Review

Effect of 1,25-dihydroxyvitamin D3 on the Wnt pathway innon-malignant colonic cells

Charlotte Gröschel a, Abhishek Aggarwal a, Samawansha Tennakoon a, Julia Höbaus a,Maximilian Prinz-Wohlgenannt a, Brigitte Marian b, Petra Heffeter b,c, Walter Berger b,c,EnikÅ Kállay a,*aDepartment of Pathophysiology and Allergy Research, Comprehensive Cancer Center, Medical University of Vienna, Währinger Gürtel 18-20, A-1090 Vienna,AustriabDepartment of Medicine I, Institute of Cancer Research, Comprehensive Cancer Center, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna,AustriacResearch Platform ``Translational Cancer Therapy Research”, Vienna, Austria

A R T I C L E I N F O

Article history:Received 14 August 2014Received in revised form 13 February 2015Accepted 17 February 2015Available online 14 March 2015

Keywords:1,25-Dihydroxyvitamin D3

Colorectal cancerChemopreventionWnt pathwayLGR5

A B S T R A C T

Epidemiological studies suggest a correlation between vitamin D deficiency and colorectal cancer (CRC)incidence. The majority of sporadic tumors develop from premalignant lesions with aberrant activationof the Wnt/b-catenin signaling pathway. The adenoma cell line LT97 harbors an adenomatous polyposiscoli (APC) mutation leading to constitutively active Wnt signaling. In these cells, expression of Wnt targetgenes leads to increased survival capacity. We hypothesized that 1,25-dihydroyvitamin D3 (1,25-D3), theactive form of vitamin D3, promotes differentiation by modulating b-catenin/T-cell factor (TCF) 4-mediated gene transcription. The effect of dietary vitamin D on colonic Wnt signaling was investigated inmice fed either with 100 IU or 2500 IU vitamin D/kg diet. We examined the effect of 1,25-D3 ondifferentiation by measuring alkaline phosphatase activity. We analyzed mRNA expression of Wnt targetgenes by real time qRT-PCR. The impact of 1,25-D3 on b-catenin and TCF4 protein expression wasassessed by western blot and immunohistochemistry.In LT97 cells, 1,25-D3 increased cellular differentiation and reduced nuclear b-catenin levels. Further,

1,25-D3 decreased mRNA expression of the Wnt target genes BCL-2, Cyclin D1, Snail1, CD44 and LGR5. Inhealthy colon of mice fed with high vitamin D diet, the mRNA levels of Wnt5a and ROR2, that promotedegradation of b-catenin, were upregulated whereas b-catenin and TCF4 protein expression weredecreased. In conclusion, 1,25-D3 inhibits Wnt signaling even in nonmalignant cells underlining itsimportance in protection against colorectal tumorigenesis and early tumor progression.This article is part of a Special Issue entitled ‘17th Vitamin D Workshop’.

ã 2015 Elsevier Ltd. All rights reserved.

Contents

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2252. Material and methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225

2.1. Cell culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2252.2. In vivo study – animals1, diets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2252.3. Alkaline phosphatase assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2252.4. RNA extraction, reverse transcription (RT), and quantitative real time RT-PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2252.5. Western blot of nuclear and cytoplasmic extracts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 226

Abbreviations: CRC, colorectal cancer; APC, adenomatous polyposis coli; 1,25-D3, 1,25-dihydroxyvitamin D3; CYP24A1, 1,25-D3 24-hydroxylase; 25(OH)2D3, 25-dihydroxyvitamin D3; TCF, T-cell factor; FAP, familial adenomatous polyposis; LGR5, leucine-rich G-protein coupled receptor 5; VDR, vitamin D receptor.* Corresponding author at: Department of Pathophysiology and Allergy Research, Leitstelle 3Q, Medical University of Vienna, Währinger Gürtel 18-20, A-1090 Vienna,

Austria. Tel.: +43 1 40 400 51230; fax: +43 1 40 400 51300.E-mail address: enikoe.kallay@meduniwien.ac.at (E. Kállay).

http://dx.doi.org/10.1016/j.jsbmb.2015.02.0110960-0760/ã 2015 Elsevier Ltd. All rights reserved.

Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 224–230

Contents lists available at ScienceDirect

Journal of Steroid Biochemistry & Molecular Biology

journa l homepage: www.e l sev ier .com/ loca te / jsbmb

2.6. Immunofluorescence staining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2262.7. Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 226

3. Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2263.1. Pro-differentiating effect of 1,25-D3 in the LT97 cell line . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2263.2. Effect of 1,25-D3 on expression of genes that regulate the Wnt pathway and CYP24A1, the catabolizing enzyme of 1,25-D3 . . . . . . 2263.3. Effect of 1,25-D3 on nuclear translocation of b-catenin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2273.4. Modulation of the colonic Wnt pathway by high vitamin D diet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227

4. Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229

1. Introduction

Colorectal cancer (CRC) is the third most common cause ofcancer-related deaths worldwide [1]. A recent meta analysisrevealed an inverse correlation between serum levels of calcidiol[25-dihydroxyvitamin D3, (25-D3)] and incidence of CRC [2].

In vitro studies in colon cancer cell lines indicate that the mostactive form of vitamin D, calcitriol [1,25-dihydroxyvitamin D3,

(1,25-D3)] has antitumorigenic properties through modulation ofsignaling pathways that are deregulated in cancer [3]. The effect of1,25-D3 on molecular level involves genomic actions through itsbinding to the vitamin D receptor (VDR), a nuclear transcriptionfactor, as well as non-genomic effects [4]. We have shownpreviously in a VDR knockout mouse model that the proliferativezone is enlarged in the colon of mice that lack the VDR suggestingthat VDR regulates colonic crypt architecture [5].

It is an established concept that most sporadic colorectaltumors arise from benign precursor lesions [6]. The stepwiseprogression within the adenoma–carcinoma sequence lasts 5–15years [7] providing the possibility to apply chemopreventivestrategies [8]. The model of Fearon and Vogelstein postulates that amutation in the tumor suppressor gene APC initiates thedevelopment from normal colonic crypt mucosa to early adenoma[9] through constitutively active Wnt/b-catenin signaling [10].APC is mutated in 90% of sporadic colorectal cancers [11].

Under physiological conditions, the Wnt/b-catenin signalingpathway (or canonical Wnt pathway) regulates self-renewal ofenterocytes and is active in cells of the stem cell niche in thecolonic crypt [12,13]. Cancer stem cells are characterized by Wnttarget gene expression [14]. Therefore, targeting components ofthe Wnt pathway could be a useful strategy against tumorprogression [15]. Interestingly, studies have shown that APCmutations do not necessarily lead to nuclear b-catenin transloca-tion [14].

It has been shown previously that 1,25-D3 is able to inhibit thecanonical Wnt pathway in colorectal cancer cells [16–19] throughseveral mechanisms, involving upregulation of DKK1, induction ofE-cadherin expression, regulation of TCF-4 levels. Palmer et al. [20]were among the first to show a direct binding between VDR andb-catenin. The importance of the nuclear vitamin D receptor forthe regulation of the canonical Wnt signaling was shown by theincreased Wnt target gene expression and higher tumor burden inan APC min/+ mouse model lacking the VDR [21].

The aim of our study was to assess the effect of 1,25-D3 on thecanonical Wnt pathway in non-malignant cells, such as the LT97adenoma cell line, and in the normal mouse colon. The LT97 cellline was established from a microadenoma of a familialadenomatous polyposis (FAP) patient. These cells carry an APCmutation leading to a truncated APC protein [22] and activatedWnt pathway. We show that low dietary vitamin D intake leads tomore active canonical Wnt pathway in the normal colon. In vitro,1,25-D3 inhibited the Wnt pathway in the non-malignant LT97cells. Our results underline the importance of vitamin D for theprevention of malignant transformation of colonic cells.

2. Material and methods

2.1. Cell culture

The colon adenoma cell line LT97 was maintained under standardtissue culture conditions (5% CO2/humidified air incubator, 37 �C) asdescribed previously [22]. Medium was changed every other day.During treatments, fresh 1,25-D3 (Sigma–Aldrich, Germany) wasadded every 48 h together with the fresh medium. EtOH served asvehicle control. The cells were tested regularly with the MycoplasmaDetection Kit from VenorGem (Minerva Biolabs, Berlin, Germany)and were free of mycoplasma infection. Cell line authentication wasperformed by DNA Diagnostic Center (London, UK).

2.2. In vivo study – animals1, diets

6-week old male CB-17 SCID (severe combined immunode-ficient) mice (Harlan Laboratories) were housed at the Institute ofCancer Research at the Medical University of Vienna in a controlledenvironment in accordance with the European Union Regulationson Care and Use of Laboratory Animals. The study was approved bythe Ethics Committee of the Medical University of Vienna (Nr.BMWF-66.009/0115-II/3b/2013). Mice were fed with a modifiedAIN-93G diet (Sniff Special Diet GmbH, Germany) containing either100 IU vitamin D3/kg diet (low vitamin D3) or 2500 IU vitaminD3/kg diet (high vitamin D3). After 5 weeks the animals weresacrificed by cervical dislocation. The colon was rinsed in ice-coldPBS and snap frozen in liquid nitrogen for mRNA isolation orformalin fixed and embedded in paraffin.

2.3. Alkaline phosphatase assay

Cells were seeded in 6 well plates; after 3 days were treatedwith 10 nM 1,25-D3 or 0.001% EtOH (control) for 10 days. Mediawas changed every 48 h and fresh 1,25-D3 was added. Alkalinephosphatase activity was determined with the alkaline phospha-tase (ALP) Colorimetric Assay Kit (Abcam, UK) according to themanufacturer’s instructions. Briefly, para-nitrophenyl phosphateserved as substrate and ALP activity per 105 cells was determinedand shown as units/ml. Results are shown as mean � SEM of 3experiments.

2.4. RNA extraction, reverse transcription (RT), and quantitative realtime RT-PCR

RNA was isolated using TRIzol reagent (Thermo Fisher ScientificInc., MA, USA) and its integrity was confirmed on agarose gels bygel green staining (Peqlab, Austria). 2 mg of total RNA was reversetranscribed using RevertAid H Minus Reverse Transcriptase andRandom Hexamer Primers according to the manufacturer’sprotocol (Fermentas, Ontario, Canada).

1 To be in accordance with the 3R principle we availed ourselves of the colon ofcontrol animals from an other study.

C. Gröschel et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 224–230 225

Quantitative real time RT-PCR (qRT-PCR) was conducted asdescribed previously [2]. Target gene expression was normalized tothe reference gene beta-2-microglobulin (b2M), set relative to thecalibrator (total human RNA, Clontech, Mountain View, CA, USA)and analyzed according the DDCt method. Sequences of primersfor b2M [24] have been described previously. Further, primersequences are presented in Table 1.

2.5. Western blot of nuclear and cytoplasmic extracts

Nuclear and cytoplasmic protein fractions from confluent cellswere extracted using following buffers: hypotonic buffer [10 mMHepes pH 7.5, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, DTT, PMSF,protease inhibitor cocktail (Sigma–Aldrich) and 10% NP40]; highsalt buffer [20 mM Hepes pH 7.5, 0.4 M NaCl, 1 mM EDTA, 1 mMEGTA, DTT, PMSF, protease inhibitor cocktail (Sigma–Aldrich)].Protein concentration was measured by the protein assay dye(Reagent Concentrate, Bio-Rad). Equal amounts of protein (16 mg)were loaded on a 12% polyacrylamide-sodium dodecyl sulfate(SDS) gel and transferred to polyvinylidene difluoride membranesby semi-dry blotting. Membranes were blocked with 5% driedskimmed milk in TBST (10 mM Tris, pH 7.5, 150 mM NaCl, 0.001%Tween-20) for 1 h at room temperature. Following primaryantibodies were used: rabbit monoclonal anti-b-catenin(1:5,000, Abcam), goat polyclonal anti-Lamin A (1:2,000, SantaCruz Biotechnology Inc., CA, USA), mouse monoclonal antia-tubulin (1:10,000, Sigma–Aldrich). Secondary Antibodies con-jugated with HRP were: anti-rabbit (1:10,000) and anti-mouse(1:10,000), Jackson ImmunoResearch, UK), anti-goat (1:20,000,AbD Serotec, UK) IgG. Protein bands were visualized using a digitalimaging system (VersaDoc, Bio-Rad) followed by quantification ofband intensities by Image lab software (version 2.0.1).

2.6. Immunofluorescence staining

LT97 cells were grown on sterile cover slips. 3 days post seeding,cells were treated with 10 nM 1,25-D3 (or EtOH as vehicle control).Following 10 days of treatment, cells were stained to detect CD44(1:100, Abcam) using immunofluorescence as previously de-scribed [23]. Cells were permeabilized with 0.2% Triton X-100,blocked with 3% BSA and incubated for 1 h with the primaryantibodies: mouse monoclonal anti CD44 (1:100, Dako) and rabbitmonoclonal anti-b-catenin (1:100, Abcam). Secondary antibodieswere: Alexafluor 647-labelled goat anti-mouse IgG (1:1000,Molecular Probes, Invitrogen) or TxRed-labelled goat anti-rabbitIgG (1:500, Vector).

5 mm paraffin embedded colonic tissue sections were cut andstained for b-catenin (1:100, Cell Signaling Technologies, Austria)and TCF4 (1:100, Abcam) with a two-step immunofluorescencetechnique as previously described [25]. Antigen retrieval wasperformed in citrate buffer. After permeabilization the sections

were blocked in 5% goat serum. Secondary antibodies were:Alexafluor 647-labelled goat anti-mouse or TxRed-labelled goatanti-rabbit IgG.

Nuclei were stained with Dapi (Roche, Switzerland). Imageswere acquired using the TissueFaxs system and quantified usingTissueQuest Software as previously described [25].

2.7. Statistical analysis

All statistical analyses were performed with SPSS version 18,and graphs were drawn with GraphPad Prism (GraphPad SoftwareInc., USA). Non-normally distributed data were log transformed,analyzed by one-way ANOVA and followed by Tukey’s post hoc testfor multiple comparisons, where appropriate. t-Tests were used toquantify statistical differences between groups. Significance wasaccepted at p < 0.05.

3. Results

3.1. Pro-differentiating effect of 1,25-D3 in the LT97 cell line

3 days after seeding, cells were treated with 10 nM 1,25-D3 or0.001% EtOH, as vehicle control, for 10 days. Continuous treatmentof LT97 cells with the active form of vitamin D increaseddifferentiation as indicated by the 1.8-fold increase of alkalinephosphatase activity (Fig. 1,p < 0.01).

3.2. Effect of 1,25-D3 on expression of genes that regulate the Wntpathway and CYP24A1, the catabolizing enzyme of 1,25-D3

We evaluated both the short-term (3.5 h) and the long-term (10days) effect of 1,25-D3 on expression of several Wnt target genes inthe LT97 cell line by qRT-PCR. In 1 week confluent cells, incubationwith 10 nM 1,25-D3 for 3.5 h decreased mRNA levels of theanalyzed Wnt target genes (Fig. 2A). The decrease was significantfor LGR5 (15.7%, p < 0.01), BCL-2 (27.5%, p < 0.05) and SURVIVIN(51.6%, p < 0.05), while the reduction of Cyclin D1 and Snail1expression did not reach statistical significance. Additionally, wemeasured mRNA transcripts of glycogen synthase-kinase 3b (GSK-3b), a component of the destruction complex that primesb-catenin for degradation. GSK-3b responded with a modestincrease of 15% (p < 0.0764) to the treatment (Supplementarymaterial, Fig. S1A). We assessed the effect of both short and longterm treatment on LT97 cells, since in humans 1,25-D3 is constantly

Table 1Primers used for the qRT-PCR (oligonucleotide sequence 50 ! 30).

Primer Forward Reverse

hBcl2hCYCLIN-D1h SNAI1

CATGTGTGTGGAGAGCGTCAACACGATTTCATTGAACACTTCCCTGCTACAAGGCCATGTC

GCCGGTTCAGGTACTCAGTCAAAATGAACTTCACATCTGTGGCGGCACTGGTACTTCTTGAC

hSurvivin CAGTGTTTCTTCTGCTTCAAGG CTTCTTGACAGAAAGGAAAGCGhCD44hLGR5hCYP24A1

CAATAGCACCTTGCCCACAATGCATTTGGAGTGTGTGAGAAAGTCTTCCCCTTCCAGGATCA

AATCACCACGTGCCCTTCTATGGAGGGCTTTCAGGTCTTCCTCCAAACCGTGGAAGGCCTATC

mWnt5a AATCCACGCTAAGGGTTCCT TACTGTCCTACGGCCTGCTTmror2 CACTGCCACTGGGGTTCTAT GCCATCTTCCTGATCGTCATmlgr5 CCTACTCGAAGACTTACCCAGT GCATTGGGGTGAATGATAGCAmcyp24a1 GAGTCCATGAGGCTTACCC GTGTATTCACCCAGAACGG

Fig. 1. Induction of alkaline phosphatase (ALP) activity after treatment with 10 nM1,25-D3. Data represent mean � SEM (n = 3). Data were analyzed by paired t-test.Asterisks show statistical significant difference compared with the control(**p < 0.01).

226 C. Gröschel et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 224–230

present under normal physiological conditions. We observed thatprolonged exposure to 10 nM 1,25-D3 inhibited expression of allinvestigated Wnt target genes. 10 days exposure to calcitriol led tosignificant reduction of LGR5 (25.3%, p < 0.05), BCL-2 (32.1%,p < 0.01), Cyclin D1 (26.1%, p < 0.01), SNAIL1 (29.3%, p < 0.05),CD44 (8.2%, p < 0.05) and decreased slightly transcription ofSURVIVIN (9.6%) (Fig. 2B).

1,25-D3 reduced also the number of CD44 positive cells, asdetermined by immunostaining (Supplementary material,Table S1).

As expected, the catabolizing enzyme CYP24A1 was stronglyinduced by 10 nM 1,25-D3. Short-term treatment (3.5 h) led tonearly 15,000-fold increase (Fig. 3A, p < 0.05) while treatment for10 days kept CYP24A1 levels high, albeit at a significantly lowerextent (Fig. 3B, 200-fold, p < 0.05).

3.3. Effect of 1,25-D3 on nuclear translocation of b-catenin

Confluent LT97 cells were treated for 1 h with 10 nM 1,25-D3

and nuclear and cytoplasmic proteins were isolated. Both fractionswere analyzed for expression and localization of b-catenin bywestern blot. Even untreated cells expressed nuclear b-catenin,which indicates constitutively active Wnt signaling in the LT97 cellline. Exposure to 10 nM 1,25-D3 for 1 h led to significant reductionof b-catenin levels in the nucleus (Fig. 4).

3.4. Modulation of the colonic Wnt pathway by high vitamin D diet

We fed SCID mice AIN-93G diet containing either 100 IU or2500 IU vitamin D/kg diet. The plasma levels of 25-hydroxyvitaminD3 in the low vitamin D diet group were undetectable, whereas in thehigh vitamin D group the concentration was in the range of 60 nm/l.The high vitamin D diet upregulated the Wnt signal molecule wnt5a(Fig. 5A, 1.6-fold) and its receptor ror2 (Fig. 5B, 2.1-fold, p < 0.05) inthe colon of the mice, while it reduced the expression of theintestinal stem cell marker and wnt target gene Lgr5 (Fig. 5C,1.3-fold) compared with the low vitamin D diet group (100 IU/kg).Expression of Cyp24a1 was induced 4.2-fold (Fig. 5D, p < 0.01).

In the colon of mice fed with 100 IU VD/kg diet, the number ofcells that stained positively for Tcf4 was increased (Fig. 6C,*p < 0.05) compared with the animals that received 2500 IU VD/kgdiet, where it was exclusively expressed in the apical differentiatedzone of the colonic crypts (Fig. 6B). In mice receiving low vitamindiet we observed Tcf-4 staining along the crypt much deepertoward the bottom than in the animals on high vitamin D diet.Similarly, b-catenin protein expression was decreased in the colonof the high vitamin D group (Fig. 6E).

4. Discussion

Deregulation of the Wnt pathway is an early event in colorectaltumorigenesis [26]. Therefore, chemoprevention by dietary

Fig. 2. Effect of 10 nM 1,25-D3 on mRNA expression of Wnt target genes. Expression of Wnt target genes (A) after treatment with 10 nM 1,25-D3 for 3.5 h or (B) 10 days wasdetermined by real time qRT-PCR. Bars indicate mean � SEM of 3–5 independent experiments. Black columns: vehicle control, open columns: 1,25-D3 treatment. Data wereanalyzed by paired t-test. Asterisks denote significance compared with vehicle control (*p < 0.05, **p < 0.01).

Fig. 3. Effect of 10 nM 1,25-D3 on mRNA expression of CYP24A1. Expression of CYP24A1 (after treatment with 10 nM 1,25-D3 for 3.5 h (A) or 10 days (B) was determined by realtime qRT-PCR. Bars indicate mean � SEM of 3–5 independent experiments. Black columns: vehicle control, open columns: 1,25-D3 treatment. Data were analyzed by paired t-test. Asterisks denote significance compared with vehicle control (*p < 0.05).

C. Gröschel et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 224–230 227

compounds that preferentially target cells with deregulated Wntsignaling could be a useful and economic strategy to reduceincidence and mortality of CRC [27]. The effect of 1,25-D3 on Wntsignaling in colon cancer cells has been shown already (reviewed in[19]). We present evidence here that even nontransformed cells areresponsive to 1,25-D3. We found that 1,25-D3 affects Wnt signalingalso in normal colonocytes and in the benign adenoma cell lineLT97. 1,25-D3 was able to further enhance differentiation of thealready differentiated LT97 cells. In the adenoma cell line LT97,1,25-D3 downregulated mRNA expression of several Wnt targetgenes (BCL-2, Cyclin D1, SNAIL1, CD44). SNAIL1 is a transcriptionfactor that promotes epithelial to mesenchymal transition andinhibits VDR expression [28]. CD44 is considered a cancer stem cellmarker that confers resistance to chemotherapy [29]. We alsoshow that vitamin D inhibited, both in vitro and in vivo theexpression of the intestinal stem cell marker LGR5, a G-protein-coupled receptor associated with poor prognosis in colorectalcancer [30]. LGR5 is both a Wnt target and component of the Wntsignaling pathway as it associates with the Frizzled/LRP receptorcomplex [31]. The effect of long-term 1,25-D3 treatment might beindirect due to enhanced expression of regulators of Wnt targetgene transcription [32]. The fact that not one but several keymembers of the pathway were affected suggests a significantbiological effect after 10 days treatment with 1,25-D3. Thesustained upregulation of CYP24A1, the major catabolizing enzymeof 1,25-D3, might explain, in part, the moderate effect of 1,25-D3 onthe inhibition of the Wnt pathway.

To address the question whether 1,25-D3 counteracts Wntsignaling through transcriptional modulation of genes that areinvolved in degradation of b-catenin, we determined the expres-sion of Wnt5a and ROR2. Wnt5a promotes proteasomal

degradation of b-catenin through binding to the orphan tyrosinekinase receptor ROR2 [33]. In LT97 cells, Wnt5a and ROR2 wereundetectable on mRNA level but 1,25-D3 treatment was able toinduce their expression (data not shown). However, in mice fedwith high vitamin D diet, these genes were upregulated whileb-catenin expression was downregulated, which suggests thatvitamin D decreases b-catenin levels in the normal colon partiallythrough this mechanism.

One unexpected effect of high vitamin D diet was that Tcf4expression became confined to the cells of the crypt surface. Thisseems to support the findings of Tang et al. [34] who suggested thatTcf4 in differentiated cells might actually inhibit b-catenin/Tcf4target gene expression. Another study, however, showed thatknock down of Tcf4 in mouse colon led to loss of proliferative cellsin the colonic crypts [35]. Interestingly, in the colon of mice fed thelow vitamin diet Tcf4 was expressed not only on the top of the cryptbut also in cells forming the crypt wall.

Although LT97 cells have a truncated APC protein [22], ourresults suggest that the Wnt pathway is still modifiable. In thispremalignant cell line, the level of b-catenin in the nucleus is muchlower than the levels seen in some colon cancer cell lines [36]. InLT97 cells b-catenin is mainly located at the cell membrane, boundto E-cadherin, a known inhibitor of the Wnt pathway which is alsoexpressed at high levels [37] and is not further inducible by1,25-D3.

We observed that 1,25-D3 reduced nuclear b-catenin expres-sion after 1 h, which suggests that it is probably mediated by a nongenomic effect of 1,25-D3 [3,20]. One mechanism by which vitaminD decreases nuclear b-catenin levels is the direct binding of VDR tob-catenin in the cytoplasm, obstructing its nuclear translocation[20]. 1,25-D3 could also lead to a change in activation or expression

Fig. 4. Effect of 1,25-D3 on expression and localization of b-catenin in LT97 cells. Cells were treated for 1 h with 0.001% EtOH or 10 nM 1,25-D3. Lamin A/C served as loadingcontrol for nuclear extracts and a-tubulin for cytoplasmic extracts. (A) representative western blot. (B) Quantification of the data from 3 independent blots, as nuclear/cytoplasmic ratio.

Fig. 5. mRNA levels of Wnt5a, ROR2, LGR5 and CYP24A1 in healthy colon of mice fed either 100 IU or 2500 IU vitamin D/kg diet. Box plots minimum to maximum showmedian, interquartile range and whiskers. Unpaired t-test: n = 4–5 animals per group (*p < 0.05, **p < 0.01).

228 C. Gröschel et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 224–230

of proteins that regulate b-catenin phosphorylation and/ordegradation [38]. Other nuclear receptors are also able to interactwith b-catenin and promote relocalization of this coactivator tothe cytoplasm or reduce the half-life of the protein. In the coloniccrypt, the gradient of differentiation increases along the crypt axis,to the same extent as the Wnt pathway activity is reduced [39].Similarly, in our cell line model 1,25-D3 enhanced the differentia-tion in parallel with the inhibition of the Wnt pathway.

In summary, our results suggest that calcitriol acts as modulatorof the canonical Wnt pathway-mediated signaling both in thenormal colon and in precursor lesions of colorectal cancer, even incells that have a mutation in the APC gene. 1,25-D3 could becomean important tool in differentiation therapy and therefore apromising strategy to reduce the abundance of CD44 positivechemoresistant cancer cells [27]. Our data provide furtherrationale for advocating the importance of vitamin D sufficiencyin the population: higher vitamin D levels are needed both toprevent the development of adenomas and also to preventmalignant transformation.

Acknowledgments

This work was funded by Herzfelder’sche Familienstiftung,Grant # KP00563OFF, (EK and BM), Vienna Science and TechnologyFund (WWTF) LS12-047 and EU FP7-PEOPLE-2010-ITN # 264663(EK), Felix Bronner Dissertation Stipendium of the Austrian Societyof Bone and Mineral Research (JH). The authors would like to thankIng. Teresa Manhardt, and Dr. Doris Hummel for their support withthe in vitro work.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.jsbmb.2015.02.011.

References

[1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancerstatistics, CA Cancer J. Clin. 61 (2) (2011) 69–90.

Fig. 6. Immunhistochemical staining of TCF4 (A and B) and b-catenin (D and E) in sections from colon tissue of mice fed low (100 IU) or high (2500 IU) vitamin D diet (VD).White arrows point to Tcf4 positive cells in the colonic crypts. Percentage of TCF4 positive cells in colonic crypts (C) is shown. Bar represents median. Statistical significancewas calculated using unpaired t-test n = 4–5 animals per group, *p < 0.05.

C. Gröschel et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 224–230 229

[2] L. Yin, N. Grandi, E. Raum, U. Haug, V. Arndt, H. Brenner, Meta-analysis:longitudinal studies of serum vitamin D and colorectal cancer risk, Aliment.Pharmacol. Ther. 30 (2) (2009) 113–125.

[3] D. Feldman, A.V. Krishnan, S. Swami, E. Giovannucci, B.J. Feldman, The role ofvitamin D in reducing cancer risk and progression, Nat. Rev. Cancer 14 (5)(2014) 342–357.

[4] K.K. Deeb, D.L. Trump, C.S. Johnson, Vitamin D signalling pathways in cancer:potential for anticancer therapeutics, Nat. Rev. Cancer 7 (9) (2007) 684–700.

[5] E. Kallay, P. Pietschmann, S. Toyokuni, E. Bajna, P. Hahn, K. Mazzucco, C.Bieglmayer, S. Kato, H.S. Cross, Characterization of a vitamin D receptorknockout mouse as a model of colorectal hyperproliferation and DNA damage,Carcinogenesis 22 (9) (2001) 1429–1435.

[6] D.L. Worthley, B.A. Leggett, Colorectal cancer: molecular features and clinicalopportunities, Clin. Biochem. Rev. 31 (2) (2010) 31–38.

[7] G.J. Kelloff, C.C. Sigman, Assessing intraepithelial neoplasia and drug safety incancer-preventive drug development, Nat. Rev. Cancer 7 (7) (2007) 508–518.

[8] A. Manzano, P. Perez-Segura, Colorectal cancer chemoprevention: is this thefuture of colorectal cancer prevention? ScientificWorldJournal 2012 (2012)327341.

[9] E.R. Fearon, B. Vogelstein, A genetic model for colorectal tumorigenesis, Cell 61(5) (1990) 759–767.

[10] M. van de Wetering, E. Sancho, C. Verweij, W. de Lau, I. Oving, A. Hurlstone, K.van der Horn, E. Batlle, D. Coudreuse, A.P. Haramis, M. Tjon-Pon-Fong, P.Moerer, M. van den Born, G. Soete, S. Pals, M. Eilers, R. Medema, H. Clevers, Thebeta-catenin/TCF-4 complex imposes a crypt progenitor phenotype oncolorectal cancer cells, Cell 111 (2) (2002) 241–250.

[11] L. Thorstensen, G.E. Lind, T. Lovig, C.B. Diep, G.I. Meling, T.O. Rognum, R.A.Lothe, Genetic and epigenetic changes of components affecting the Wntpathway in colorectal carcinomas stratified by microsatellite instability,Neoplasia 7 (2) (2005) 99–108.

[12] T. Reya, H. Clevers, Wnt signalling in stem cells and cancer, Nature 434 (7035)(2005) 843–850.

[13] A. Reynolds, N. Wharton, A. Parris, E. Mitchell, A. Sobolewski, C. Kam, L.Bigwood, A. El Hadi, A. Munsterberg, M. Lewis, C. Speakman, W. Stebbings, R.Wharton, K. Sargen, R. Tighe, C. Jamieson, J. Hernon, S. Kapur, N. Oue, W. Yasui,M.R. Williams, Canonical Wnt signals combined with suppressed TGFbeta/BMP pathways promote renewal of the native human colonic epithelium, Gut63 (4) (2014) 610–621.

[14] L. Vermeulen, E.M.F. De Sousa, M. van der Heijden, K. Cameron, J.H. de Jong, T.Borovski, J.B. Tuynman, M. Todaro, C. Merz, H. Rodermond, M.R. Sprick, K.Kemper, D.J. Richel, G. Stassi, J.P. Medema, Wnt activity defines colon cancerstem cells and is regulated by the microenvironment, Nat. Cell Biol. 12 (5)(2010) 468–476.

[15] F. Takahashi-Yanaga, M. Kahn, Targeting Wnt signaling: can we safely eradicatecancer stem cells? Clin. Cancer Res. 16 (12) (2010) 3153–3162.

[16] P. Ordóñez-Morán, M.J. Larriba, H.G. Pálmer, R.A. Valero, A. Barbáchano, M.Duñach, A.G. de Herreros, C. Villalobos, M.T. Berciano, M. Lafarga, A. Muñoz,RhoA-ROCK and p38MAPK-MSK1 mediate vitamin D effects on geneexpression, phenotype, and Wnt pathway in colon cancer cells, J. Cell Biol.183 (4) (2008) 697–710.

[17] O. Aguilera, C. Peña, J.M. García, M.J. Larriba, P. Ordóñez-Morán, D. Navarro, A.Barbáchano, I. López de Silanes, E. Ballestar, M.F. Fraga, M. Esteller, C. Gamallo,F. Bonilla, J.M. González-Sancho, A. Muñoz, The Wnt antagonist DICKKOPF-1gene is induced by 1alpha,25-dihydroxyvitamin D3 associated to thedifferentiation of human colon cancer cells, Carcinogenesis 28 (9) (2007)1877–1884.

[18] M.J. Larriba, P. Ordóñez-Morán, I. Chicote, G. Martín-Fernández, I. Puig, A.Muñoz, H.G. Pálmer, Vitamin D receptor deficiency enhances Wnt/b-cateninsignaling and tumor burden in colon cancer, PLoS One 6 (8) (2011) e23524.

[19] M.J. Larriba, J.M. Gonzalez-Sancho, A. Barbachano, N. Niell, G. Ferrer-Mayorga,A. Munoz, Vitamin D is a multilevel repressor of Wnt/b-catenin signaling incancer cells, Cancers 5 (4) (2013) 1242–1260.

[20] H.G. Palmer, J.M. Gonzalez-Sancho, J. Espada, M.T. Berciano, I. Puig, J. Baulida,M. Quintanilla, A. Cano, A.G. de Herreros, M. Lafarga, A. Munoz, Vitamin D(3)promotes the differentiation of colon carcinoma cells by the induction of E-

cadherin and the inhibition of beta-catenin signaling, J. Cell Biol.154 (2) (2001)369–387.

[21] M.J. Larriba, P. Ordonez-Moran, I. Chicote, G. Martin-Fernandez, I. Puig, A.Munoz, H.G. Palmer, Vitamin D receptor deficiency enhances Wnt/beta-catenin signaling and tumor burden in colon cancer, PLoS One 6 (8) (2011)e23524.

[22] M. Richter, D. Jurek, F. Wrba, K. Kaserer, G. Wurzer, J. Karner-Hanusch, B.Marian, Cells obtained from colorectal microadenomas mirror earlypremalignant growth patterns in vitro, Eur. J. Cancer 38 (14) (2002) 1937–1945.

[23] I.S. Fetahu, J. Höbaus, A. Aggarwal, D.M. Hummel, S. Tennakoon, I. Mesteri, S.Baumgartner-Parzer, E. Kállay, Calcium-sensing receptor silencing incolorectal cancer is associated with promoter hypermethylation and loss ofacetylation on histone 3, Int. J. Cancer 135 (9) (2014) 2014–2023.

[24] M. Lucerna, J. Pomyje, D. Mechtcheriakova, A. Kadl, F. Gruber, M. Bilban, Y.Sobanov, G. Schabbauer, J. Breuss, O. Wagner, M. Bischoff, M. Clauss, B.R.Binder, E. Hofer, Sustained expression of early growth response protein-1blocks angiogenesis and tumor growth, Cancer Res. 66 (13) (2006) 6708–6713.

[25] D. Hummel, A. Aggarwal, K. Borka, E. Bajna, E. Kállay, H.C. Horváth, The vitaminD system is deregulated in pancreatic diseases, J. Steroid Biochem. Mol. Biol.144 (Pt B) (2014) 402–409.

[26] H. Brenner, M. Kloor, C.P. Pox, Colorectal cancer, Lancet 383 (9927) (2014)1490–1502.

[27] Y. Li, M.S. Wicha, S.J. Schwartz, D. Sun, Implications of cancer stem cell theoryfor cancer chemoprevention by natural dietary compounds, J. Nutr. Biochem.22 (9) (2011) 799–806.

[28] M.J. Larriba, F. Bonilla, A. Munoz, The transcription factors Snail1 and Snail2repress vitamin D receptor during colon cancer progression, J. SteroidBiochem. Mol. Biol. 121 (1–2) (2010) 106–109.

[29] M. Zoller, CD44: can a cancer-initiating cell profit from an abundantlyexpressed molecule? Nat. Rev. Cancer 11 (4) (2011) 254–267.

[30] Y.S. Liu, H.C. Hsu, K.C. Tseng, H.C. Chen, S.J. Chen, Lgr5 promotes cancerstemness and confers chemoresistance through ABCB1 in colorectal cancer,Biomed. Pharmacother. 67 (8) (2013) 791–799.

[31] W. de Lau, N. Barker, T.Y. Low, B.K. Koo, V.S. Li, H. Teunissen, P. Kujala, A.Haegebarth, P.J. Peters, M. van de Wetering, D.E. Stange, J.E. van Es, D.Guardavaccaro, R.B. Schasfoort, Y. Mohri, K. Nishimori, S. Mohammed, A.J.Heck, H. Clevers, Lgr5 homologues associate with Wnt receptors and mediateR-spondin signalling, Nature 476 (7360) (2011) 293–297.

[32] M. Katoh, Wnt signaling pathway and stem cell signaling network, Clin. CancerRes. 13 (14) (2007) 4042–4045.

[33] R.J. MacLeod, M. Hayes, I. Pacheco, Wnt5a secretion stimulated by theextracellular calcium-sensing receptor inhibits defective Wnt signaling incolon cancer cells, Am. J. Physiol. Gastrointest. Liver Physiol. 293 (1) (2007)G403–411.

[34] W. Tang, M. Dodge, D. Gundapaneni, C. Michnoff, M. Roth, L. Lum, A genome-wide RNAi screen for Wnt/beta-catenin pathway components identifiesunexpected roles for TCF transcription factors in cancer, Proc. Natl. Acad. Sci. U.S. A. 105 (28) (2008) 9697–9702.

[35] J.H. van Es, A. Haegebarth, P. Kujala, S. Itzkovitz, B.K. Koo, S.F. Boj, J. Korving, M.van den Born, A. van Oudenaarden, S. Robine, H. Clevers, A critical role for theWnt effector Tcf4 in adult intestinal homeostatic self-renewal, Mol. Cell Biol.32 (10) (2012) 1918–1927.

[36] I. Koneczny, A. Schulenburg, X. Hudec, M. Knöfler, K. Holzmann, G. Piazza, R.Reynolds, P. Valent, B. Marian, Autocrine fibroblast growth factor 18 signalingmediates Wnt-dependent stimulation of CD44-positive human colorectaladenoma cells, Mol. Carcinog. (2014) , doi:http://dx.doi.org/10.1002/mc.22146.

[37] D. Lazarova, A. Lee, T. Wong, B. Marian, C. Chiaro, C. Rainey, M. Bordonaro,Modulation of Wnt activity and cell physiology by butyrate in LT97microadenoma cells, J. Cancer 5 (3) (2014) 203–213.

[38] C. Gao, G. Xiao, J. Hu, Regulation of Wnt/beta-catenin signaling byposttranslational modifications, Cell Biosci. 4 (1) (2014) 13.

[39] D.H. Scoville, T. Sato, X.C. He, L. Li, Current view: intestinal stem cells andsignaling, Gastroenterology 134 (3) (2008) 849–864.

230 C. Gröschel et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 224–230

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具