05

3 Ust = 0 when the number of observations n1 = n2 = 3,

P = 0.05 3 20.33 ± 2.36 21.67 ± 0.47 1.78 2 6 31.77 ± 2.29 30 2.76 3 from 3 to 6 11.44 ± 3.24 8.33 ± 0.47 1.12

Table 1 The examination of magnetized rod action on rat bone marrow-derived stromal stem cells proliferation

Avalanchedischarge

Creepingdischarge

1

2

3

45

Figure 3 The scheme of a device for studying the characteristics of gas discharge visualisation. An object of a study with an attached grounding electrode (1); a transparent electrode (2); an optical system (3); video converter (4); electronic components (5). The optical system (3) produces photographs of the electron avalanche and the creeping gas discharges through the transparent electrode (2) (cited in Korotkov, 2001).

Figure 4 A general view of the experimental setup using the gas discharge visuali-sation Pro Camera. The grounding electrode (1). A culture dish with culture medium covered with the specially designed lid (2) with openings for the introduction of the grounding electrode (1) at different locations. The dish holder (3). A transparent electrode covers the whole area under the holder (3) and the culture dish (2). To take gas discharge visualisation photos, the grounding electrode (1) is set in one of the lid holes to the depth of contact with liquid. After that, photography was performed in the dark.

1 2 3



concentration of spread BMSCs up to 20 thousands per square centimetre. Figure 5B shows hBMSCs exposed with the needle during a day. There is most cell density in the region 2.

Figure 5C shows the distribution of suspended human cells without exposure to the magnetised rod. Mononuclear leukocytes made up the majority of the cells, and the cells appear as a heap in the centre of the dish. There are many cells in region 1, fewer in

areas 2 and 3, and practically no cells in region 4. This effect arose during a single day of incubation. We gently redistributed the cells uniformly within the dish. However, the next day, they had again piled up in the centre. We introduced the needle into the cell heap. The next day, the cells had redistributed over the dish bottom more or less uniformly. No heaping was observed for cells cultured in dishes with uncharged, hydrophobic bottoms. Square and rectangular flasks with negatively charged

1 2 3 4

A

B

C

Figure 5 Arrangements of living unstained cells in affecting the magnetized needle. Snapshots were carried out in four perpendicular directions from the center of the cultural dish in four concentric areas fixed width (Figure 2). In columns: The central region (1); the area near the central region (2); the area near the fringe region (3); the fringe region (4). In rows: A: Arrangements at the dish bottom of rBMSCs cultured for 6 d under the influence of the magnetized needle (the needle in the center of the culture dish). The small rounded cells of approximately a micron are seen over the cell monolayer. They are unevenly distributed, depending on their distance from the center of the dish. The bar is 10 μm; B: Arrangements of hBMSCs cultured for 1 d under the influence of the needle (the needle in the center of the culture dish). The dark round trace of the needle is seen on the left edge of the photo B1. The bar is 25 μm; C: Migration of human mononuclear leukocytes during a day without expo-sure to the needle. The bar is 10 μm. rBMSCs: Rat bone marrow-derived stromal stem cells; hBMSCs: Human bone marrow-derived stromal stem cells.



bottoms showed faint clustering of the cells.

Photographing dishes with fixed and stained cellsPhotographing living cells allows the cells to be used in experiments again. However, it is obvious that this method is not ideal for establishing exactly how the cells are distributed along the dish bottom. Therefore, to clarify the cell distribution, the cells were fixed in the dishes and then stained, and the entire dish bottoms were scanned. Over the 2 years of experiments, approxi-mately 160 dishes were stained.

In using rBMSCs, positive results were obtained from the first to 11th-12th passages. Figure 6 shows rBMSCs exposed and unexposed (control) to the needle. The needled cells show a rarefaction in the centre of the dish where the end of the needle was (the central depression). Annular crowding of the cells in a 3-5 mm width is observed at approximately 5 mm from the centre of the dish (the central ring). In some dishes, there is another ring-shaped cluster of cells at approximately 5 mm from the edge of the dish (the peripheral ring). The controls may include two clusters of cells: A cell accumulation in the centre of the dish (the central heap) and the peripheral ring. There was only small, inconstant effect involved when using 35- or 90-mm culture dishes. Therefore, only the 50-mm dishes were utilised in the subsequent experiments.

To eliminate the possible influence of metal ions

diffusing from the needle on the formation of the central depression, the effects of the non-magnetised needles and comparable plastic rods on the arrangement of rBMSCs were evaluated. Non-magnetised needles did not cause the formation of the central depression and the central ring, and neither did thin plastic rods. When the non-magnetised needles or plastic rods were inserted away from the centres of the dishes, rarefactions around them remained absent. Further, magnetised needles inserted away from the centres of the dishes also did not form rarefactions (Figure 7B, C and D). However, the central heap seemed to change its shape, becoming irregular and elongated, when magnetised needles were applied in different positions. We next tested the influence of the needles’ magnetic polarisation on the arrangement of the rBMSCs, and we did not observe significant differences in these influences. The influence of the north pole seemed to produce a somewhat more vivid picture.

In addition, we observed that the generation of these effects depended on the season. The most pronounced response of BMSCs to the magnetised rods occurred in spring. However, there were always a number of unresponsive cells. In the images, this is reflected by the presence of the background (Figure 6). There were more unresponsive cells in summer and autumn. This was expressed both as a more intense background and as the disappearance of the peripheral ring (Figure 7B, C and D). In winter, from mid-November to mid-January, BMSCs showed no responses to the magnetised needle (Figure 7A). There was always the strongest effect in spring, some effect in summer and autumn, and no effect in winter. Approximately 40 dishes were tested for each season. The 40 dishes for winter (from mid-November to mid-January) showed no effect. The 40 dishes for spring (from March to April) all showed the effect. Consequently, seasonality is present at P < 0.05.

In winter, studies were performed to determine the effects on the rBMSCs distribution of both the method of plating the cells and the method of setting the needles. The dishes with just the cells placed in them were moved horizontally on the bench surface back and forth in the 8 cardinal directions, for three times per direction. Thereafter, some of the dishes were moved horizontally in a circle one or three times, creating a torque in the culture medium. Needles were not inserted in these dishes. Notably, these dishes showed no central heaps. In some instances, a formation resembling the peripheral ring appeared. However, in these cases, this “ring” was not uniform and complete, and it was located closer to the edge of the dish than the peripheral ring. To test the method of setting the needles in the culture dishes, needles were introduced perpendicularly into the dishes, heavily or slightly rest against the bottom, and rotated clockwise or anticlockwise. In these cases, we found no central depressions or central rings.

In addition to human and rat BMSCs, in the spring, we used two stable cell lines: Mouse fibroblast NCTC

Figure 6 The effect of a metal rod (needle) on the arrangement of rat bone marrow-derived stromal stem cells. rBMSCs in 4 mL of culture medium were plated in 50mm culture dishes at 20000 cells/cm2 and cultured with the needle in the centre of the dishes (A) or without the needle (B) for one day. Cells in the dishes were fixed and stained with crystal violet. The vertical walls of the dishes were removed. The stained bottoms of the dishes were scanned. Arrows mark the central depression (1); the central ring (2); the central heap (3); and the peripheral ring (4). rBMSCs: Rat bone marrow-derived stromal stem cells.

A

B

12

4

3



L929 cells and human glioblastoma A172 fibroblasts. NCTCs, which proliferate rapidly, were used in our experiments beginning at passage 2 (i.e., 4 d after thawing). These cells showed a certain unstable positive result for two weeks after thawing both in the control and in the experiment. However, after that time period, the cells showed no effects of the magnetised needles and distributed uniformly across the dish bottoms both in the control and in the experiment (as in Figure 7A). Similar results were obtained for the A172 cells.

GDV researchWe investigated the gas discharge glow (GDG) from circular culture NUNC dishes of diameters of 35 (9.6 cm2) and 50 mm (20 cm2) and from rectangular cuve-ttes with an area of 20 cm2. The emissions at voltages of 90, 115 and 125 V were investigated. The same volumes of water, PBS or culture medium with or without cells were placed in the dishes as in the experiments with the needles. Annular GDG gradually forming from 10 to 18-20 s was observed when using circular 50-mm dishes and a voltage of 115 V (Figure 8C3 and C4). Three peripheral rings were always clearly visible when the location of the ground electrode was in the centre of the dish. The central ring was less pronounced. The average distances between the rings were 5-7 mm (Figure 8B1 and C4). Annular illumination was not observed without the presence of liquid in the dish (Figure 8A1), when the liquid was water (uncharged liquid, Figure 8A2), or from hydrophobic dishes or rectangular cuvettes (Figure 8A3 and A4). The dishes filled with PBS produced annular illuminations more clearly than those filled with culture medium and/or various cells. Three positions of the grounding electrode were evaluated: In the centre, next to the edge and equidistant from the centre and the edge of the dish (Figure 8B1, B2 and B3). Two outer rings were recorded in all cases. The central ring appeared only when the ground electrode was located in the centre of the dish. With a voltage of 90 V, the rings were not formed (Figure 8C2). When using 35-mm dishes, some faint crowded rings around the periphery of the dish were formed at approximately 30 s with a voltage of 125 V (Figure 8D1). The rings were not formed in 50-mm dishes at a voltage of 125 V. Thus,

EM resonances existed in the system.Patterns regarding the shape and size of the dishes,

the location of the grounding electrode and the voltage were detected in both the GDV study of culture medium or PBS and the GDV study of suspended rBMSCs, NCTCs or E. coli cells. The rings were the most prominent and stable when using NCTCs. The rings could be obtained by placing these cells in the high-voltage field for 32 s for many consecutive applications. Although the suspension of rBMSCs provided a relatively clear image at approximately 18-20 s of exposure, the glow disappeared within 4-5 s after that and never reappeared. The glow also did not appear in repeated attempts after a while, whether in fresh culture medium or PBS. After a single treatment with the high-voltage field during 32 s, NCTCs and E. coli stopped proliferating for several days but then continued to multiply actively. Rat and human BMSCs treated thus ceased proliferating permanently, but when attached to the bottom of the dish, they remained viable for 2-3 wk. A few dishes filled with NCTC suspension after GDV were placed carefully without shaking in an incubator for one day and then fixed and stained. These dishes did not present cell formations similar to the light patterns identified by GDV. When using chalky powder of various concentrations (uncharged suspension), no annular illumination was obtained. In addition, after a day of using a needle to spread the cells into the central depression and ring, we observed GDV. After GDV, the cells were fixed and stained. In these cases, we obtained no annular illumination (Figure 8D2 and D3). In addition, no annular emission was obtained from dishes filled with culture medium and preincubated for a day (Figure 8C1). In most cases, E. coli produced GDG that was close to annular (Figure 8D4).

DISCUSSIONPreviously, other authors observed that MF increased, decreased or did not affect the proliferation of various types of cells[21,22]. No clear response patterns of biolo-gical systems to the influences of MF were observed. We did not observe significant influence of MFs on the rBMSC proliferation rate. This may indicate that the

A B C D

Figure 7 The effect of the needle on the redistribution rat bone marrow-derived stromal stem cells when setting the needle away from the centre of the culture dish. A: The dish in the absence of the effect; B: Control without the needle; C: The needle in the centre; D: The needles away from the centre, with the placement of the needle as indicated by a dot. Explanations are provided in the text.



influence of MFs on cell proliferation is indirect. It may be that the direct effect of MFs is related to morphogenesis. It is logical that structure maintenance of tissues and organs and cell renewal are regulated by different mechanisms.

If fibroblasts are spread on plastic or glass, their attachment occurs only after 30-40 min from placing them into a dish; their spreading continues during the following day[23]. At 5-10 min after placing cells into a dish, most of the cells have reached the bottom. Upon reaching the bottom of the dish, for approximately half an hour, fibroblasts are in contact with the dish but still not attached to it. At that point, the fibroblast performs a type of “rolling” movement and “releases” and “inhales” its filopodia. Thus, there is a gap between touching and attachment of a fibroblast during which it can be moved by an EF.

We have used culture dishes coated with a uniform negative electric charge on the bottom surface. In accordance with Ostrogradsky’s-Gauss’s divergence theorem, the electric field strength in the plane of the charge, along the dish bottom, decreases from the periphery to the centre of the bottom, where it reaches zero. Thus, the charged particles (cells) situated in the plane of the dish, when of appropriate size and weight, will move to the periphery of the dish (opposite charge, “+”) or to its centre (same charge, “-”). Because culture media are ionic solutions, these electrical forces affect only cells in contact with the bottom of the dish. The forces are absent in the medium column because of an electrical double layer. The participation of the charge of the dish bottom in the cell distribution across the dish has been confirmed by the absence of movement of suspended cells towards the bottom centres when using


Figure 8 Evaluation of the structure of the electromagnetic field in the dishes using the gas discharge visualisation method. Except where otherwise stated, the experimental conditions are as follows: A 50-mm culture dish with a negatively charged bottom, the grounding electrode in the centre of the dish, a voltage of 115 V, an exposure time of 20 s, and a liquid volume of 3 mL. GDG from an empty dish (A1). Water GDG (A2). GDG from a dish with a hydrophobic, uncharged bottom filled with PBS (A3). GDG from a square culture cuvette filled with PBS (A4). GDG from the dish filled with PBS when the grounding electrode is in the centre (B1, note the gap in the lower left quadrant due to the uneven distribution of the charge on the bottom of the dish), equidistant from the centre and the edge (B2), and at the side (B3) of the dish. GDG from the complete culture medium α-MEM (B4). GDG from α-MEM incubated in the dish at 37 ℃ for one day (C1). GDG from the dish containing NCTCs at 25 × 103 cells/cm2, at a voltage of 90 V (C2) and at a voltage of 115 V, with exposure for 10 (C3) and 20 s (C4). GDG from a 35-mm culture dish with NCTCs at 25 × 103 cells/cm2, at a voltage of 125 V (D1). GDG from rBMSCs incubated with the magnetised needle for one day (D2). The same cells after fixation and staining (D3). GDG from E. coli at 200 × 103 cells/mL. rBMSCs: Rat bone marrow-derived stromal stem cells; GDG: Gas discharge glow; E. coli: Escherichia coli.

1 2 3 4

A

B

C

D


dishes with hydrophobic bottoms and by the absence of GDV rings in the dishes with culture medium without cells after a day of incubation (Figure 8C1).

It is widely believed that cells can carry one type of electrical charge or another and can be moved by microelectrophoresis[24]. In our experiment without the use of the magnetised needles, some BMSCs accumulated in the dish centre (central heap), some accumulated in the dish periphery (peripheral ring), and some did not respond to the EF. Thus, cells within the same population may apparently have either positive or negative charges on their surfaces or may be electrically neutral. This may depend on the availability and structure of the glycocalyx. The glycocalyx, due to its sulfate groups, creates a negative charge on the cell surface, whereas the outer surface of the cell membrane has a positive charge due to ion pumps. The fact that the glycocalyx plays a pivotal role in the cell movement in EFs along the dish bottoms is demonstrated by the accumulation of suspended cells (leukocytes) in the dish centres through one day of incubation. These cells, as they were not subjected to trypsinisation, retained an intact glycocalyx on their surfaces. In addition, these cells cannot crawl from place to place like fibroblasts. BMSCs do not appear to crawl across the dish to produce the effects induced by EFs. Further, one day is insufficient time for BMSCs to crawl the distances involved. That the BMSCs are not crawling is partly illustrated by the positions of their “tails” in all directions after one day of incubation with the needle (Figure 5B). To remove the cells from the substrate, we applied trypsin for 5 min. With this treatment, a large part of the glycocalyx is retained. It has been shown that the glycocalyx is completely removed from the cell surface only after 15 min of incubation in 2.5 g/L trypsin solution[25]. After trypsinisation during cell isolation from tissue, the complete restoration of the glycocalyx occurred in 7-10 d[26]. Therefore, by the time the cells were subjected to EMFs (4-7 d after passaging), the cells appeared to have a complete layer of glycocalyx. In spring, rBMSCs trypsinised for 5 or 10 min showed the effect involved. In contrast, rBMSCs during winter and NCTCs and A172 cells at two weeks after thawing showed no such effect. Based on these data, one can conclude that the molecular structure of the glycocalyx is more important than its thickness. In spring, NCTC and A172 cells showed the effect before 2 wk after thawing, but later, they showed no such effect. The behaviour of NCTCs and A172 cells led to the conclusion that the glycocalyx charge depends on protein synthesis. Those proteins are related to some proteins of transformed cells that are not synthesised until the cell’s DNA is restored.

Thus, upon reaching the bottom of the dish by gra-vity, BMSCs begin to move, perhaps by rolling, in res-ponse to the EF to the centre or the periphery of the dish, in accordance with the glycocalyx charge, whereby they form the central heap and the peripheral ring.

With the introduction of the magnetised needle, mag-

netic forces are established, and the resultant vector is directed from the centre to the periphery of the dish (note the sparseness around the needle). It is likely that because BMSCs bear negative charges on their surfaces, they move towards the dish centre as long as the magnetic force directed from the centre equals the electric force directed towards the dish centre. It is similar for moving the cells away from the dish centre. Thus, a “donut” (torus) of cells (the central ring) might arise.

Firmly established mechanisms of primary rece-ption of MFs and EMFs in the range of non-thermal effects have not yet been identified. Cytoskeletal rear-rangements and intracellular signalling as a result of exposure to EMF on cell surface membrane are assumed to be among the primary magnetoreceptive mechanisms[8]. However, these mechanisms cannot explain the effects involved here. To date, no one has shown that MFs can move SCs. Currently, to move cells, magnetic nanoparticles are introduced into them[27]. In our experiments, the cells were moved through MFs over distances of up to 5 mm (the radius of the central ring). As seen from experiments with leukocyte suspensions (Figure 5C), this distance can probably be extended. It is obvious that EFs and MFs affect different cellular mechanisms. However, these mechanisms are somehow associated with each other, given that the cells were not moved in the dishes with the hydrophobic bottoms. Magnetic and electrical mechanisms appear to be nonlinearly related. Therefore, the electrical effects detectable in the controls showed significant variation between experiments. This was manifested in the presence or the absence of the peripheral ring and in the different forms of the central heap. Meanwhile, the magnetic effects, specifically the central depression and the central ring, did not show changeable shapes.

For a MF to move a cell, it must have a directed ion stream. Although there are transmembrane ion currents, these currents are balanced and therefore cannot serve as mechanisms by which MFs can induce cells to move. Protozoan (e.g., the nutrition of Paramecium caudatum) and plant cells (e.g., cytoplasmic current in the cambium layer) possess cytoplasmic currents. It is likely that the slow transport in the axons of nerve cells and the circulation of the outer membrane by ruffling are accompanied by directional circular currents of cytoplasm. It is likely that cells can also have circular cytoplasmic currents when detached. If this is actually the case, there is also circular movement of cytoplasm ions, which would produce MFs. Then, the MF of the magnetised needle would affect the cytoplasm, moving it and moving the entire cell together with it. In addition, cells would move in opposite directions in accordance with the direction of their cytoplasmic motion. Our finding that both the N and S needle poles could cause the central depression supports this model. In 1999, Makarevich[28] used yeast cultures to show that different permanent magnetic poles produced only quantitative differences in cellular responses. We have also shown



that not all cells respond to EM exposure. Thus, there are three types of cells in the same population: Cells with cytoplasm circulating clockwise, cells with cyto-plasm circulating anticlockwise, and those with non-circulating cytoplasm. This suggestion accounts for the observation of the same type of central depression in response to either magnetic pole of the needle. The fact that cells of the same population can react differently to the same MF has been shown previously[29].

The above model cannot explain all of the observed effects. The formation of the peripheral ring remains unclear. Based on the above assumptions, some of the cells should accumulate next to the dish wall and others near the needle. Furthermore, in this model, the phenomena causing the needle MF should be observed when setting the needle outside the centre of the dish. All these reasons led us to explore in more detail the EMFs formed in the culture dishes.

The movement of the cytoplasm create a MF in the range of nT or less. This is likely insufficient to move the cells. Therefore, an amplifier of the MF is needed. In the model system some resonances appear to exist which function as such an amplifier. This assumption is confirmed by findings of the GDV study as follows: The presence of glowing rings; the importance of the shape and size of the dish; the importance of the electric voltage magnitude; and the fundamentally unchanged ring-shaped glow upon setting the ground electrode off to the side from the dish centre (Figure 8). This effect in particular may indicate that it is not necessary to introduce the needle to the acupoint centre only to achieve a therapeutic effect. All of the acupuncture practice has noted this; the exact anatomical centre has not been established for any acupoint. The resonant nature of the field created by the magnetised needle is also demonstrated by the absence of sparseness around the needles set eccentrically and by the poor results when using culture dishes with diameters of 35 and 90 mm. The same findings also demonstrate that there is little or no effect of metal ion diffusion from the needle on the investigated phenomenon. The absence of cell sparseness around the plastic hydrophobic rod demonstrates a very small value of hydrophobic forces produced by the dish wall. Thus, magnetic resonance phenomena are present in the system of the culture dish, the BMSCs, and the needle. There are obvious similarities between the rings obtained by cell staining and observed in GDV (Figure 8C4 and D3). Furthermore, GDV (the same as the cell cultivation in the dishes with hydrophobic bottoms) shows the necessity of a polar liquid or suspension for the effect to exist, with annular GDG being absent from water and from chalky suspensions. We believe that the observed resonance phenomena explain the sparseness around the needle only in the dish centre, the absence of cell accumulation around the needle and forming the peripheral ring. The resonant nature of the meridian system (and, consequently, acupoints) has been proposed previously[30]. However, experimental

verification of this phenomenon has so far been absent.In a series of studies, we have shown the funda-

mental insignificance of the methods of cell application and distribution across the dish bottom and the mode of needle administration for the generation of the central heap, the central depression and the central ring. We have shown that if the cells do not form these structures themselves, we cannot form them by neither some special twisting the needle nor by some rocking or spins the dish as a whole. Clearly, the uniform distribution of cells across the dish bottom may be broken in those cases. Additionally, as shown by GDV, the dish charge sometimes appears to be unevenly distributed. For example, in the bottom left sector, a bit below the centre of Figure 8B1, a gap is clearly visible, distorting the overall picture of the glow. These irregularities in charge also seem to affect the movement of the cells.

In addition, we observed a seasonal pattern in the effects involved. Seasonal phenomena have already been described in the literature in studying whole organisms and their foetuses. Temporary physiological “windows” from minutes and hours to seasons have been reported[31,32]. Blank et al[33] showed Na-K-ATPase in various enzyme activity to respond or to non-respond to the same EMF. Laboratories have long empirically known that cell cultures can behave unconventionally during the summer, from mid-July until the end of August, and during winter, from mid-November to mid-January. However, no one has shown the seasonal effect in cell cultures. It is likely that there are transition states from autumn to winter and from winter to spring, but examining those states was beyond the scope of this study.

In conclusion, in this study, we first showed that a magnetic field of 10-100 μT can move human and rat BMSCs over a distance visible to the naked eye without the introduction of magnetic nanoparticles inside the cells. We have shown that achieving this effect requires a constant EF from one source, a constant MF from another source, and cells in the responsive functional state. We have demonstrated that EM resonances exist in this system. We propose a model to explain the results. We hypothesise that the electrical phenomena depend on the glycocalyx and that the magnetic phenomena may depend on movements of the cytoplasm. Thus, we propose an experimental model of acupoint that may provide the basis for an explanation of EM phenomena in acupoints as well as some features of acupoint treatments (acupoints as a biological MF amplifier). In this study, we also showed that the responses of human and rat BMSCs to EFs and MFs in this system depend on the season. This result is consistent with known features of acupoint function.

From our perspective, aside from the roles of vascular nerve sensors[13] and connective tissue connectors[34], acupoints act as MF amplifiers for maintaining the structure of organs and tissues of the body. Based on our present findings, this idea seems less outlandish. Obviously, there may be opportunities for the conditions



in acupoints for MFs structural formative action on cells, tissues, and organs to exist. This possibility needs now to be explored in a whole organism.

Further studies may be advanced on several fronts. If using this model of acupoint one may investigate the influence of various physical and chemical factors such as visible, infrared and ultraviolet light. There is the nature of the resonances observed to be resolved. Solving this problem would allow cells to be moved much further than 5 mm. Verification of the movable cytoplasm hypothesis is also important. If the cytoplasm of the cell genuinely somehow moves directionally, it may be another cellular mechanism for the regulation of cellular functional activity. For example, it has long been known that rearrangement of the actin cytoskeleton first requires its complete disassembly. That cytoskeletal peculiarity may be directly linked to the movement of the cytoplasm. An interesting question is the nature of the glycocalyx charge. The glycocalyx can reach a thickness of 20 nm and thus create tissue electrical potential gradients. Therefore, the model proposed here may prompt various studies in cell biology and physiology.

ACKNOWLEDGMENTSThe authors are heartily grateful to Georgy Petrovich Pinaev, the head of the Department of Cell Cultures of Institute of Cytology of Russian Academy of Sciences. Unfortunately, he passed away. The study was carried out solely thanks to him. He participated in all the phases of the current experimental research. Also we express gratitude to Svetlana A Alexandrova, Irina A Chistyakova and Danila E Bobkov for valuable advices in carrying out the experiments.

COMMENTSBackgroundRegeneration occurs via two types of processes: (1) forms and structures are reproduced; and (2) the cellularintercellular mass is reproduced. Stem cells reproduce the cellular mass. It is clear that there must be some mechanism for controlling the reproduction of the form and structure of tissues and organs. This mechanism may be related to the acupuncture meridian system.

Research frontiersAt present, various types of stem cells have been successfully used to treat acquired or congenital defects in human tissues. Tissue grafts are used for correcting large tissue defects or the disordered structure of hollow viscera. However, reproducing the structures of solid organs such as the liver, kidney or heart has not yet been successful. Although the morphological and electrical features of acupoints are known, the nature of the meridian system has yet to be determined.

Innovations and breakthroughsThe authors first showed experimentally that a magnetic field may be involved in the mechanism of structural formative regeneration and the acupuncture meridian system. The authors first showed that when using a magnetic field of 10100 μT, human and rat bone marrow derived stromal stem cells can be moved without the introduction of magnetic nanoparticles inside the cells. The authors have shown that achieving this effect requires a constant electrical fields from one source, a constant magnetic fields from another source, and cells in the responsive functional state. The authors have demonstrated that EM resonances

exist in this system.

ApplicationsTo verify the discovery, the authors proposed the acupuncture point as a model. This model allows the investigation of the many cell properties involved in the cell moving by a magnetic field. Of course, it may take considerable effort to develop methods of managing cell movement in the body by means of a magnetic field without magnetic nanoparticles. However, the authors are now confident that these methods exist. Furthermore, the same methods will able to affect the existing stem cells of a patient to induce the recreation and maintenance of the correct structures of the patient’s organs and tissues.

TerminologyBMSCs: Bone marrow derived stromal stem cells. These multipotent cells serve as source for other types of stem cells and regenerative processes. GDV: Gas discharge visualisation is a method based on the visualisation of gas discharge induced photoelectron emission from the surface of an object placed in a hightension electric field (Kirlian effect). Ultimately, the authors see a glow from the object. This method uses an electromagnetic field of 1 kHz frequency. Thus, the glow is caused by both electrical and magnetic fields.

Peer-reviewThis is an important research describing about the relationship between BMSCs and electromagnetic field. The manuscript could be of interest in its field due to the novelty of use of acupuncture needles as source of a low magnetic field.

REFERENCES1 Atala A, Lanza R, Thomson JA, Nerem RM. Principles of

regenerative medicine. Burlington: Academic Press Elsevier Inc., 2010: 733-1116

2 Lubischew AA. Philosophical aspects of taxonomy. Annu Rev Entomol 1969; 14: 19-38 [DOI: 10.1146/annurev.en.14.010169.000315]

3 Friedenstein AJ, Luria EA. Cellular bases of hemopoietic micro-environment [in Russian]. Moscow: Meditsina, 1980: 49-75

4 Gurwitsch AG. Biological field theory [in Russian]. Moscow: Sovetscaja Nauka, 1944: 1-156

5 Beloussov LV, Opitz JM, Gilbert SF. Life of Alexander G. Gurwitsch and his relevant contribution to the theory of morphogenetic fields. Int J Dev Biol 1997; 41: 771-777; comment 778-779 [PMID: 9449452]

6 Kaznacheev VP, Mikhailova LP, Kartashov NB. Distant interce-llular electro-magnetic interaction between two tissue cultures. Bull Exp Biol Med 1980; 89: 345-348 [DOI: 10.1007/BF00834249]

7 Yung KT. A birdcage model for the Chinese Meridian System: part I. A channel as a transmission line. Am J Chin Med 2004; 32: 815-828 [PMID: 15633816 DOI: 10.1142/S0192415X04002417]

8 Binhi VN. Magnetobiology: Underlying physical problems. New York: Academic Press, 2002: 39-208

9 Adey WR. Biological effects of electromagnetic fields. J Cell Biochem 1993; 51: 410-416 [PMID: 8388394 DOI: 10.1002/jcb.2400510405]

10 Emelyanov AN, Kiryanova VV. Photomodulation of proliferation and differentiation of stem cells by the visible and infrared light. Photomed Laser Surg 2015; 33: 164-174 [PMID: 25692649 DOI: 10.1089/pho.2014.3830]

11 Chang S. The meridian system and mechanism of acupuncture-a comparative review. Part 1: the meridian system. Taiwan J Obstet Gynecol 2012; 51: 506-514 [PMID: 23276552 DOI: 10.1016/j.tjog.2012.09.004]

12 Dung HC. Anatomical features contributing to the formation of acupuncture points. Am J Acupunct 1984; 12: 139-143

13 Lou XF, Jiang SH. Anatomical characters and classification of acupoint. Zhongguo Zhenjiu 2012; 32: 319-323 [PMID: 22734380]

14 Ahn AC, Wu J, Badger GJ, Hammerschlag R, Langevin HM. Electrical impedance along connective tissue planes associated with acupuncture meridians. BMC Complement Altern Med 2005; 5: 10 [PMID: 15882468 DOI: 10.1186/1472-6882-5-10]

15 Shenberger R. Acupuncture meridians retain identity after death.

COMMENTS



Am J Acu-punct 1977; 5: 357-36116 Hou TZ, Dawitof M, Wang JY, Li MD. Experimental evidence of a

plant meridian system: I. Bioelectricity and acupuncture effects on electrical resistance of the soybean (Glycine max). Am J Chin Med 1994; 22: 1-10 [PMID: 8030614]

17 Javazon EH, Colter DC, Schwarz EJ, Prockop DJ. Rat marrow stromal cells are more sensitive to plating density and expand more rapidly from single-cell-derived colonies than human marrow stromal cells. Stem Cells 2001; 19: 219-225 [PMID: 11359947 DOI: 10.1634/stemcells.19-3-219]

18 Wolfe M, Pochampally R, Swaney W, Reger RL. Isolation and culture of bone marrow-derived human multipotent stromal cells (hMSCs). In: Prockop DJ, Phinney DG, Bunnell B. Mesenchymal Stem Cells: Methods and Protocols. Methods Mol Biol 2008; 449: 3-27 [DOI: 10.1007/978-1-60327-169-1]

19 Kueng W, Silber E, Eppenberger U. Quantification of cells cultured on 96-well plates. Anal Biochem 1989; 182: 16-19 [PMID: 2604040 DOI: 10.1016/0003-2697(89)90710-0]

20 Korotkov KG. The foundations of GDV-bioelectrography. St. Petersburg: SPbGITMO (TU), 2001: 24-78

21 Ross SM. Combined DC and ELF magnetic fields can alter cell proliferation. Bioelectromagnetics 1990; 11: 27-36 [PMID: 2346505 DOI: 10.1002/bem.2250110105]

22 Malko JA, Constantinidis I, Dillehay D, Fajman WA. Search for influence of 1.5 Tesla magnetic field on growth of yeast cells. Bioelectromagnetics 1994; 15: 495-501 [PMID: 7880162 DOI: 10.1002/bem.2250150602]

23 Burridge K, Fath K, Kelly T, Nuckolls G, Turner C. Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton. Annu Rev Cell Biol 1988; 4: 487-525 [PMID: 3058164 DOI: 10.1146/annurev.cb.04.110188.002415]

24 Jiang D, Sims CE, Allbritton NL. Microelectrophoresis platform for fast serial analysis of single cells. Electrophoresis 2010; 31: 2558-2565 [PMID: 20603824 DOI: 10.1002/elps.201000054]

25 Hamouda H, Kaup M, Ullah M, Berger M, Sandig V, Tauber R, Blanchard V. Rapid analysis of cell surface N-glycosylation from living cells using mass spectrometry. J Proteome Res 2014; 13: 6144-6151 [PMID: 25348702 DOI: 10.1021/pr5003005]

26 Lee YS, Hsu TS. Relationship between reestablishment of sarcolemma-glycocalyx ultrastructures and restoration of transmem-brane potentials in cultured rat heart cells. J Electrocardiol 1987; 20: 303-311 [PMID: 3430101 DOI: 10.1016/S0022-0736(87)80081-X]

27 Cores J, Caranasos TG, Cheng K. Magnetically Targeted Stem Cell Delivery for Regenerative Medicine. J Funct Biomater 2015; 6: 526-546 [PMID: 26133387 DOI: 10.3390/jfb6030526]

28 Makarevich AV. Cell biophysics - effect of magnetic fields of magnetoplastics on the growth of microorganisms. Biophysics 1999; 44: 65-69

29 Semm P, Beason RC. Responses to small magnetic variations by the trigeminal system of the bobolink. Brain Res Bull 1990; 25: 735-740 [PMID: 2289162 DOI: 10.1016/0361-9230(90)90051-Z]

30 Yung KT. A birdcage model for the Chinese meridian system: part II. The meridian system as a birdcage resonator. Am J Chin Med 2004; 32: 985-997 [PMID: 15673203 DOI: 10.1142/S0192415X04002582]

31 Ho MW, Stone TA, Jerman I, Bolton J, Bolton H, Goodwin BC, Saunders PT, Robertson F. Brief exposures to weak static magnetic field during early embryogenesis cause cuticular pattern abnormalities in Drosophila larvae. Phys Med Biol 1992; 37: 1171-1179 [PMID: 1609003]

32 Ružič R, Jerman I, Gogala N. Water stress reveals effects of Elf magnetic fields on the growth of seedlings. Electromag Biol Med 1998; 17: 17-30 [DOI: 10.3109/15368379809012884]

33 Blank M, Soo L. The threshold for Na-K-ATPase stimulation by electromagnetic fields. Bioelectrochem Bioenerg 1996; 40: 63-65 [DOI: 10.1016/0302-4598(96)05053-2]

34 Langevin HM. Connective tissue: a body-wide signaling network? Med Hypotheses 2006; 66: 1074-1077 [PMID: 16483726 DOI: 10.1016/j.mehy.2005.12.032]

P- Reviewer: Scarfì S, Tanabe S, Zou TM S- Editor: Gong XM L- Editor: A E- Editor: Wu HL


ORIGINAL ARTICLE


Characterization and genetic manipulation of primed stem cells into a functional naïve state with ESRRB

Ricardo Antonio Rossello, Department of Science and Technology, Sistema Universitario Ana G. Méndez, Metropolitan University, San Juan 00928, Puerto Rico

Ricardo Antonio Rossello, Department of Biochemistry, University of Puerto Rico - Medical Sciences Campus, San Juan 00921, Puerto Rico

Andreas Pfenning, Massachusetts Institute of Technology, Cambridge, MA 02139, United States

Jason T Howard, Howard Hughes Medical Institute, Chevy Chase, MD 20815-6789, United States

Ute Hochgeschwender, Duke Neurotransgenic Laboratory, Duke University Medical Center, Durham, NC 27710, United States

Author contributions: Rossello RA contributed to conception and design, acquisition of data, analysis and interpretation of data, drafting or revising the article, contributed unpublished essential data or reagents; Pfenning A contributed to analysis and interpretation of data and revising the article; Howard JT contributed to acquisition of data, revising the article, contributed unpublished essential data or reagents; Hochgeschwender U contributed to conception and contributed unpublished essential data or reagents.

Supported by Partially by an NIH translational training, No. T32NS051156; a seed grant from the University of Puerto Rico Medical Sciences Campus, No. 400100420002; the Metropolitan University seed grant; and the Duke Neurotransgenic Laboratory, supported, in part, with funding from NIH-NINDS Center Core, No. 5P30NS061789.

Institutional review board statement: This study was approved ethically by the Duke University (# 09-6152-01).

Institutional animal care and use committee statement: The Duke University and Duke University Medical Center Institutional Animal Care and Use Committee (IACUC) approved protocol A262-12-10.

Conflict-of-interest statement: Authors have no conflicts of




interest.

Data sharing statement: All data sets were submitted as tables.



Correspondence to: Dr. Ricardo Antonio Rossello, Depart-ment of Science and Technology, Sistema Universitario Ana G. Méndez, Metropolitan University, Ave. Ana G. Méndez Cupey, San Juan 00928, Puerto Rico. [email protected]: +1-787-7661717

Received: January 14, 2016 Peer-review started: January 15, 2016 First decision: March 1, 2016Revised: July 21, 2016 Accepted: August 6, 2016Article in press: August 8, 2016Published online: October 26, 2016

AbstractAIMTo identify differences between primed mouse embryo-nic stem cells (ESCs) and fully functional naive ESCs; to manipulate primed cells into a naive state.

METHODSWe have cultured 3 lines of cells from different mouse strains that have been shown to be naive or primed as determined by generating germline-transmitting chimeras.

Basic Study

Ricardo Antonio Rossello, Andreas Pfenning, Jason T Howard, Ute Hochgeschwender


Rossello RA et al . Characterization and manipulation of primed stem cells

Cells were put through a battery of tests to measure the different features. RNA from cells was analyzed using microarrays, to determine a priority list of the differentially expressed genes. These were later validated by quantificational real-time polymerase chain reaction. Viral cassettes were created to induce expression of differentially expressed genes in the primed cells through lentiviral transduction. Primed reprogrammed cells were subjected to in-vivo incorporation studies.

RESULTSMost results show that both primed and naive cells have similar features (morphology, proliferation rates, stem cell genes expressed). However, there were some genes that were differentially expressed in the naïve cells relative to the primed cells. Key upregulated genes in naïve cells include ESRRB, ERAS, ATRX, RNF17, KLF-5, and MYC . After over-expressing some of these genes the primed cells were able to incorporate into embryos in-vivo , re-acquiring a feature previously absent in these cells.

CONCLUSIONAlthough there are no notable phenotypic differences, there are key differences in gene expression between these naïve and primed stem cells. These differences can be overcome through overexpression.

Key words: ESRRB; ERAS ; Induced stem cells; Over-expression; C-myc


Core tip: Derivation and culturing of mouse embryonic stem cells (ESCs) from gene targeting to injection into blastocysts for chimera generation is a lengthy process that is difficult to control. Some stem cells might be in a primed state, having lost some of their characteristics, most importantly their pluripotency. These differences between ESC clones are usually only detected after many months by the failure of chimeric males to transmit the ESC genome through the germline. Here we have determined key expression differences between cells in a primed state and those in a presumed ground state. Detection of these differences will give researchers a powerful tool to quickly distinguish these cells, saving time, money and effort by choosing the best clones to go forward with. Furthermore, we were able to rescue the ground state through overexpression, indicating that the fate of these cells may potentially be controlled.

Rossello RA, Pfenning A, Howard JT, Hochgeschwender U. Characterization and genetic manipulation of primed stem cells into a functional naïve state with ESRRB. World J Stem Cells 2016; 8(10): 355-366 Available from: URL: http://www.wjgnet.com/1948-0210/full/v8/i10/355.htm DOI: http://dx.doi.org/10.4252/wjsc.v8.i10.355

INTRODUCTIONStem cells are in an early undifferentiated state and have the potential to differentiate into a variety of cell types and tissues, both in-vitro and in-vivo[1]. There are different types of stem cells. Adult stem cells are multipotent cells that exist within the adult tissue[2]. Embryonic stem cells (ESCs) have the potential to be differentiated to any cell type (pluripotent), whereas more differentiated stem cells, such as those in the skin, have a more restricted differentiation potential (unipotent)[3,4]. Induced pluripotent stem cells (iPSCs) can also be differentiated into various cell types[5-8] but a major advantage of iPSCs is that they can be generated from already terminally differentiated cells, such as skin or fibroblasts, of an individual and do not require isolating cells from embryos[9]. Findings that the simple over-expression of four transcription factors (Oct4, Sox2, Klf4 and c-myc) was sufficient to induce iPSCs from adult mice[5] and human[6] cells made the process of generating stem cells much more tractable in certain species, where it was once difficult to generate stem cells (such as in rats[10], pigs[11], and birds[12,13]). Since then, several strategies have been used to manipulate cells into a pluripotent state[14,15].

Derivation of mouse ESCs is a lengthy process[16,17] that often produces cell lines that have all of the features inherent in ESCs, but fail to incorporate into the germline. Similarly, culturing, selection, and expansion of ESC clones for gene targeting experiments results in clones whose potential for germline transmission will only be revealed after months of mouse breeding. This presents a significant limitation, as time invested may not yield the desired results. Identifying the potential of these cells early in the process, in order to make a stop/go decision, could enhance the efficiency in which research is conducted. Furthermore, over-coming identified differences in cells which lost their pluripotency may lead to rescue of valuable cell lines.

Lastly, while the reprogramming of healthy human somatic cells into a stem cell state has been defined[6,14]; there are still important differences being assessed between pluripotent states in derived ESCs, such as the differences between primed and naïve ground states[18].

Our work aims to identify differences, molecular and otherwise, between mouse embryonic stem cells which we are defining as naïve (ESCs that result in germline transmitting chimeras, and thus are fully pluripotent) and primed (ESCs that have all of the features of naïve cells, except that they fail to produce germline transmitting chimeras). These included morphological markers, telomerase activity, MTT assays, and microarray analy-sis, and incorporation into an embryo. Differences in gene expression can be used as a diagnostic tool to determine if the stem cells are in a fully naïve pluripotent state. In addition, we aim to manipulate primed cells, using lentiviral vectors, in order to induce a naïve state. We determined the differential expression patterns in 3 pairs (naïve/primed) of mouse ESC lines derived


from different strains and test the hypothesis that ESC functionality can be restored. Each pair of naïve and primed cell line was generated during a separate gene targeting experiment, each starting from a pluripotent ESC line. Using microarray and bioinformatic analysis, we determined a priority list of differentially expressed genes. The list included genes such as Esrrb, Eras, Klf-5, c-myc, Rnf-17, Atrx, which were significantly downregulated in the primed ESCs; the expression level of these genes was further validated using qRT-PCR. cDNAs for these genes were isolated and used to construct gene cassettes and lentiviral vectors. Primed cells were induced to overexpress some of these genes. Reprogrammed cells were injected into the blastocyst to assess the hypothesis that function, here measured by incorporation into the embryo, could be restored.

MATERIALS AND METHODSGeneral cell culture Mouse embryonic fibroblasts were collected at embryonic day 12.5 for 129 Sv and C57BL/6 mice strains (Jackson). Briefly, embryos (n = 4) were extracted from the womb, their liver and head were removed, and the remaining contents were minced manually using forceps. The contents were placed in a 15 mL tube and treated with 0.25% trypsin (0.25% Trypsin/EDTA, Gibco; 1-2 mL per embryo) for 30 min at 37 ℃, pipetting briefly every 5 min to enhance dissociation. Trypsin was neutralized with complete DMEM media, cells were spun down, counted (hemocytometer), re-suspended in media and plated at a concentration of one embryo per 150 mm dish. When grown to confluent layers, all fibroblasts were passaged in complete media twice before cells were frozen in aliquots. Mouse embryonic stem cells[16] were cultured using KO-DMEM and standard conditions. Cells from two different genetic backgrounds and from three different gene targeting experiments were paired up after they were revealed as naïve (germline transmitting) or primed (no germline transmission), respectively (Table 1).

RNA extractionCells or RNA were spun down and RNA isolated using a standard kit (Promega SV total RNA isolation system, Z3105) as before[12]. RNA was quantified using a NanoDrop 2000c (Thermo Scientific) and then stored in -80 ℃. RNA was used for microarray (methods) and qRT-PCR experiments.

MicroarrayMicroarray analysis was performed in the Microarray Center (Duke University Center for Genomic and Computational Biology), as per their standard protocols (Affymetrix Exon WT Package). Briefly, total RNA (volume 50 mL) was extracted and submitted to the core for analysis on a Mouse Gene 1.0 ST Array (Affymetrix). Results were analyzed using variance stabilization[19].

qRT-PCRComplementary DNA (cDNA) was produced by re-verse transcription (RT) in a 20 mL reaction using the supplier’s protocol (10 mL of 2 × RT buffer and 1 mL of 20 × Superscript II enzyme; Applied Biosystems). The cDNA was then used as a template to perform PCR gene expression assays in 20 mL reactions containing 1 mL template (approximately 2 μg/mL), 10 mL 2 × Gene Expression Master Mix (BioRad) and forward and reverse TaqMan primer probes (Generated by Applied Biosystems) or in 20 mL reactions containing the same reagents, but in place of TaqMan primers, custom PCR primers and 1 mL SYBR green (BioRad). The reactions were performed in a Cx96 real-time machine (Bio-rad). Cycling conditions were 95 ℃ for 10 min, followed by 35 cycles of denaturation at 95 ℃ for 15 s and annealing/extension at 60 ℃ for 1 min. No-template controls were run for each primer set and probe. 18S rRNA endogenous control was run for each sample using TaqMan primers that recognized the RNA in all samples tested (Cat# Eukaryotic 18S RNA HS99999901_S1; Applied Biosystems). The results were normalized to the endogenous 18S expression and to the gene expression level of the control mouse fibroblasts using the 2-DDCT method common for qRT-PCR analyses[20]. All primers showed efficiency levels above 90%, using the protocol in the MIQE guidelines (minimal information for publi-cation of real-time PCR experiments). For statistical analysis, 2-way ANOVAs were performed on two factors [genes and strain type (C57BL/6 and 129 Sv)] on n = 3 independently generated lines (replicates) for each of the groups. Table 2 contains the primer sets utilized in this project.

Viral vector generationIn order to generate vectors, we used the backbone for the STEMCCA Cassette[20], excising the stem cell genes using restriction enzymes. After evaluating a priority list of differentially expressed genes, we decided to generate cDNAs for two genes, Eras (Embryonic Stem Cell Expressed RAS, ENSMUSG00000031160) and Ring Finger Protein 17 (Rnf-17, ENSMUSG00000000365) and Essrb (Estrogen Related Receptor Beta, ENSM-USG00000021255) were generated in order to incor-porate them into the cassette. RNF17 incorporation was not successful, therefore, only the ESRRB and Eras genes were used. Cassettes with c-myc and KlF-4 derived from Sommer et al[20], were also generated. We also generated a cassette with Nanog (NM_028016.1), as a positive control to ESRRB.

Mouse strain of ESC line

Targeted locus

Germline transmissionPluripotent

No germline transmission

Not pluripotent 129Sv POMC I (QKQR-1E) II (QKQR-11B) C57BL/6 IGFR1 III (IGFR1-152) IV (IGFR1-R13) C57BL/6 FGF13 V (FGF13-1) VI (FGF13-15)

Table 1 Naive and primed mouse embryonic stem cells

ESC: Embryonic stem cell.



Viral generationLentiviral vectors were generated in human embryonic kidney 293T cells (Cell Biolabs, Cat # LTV-100), using a third-generation lentiviral system, following a previously described protocol[12]. Prior to transfection, the cells were plated on 10 cm collagen coated plates at a density that resulted in 60%-70% confluency at the time of transfection. A transfection mix was prepared with either 5, 10 or 15 mg of DNA of the genes generated in vector or control GFP lentiviral vectors (EF1alfa-GFP; generated in lab), packaging cassette (REV and Gag/Pol, 10 mg) and the VSV-G (5 mg) envelope expression cassette, respectively. The cells were then transduced with the mix, using 40 mL of Lipofectamine (Invitrogen) per plate. Eight hours after the addition of DNA, the transduced cells were washed with PBS and fresh complete media as used for mouse cells. Media with viral particles were collected every 24 h for the next 48 h and stored at 4 ℃ until complete. Viral particles were separated from cellular debris by centrifugation at 4000 g for 5 min followed by filtration through a 0.45-micron filter. The titer was measured using Quick-Titer (Cell Biolabs Inc, Cat # VPK-112) and promptly stored at -80 ℃. If necessary, titer concentrations were increased by ultracentrifugation (SW-29 rotor) at 50000 g for 2 h, followed by re-suspension in PBS (pH = 7.2).

Lentiviral transductionTransduction was performed in the Comprehensive Cancer Center of Puerto Rico, using the ViraDuctin system, as per supplier’s protocol (Cell Biolabs, Cat # LTV-201) in KO medium. Before transduction, cells were thawed and cultured in complete media until 80% confluent. After transduction, cells were grown for 10 d, then passaged (1st passage), and let to grow for approximately 10 d in KO medium. Viral transduction efficiency values were assessed at different vector concentrations in 48 well plates and cell colony-forming units quantified as before (Rosselló et al[12], 2013).

Proliferation assayTo assess proliferation, we used the MTT [3-(4,5-Dime-

thylthiazolyl-2)-2,5-diphenyltetrazolium bromide] Quantitative Cell Proliferation Assay (ATCC; Cat# 30-1010K). Briefly, tetrazolium salts are reduced metabolically by the cells, resulting in a colorimetric change. The resulting intracellular purple formazan is solubilized and quantified spectrophotometrically (at 570 nm). Cells were plated at 10000 cells/well (in quintuplets) and incubated for 24 h. Ten microliters of the MTT reaction solution was added to each plate and incubated for 3 h. One hundred microliters of detergent was added to each plate, stored for 2 h in the dark (room temperature), and the absorbance was measured at 570 nm using a Molecular Devices Emax Microplate Reader. ANOVA was performed to test for differences between cells and strain (n = 5 lines, per strain). Statistical significance was considered at P < 0.05.

Telomerase activityTelomerase enzymatic activity was determined using the Quantitative Telomerase Detection Kit (BioMax, United States, MT3012), following the manufactur-er’s protocol. Cell extracts containing proteins and RNA were generated from the ESC, iPSC, and control fibroblast, and then telomerase activity was measured. If telomerase is present, it adds nucleotide repeats to the end of an oligonucleotide substrate of the kit, which is subsequently amplified by real time qPCR. Quantitation was carried out by the PCR software of the BioRad Cx96 system. Positive control (template provided with kit) and negative control (heat inactivated samples) reactions were performed. Cycling conditions for the BioRad Cx96 real-time machine were as follows: 48 ℃ for 10 min and 95 ℃ for ten min, followed by 40 cycles of 95 ℃ for 15 s (denaturation) and 60 ℃ for 1 min (annealing/extension). All reactions were performed in quintuplets. Paired t-tests were performed to test for differences of telomerase in the induced and control fibroblasts of each cell line. Statistical significance was considered at P < 0.05.

Chimera formationBlastocysts (from strain C57BL/6) were injected with

Mouse Gene identification Fwd primer Rev primer

Oct-4 NM_013633.2 CCCCATGTCCGCCCGCATAC AGGCCCAGTCCAACCTGAGGTC Sox-2 NM_011443.3 GAAGAACAGCCCGGACCGCGT ATGAACGGCCGCTTCTCGGT c-myc NM_010849.4 ACCCGCTCAACGACAGCAGC ACTAGGGGCTCAGGGCTGGC KLF-4 NM_207209.2 TAGTGGCGCCCTACAGCGGT TCGTGTGTGTTGGGCCGGTG KLF-5 NM_009769.4 CACCGGATCTAGACATGCCC ACGTCTGTGGAACAGCAGAG Pax-6 NM_001244198.1 CACCAGACTCACCTGACACC TCACTCCGCTGTGACTGTTC BMP-7 NM_007557.3 CTGAGTAAAGGACAGGGGCG CTGAGTAAAGGACAGGGGCG ESRRB NM_001159500.1 CTACGCCACTCAAGAAGCCA TTGATGAAGGAGCCGCAACT Nanog NM_028016.1 GGCTGCCTCTCCTCGCCCTT GTGCACACAGCTGGGCCTGA ERAS NM_181548.2 TGCCCCTCATCAGACTGCTA CCAAGCCTCGTGACTTTCCT ATRX NM_009530.2 CTTGCTTTGTTTCCGTGGCTCT CTTGTTTCCACTCATGGGCTC RNF17 XM_006519107.1 CACCTAGTGGAGAGTGACCA TCTAAATGCCTGTCAGGGGC

Table 2 Primers used for quantificational real-time polymerase chain reaction to amplify and quantify expression of differentially expressed genes



control fibroblasts, primed ESCs, reprogrammed primed ESCs and positive control naive ESCs and implanted into recipient females of the same strain as has been previously done[21]. Briefly, we injected blastocysts, isolated from pregnant C57BLK/6 females, with fibro-blasts, primed ESCs, reprogrammed primed ESCs, and positive control naïve ESCs (n = 4). All cells were labeled with GFP through viral transduction. Five days after injection, embryos were extracted and analyzed for incorporation. Embryos were placed in 70% EtOH solution, before being paraffined and sectioned for histological analysis.

Immunohistochemistry GFP labeling (performed by the Duke University Pathology Lab, as before[12]) was performed on mouse embryos, or positive control tissue slides (GFP positive), that were cut at 5 mm on a paraffin block and mounted onto glass slides. These were dried for 40 min at 60 ℃ in an oven. The slides were deparaffinized in 3 changes of xylene (5 min each), 2 changes of 100% EtOH (3 min each), and 2 changes of 95% EtOH (3 min each). Rehydration was performed in dH2O for 1 min. To block endogenous peroxidase activity, 3% hydrogen peroxide was used for 10 min, followed by a rinse in dH2O to remove antigens. For the primary antibody [anti-Rabbit GFP Abcam ab290, diluted at 1:100 in PBS (pH = 7.1)], 200 mL of the citrate, pH 6.1, antigen-retrieval buffer from Dako (10 × concentrate) were used. The buffer was preheated to 80 ℃ in a Black and Decker vegetable steamer for 20 min. The slides were then cooled to room temperature. Slides were thoroughly rinsed in water and placed in TBST. After antigen retrieval, 10% normal rabbit serum was applied to the slides and incubated for 60 min at room temperature. Afterwards, they were washed with PBS and the excess

was drained. After incubation, Vectastain Elite ABC was used, followed by DAB chromagen (Dako), and incubated for 5 min, followed by washing. All slides were counterstained in hematoxylin for 30 s. Slides were rinsed in tap water until clear and coverslipped.

Animal care and useAll appropriate measures were taken to minimize animal discomfort, monitor post operative recovery and establishing humane endpoints per our IACUC protocol A262-12-10.

Statistical analysisBiostatistics were reviewed by an expert in biomedical statistics, in order to evaluate methods used, as per suggestions. For the gene comparative, the positive log fold change values mean that the gene expression is lower in the pluripotent cells. The same is true for the t value (which the P value is based on that shows the strength of significance). Although P and t values are linked, we use t values to determine differences between populations, in order to measure the size difference rela-tive to the variation.

RESULTSMorphology, proliferation and telomerase activity At first glance, all ESC cells exhibit similar morphology. Those that had been determined to be primed, i.e., no germline transmission, showed round, cluster like formation, similar to naïve ESCs (Figure 1), as well as alkaline phosphatase activity (not shown). In addition, qRT-PCR was performed on all samples to determine expression of typical stem cell genes (Oct-4, Sox-2, Klf-4, Nanog). Here, they exhibited similar profiles (relative to control fibroblasts) (Figure 2). Normalization

129SV C57BLK C57BLK

Prim

ed m

ESCs

N

aïve

mES

Cs

Figure 1 Primed and naive cells from different strains exhibit similar morphology. Cells that turn out to be primed are visually indistinguishable from otherwise fully naïve stem cells (scale bar 150 mm). ESCs: Embryonic stem cells

150 mm



was performed with 18 s expression levels for each sample. In order to compare the expression levels of the different stem cells relative to fibroblasts, fibrob-lasts expression values were set at 1 (Figure 2). This normalization allows us to visualize and determine the difference between fibroblasts and the stem cell groups, relative to each other.

Doubling times were observed to be similar in all six cell types (3 naive, 3 primed), but were also put to the quantitative test with an MTT Assay. After 5 passages, there was no significant difference between cells, and they all maintained steady rates (Figure 3A).

Finally, we assessed telomerase activity in all cell types. Telomerase expression is low or absent in most somatic tissues, such as our control fibroblasts, but not in germ cells, stem cells, and tumors. The telomerase binds to a particular repeat sequence TTAGGG present at the ends of chromosomes of most eukaryotic species and extends them during cell replication. While telomerase activity was significantly lower in the control fibroblast cells, there was no significant difference between the naïve and primed ESC groups (Figure 3B).

Differentially expressed genesThe gene array that was utilized (Affymetrix Mouse 1.0 ST Array), evaluated a total of 22690 genes. Our analysis included all of the genes, and a priority list was established for those that were differentially expressed

(Table 3). We used a positive log fold change to evaluate the differences. A positive log fold change indicates that gene expression is lower in the naïve cells. The same is true for the t value (which the P-value is based on that shows the strength of significance).

A gene ontology analysis was performed on the top set of genes using the Ingenuity Pathway Analysis. We have provided a detailed list of all significant gene ontology categories and the genes within (Table 4). Cell proliferation is the most significant gene ontology category. The P-value estimated from the current version of the IPA database (October 2015) is 1.08E-8. The gene ontology categories we searched are comprised of thousands of complex overlapping hierarchies. Further analysis was performed examining significant sub-categories listed under proliferation. The two sub-

400

10040

10

41

0.40.1

0.040.01

0.0040.001

0.00040.0001

Rela

tive

expr

essi

on

ATRX

BMP-7

c-myc

ERAS

ESRR

BKL

F-4 KLF-5

Nanog

Oct-4

Pax-6

RNF1

7So

x-2

Genes

FibroblastsmESCPrimedNaïve

Figure 2 Differentially expressed genes in primed, naive and reprogrammed primed embryonic stem cells. qRT-PCR of known master factor stem cell genes and candidate genes selected from our microarray analysis (Tables 3 and 4, Figure 4). Differences are measured in relative expression levels (to control fibroblasts). Results show that master factor genes such as Oct-4, Sox-2 and Nanog are all significantly higher than the control fibroblasts (red) in naive (blue), primed (green) and reprogrammed primed cells (yellow). Primers used are shown in Table 2. Esrrb, Atrx and Rnf-17 are all significantly upregulated in naïve ESCs and reprogrammed primed ESCs, relative to primed ESCs. Pax-6 and BMP-7 are significantly upregulated in primed ESCs. Expression levels were measured in established ESCs and primed ESCs after the 30th passage, in re-programmed primed ESCs two passages after transduction, and in fibroblasts two passages after primary cells were extracted. Error bars indicate SEM within cell populations (Tukey’s post hoc, P < 0.001; n = 5 replicates of independent cell lines). ESCs: Embryonic stem cells.

1.0

0.9

0.8

0.7

0.6

0.5

0.4

0.3

0.2

Opt

ical

den

sity

(M

TT)

1 2 3 4 5

1 2 3 4 5

Telo

mer

ase

mea

n CT

30.530.029.529.028.528.027.527.026.526.025.525.024.524.023.5

FibroblastsPrimedNaïve

A

B

Figure 3 Proliferation and telomerase. Time course of self-renewal and proliferation of stem cells (potential induced pluripotent stem cells-like cells and embryonic stem cells) relative to control fibroblast (red) as measured by the MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenilytetrazolium bromide] assay (read at 570 nm). mESCs (blue) and primed mESCs (green) exhibit similar patterns of proliferation, while fibroblast proliferation diminishes as time passes. Telomerase activity was greatly increased (lower mean CT) in both mESCs and primed mESCs over control fibroblast cells. Error bars, SEM (n = 5 independent replicates for both MTT and telomerase data). mESCs: Mouse embryonic stem cells; CT: Cycle threshold.


1456190_a_at BC031140 3.659632397 0.015088211 1436162_at C730048C13Rik 3.668343947 0.014953486 1420517_at 2310010I16Rik 3.669025757 0.01494300 1452408_at 3.669339752 0.014938174 1438215_at Sfrs3 3.674062823 0.014865793 1417757_at Unc13b 3.696140227 0.014532751 1417270_at Wdr12 3.706962408 0.014372629 1424942_a_at Myc 3.714859557 0.014257063 1422135_at Zfp146 3.722089586 0.014152193 1425270_at Kif1b 3.723748371 0.014128258 1428045_a_at Elf2 3.731380905 0.014018724 1427101_at Metrn 3.749492087 0.013762692 1419940_at 4930488L10Rik 3.761372517 0.01359766 1435626_a_at Herpud1 3.76528356 0.01354383 1423437_at Gsta3 3.765317741 0.013543361 1449416_at Fzd4 3.775661238 0.01340218 1428160_at Ndufab1 3.778355433 0.013365684 1417029_a_at Trim2 3.781146538 0.013327996 1455808_at 4922502D21Rik 3.782747632 0.013306432 1430483_a_at 2310042N02Rik 3.791162199 0.013193759 1424083_at Rod1 3.791959817 0.013183136 1460725_at Xpa 3.792592186 0.01317472 1452318_a_at Hspa1b 3.796896622 0.013117602 1421230_a_at Msi2h 3.812474518 0.012913258 1418349_at Hbegf 3.817881032 0.012843195 1440192_at 1810054D07Rik 3.854206413 0.012383645 1452243_at Kcnj14 3.85496781 0.012374217 1451887_at Lrba 3.857465589 0.012343347 1419900_at Sin3a 3.88287621 0.012034288 1450193_at Hcn1 3.891121372 0.011935929 1417905_at Prlpf 3.896151709 0.011876375 1434987_at Aldh2 3.902236841 0.011804791 1449118_at Dbt 3.905570325 0.011765788 1420982_at Rnpc2 3.917975152 0.011621945 1424755_at Hip1 3.936108008 0.011415316 1446914_at Eif2s2 3.944832819 0.011317406 1455540_at 3.954421033 0.011210923 1456319_at 3.960519659 0.011143796 1438741_at Rbm13 3.971304363 0.011026221 1449597_at 3.9720719 0.011017908 1416934_at Mtm1 3.975422707 0.010981701 1426196_at 3.981642563 0.010914857 1427765_a_at Tcrb-V13 3.988067373 0.010846303 1419277_at Usp48 3.995642623 0.010766111 1438700_at Fnbp4 4.007934467 0.010637441 1451739_at Klf5 4.009661813 0.010619502 1452415_at Actn1 4.013468651 0.010580091 1421595_at 9630031F12Rik 4.026451959 0.010446942 1423093_at Incenp 4.056991536 0.010141312 1449729_at 4.059318965 0.010118447 1448371_at Mylpf 4.060423682 0.010107615 1432007_s_at Ap2a2 4.061118175 0.010100812 1426375_s_at BC019806 4.061705841 0.01009506 1421267_a_at Cited2 4.067131851 0.010042127 AFFX-18SRNAMur/X00686_3_at 4.068244684 0.01003131 1424872_at 2310001H12Rik 4.072170362 0.009993261 1448606_at Edg2 4.076478623 0.009951696 1420930_s_at Catnal1 4.093968451 0.009784998 1438082_at 2310028N02Rik 4.096841999 0.00975792 1418569_at 2410043F08Rik 4.109867254 0.009636263 1417178_at Semcap2 4.111817999 0.009618195 1452620_at Pck2 4.113798961 0.009599886 1419116_at 5430428G01Rik 4.127933982 0.009470413 1451902_at BC021442 4.164797416 0.009142157 AFFX-18SRNAMur/X00686_M_at 4.172558479 0.009074738 1449838_at Crisp3 4.181403551 0.008998604 1450430_at Mrc1 4.194900667 0.008883849 1431893_a_at Tprt 4.199779855 0.008842784 1453360_a_at Tex9 4.212874201 0.008733659 1418417_at Msc 4.222435464 0.008654964


Table 3 Top differentially expressed genes


ID Gene symbol (HUGO)

t P value

1420106_at Siah1a 3.397282751 0.019877842 1451158_at Trip12 3.397517988 0.019872832 1425223_at Birc3 3.399188537 0.019837294 1455579_at Csng 3.407711727 0.019657099 1416670_at Setdb1 3.40836782 0.019643305 1448406_at Cri1 3.417799448 0.019446231 1420981_a_at Lmo4 3.424023676 0.01931741 1417831_at Smc1l1 3.429111876 0.019212822 1423271_at Gjb2 3.440985605 0.01897126 1425329_a_at Dia1 3.444249087 0.018905474 1438223_at Grid2 3.447575597 0.018838686 1422666_at Cblc 3.458197089 0.018627226 1434755_at Coro2b 3.458912253 0.018613086 1422812_at Cxcr6 3.459767614 0.01859619 1416515_at Fscn1 3.460527429 0.018581195 1449371_at Harsl 3.460876887 0.018574304 1415772_at Ncl 3.461800178 0.018556109 1448389_at Wdr5 3.473565946 0.018326028 1426389_at Camk1d 3.474454082 0.018308793 1424840_at Rbks 3.476474953 0.018269645 1425234_at 1700051I12Rik 3.477915552 0.018241796 1452638_s_at Dnm1l 3.478750478 0.018225678 1430335_a_at Pax3 3.480374948 0.018194365 1427854_x_at 3.482574812 0.018152058 1452402_at 3.483987577 0.018124947 1438070_at Phf3 3.487165588 0.018064131 1454061_at Thumpd3 3.488257585 0.018043287 1420053_at Psmb1 3.488906078 0.018030922 1422546_at Ilf3 3.508209824 0.017667244 1418909_at Ermap 3.509477595 0.017643654 1424498_at 5730596K20Rik 3.515771328 0.017527076 1418065_at Rag2 3.520156261 0.017446374 1425961_at BC016548 3.520765643 0.017435193 1444953_at 8430423A01Rik 3.524330508 0.017369944 1418227_at Orc2l 3.526672877 0.017327223 1419179_at Txnl4 3.529589461 0.017274198 1423249_at Nktr 3.532283103 0.01722539 1427554_at Hel308 3.53288254 0.01721455 1427643_at 1200009O22Rik 3.543340398 0.01702668 1421869_at Trim44 3.554867777 0.016822308 1427482_a_at Car8 3.558911802 0.016751276 1432459_a_at Rog 3.561412525 0.016707523 1438245_at Nfib 3.565204959 0.01664142 1422956_at D1Pas1 3.576076558 0.016453576 1422036_at Strn 3.57762187 0.016427073 1453683_a_at 1200008O12Rik 3.585757456 0.016288346 1419253_at Mthfd2 3.586846457 0.016269879 1420974_at Setdb1 3.587477754 0.016259184 1431686_a_at Gmfb 3.588593964 0.016240294 1430586_at 2700007P21Rik 3.588969301 0.016233948 1423553_at Dnajb3 3.599839679 0.016051375 AFFX-18SRNAMur/X00686_5_at 3.612923955 0.015834729 1438748_at 2700078E11Rik 3.613005797 0.015833384 1425605_a_at Lmbr1 3.614705726 0.015805487 1443589_at Gpm6b 3.615856465 0.015786634 1425338_at Plcb4 3.61646714 0.015776639 1428132_at Cdc42se1 3.625113293 0.015635909 1450541_at Pvt1 3.628326703 0.015583973 1456565_s_at Map3k12 3.631282846 0.015536369 1419052_at Ovol1 3.635287213 0.015472151 1451456_at 3.640820903 0.015383907 1452642_at Tmem16f 3.646863541 0.015288205 1451021_a_at Klf5 3.651556285 0.015214353 1421933_at Cbx5 3.652925906 0.015192876 1419241_a_at Aire 3.655287704 0.015155921

1456225_x_at Trib3 4.225132709 0.008632913 1427649_at Wdr22 4.23098011 0.008585331 1452502_at Serf1 4.234174345 0.008559468 1452070_at Dedd2 4.27019116 0.008274009 1448457_at Krt2-6g 4.278133662 0.008212555 1416268_at Ets2 4.278591968 0.008209025 1425831_at Zfp101 4.280752877 0.008192405 1449693_at Map3k7 4.284119202 0.008166592 1449229_a_at Cdkl2 4.286647093 0.008147271 1452142_at Slc6a1 4.305051867 0.008008185 1430634_a_at Pfkp 4.316779598 0.007920996 1428060_at Cd3z 4.323698776 0.007870073 1434326_x_at Coro2b 4.329579399 0.007827092 1424843_a_at Gas5 4.357574401 0.007626183 1421279_at Lamc2 4.404512781 0.007302618 1421496_at 2410116I05Rik 4.40646557 0.007289506 1419921_s_at Usp7 4.409499533 0.007269189 1448348_at Gpiap1 4.411257474 0.007257448 1423809_at Tcf19 4.516818863 0.006591172 1429427_s_at Tcf7l2 4.555365814 0.006365827 1431117_x_at 1810029B16Rik 4.593837426 0.006149825 1450791_at Nppb 4.610263947 0.006060208 1451524_at Fbxw2 4.619741472 0.006009196 1426458_at 4.621344819 0.006000616 1431716_at Herc4 4.621895613 0.005997671 1421257_at Pigb 4.628246541 0.005963844 1425285_a_at Rab27a 4.63066177 0.005951038 1425709_at Rnf17 4.684098899 0.005675746 1418460_at Sh3d19 4.750024695 0.005356347 1434674_at Lyst 4.776236981 0.005235221 1422567_at Niban 4.818450492 0.005046817 1423154_at BC005537 4.830514081 0.00499444 1425837_a_at Ccrn4l 4.886163806 0.004760904 1419929_at 4.934007639 0.004570291 1427285_s_at 2210401K01Rik 4.971430915 0.004427403 1424841_s_at Rbks 4.999229746 0.004324644 1456511_x_at Eras 5.002953677 0.004311091 1460464_at 2700089E24Rik 5.011990225 0.004278412 1435106_at 3732412D22Rik 5.067838157 0.004082764 1420605_at Mtag2 5.106047884 0.003954942 1438403_s_at Ramp2 5.1302574 0.003876383 1438824_at Slc20a1 5.153244671 0.003803479 1422986_at Esrrb 5.181240688 0.003716852 1437867_at 5.202674306 0.003652093 1451416_a_at Tgm1 5.218518597 0.003605072 1455930_at 5.274806147 0.003443681 1422903_at Ly86 5.294879889 0.003388188 1420947_at Atrx 5.29861609 0.003377976 1426267_at Zbtb8os 5.321555804 0.003316062 1420946_at Atrx 5.339806851 0.003267753 1443949_at Ppp2r5e 5.375119299 0.003176613 1418189_s_at 5.379928117 0.003164434 1427408_a_at Thrap3 5.479919443 0.002923217 1418188_a_at 5.510099766 0.002854707 1416325_at Crisp1 5.528967926 0.002812835 1423411_at BC013481 5.560493925 0.002744476 1449167_at Epb4.1l4a 5.632515885 0.002595515 1417755_at Topors 5.656705105 0.002547636 1424786_s_at Wdr45 5.706240554 0.002452797 1417548_at Sart3 5.718574747 0.002429833 1420781_at Etos1 5.757749264 0.002358561 1425019_at Ubxd4 5.830010327 0.002233456 1420909_at Vegfa 5.932031625 0.002069901 1450051_at Atrx 5.978799312 0.001999675 1420169_at 6.10858383 0.001819049 1447984_at Gpatc2 6.132886435 0.001787407 1422259_a_at Ccr5 6.259509495 0.001632696 1442566_at Jarid2 6.267516862 0.001623457 1437534_at 6.415989061 0.001462848 1428786_at 4930568P13Rik 6.897342617 0.001057372


categories that passed our significance threshold were “proliferation of stem cells” at P = 5.45E-5 and “proliferation of embryonic cells” at P = 1.41E-4 (Table 4). These two, more specific, categories further connect the results of our gene ontology analysis to the function of embryonic stem cells. These two candidate genes (ESRRB and ERAS), as well as the others we highlight (KLF5 and MYC) are found in the significant “proliferation” sub-categories. Only 18 distinct genes are found in these two sets. Estrogen-Related Receptor Beta (Esrrb), Eras and myc are found in “proliferation of embryonic cells” (Table 4). The other significant sub-category of proliferation, “proliferation of stem cells”, contained the genes Eras, Kruppel-Like Factor (Klf-5), and myc (Table 4).

Thus, we turned our attention to a particular set of genes that were differentially higher in naïve stem cells. In particular, Klf-5 (5 1451021_a_at, 1451739_at), c-myc (1424942_a_at), Rnf-17 (1425709_at), Esrrb (1422986_at), Eras (ES Cell Expressed Ras 1456511_x_at) have been implicated in stem cell growth and pluripotency. It is important to note that there were several genes that were upregulated in the primed, that are implicated in differentiation, such as bone morphogenetic protein 7 (Bmp-7) and paired box 6 (Pax-6). Microarray results were validated using qRTPCR (Figure 2).

Manipulation of primed cells and in-vivo incorporationPrimed cells were transduced with GFP containing vectors expressing either Essrb or Eras. In addition to these two genes, cells were transduced with c-myc and Klf-4. Gene expression was assessed with RTPCR (Figure 2, only ESRRB + c-myc + Klf-4 transduced

Top 200 differentially expressed genes in incorporating stem cells relative to non-incorporating stem cells.

Categories Diseases or functions

annotation

P value No. of molecules

Cellular growth and proliferation Proliferation of cells

1.08E-08 114

Cellular development, cellular growth and proliferation

Proliferation of stem cells

5.45E-05 11

Cellular development, cellular growth and proliferation, embryonic development, development

Proliferation of embryonic

cells

4.41E-04 13

Table 4 Top gene ontology (proliferation)

The category and sub-categories annotated as “proliferation”. Shown are the top gene ontology results (P < 10E-4, number of molecules ≥ 5) of analysis performed on the 391 genes found to be significantly different between groups (P < 0.02). The analysis was performed with IPA (http://www.ingenuity.com/products/ipa, October 2014).


1418350_at Hbegf 8.389351415 0.00043149 1449898_at 1-Sep 9.133148915 0.00029058


cells shown). Embryos injected with primed transduced cells over-expressing ESRRB were able to incorporate into mouse embryos, whereas those same cell controls were not. When ESRRB, c-myc and Klf-4 where expressed in the same primed ESC, cells incorporated into 5 out of 6 of the embryos (Figure 4). However, cells overexpressing Eras alone, or Eras with Klf-4 and c-myc, were not able to incorporate, with the exception of one sample containing all three (1 out of 6). Cells transduced with c-myc and Klf-4 only did not incorporate. Cells overexpressed with Nanog only did not incorporate, demonstrating that the effect is Esrrb dependent. Positive control groups (naïve ESCs, Figure 4C) and negative control groups (fibroblasts, Figure 4A) showed the expected results.

Given the results, we performed expression profiles on Esrrb levels of primed ESCs. The data shows that all of them expressed significantly less Esrrb than their naive counterparts.

DISCUSSIONEstablishing mouse ESC cell lines from blastocysts or after gene targeting experiments can be a laborious endeavor, which may produce naïve or primed ESCs. Here we report that, although there are no significant differences in morphology, proliferation, telomerase

activity, there are however some significant differences in the expression level of key genes. Upregulation of key genes is observed in primed cells that indicate differentia-tion, such as Bmp-7 and Pax-6. Bmp-7 is a bone morphogenetic protein has been shown to be important in development, particularly, bone formation[2,22] and embryogenesis[23]. Pax-6 is a transcription factor that is implicated in embryonic development, particularly the brain and eye[24], ensuring proper tissue formation. Although further studies are necessary, overexpression of these factors, relative to a base ESC range, could provide an early marker to determine if the cell clones are naïve or primed.

Our attention focused on genes that were down-regulated in primed ESCs. Ingenuity Pathway Analysis showed that the top gene ontology category was proliferation. Interestingly, there was no significant difference in proliferation rates, when measured by MTT (Figure 3A). However, some of these genes have also been implicated in pluripotency and stem cell self-renewal. This may indicate that either pluripotency genes are the driving force, or that diminishing proli-feration rates may be small and biologically significant or may be observed in further cell passages. In any case, downregulation of these genes may serve a similar diagnostic purpose as the upregulated ones.

Specifically we examined several genes that were

Fibroblasts mESCs (primed)

mESCs (naïve) Primed + ESRRB

A B

C D

Figure 4 Sample tissue of mouse embryos after blastocyst injections of embryonic stem cells (100 ×). Five days old embryos that were produced with GFP labeled cells were sectioned and stained for GFP (brown color). Sample tissues are shown here. Cells that were reprogrammed with Esrrb + Klf-4 + c-myc integrated into the embryo (D), as well as positive control naïve ESCs (C). No incorporation was observed in the primed state (B) or in control embryos injected with fibroblasts (A). Sample size was set at n = 4 mice per cell type. ESCs: Embryonic stem cells; GFP: Green fluorescent protein.



downregulated in primed cells; namely Eras Esrrb, c-myc, Klf-5, Atrx, and Rnf-17. All of these genes were shown to be significantly downregulated relative to funtional ESCs (Figure 2). Eras produces a constitutively active product that stimulates ESC proliferation[25], while Esrrb has been shown to have an essential role in placental development and has recently been used as a marker for iPSC reprogramming and substitute for Sox-2[26,27]. Eras has been identified to provoke tumorigenic growth, expressed only in stem cells and silenced in somatic cells due to epigenetic changes. Adding Eras exogenously in a constitutively expressed promoter would overcome this limitation. Asides from Sox-2, Esrrb has also been identified as prominent transcription factor that targets Nanog[28]. However, interestingly, when overexpressing Nanog only in primed cells, they did not acquire a naïve phenotype, showing that ESRRB’s role spans beyond only NANOG. In fact, ESRRB’s role interacting with key stem cell master factors, made it a prime candidate to study not only as a diagnostic indicator, but also as a potential reprogramming factor[29]. In addition ESRRB has been implicated as key downstream regulator of self-renewal, downstream of GSK-3[27]. Inhibition of GSK-3 has been implicated in supporting mESC state.

Low induction of endogenous Klf-5 may be due to the redundancy of the Klf family[30], or a lineage specific difference of mammals. It has been shown that the Klf family preferentially regulates genes involved in cell adhesion, either activating or inhibiting adhesion, and that cell adhesion can inhibit proliferation[31]. Myc, in particular c-myc, is known to induce proliferation, by repressing growth arresting genes[32]. This makes it a key contributor in inducing the self-renewal state of the cell. Recently, other factors that are less oncogenic have been shown to be suitable substitutes for c-myc, such as Glis1[14]. However, Glis1 is not differentially regulated between the naïve and primed cell types. Although we were not able to produce Atrx and Rnf-17 vectors, they do serve as key indicators. Atrx [alpha thalassemia/men-tal retardation syndrome X-linked homolog (human)] is known for its role in mental retardation, but it has recently been shown that it is a key element in maintaining telomere integrity in pluripotent stem cells[33]. Three different times this gene (1420947_at 1420946_at and 1450051_at) is in the top 20 genes downregulated, and differences in expression level were significant (Figure 2 and Table 4). Future studies will look at this particular gene and its novel function. Rnf-17 is involved in early stages of germ cells, such as PGCs[34,35]. It is also known that Rnf-17 enhances c-myc function, through interaction with all four known Mad proteins[36]. Although germline transmission is beyond the scope of this paper, primed cells do not possess this quality. We encourage others to examine the differentially expressed genes to further elucidate important mechanisms in the maintenance and plasticity of ESCs (Table 3).

It is interesting to note that key stem cell “master

factor” genes, such as Oct-4, Sox-2 and Nanog[37], are not differentially expressed in cells whose in-vivo function is limited. These results may therefore yield insights into proper reprogramming of iPSCs, as all of these genes may be upregulated, but other key co-regulators may be lagging.

Another important question in our project was to determine if we could restore the fully functional naïve phenotype, by overexpressing some of these key genes. Here we show at least one combination of transfections (Esrrb + Klf-4 + c-myc) in primed cells was able to alter the expression profile and establish functionality as determined by the degree of incorporation of ESCs into embryos (Figure 4). Also, in two cases, Esrrb was sufficient to establish pluripotency in primed stem cells. We do not claim that these vectors will work for every case, but do demonstrate the principle that these cells can be reprogrammed into a naïve state, without the need for the OSCK cassette[20]. This suggests that, through genetic manipulation, it is possible to restore the functional naïve state of a primed mESC. The results may be a translational gateway into reprogramming human ESCs, into a naïve state with full ESC features and function.

Although there were strain differences observed in terms of gene expressions, all of the genes utilized in our experiments were differentially expressed in both C57BL/6 and 129SV derived ESCs. Further studies are needed to assess if there are significant strain differ-ences, and what their implications are.

Our study shows that there is a significant set of genes that are differentially expressed between naïve and primed mESCs. These genes tend to be implicated in proliferation and pluripotency. Overexpression of at least one set of genes restores the functional naive phenotype in the primed cells. Taken together, primed cells can be identified at early stages, allowing the researcher to disregard this cell type or attempt to change it into a naïve state. Future studies into other genes, such as ATRX, should yield further insight into the nature of ESC functionality and phenotypes, providing a platform to study the ESC ground state and iPSC reprogramming fate.

ACKNOWLEDGMENTSWe’d like to thank Erich Jarvis for his support, mentoring and comments throughout this project, and Gustavo Mostoslavsky (Boston University) for providing the STEMCCA cassette vector. We would also like to thank the University of Puerto Rico Comprehensive Cancer Center, for the lab space provided to perform some of the experiments. ES cell targeting experiments, blastocyst injections for generation of chimeras, and mating of chimeric males to test for germline transmission were performed by the Duke Neurotransgenic Laboratory. Microarray analysis was performed in the Duke University DNA analysis facility.



COMMENTSBackgroundDerivation of mouse embryonic stem cells (ESCs) or gene targeting of ESCs is a lengthy process that sometimes produces cell lines that have all of the features inherent in ESCs, but fail to incorporate into the germline. Identifying this limitation takes many months, from blastocyst injection of ESCs to testing chimeric males for germline transmission of the ESC genome.

Research frontiersCell plasticity, reprogramming, and maintenance of stem cells are all inherent topics in this research.

Innovations and breakthroughsNo study, that the authors are aware of, had looked at the differences between two phenotypically identical stem cells, and determined the features that make them behave differently. In addition, here the authors demonstrated that the incorporating/pluripotent feature can be induced in these stem cells as well as potentially controlled.

ApplicationsResearchers will be able to detect within days if the stem cells they are working with have the capacity to be functional, i.e., generate germline transmitting chimeras, or not. This is a key feature that will save time, money, and effort.

TerminologySeveral proteins and gene products are discussed in this paper. Importantly, ESRRB is an estrogen related receptor beta that has been implicated as a downstream regulator of self-renewal and embryonic stem cell expressed RAS, has been implied with tumorigenic growth in stem cells.

Peer-reviewThe paper is well written and addresses an important issue of the ESC functionality. Authors performed transcriptom analysis of functional and non-functional ESC lines and found some differences in gene expression signature. Overexpression of the downregulated ESRRB gene along with Klf-5 and c-myc provided better chimera formation.

REFERENCES1 Langer RS, Vacanti JP. Tissue engineering: the challenges ahead.

Sci Am 1999; 280: 86-89 [PMID: 10201120 DOI: 10.1038/scientificamerican0499-86]

2 Rosselló RA, Wang Z, Kizana E, Krebsbach PH, Kohn DH. Connexin 43 as a signaling platform for increasing the volume and spatial distribution of regenerated tissue. Proc Natl Acad Sci USA 2009; 106: 13219-13224 [PMID: 19628695 DOI: 10.1073/pnas.0902622106]

3 Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science 1998; 282: 1145-1147 [PMID: 9804556 DOI: 10.1126/science.282.5391.1145]

4 Lavial F, Acloque H, Bertocchini F, Macleod DJ, Boast S, Bachelard E, Montillet G, Thenot S, Sang HM, Stern CD, Samarut J, Pain B. The Oct4 homologue PouV and Nanog regulate pluripotency in chicken embryonic stem cells. Development 2007; 134: 3549-3563 [PMID: 17827181 DOI: 10.1242/dev.006569]

5 Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006; 126: 663-676 [PMID: 16904174 DOI: 10.1016/j.cell.2006.07.024]

6 Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007; 131: 861-872 [PMID: 18035408 DOI: 10.1016/j.cell.2007.11.019]

7 Stadtfeld M, Nagaya M, Utikal J, Weir G, Hochedlinger K. Induced pluripotent stem cells generated without viral integration.

Science 2008; 322: 945-949 [PMID: 18818365 DOI: 10.1126/science.1162494]

8 Maherali N, Hochedlinger K. Guidelines and techniques for the generation of induced pluripotent stem cells. Cell Stem Cell 2008; 3: 595-605 [PMID: 19041776 DOI: 10.1016/j.stem.2008.11.008]

9 Lo B, Parham L. Ethical issues in stem cell research. Endocr Rev 2009; 30: 204-213 [PMID: 19366754 DOI: 10.1210/er.2008-0031]

10 Li W, Ding S. Generation of novel rat and human pluripotent stem cells by reprogramming and chemical approaches. Methods Mol Biol 2010; 636: 293-300 [PMID: 20336530 DOI: 10.1007/978-1-60761-691-7_18]

11 Wu Z, Chen J, Ren J, Bao L, Liao J, Cui C, Rao L, Li H, Gu Y, Dai H, Zhu H, Teng X, Cheng L, Xiao L. Generation of pig induced pluripotent stem cells with a drug-inducible system. J Mol Cell Biol 2009; 1: 46-54 [PMID: 19502222]

12 Rosselló RA, Chen CC, Dai R, Howard JT, Hochgeschwender U, Jarvis ED. Mammalian genes induce partially reprogrammed pluripotent stem cells in non-mammalian vertebrate and invertebrate species. Elife 2013; 2: e00036 [PMID: 24015354 DOI: 10.7554/eLife.00036]

13 Dai R, Rossello R, Chen CC, Kessler J, Davison I, Hochgeschwender U, Jarvis ED. Maintenance and neuronal differentiation of chicken induced pluripotent stem-like cells. Stem Cells Int 2014; 2014: 182737 [PMID: 25610469 DOI: 10.1155/2014/182737]

14 Maekawa M, Yamaguchi K, Nakamura T, Shibukawa R, Kodanaka I, Ichisaka T, Kawamura Y, Mochizuki H, Goshima N, Yamanaka S. Direct reprogramming of somatic cells is promoted by maternal transcription factor Glis1. Nature 2011; 474: 225-229 [PMID: 21654807 DOI: 10.1038/nature10106]

15 Lin Z, Perez P, Lei D, Xu J, Gao X, Bao J. Two-phase analysis of molecular pathways underlying induced pluripotent stem cell induction. Stem Cells 2011; 29: 1963-1974 [PMID: 21956995 DOI: 10.1002/stem.752]

16 Nagy A, Rossant J, Nagy R, Abramow-Newerly W, Roder JC. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci USA 1993; 90: 8424-8428 [PMID: 8378314]

17 Handyside AH, Hunter S. A rapid procedure for visualising the inner cell mass and trophectoderm nuclei of mouse blastocysts in situ using polynucleotide-specific fluorochromes. J Exp Zool 1984; 231: 429-434 [PMID: 6209359 DOI: 10.1002/jez.1402310317]

18 Nichols J, Smith A. Naive and primed pluripotent states. Cell Stem Cell 2009; 4: 487-492 [PMID: 19497275 DOI: 10.1016/j.stem.2009.05.015]

19 Huber W, von Heydebreck A, Sültmann H, Poustka A, Vingron M. Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics 2002; 18 Suppl 1: S96-104 [PMID: 12169536]

20 Sommer CA, Stadtfeld M, Murphy GJ, Hochedlinger K, Kotton DN, Mostoslavsky G. Induced pluripotent stem cell generation using a single lentiviral stem cell cassette. Stem Cells 2009; 27: 543-549 [PMID: 19096035]

21 Yaswen L, Diehl N, Brennan MB, Hochgeschwender U. Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nat Med 1999; 5: 1066-1070 [PMID: 10470087 DOI: 10.1038/12506]

22 Rossello RA, H D. Cell communication and tissue engineering. Commun Integr Biol 2010; 3: 53-56 [PMID: 20539784]

23 Carreira AC, Lojudice FH, Halcsik E, Navarro RD, Sogayar MC, Granjeiro JM. Bone morphogenetic proteins: facts, challenges, and future perspectives. J Dent Res 2014; 93: 335-345 [PMID: 24389809 DOI: 10.1177/0022034513518561]

24 Nacher J, Varea E, Blasco-Ibañez JM, Castillo-Gomez E, Crespo C, Martinez-Guijarro FJ, McEwen BS. Expression of the transcription factor Pax 6 in the adult rat dentate gyrus. J Neurosci Res 2005; 81: 753-761 [PMID: 16035109 DOI: 10.1002/jnr.20596]

25 Takahashi K, Mitsui K, Yamanaka S. Role of ERas in promoting tumour-like properties in mouse embryonic stem cells. Nature 2003; 423: 541-545 [PMID: 12774123 DOI: 10.1038/nature01646]

26 Buganim Y, Faddah DA, Cheng AW, Itskovich E, Markoulaki S, Ganz K, Klemm SL, van Oudenaarden A, Jaenisch R. Single-cell

COMMENTS



expression analyses during cellular reprogramming reveal an early stochastic and a late hierarchic phase. Cell 2012; 150: 1209-1222 [PMID: 22980981 DOI: 10.1016/j.cell.2012.08.023]

27 Martello G, Sugimoto T, Diamanti E, Joshi A, Hannah R, Ohtsuka S, Göttgens B, Niwa H, Smith A. Esrrb is a pivotal target of the Gsk3/Tcf3 axis regulating embryonic stem cell self-renewal. Cell Stem Cell 2012; 11: 491-504 [PMID: 23040478 DOI: 10.1016/j.stem.2012.06.008]

28 Festuccia N, Osorno R, Halbritter F, Karwacki-Neisius V, Navarro P, Colby D, Wong F, Yates A, Tomlinson SR, Chambers I. Esrrb is a direct Nanog target gene that can substitute for Nanog function in pluripotent cells. Cell Stem Cell 2012; 11: 477-490 [PMID: 23040477 DOI: 10.1016/j.stem.2012.08.002]

29 Papp B, Plath K. Pluripotency re-centered around Esrrb. EMBO J 2012; 31: 4255-4257 [PMID: 23064149 DOI: 10.1038/emboj.2012.285]

30 Jiang J, Chan YS, Loh YH, Cai J, Tong GQ, Lim CA, Robson P, Zhong S, Ng HH. A core Klf circuitry regulates self-renewal of embryonic stem cells. Nat Cell Biol 2008; 10: 353-360 [PMID: 18264089 DOI: 10.1038/ncb1698]

31 Swamynathan SK, Davis J, Piatigorsky J. Identification of candidate Klf4 target genes reveals the molecular basis of the diverse regulatory roles of Klf4 in the mouse cornea. Invest Ophthalmol Vis Sci 2008; 49: 3360-3370 [PMID: 18469187 DOI: 10.1167/iovs.08-1811]

32 Gartel AL, Shchors K. Mechanisms of c-myc-mediated trans-

criptional repression of growth arrest genes. Exp Cell Res 2003; 283: 17-21 [PMID: 12565816]

33 Wong LH, McGhie JD, Sim M, Anderson MA, Ahn S, Hannan RD, George AJ, Morgan KA, Mann JR, Choo KH. ATRX interacts with H3.3 in maintaining telomere structural integrity in pluripotent embryonic stem cells. Genome Res 2010; 20: 351-360 [PMID: 20110566 DOI: 10.1101/gr.101477.109]

34 Antonucci I, Di Pietro R, Alfonsi M, Centurione MA, Centurione L, Sancilio S, Pelagatti F, D’Amico MA, Di Baldassarre A, Piattelli A, Tetè S, Palka G, Borlongan CV, Stuppia L. Human second trimester amniotic fluid cells are able to create embryoid body-like structures in vitro and to show typical expression profiles of embryonic and primordial germ cells. Cell Transplant 2014; 23: 1501-1515 [PMID: 24480362 DOI: 10.3727/096368914X678553]

35 Zhou J, Leu NA, Eckardt S, McLaughlin KJ, Wang PJ. STK31/TDRD8, a germ cell-specific factor, is dispensable for reproduction in mice. PLoS One 2014; 9: e89471 [PMID: 24586802 DOI: 10.1371/journal.pone.0089471]

36 Yin XY, Grove LE, Prochownik EV. Mmip-2/Rnf-17 enhances c-Myc function and regulates some target genes in common with glucocorticoid hormones. Oncogene 2001; 20: 2908-2917 [PMID: 11420703 DOI: 10.1038/sj.onc.1204417]

37 Li YQ. Master stem cell transcription factors and signaling regulation. Cell Reprogram 2010; 12: 3-13 [PMID: 20132009 DOI: 10.1089/cell.2009.0033]

P- Reviewer: Kiselev SL, Lee Y, Sarkadi B S- Editor: Ji FF L- Editor: A E- Editor: Wu HL



Published by Baishideng Publishing Group Inc8226 Regency Drive, Pleasanton, CA 94588, USA

Telephone: +1-925-223-8242Fax: +1-925-223-8243

E-mail: [email protected] Desk: http://www.wjgnet.com/esps/helpdesk.aspx

http://www.wjgnet.com

issn 1948-0210 world journal of - microsoft€¦ · world journal of stem cells world j stem cells...

Documents