lx-11, a potential biocontrol agent against rice …

SUMMARY

A strain of Bacillus amyloliquefaciens denoted Lx-11was found to possess biocontrol activity against ricebacterial leaf streak (BLS) caused by Xanthomonasoryzae pv. oryzicola. Lx-11 secreted three kinds oflipopeptides including surfactin, bacillomycin D andfengycin, which exhibted antibacterial activity againstX. oryzae pv. oryzicola. The antibacterial activity couldbe associated with surfactin-lipopeptides, and was prac-tically abolished in surfacin-deficient mutants. In addi-tion, the defense-related genes PR-1a, PR-1b, NPR1 andPAL were concurrently expressed in the leaves of riceafter treatment with Lx-11. Results suggest that Lx-11triggers a systemic immunization activity. Lx-11 signifi-cantly reduced the incidence of BLS, control efficacyranging from 60.2% to 70.6%, i.e. better than that af-forded by bismerthlazol in field experiments. We con-clude that B. amyloliquefaciens Lx-11 might be a prom-ising biocontrol agent and should be further studied.

Key words: Bacillus amyloliquefaciens, bacterial leafstreak, lipopeptides, defense-related genes, biologicalcontrol.

INTRODUCTION

Bacterial leaf streak (BLS) is a destructive rice diseasecaused by Xanthomonas oryzae pv. oryzicola (Xooc), apathogen that infects the host plant at all growth stages.Under conditions favourable for spreading, BLS may af-fect entire fields and cause damage comparable to thoseinduced by bacterial leaf blight of rice, e.g. reductionsin grain weight of up to 32% (Ou, 1985). The singnifi-cance of BLS is increasing in Chinese areas where hy-brid rice varieties particularly susceptible to thepathogen are grown (Xie et al., 1990; Xu et al., 1995).Various disease management practices, such as chemical

Corresponding author: Z.Y. ChenFax: +86.25.84390393.E-mail: [email protected]

control, modification of cropping systems, and biologi-cal control, have been employed to reduce BLS damage(Gnanamanickam et al., 1999; Tang et al., 2000; Zhanget al., 2005). Application of chemical control is general-ly considered as a rapid and effective strategy for plantdisease management; however, no effective chemicalproducts are available for a satisfactory control of BLS(Kondoh et al., 2001). Therefore, more efforts need tobe devoted to biological control by and large.

Biological control using plant-associated microorgan-isms is an efficient approach to disease management andis regarded as environment friendly (Bargabus et al.,2003; Han et al., 2005; Tjamos et al., 2005; Vasudevanet al., 2002). It can also be integrated with other man-agement practices to afford greater levels of protectionand sustain rice yields. Bacillus species offer several ad-vantages over other bacteria for protection against vari-ous plant pathogens (Broggini et al., 2005; Chen et al.,2009; Kunz and Haug, 2006), its biocontrol mecha-nisms including antagonism, competition and inducedplant systemic resistance. This bacterium produces an-timicrobial compounds including the antibiotics zwiter-micin-A and kanosamine (Leifert et al., 1995), lipopep-tides (Stein, 2005), polyketides (Chen et al., 2006) andantifungal proteins (Liu et al., 2007). Furthermore,many reports have demonstrated that compounds ofthe iturin and fengycin families produced by Bacillusspp. are effective against fungal diseases (Ongena et al.,2005; Zeriouh et al., 2011). However, few studies haveinvestigated the role of surfactin against Gram-negativebacteria, such as Bacillus, although is it a major biocon-trol agent (Bais et al., 2004).

Examples of systemic acquired resistance (SAR) andinduced systemic resistance (ISR) were well studied.While SAR is triggered by necrotrophic pathogens(Conrath et al., 2002), ISR is activated by selected non-pathogenic bacteria, such as specific plant growth-pro-moting rhizobacteria (PGPR) (Van der Ent et al., 2009).Biocontrol agents trigger ISR by priming the plant forthe potentiated activation of various cellular defense re-sponses, including accumulation of defense-related en-zymes (Benhamou and Belanger, 1998; Jourdan et al.,2009) and strengthened expression level of defense-re-lated genes (Niu et al., 2011). Surfactins and fengycins

Journal of Plant Pathology (2012), 94 (3), 609-619 Edizioni ETS Pisa, 2012 609

BACILLUS AMYLOLIQUEFACIENS Lx-11, A POTENTIAL BIOCONTROL AGENTAGAINST RICE BACTERIAL LEAF STREAK

R.S. Zhang1, 2, Y.F. Liu2, C.P. Luo2, X.Y. Wang2, Y.Z. Liu2, J.Q. Qiao2, J.J. Yu2 and Z.Y. Chen1,2

1 Department of Pesticide Science, College of Plant Protection, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects,

Ministry of Agriculture, Nanjing 210095, China2 Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China

013_JPP1164RP(Chen)_609 20-11-2012 11:55 Pagina 609

610 B. amyloliquefaciens as a biocontrol agent Journal of Plant Pathology (2012), 94 (3), 609-619

produced by Bacillus subtilis S499 act as elicitors of ISR(Ongena et al., 2007) and surfactins with different struc-ture exhibit eliciting activity on tomato cells (Jourdan etal., 2009).

In a previous study, we found that B. amyloliquefa-ciens Lx-11, which was isolated from diseased riceleaves, displayed a powerful antibacterial activity againstXooc (Zhang et al., 2011a). The objectives of this studyare aimed to: (i) identify lipopeptides produced by Lx-11, (ii) determine whether surfactin is a key factor inprotect rice against Xooc, and (iii) demonstrate thestrengthened expression level of defense-related genescaused by Lx-11.

MATERIALS AND METHODS

Bacterial strains and culture conditions. The wild-type B. amyloliquefaciens Lx-11 strain and the Xoocstrains b2-19, Yn-70, b5-16, b3-2, and b1-18 (Chen etal., 2009; Zhang et al., 2011b) were stored in 30% glyc-erol at -20°C. YPG medium (5 g yeast extract, 5 g bac-to-peptone, 10 g glucose per litre) was used as growthmedium for Lx-11. Strain b2-19 was grown for two dayson leaven beef peptone agar (LBA) containing 5 g yeastextract, 10 g peptone, 10 g NaCl, 15 g agar, and 1000 mlof distilled water, with pH adjusted to 7.0.

Construction of mutants deficient in surfactin syn-thesis. The srfAA gene (involved in surfactin biosynthe-sis) was disrupted by insertion mutagenesis with anerythromycin cassette derived from pMUTIN4. A 1.1kb PCR product from the srfAA gene region was am-plified from Lx-11 chromosomal DNA by PCR cycling(30 cycles of 40 sec at 94°C, 30 sec at 55°C, and 1 minat 72°C) with the primers srfAA-F (5-GCCCAAGCTTTATCTACGGTGCCTGTGC)(HindIII restriction site is underlined) and srfAA-R (5-G C G C G G AT C C TA A A G C G T C T G T C C C A A )(BamHI restriction site is underlined), then extractedfrom polyacrylamide gels after electrophoresis. Bothproduct and the integration vector (pMUTIN4, spoVG-lacZ; Ermr; Ampr, BGSC) were digested with HindIIIand BamHI. The digested fragments and plasmid werethen mixed for ligation. The ligation mixtures wereused to transform E. coli DH5α competent cells. Re-combinant plasmids pMUTIN4-srfA were purified andthen used to transform Lx-11 competent cells. A posi-tive strain (named Lx-11∆srfA) was selected on LBplates containing 0.3 µg ml-1 erythromycin. High per-formance liquid chromatography-electrospray ioniza-tion mass spectrometry (HPLC-ESI-MS) analysis wasused to confirm Lx-11∆srfA transformants.

Competent cells were prepared according to Kunstand Rapoport (1995), with slight modifications. Lx-11cells were grown in 10 ml of glucose-casein hydrolysate-

potassium phosphate buffer (GCHE) under vigorousshaking (200 rpm) at 37°C until an optical density at600 nm of 1.4 was reached. A total of 10 ml of GCmedium without casein hydrolysate was added, and theculture was incubated under the same conditions for 1h. Then, the cells were harvested by centrifugation fo 30min at 8,000 rpm and the pellet was resuspended in 1ml of supernatant containing 0.5% glucose. Subse-quently, 100 ng of DNA was added to 0.2 ml of cell sus-pension and incubated for 20 min. Finally, the cellswere cultivated in LB medium with inducing concentra-tions of the appropriate antibiotics for 90 min beforethey were plated on selective agar.

Detection of lipopeptides of Lx-11 by HPLC-ESI-MS and Matrix-assisted laser desorption/ionizationtime-of-flight mass spectrometry (MALDI-TOF MS).Lipopeptides were prepared according to Gao et al.(2003), with slight modifications. After fermentation at28°C for 48 h, the culture broth of Lx-11 was adjustedto pH 7.0 and centrifuged at 8000 rpm for 20 min. Thesupernatant was adjusted to pH 2.0 with 6 mol l–1 HCland stored overnight at 4°C. The precipitate was recov-ered by centrifugation at 8,000 rpm for 20 min, washedtwice with deionized water (adjusted to pH 2.0 with 6mol l–1 HCl), and extracted three times with methanol.The extracts were combined and evaporated at 30°Cunder vacuum to dryness with a rotary evaporator toyield pale-yellow crude lipopeptides. The crudelipopeptides were further purified by gel filtration on a2×50 cm SephadexTM LH-20 column (methanol as mo-bile phase). Finally a concentration of 2500 µg ml-1

stock solution of lipopeptides in methanol was preparedand stored at 4°C. Lipopeptides was filtered through a0.2 µm pore-size polytetrafluoroethylene membrane(JP020; Advantec, Japan) and injected into a reverse-phase high-performance liquid chromatography(HPLC) column (column, Eclipse XDB-C18; 2.1 mm indiameter×150 mm; Agilent, USA). The system was op-erated at a flow rate of 0.3 ml min-1 and monitored at215 nm with the solvent 3.8 mM acetonitrile:trifluo-racetic acid [80:20 (v/v)]. The concentration of sur-factin was determined with the standard surfactin pur-chased from Sigma (USA). The identities of each elutedfractions were analysed in positive iron mode by HPLC-ESI-MS. During the analysis, nitrogen was used as thenebulizing gas (25.0 psi), drying gas (10 l min-1, 350°C)and capillary voltage 4 KV. Peptide masses in the range1000-2000 Da were measured. Agilent MassHunterWorkstation Software (Agilent, USA) was used to iden-tify the results.

Crude lipopeptides of B. amyloliquefaciens Lx-11were identified in extracts of acid precipitation andSephadexTM LH-20 column extracts analyzed by MAL-DI-TOF MS as previously described (Koumoutsi et al.,2004). Mass spectra were recorded with a Bruker Dal-


Journal of Plant Pathology (2012), 94 (3), 609-619 Zhang et al. 611

tonik Reflex MALDI-TOF instrument containing a 337nm nitrogen laser for desorption and ionization. For MSanalysis, samples (1 µl) were mixed with an equal vol-ume of matrix solution [a saturated solution of α-cyano-4-hydroxycinnamic acid in 70% aqueous acetonitrilecontaining 0.1% (v/v) trifluoroacetic acid], and air-dried. Peptide masses in the range 1000-2000 Da weremeasured.

In vitro inhibition of Xooc strains by Lx-11. Xoocstrains were grown in leaven beef peptone broth (LB,which contained the same ingredients as LBA minus theagar) at 28°C for two days with constant shaking at 180rpm. Antibacterial activity was determined by agar dif-fusion technique according to the previous study (Ji etal., 2008). Suspensions (10 ml) of Xooc strains (ca. 109

CFU ml–1) were mixed with LBA (100 ml) prior topouring into plates. After solidification, 15 µl suspen-sion or supernatant of Lx-11 (supernatant obtainedfrom a 108 CFU ml-1 culture, filtered through a 0.2 µmpore-size polytetrafluoroethylene membrane) orlipopeptides (100 µg ml-1) were plated on the agar sur-face and incubated at 28°C for 48 h. Antibacterial activ-ity was measured as the width of the clear halo sur-rounding the bacterial streak.

Scoring of BLS disease and evaluation of diseasecontrol. Lx-11 strain was inoculated in YPG mediumand incubated at 28°C for 48 h with constant shaking at180 rpm, to the yielding capacity (bacterial population)of 109 CFU ml–1. The BLS pathogen, Xooc strain b2-19,was cultured on LB medium for 48 h at 28°C. The BLS-susceptible rice cv. Jingang 30, was used as the hostplant. Seeds were surface-sterilized for 20 min in 1%sodium hypochlorite followed by a brief rinse with wa-ter before sowing in sterile organic soil. Seedlings (3-week-old) were transferred into 15 cm×30 cm pots con-taining sterile organic soil. Each pot contained threeplants and each treatment was replicated three times. Atthe maximum tillering stage (about 60 days after trans-planting), plants were sprayed with a laboratory atomiz-er with the following: (i) sterile YPG medium serving ascontrol; (ii) 40 ml suspension of Lx-11 (108 CFU ml–1);(iii) 40 ml suspension of Lx-11 (106 CFU ml–1); (iv) 40ml suspension of Lx-11 (104 CFU ml–1); (v) 40 ml sus-pension of Lx-11 (102 CFU ml–1); (vi) 40 ml lipopep-tides (LPS, 100 µg ml-1).

Firstly, the rice plants were inoculated by sprayingwith cell suspensions of the BLS pathogen (ca. 108 CFUml–1). About 10-15 leaves of rice plants were puncture-inoculated with a cell suspension of strain b2-19 (108

CFU ml–1) then, 1 day post inoculation (dpi), the Lx-11suspension (108 CFU ml-1) and lipopeptides (100 µg ml-1) were sprayed on the leaves. The length of lesion de-veloped on 10 inoculated leaves was measured 14 dpiaccording to Guo et al. (2004). Rice plants were main-

tained at 80% relative humidity and 28°C for 1 day pri-or to moving to a greenhouse bench. The pots wereplaced in a randomized complete block design withthree replicates per treatment and the efficiency of Xooccontrol was estimated with the formula:

Control efficacy (%) = [(lesion length of control-lesion of treated group)/lesion length of control]×100%

Field trials were conducted in two consecutive years,2010 and 2011, at Siyang (Jiangsu province). The BLS-susceptible rice cv. II you 42 was used in these experi-ments. A completely randomized design was used withseven treatments (all sprays) and three replicate plotsper treatment (each plot was 4×5 m2). The treatmentswere: (i) a control consisting of water, 750 l ha–1; (ii) Lx-11 in suspension (108 CFU ml–1), 750 l ha–1; (iii) 20%bismerthlazol (a bactericide commonly used againstBLS in China produced by Zhejiang Longwan Chemi-cals), at the supplier’s recommended dosage of 300 g ac-tive ingredient ha-1.

The corresponding antagonistic strain suspensionswere applied at the onset of BLS with a Jacto HD400sprayer (Republic of Singapore). Tween 80 (0.1%) wasadded as a surfactant. No other bactericides were ap-plied to the experimental plots. A single application ofeach treatment was made at the maximum tillering stageof rice plants (about 60 days after transplanting). Thedevelopment of BLS lesions was surveyed 21 days aftertreatment. The diseased lesion area and the whole leafarea were measured. Scoring was assessed based on theaverage area of diseased lesion/area of whole leaves.The severity level was assessed using the following em-pirical scale: 0 = no lesions; 1 = lesions on <5% of theleaf area; 3 = lesions on 6-15% of the leaf area; 5 = le-sions on 16–30% of the leaf area; 7 = lesions on31–50% of the leaf area; 9 = lesions on >50% of theleaf area (Zhang et al., 2011). The disease index (DI)was calculated with the formula

DI = 100×sum of individual scores/total leaves observed × maximum score.

The extent of disease reduction attributed to eachtreatment was calculated with the formula:

Control efficacy (%) = ([disease index of control–disease index of treatment group]/disease index of control) × 100%

Detection of expression of the PR-1a, PR-1b, NPR1and PAL genes by RT-PCR or Real-time RT-PCR. TotalRNA from the BLS-susceptible cv. Jinggang 30, was ex-tracted from expanded 6-week-old leaves using TRIzolreagent (TransGen Biotech, China). First-strand cDNAwas synthesized using the oligo dT primer from 500 ngof total RNA with reverse transcriptase (TransGen



Biotech, China). A constitutively expressed gene, EF1α,was used as a quantitative control for the RT-PCR analy-sis which was conducted with 25 cycles using aliquots (1µl) of cDNA samples and EF1α, PR-1a and PR-1b spe-cific primers described by Shao et al. (2008).

Real-time RT-PCR was carried out with the LightCy-cler 2.0 Real-Time PCR system (Roche, Switzerland) byusing 1 µl cDNA mixture, gene-specific primers NPR1and PAL (see below) and SYBR Premix Ex TaqTM

(TaKaRa Biotech, China) according to the manufacturer’sinstructions. The PCR primer sequences were: NPR1-F:GCCCGATAGTCCTGATGC and NPR1-R: TTGGGAGGTGGCGAAGAG; PAL-F: TCCCGCTCTACCGCTTCGT and PAL-R: TCGCCGTTCCACTCCTTG, forthe amplification of NPR1 and PAL genes, respectively.The highly conserved EF1α gene, chosen as endogenouscontrol, was amplified using the following primers:EF1α-F: TTTCACTCTTGGTGTGAAGCAGAT andEF1α-R: GACTTCCTTCACGATTTCATCGTAA. PCRruns were repeated three times. Relative quantification

was based on threshold cycle (Ct) values according toPaffl (2001).

Statistical analysis. Data were processed with theanalysis of variance (ANOVA) using the SAS GLM(SAS Institute, USA). When the ANOVA wassignificant (P≤0.05), means were separated with Fisher’sProtected Least Significant Difference (PLSD).

RESULTS

Mass spectra obtained from lipopeptides of Lx-11showed very clear peak clusters (Fig. 1 A and B). Theparticular mass peaks and the corresponding antibioticsare listed in Table 1. The group of peaks at m/z = 1031,1045 and 1059 differ by 14 Da, suggesting the presenceof a series of homologous molecules with differentlength of fatty acid chain, which corresponded to sodi-um adduct of C13-C15 sufactins. Peaks in the range of

Fig. 1. MALDI-TOF-MS of lipopeptides produced by Lx-11. For MS analysis, 1-2 µl lipopeptides were used. Experimental de-tails are described in Materials and Methods. A. spectra of surfactin and bacillomycin D; B. spectra of fengycin.

Fig. 2. In vitro inhibition of lipopeptides and supernatant of Lx-11 against X. oryzae pv. oryzicola strain b2-19 by A: a (100%methanol), b (lipopeptides, 100 µg ml-1), c (CK, YPG medium), d (supernatant of Lx-11, obtained from the culture grown to 108

CFU ml-1 ); B: Antibacterial activities of Lx-11 (suspension of Lx-11, 108 CFU ml-1) against different pathotype Xooc strains (e:b1-18; f: b5-16; g: Yn-70; h: b3-2; i: b1-19).


m/z = 1032, 1046 and 1060 were attributed to protonadduct of C14-C16 bacillomycin D. For fengycins, sig-nals at m/z of 1486 and 1514, and at 1500 and 1528,highlight an Ala/Val dimorphy at position 6 of the pep-tide ring for the C16 and C17 homologues, respectively,which is the characteristic trait of fengycin A and B(Table 1).

Antibacterial activity of Lx-11 and lipopeptides (ob-tained from the culture supernatant of Lx-11) againstXooc b2-19 was determined by agar diffusion technique.The supernatant and lipopeptides of Lx-11 strongly in-hibited the growth of b2-19 strain, a clear halo sur-rounding the disk b and d, and the inhibition widthswere 9.8 mm and 11.7 mm, respectively; while in con-trol disk (disk a and c), b2-19 strain appeared normal(Fig. 2A). Compared with the antagonistic activity ofLx-11 strain, it indicated that the main antibacterialproducts existed in lipopeptides. We also observed thatLx-11 strain had antibacterial activity against different

Xooc pathotype, and the inhibition haloes ranged from7.1 to 11.7 mm (Fig. 2B).

To evaluate the role of surfactin in suppressing Xooc,the surfactin-deficient mutant strain Lx-11∆srfA wasconstructed. Surfactin production from two bacterialstrains was determined by HPLC-ESI-MS. Extract fromliquid cultures was filtered through a 0.2 µm pore-sizepolytetrafluoroethylene membrane and injected into areverse-phase HPLC column. Commercially purchasedsurfactin was used as a standard control. HPLC-ESI-MS analysis of standard surfactin giving peaks at m/z1023 and 1037 were found in accordance with the cal-culated mass values of proton adducts of C14 and C15homologues of surfactins (Fig. 3A). The full-scan massspectra of lipopeptides obtained from Lx-11 culturecorresponded to the surfactin control (Fig. 3B). The Lx-11∆srfA strain exhibited an impaired capacity to pro-duce surfactin. We also observed that the antibacterialactivity of the surfactin-deficient mutant strain waspractically abolished (Fig. 4A). The lesion length of therice leaves treated with Lx-11 and Lx-11∆srfA were15.3 mm and 25.7 mm, with control efficacy of 55.4 and25.1%, respectively (Fig. 4B). In field trials, Lx-11 sig-nificantly reduced disease incidence, and control effica-cy of Lx-11 ranged from 60.2 to 70.6%, better than thatof bismerthlazol.

When the efficacy of different dilutions of the wholeLx-11 culture against BLS was compared, all serial dilu-tions, ranging from 10 fold up to 1×106 fold, signifi-cantly reduced BLS compared to the control. Biocon-trol efficacy of different concentrations of Lx-11 rangedfrom 11.0 to 55.4% and, as the concentration of Lx-11decreased, biocontrol efficacy gradually declined ac-cordingly (Fig. 5). This was taken as an indication thatthe concentration of Lx-11 strain was not less than 108

CFU ml–1 when applied in field trails. Consistently withthe in vitro tests, lipopeptides exhibited a 45.8% con-trol efficacy against BLS (Table 2), suggested thatlipopeptides might play an important role in controllingBLS.


Table 1. Lipopeptides products of Lx-11 Detected by MALDI-TOF-MS.

Mass peaks (M/Z) AssignmentSurfactin1031/1047 C13-sufactin [M+Na, K]+

1045/1061 C14-sufactin [M+Na, K]+

1059/1075 C15-sufactin [M+Na, K]+

Bacillomycin D1032 C14-bacillomycin D [M+H]+

1046 C15-bacillomycin D [M+H]+

1060/1082 C16-bacillomycin D [M+H, Na]+

Fengycin1472/1488 C15-fengycin [M+ Na, K]+ (6-Ala)1486/1502 C16-fengycin [M+ Na, K]+ (6-Ala)1478/1500/1516 C17-fengycin [M+H, Na, K]+(6-Ala)1514/1530 C16-fengycin [M+Na, K]+(6-Val)1506/1528 C17-fengycin [M+H, Na]+(6-Val)

Table 2. Control efficacies of Lx-11 against rice bacterial leaf streak in pot and field trials.

Filed trialsc (%)Treatmenta Control efficacy in pot trialsb (%)

Control efficacy in 2010 Control efficacy in 2011Lx-11 55.4 ad 60.2 b 70.6 aLipopeptides 45.8 b / /Lx-11∆srfA 25.1 c / /20% bismerthlazol 46.1 b 45.4 c 48.5 cCK(water) 0 d 0 d 0 da: The concentration of Lx-11 and Lx-11∆srfA suspensions were 108 CFU ml-1, the concentration of lipopeptides was 100µg ml-1.b: Pot trails control efficacy=[(lesion length of control-lesion of treated group)/lesion length of control] ×100%.c: Filed trails control efficacy (%) = ([disease index of control–disease index of treatment group]/disease index of control)× 100%.d: Values in columns followed by similar letters were not significantly different according to Fisher’s protected LSD test(p=0.05). (/ : not tested)


To determine whether the Lx-11 strain induced hostdefense responses, the expression of three defense-relat-ed genes was examined in cv. Jinggang 30 using RT-PCR. The genes tested are involved in plant basal de-fense pathways mediated by salicylic acid (SA) and jas-monic acid (JA), and included three defense genes (PR-

1a, PR-1b and PAL) and a signal transduction (NPR1)gene. The expression of PR-1a and PR-1b was enhancedin cv. Jinggang 30 after treatment of Lx-11 (around 108

CFU ml-1) (Fig. 6B). After 24 h of treatment, PR-1a andPR-1b expression reached the maximum level, then de-clined gradually. PR-1a and PR-1b expression was not


Fig. 3. Detection of surfactin by HPLC-ESI-MS in wild-type and mutant strains (detection at 215 nm). TIC scanfor (A): standard sufactin; lipopeptides obtain from Lx-11 culture (108 CFU ml-1) (B) and Lx-11∆srfA culture(108 CFU ml-1) (C). a-f: Extracted ion chromatogram for m/z 1023 (a-b, d-e), 1037 (c, f).


detected in the control (Fig. 6A). Results of real-timeRT-PCR indicated that the expression of PAL andNPR1 achieved the maximum after 24 h of Lx-11 treat-ment, being 7.3-fold and 4.2-fold higher than that inthe YPG medium treatment, respectively (Fig. 7A andB). The surfactin-deficient strain Lx-11∆srfA only had a2.0-fold increase compared with the YPG mediumtreatment.

DISCUSSION

BLS caused by Xooc is one of the most importantrice diseases in China and in most hybrid rice varieties,and cannot be efficiently controlled (Zhang et al., 2005).Biological control is one of the effective methods forplant protection, but until now, the commercialization

of biocontrol agents is still limited (Szewczyk, 2006).Understanding the mechanism of control could help inimproving the level of and efficiency of the control.Some of the potential mechanisms of biocontrol deter-mined from previous studies are the production ofmetabolites with antimicrobial activity (antibiosis), andthe induction of systemic resistance (Ahimoua et al.,2000; Arguelles-Arias et al., 2009; Bais et al., 2004; Du-


Fig. 4. A: Antibacterial activity of YPG medium (a), mutant Lx-11∆srfA(b) and wild type Lx-11(c) against X. oryzae pv. oryzicola.B: The lesion length after Xooc inoculated with different treatments. The suspensions of Lx-11 and Lx-11∆srfA strains at a con-centration of 108 CFU ml-1.

Fig. 5. Control efficacy of Lx-11 strain with different concen-trations in pot trails. The suspension of Lx-11 strain dilutedto different concentration: 108 CFU ml-1; 106 CFU ml-1; 104

CFU ml-1; 102 CFU ml-1. Control efficacy=[(lesion length ofcontrol-lesion of treated group)/lesion length of con-trol]×100%. Different letters indicate statistically significantdifferences between treatments (LSD test; P < 0.05).

Fig. 6. Time courses of the expressions of PR-1a and PR-1bgenes in rice in response to YPG medium treatment (CK) (A)or Lx-11 treatment (B). Plants were inoculated with antago-nist suspensions of Lx-11 at a concentration of 108 CFU ml-1while control plantlets were treated with YPG medim.


an et al., 2007; Liu et al., 2007; Raaijmakers et al., 2002).We previously identified B. amyloliquefaciens Lx-11 as apromising biocontrol agent (Zhang et al., 2011). In viewof a future commercialization of Lx-11, its biocontrolmechanism was studied including antibacterial prod-ucts synthesized by Lx-11, and Lx-11-mediated ISR atthe molecular levels and its biocontrol efficacy in thefield were studied.

MALDI-TOF-MS confirmed that lipopeptides wereproduced by Lx-11, including surfactin, bacillomycinD, fengycin (Table 1), which is consistent with previousstudies (Koumoutsi et al., 2004). In in vitro tests, the in-hibition zone seen in the dual culture plates indicatedthe presence of biologically active metabolite producedby Lx-11 (Fig. 2A) which ae likely to be lipopeptides.Moreover, pot trials results indicated that Lx-11 andlipopeptides provided 55.4 and 45.8% control efficacy,respectively, while Lx-11∆srfA, the mutant deficient insurfactin synthesis generated from Lx-11, only exhibit-ed 25.1% control efficacy (Table 2). This is also in ac-cordance with the in vitro tests and further confirms therole of lipopeptides in controlling BLS, although the

presence of other antibacterial agents involved in theLx-11-induced biocontrol of BLS cannot be excluded.Previous studies indicated that bacillomycin D andfengycin against fungal diseases played a major role(Benitez et al., 2010; Moyne et al., 2001; Ongena et al.,2005; Zeriouh et al., 2011), and the cyclic lipoheptapep-tide surfactin was one of the most potent biosurfactantsshowing antibacterial and antiviral activity (Bais at el.,2004; Koppe and Marahiel, 2007). However, B. amy-loliquefaciens strain ARP23 and BO7 showing antifungalactivity thanks to the production of surfactin, had dif-ferent antifungal activities due to the different structureof surfactins (Alvarez et al., 2012; Romano et al., 2011).Recently, bacilysin and difficidin produced by B. amy-loliquefaciens FZB42 were confirmed to be efficient infire blight disease control (Chen et al., 2009). Thus, sur-factins can be considered as a novel class of microbial-associated molecules that can specifically be perceivedby plant cells as signals to activate defense mechanisms(Jourdan et al., 2009). Surfacins and fengycins producedby B. subtilis ss49 can also act as elicitors of ISR in pro-tecting beans from pathogen infection (Ongena et al.,2007). Bacillus isolates such as strain Lx-11, that co-pro-duce the three lipopeptide families, might also displaysuch a multi-faceted biocontrol activity. Field trials alsoshowed that Lx-11 was a potential biocontrol agentstrain against BLS (Table 2).

Consequent to the many studies of the past decade,the ISR phenomenon induced by beneficial bacteria hasbeen addressed, depicting the cascade of signalingevents from the activation of transcription factors to thephenotypic expression of the phenomenon (Van Weeset al., 2008). However, the molecular mechanisms in theperception of elicitors from these biocontrol agents bythe host plant are still poorly understood (Van Loon,2007). In this study, the expression of defense-relatedgenes PR-1a and PR-1b was enhanced after treatmentwith Lx-11 (Fig. 6B). These genes encoding basic oracidic PR proteins might be essential for resistance toBLS of rice. In addition, the defense-related genes PR-1a, PR-1b, NPR1 and PAL were highly responsive toharpin-treated plants 8 h later (Zhao et al., 2006). TheNPR1 protein modulates defense pathway mediated bySA and JA (Spoel et al., 2003), and both of them induceSAR in rice against infection from the blast fungus(Magnaporthe grisea) (Yang et al., 2004). PAL is a keyenzyme in the phenylpropanoid metabolism leading tothe production of a large array of phenolics, includingprecursors for cell wall reinforcement, antimicrobialcompounds which play important roles in disease resist-ance (Dixon et al., 2002). A previous study reportedthat B. cereus AR156 triggered ISR in Arabidopsis by si-multaneously activating the SA-and JA/ET-signalingpathways in an NPR1-dependent manner that lead to anadditive effect on the level of induced protection (Niuet al., 2011). We observed that NPR1 and PAL genes


Fig. 7. Real time RT-PCR: Time course of the expressions ofPAL (A) and NPR1 (B) genes in rice in response to Lx-11,Lx-11∆srfA and YPG medium (CK) treatments. Plants wereinoculated with antagonist suspensions of Lx-11 and Lx-11∆srfA at a concentration of 108 CFU ml-1 while controlplantlets were treated with YPG medium. Different letters in-dicate statistically significant differences between treatments(LSD test; P < 0.05).


expression level was significantly enhanced after treat-ment of Lx-11 strain 24 h later compared with Lx-11∆srfA treatment (Fig. 7A and B). This suggests thatLx-11 might also trigger ISR in rice like other ISR-in-ducing rhizobacteria (Bakker et al., 2007; Kloepper etal., 2004; Ongena and Thonart, 2006), so it is plausibleto conclude that the surfactin produced by Lx-11 mayplay an important role in triggering ISR in rice plant.Work for further investigating how to activate the path-ways by Lx-11 leading to increased resistance to Xooc isstill going on in our laboratory. The knowledge in thisaspect will be instrumental in improving the practicalapplication of Lx-11 in plant protection.

ACKONWLEGEMENTS

We gratefully thank Dr. Yu Chen (Anhui Academy ofagricultural Sciences) for his critical revision of thismanuscript. This research was supported by grantsfrom the National Department Public Benefit ResearchFoundation (No. nyhyzx07-056), the Science Founda-tion of the Jiangsu Academy of Agricultural Sciences[Grant no. CX(11)2045] and Key Projects of JiangsuProvince Science and Technology Pillar Program(BE2011356).

REFERENCES

Ahimoua F., Jacquesb P., Deleua M., 2000. Surfactin anditurin A effects on Bacillus subtilis surface hydrophobicity.Enzyme and Microbial Technology 27: 749-754.

Alvarez F., Castro M., Principe A., Borioli G., Fischer S.,Mori G., Jofre E., 2012. The plant-associated Bacillus amy-loliquefaciens strains MEP218 and ARP23 capable of pro-ducing the cyclic lipopeptides iturin or surfactin andfengycin are effective in biocontrol of sclerotinia stem rotdisease. Journal of Applied Microbiology 112: 159–174.

Arguelles-Arias A., Ongena M., Halimi B., Lara Y., Brans A.,Joris B., Fickers P., 2009. Bacillus amyloliquefaciens GA1as a source of potent antibiotics and other secondarymetabolites for biocontrol of plant pathogens. MicrobialCell Factories 8: 63-74.

Bais H.P., Fall R., Vivanco J.M., 2004. Biocontrol of Bacillussubtilis against infection of Arabidopsis roots byPseudomonas syringae is facilitated by biofilm formationand surfactin production. Plant Physiology 134: 307-319.

Bakker P., Pieterse C.M.J., Van Loon L.C., 2007. Induced sys-temic resistance by fluorescent Pseudomonas spp. Phy-topathology 97: 239-243.

Bargabus R.L., Zidack N.K., Sherwood J.E., Jacobsen B.J.,2003. Oxidative burst elicited by Bacillus mycoides isolateBac J, a biological control agent, occurs independently ofhypersensitive cell death in sugar beet. Molecular Plant-Mi-crobe Interactions 16: 1145-1153.

Benhamou N., Kloepper J.W., Quadt-Hallman A., Tuzun S.,1996. Induction of defense-related ultrastructural modifi-

cations in pea root tissues inoculated with endophytic bac-teria. Plant Physiology 112: 919-929.

Benhamou N., Belanger R.R., 1998. Benzothiadiazole-mediat-ed induced resistance to Fusarium oxysporum f. sp. radicis-lycopersici in tomato. Plant Physiology 118: 1203-1212.

Benitez L.B., Velho R.V., Lisboa M.R., Da Costa Medina L.F.,Brandelli A., 2010. Isolation and characterization of anti-fungal peptides produced by Bacillus amyloliquefaciensLBM5006. The Journal of Microbiology 48: 791-797.

Broggini G.A.L., Duffy B., Holliger E., Scharer H.J., GesslerC., Patocchi A., 2005. Detection of the fire blight biocon-trol agent Bacillus subtilis BD170 (Biopro®) in a Swiss ap-ple orchard. Europen Journal of Plant Pathology 111: 93-100.

Chen X.H., Vater J., Piel J., Franke P., Scholz R., SchneiderK., Koumoutsi A., Hitzeroth G., Grammel N., StrittmatterA.W., Gottschalk G., Sussmuth R.D., Borriss R., 2006.Structural and functional characterization of three polyke-tide synthase gene clusters in Bacillus amyloliquefaciensFZB42. Journal of Bacteriology 188: 4024-4036.

Chen X.H., Scholz R., Borriss M., Junge H., Mogel G., KunzS., Borriss R., 2009. Difficidin and bacilysin produced byplant-associated Bacillus amyloliquefaciens are efficient incontrolling fire blight disease. Journal of Biotechnology140: 38-44.

Chen Z.Y., Liu Y.F., Liu F.Q., Luo C.P., Nie Y.F., 2009 Resis-tant evaluation of rice bacterial leaf streak and virulencedifferentiation of Xanthomonas oryzae pv. oryzicola inJiangsu. Acta Phytophylacica Sinica 4: 315-318.

Conrath U., Pieterse C.M.J., Mauch-Mani B., 2002. Primingin plant-pathogen interactions. Trends in Plant Science 7:210-216.

Dixon R.A., Achnine L., Kota P., Liu C.J., Reddy M.S.S.,Wang L.J., 2002. The phenylpropanoid pathway and plantdefence - A genomics perspective. Molecular Plant Patholo-gy 3: 371-390.

Duan G.F., Zhang Z.B., Zhang J.P., Zhou Y.J., Yu L.Q., YuanQ.S., 2007. Evaluation of crude toxin and metabolite pro-duced by Helminthosporium gramineum Rabenh for thecontrol of rice sheath blight in paddy fields. Crop Protec-tion 26: 1036-1041.

Gnanamanickam S.S., Priyadarisini B.V., Narayanan N., Va-sudevan P., Kavitha S., 1999. An overview of bacterialblight disease of rice and strategies for its management.Current Science 77: 1435-1443.

Guo Y.H., Xu Z.G., Hu B.S., Shen X.P., Chen Z.Y., Liu Y.F.,2004. Virulence differentitation of Xanthomonas oryzae pv.oryzicola in southern regions of China. Chinese Journal ofRice Science 18: 83-85.

Han J., Sun L., Dong X., 2005. Characterization of a novelplant growth-promoting bacteria strain Delftia tsuruhaten-sis HR4 both as a diazotroph and a potential biocontrolagent against various plant pathogens. Systematic AppliedMicrobiology 28: 66-76.

Ji G.H., Wei L.F., He Y.Q., Wu Y.P., Bai X.H., 2008. Biologi-cal control of rice bacterial blight by Lysobacter antibioti-cus strain 13-1. Biological Control 45: 288-296.

Jourdan E., Henry G., Duby F., Dommes J., Barthelemy P.,Thonart P., Ongena M., 2009. Insights into the defense-re-



lated events occuring in plant cells following perception ofa surfactin-type lipopeptide from Bacillus subtilis. Molecu-lar Plant-Microbe Interactions 22: 456-468.

Kondoh M., Hirai M., Shoda M., 2001. Integrated biologicaland chemical control of damping-off caused by Rhizocto-nia solani using Bacillus subtilis IXB14-C and flutolanil.Journal of Bioscience and Bioengineering 91: 173-177.

Kopp F., Marahiel M.A., 2007. Macrocyclization strategies inpolyketide and nonribosomal peptide biosynthesis. NaturalProduct Reports 24: 735-749.

Kloepper J.W., Ryu C.M., Zhang S., 2004. Induced systemicresistance and promotion of plant growth by Bacillus spp..Phytopathology 94: 1259-1266.

Koumoutsi A., Chen X.H., Henne A., Liesegang H., Hitze-roth G., Franke P., Vater J., Borriss R., 2004. Strain FZB42Bacillus amyloliquefaciens in Synthesis of Bioactive CyclicLipopeptides of Gene Clusters Directing NonribosomalStructural and Functional Characterization. Journal of Bac-teriology 186: 1084-1096.

Kunst F., Rapoport G., 1995. Salt stress is an environmentalsignal affecting degradative enzyme synthesis in Bacillussubtilis. Journal of Bacteriology 177: 2403-2407.

Kunz S., Haug P., 2006. Development of a strategy for fireblight control in organic fruit growing. In: Foko E.V. (ed.).Proceedings of 12th International Conference on cultivationTechnique and Phytopathological problems in Organic Fruit-Growing. FOKO e.V., Weinsberg, Germany 2006: 145-150.

Leifert C., Li H., Chidburee S., Hampson S., Workman S.,Sigee D., Epton H.A.S., Harbour A., 1995. Antibiotic pro-duction and biocontrol activity by Bacillus subtilis CL27and Bacillus pumilus CL45. Journal of Applied Bacteriology78: 97-108.

Liu Y.F., Chen Z.Y., Ng T.B., Zhang J., Zhou M.G., Song F.P.,Lu F., Liu Y.Z., 2007. Bacisubin, an antifungal protein withribonuclease and hemagglutinating activities from Bacillussubtilis strain B-916. Peptides 28: 553-559.

Moyne A.L., Shelby R., Cleveland T.E., Tuzun S., 2001. Bacil-lomycin D: an iturin with antifungal activity against As-pergillus flavus. Journal of Applied Microbiology 90: 622-629.

Niu D.D., Liu H.X., Jiang C.H., Wang Y.P., Wang Q.Y., JinH.L., Guo J.H., 2011. The Plant Growth-Promoting Rhi-zobacterium Bacillus cereus AR156 Induces Systemic Resis-tance in Arabidopsis thaliana by Simultaneously ActivatingSalicylate-and Jasmonate/Ethylene-Dependent SignalingPathways. Molecular Plant-Microbe Interactions 24: 533-542.

Ongena M., Jacques P., Touré Y., Destain J., Jabrane A.,Thonart P., 2005. Involvement of fengycin-type lipopep-tides in the multifaceted biocontrol potential of Bacillussubtilis. Applied Microbiology and Biotechnology 69: 29-38.

Ongena M., Thonart P., 2006. Resistance induced in plants bynonpathogenic microorganisms: Elicitation and defense re-sponses. In: Jaime A., Da Silva T. (eds). Floriculture, Orna-mental and Plant Biotechnology: Advances and Topical Is-sues, pp. 447-463. Global Science Books, London, UK.

Ongena M., Adam A., Jourdan E., Paquot M., Brans A., JorisB., Arpigny J.L., Thonart P., 2007. Surfactin and fengycinlipopeptides of Bacillus subtilis as elicitors of induced sys-

temic resistance in plants. Environmental Microbiology 9:1084-1090.

Ou S.H., 1985. Rice Diseases. Commonwealth AgriculturalBureau. Kew, UK.

Paffl M.W., 2001. A new mathematical model for relativequantification in real-time RT-PCR. Nucleic Acids Research29: 2002-2007.

Raaijmakers J.M., Vlami M., De Souza J.T., 2002. Antibioticproduction by bacterial biocontrol agents. Antonie vanLeeuwenhoek 81: 537-547.

Romano A., Vitullo D., Di Pietro A., Lima G., Lanzotti V.,2011. Antifungal lipopeptides from Bacillus amyloliquefa-ciens strain BO7. Journal of Natural Products 74: 145-151.

Shao M., Wang J.S., Dean R.A., Lin Y.J., Gao X.W., Hu S.J.,2008. Expression of a harpin-encoding gene in rice confersdurable nonspecific resistance to Magnaporthe grisea. PlantBiotechnology Journal 6: 73-81.

Spoel S.H., Koornneef A., Claessens S.M., Korzelius J.P., VanPelt J.A., Mueller M.J., Buchala A.J., Metraux J.P., BrownR., Kazan K., Van Loon L.C., Dong X., Pieterse C.M.,2003. NPR1 modulates cross-talk between salicylate andjasmonate-dependent defense pathways through a novelfunction in the cytosol. Plant Cell 15: 760-770.

Stein T., 2005. Bacillus subtilis antibiotics: structures, syntheseand specific functions. Molecular Microbiology 56: 845-857.

Szewczyk B., Hoyos-Carvajal L., Paluszek M., Skrzecz I.,Souza M.L., 2006. Baculoviruses, re-emerging biopesti-cides. Biotechnology Advances 24: 143-160.

Tang D., Wu W., Li W., Lu H., Worland A.J., 2000. Mappingof QTLs conferring resistance to bacterial leaf streak inrice. Theoretical and Applied Genetics 101: 286-291.

Tjamos S.E., Flemetakis E., Paplomatas E.J., Katinakis P.,2005. Induction of resistance to Verticillium dahliae in Ara-bidopsis thaliana by the biocontrol agent K-165 and patho-genesis-related proteins gene expression. Molecular Plant-Microbe Interactions 18: 555-561.

Van der Ent S., Van Wees S.C., Pieterse C.M., 2009. Jas-monate signaling in plant interactions with resistance-in-ducing beneficial microbes. Phytochemistry 70: 1581-1588.

Van Wees S.C., Van der Ent S., Pieterse C.M., 2008. Plant im-mune responses triggered by beneficial microbes. CurrentOpinion in Plant Biology 11: 443-448.

Vasudevan P., Kavitha S., Priyadarisini V.B., Babujee L.,Gnanamanickam S.S., 2002. Biological control of rice dis-eases. In: Gnanamanickam S.S. (ed.). Biological Control ofCrop Diseases. pp. 11-32. Marcel Decker, New York, NY,USA.

Xie G.L., Sun S., Chen J., Zhu X., Chen J., Ye Y., Feng Z.,Liang M., 1990. Studies on rice seed inspection of Xan-thomonas campestris pv. oryzicola: immunoradiometric as-say. Chinese Journal Rice Science 4: 127-132.

Xu Z.G., Qian J.M., 1995. Advances in control and ecologicalresearch of bacterial streak of rice. Plant Quarantine 9:239-244.

Yang Y.N., Qi M., Mei C.S., 2004. Endogenous salicylic acidprotects rice plants from oxidative damage caused by agingas well as biotic and abiotic stress. The Plant Journal 40:909-919.



Zhao M.Q., Wang L., Zhang B., Wang J.S., Chen G.Y., 2006.Harpin, a proteieous elicitor of Xanthomonas oryzae pv.oryzicola, triggering hypersensitive response in tobacco andinducing disease resistance in rice. Chinese Journal of Bio-logical Control 22: 283-289.

Zhang J.S., Li Y.Z., Fang X.J., 2005. Detection of QTL con-ferring resistance to bacterial leaf streak in rice chromo-some 2 (O. sativa L. spp. indica). Scientia Agricultura Sinica38: 1923-1925.

Zhang R.S., Liu Y.F., Chen Z.Y., 2011a. Screening, evaluationand utilization of antagonistic bacteria against Xan-

thomonas oryzae pv. oryzicola. Chinese Journal of BiologicalControl 27: 510-514.

Zhang R.S., Chen Z.Y., Liu Y.F., 2011b. Genetic diversity andpathotype variability of Xanthomonas oryzae pv. oryzicolastrains. Chinese Journal of Rice Science 25: 523-528.

Zeriouh H., Romero D., García-Gutiérrez L., Cazorla F.M.,Vicente D.A., Pérez-García A., 2011. The iturin-likelipopeptides are essential components in the biologicalcontrol arsenal of Bacillus subtilis against bacterial diseasesof cucurbits. Molecular Plant-Microbe Interactions 24:1540-1552.


Received February 28, 2012Accepted July 27, 2012


lx-11, a potential biocontrol agent against rice …

Documents