materials and methods - shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/51359/6/4... · 2018....

Materials and Methods

52 | P a g e

3. Materials and Methods

3.1 Materials

3.1.1 Bacterial species used in this study

Burkholderia pseudomallei

Standard strains of Burkholderia pseudomallei were procured from NTCC, UK and further

were maintained by subculture. In addition to this 11 clinical isolates isolated from patients

from different geographical regions of India were maintained at DRDE, Gwalior. Soil

isolates isolated from soil samples collected from Parangipettai, Tamilnadu were also used

in this study. The DNA isolated from B. pseudomallei BPS1688 was used for cloning and

expression of all recombinant antigens. Nucleic acid based detection system developed

was evaluated with all standard strains, clinical and soil isolates of B. pseudomallei. The list

of standard strains, clinical and environmental isolates of B. pseudomallei used in this study

is summarized in table 1.

S. No. Burkholderia Species Ref ID Lab Code

1. Burkholderia pseudomallei NCTC 1688 BPS1688

2. Burkholderia pseudomallei NCTC10274 BPS

3. Burkholderia pseudomallei Clinical isolate BPSP

4. Burkholderia pseudomallei Clinical isolate C1




Table 1: List of Standard strains, clinical and environmental isolates used in study


53 | P a g e

E. coli

The E. coli host cells used in the cloning and expression of recombinant antigens are

mentioned in table 2:

Table 2: List of E. coli host cells used in study

Other bacterial species

Specificity of recombinant antigens and gene targets was determined with bacterial species

cross reactive to B. pseudomallei, procured from MTCC, Institute of Microbial Technology,

Chandigarh and summarized in table 3:




11. Burkholderia pseudomallei Clinical isolate T892



14. Burkholderia pseudomallei Soil isolate A1




Strain Application Transformation

Efficiency Resistance Source

Mach1TM–T1

R

Cells Used for general cloning

purpose. ≥1x10

9 cfu/µg DNA - Invitrogen, USA

BL21(DE3) Cells Used for expression only. ≥ 1x108

cfu/µg DNA. - Invitrogen, USA


54 | P a g e

Table 3: List of cross reactive bacterial species used in the study

S. No. Bacterial Species Ref ID Lab code

1. Burkholderia mallei NTCC 10624 BM

2. Burkholderia cepacia MTCC 438 BCEP 438

3. Burkholderia cepacia MTCC 1617 BCEP 1617

4. Burkholderia cepacia MTCC Lab BCEP

5. Pseudomonas alcaligens MTCC 493 PALC

6. Pseudomonas aeruginosa MTCC 741 PAE 741

7. Pseudomonas aeruginosa ATCC 25668 PAER

8. Ralstonia eutropha MTCC 1285 REU 1285

9. Burkholderia cocovenenans MTCC 1888 BCO 1888

10. Pseudomonas citronellolis MTCC 1191 PCI 1191

11. Pseudomonas synxantha MTCC 2652 PXA 2652

12. Brevundimonas dimuta MTCC 1287 BDI 1287

13. Pseudomonas mucidolens MTCC 1618 PMU 1618

14. Pseudomonas echinoids MTCC 1625 PEC 1625

15. Pseudomonas putida MTCC 102 PPU 102

16. Acidovorex facilis MTCC 1198 AFA 1198

17. Comamonas acidovorans MTCC 104 CAC 104

18. Pseudomonas elongate MTCC 2426 PEL 2426

19. Pseudomonas syringae MTCC 1604 PSY 1604

20. Pseudomonas taetrolens MTCC 1612 PTA 1612

21. Ralstonia pickettii MTCC 648 RPI 648

22. Pseudomonas cruciviae MTCC 512 PCR 512

23. Pseudomonas syncyanea MTCC 1762 PNC 1762

24. Escherichia coli MTCC 520 ECO 520

25. Klebsiella pneumonia MTCC 7028 KPN 7028


55 | P a g e

3.1.2 Clinical samples

A total of 123 serum samples collected from Kasturba Medical College, Manipal, Karnataka,

India were tested in indirect ELISA assay. 123 Serum samples were grouped into three

categories based on culture tests. Group I included 23 serum samples which were culture

confirmed positive for melioidosis. Group II included 59 serum samples of other febrile

illness patients and group III included 41 serum samples from healthy individuals.

3.1.3 Expression vectors and host cells

pET-SUMO expression system- was used for cloning of specific antigenic targets of

Burkhoderia pseudomallei. This vector system utilizes a small ubiquitin-like modifier

(SUMO) to allow expression, purification, and generation of native proteins in E. coli and

enhance the solubility of proteins.

This vector is having various features for regulated expression as T7lac promoter for

IPTG-inducible high level expression of the gene of interest in E. coli, N-terminal 6xHis tag

for detection and purification of recombinant fusion proteins, N-terminal SUMO fusion

protein, TA Cloning site for efficient cloning of Taq-amplified PCR products, kanamycin

resistance gene for selection in E. coli, lacI gene encoding the lac repressor to reduce basal

level transcription from the T7lac promoter in the pET SUMO vector and from the lacUV5

26. Vibrio fischeri MTCC 1738 VFI 1738

27. Yersinia enterocolitica MTCC 23715 YE 23715

28. Proteus vulgaris MTCC 744 PVG 744

29. Staphylococcus aureus MTCC 6908 SA 6908

30. Salmonella typhimurium MTCC 3224 STP 3224


56 | P a g e

promoter in the E. coli and pBR322 origin for low-copy replication and maintenance in E.

coli.

E. coli strain Mach1TM–T1R cells- were used as maintenance host. It is modified form of

the wild-type W strain (ATCC 9637) having features like lacZΔM15 for blue/white color

screening of recombinants, hsdR mutation for efficient transformation of unmethylated DNA

from PCR applications, endA1 mutation for increased plasmid yield and quality, tonA

mutation to confer resistance to T1 and T5 phage.

E.coli BL21 (DE3) strain- was used as expression host. The DE3 designation means this

strain contains the lambda DE3 lysogen which carries the gene for T7 RNA polymerase

under the control of the lacUV5 promoter. IPTG is required to induce expression of the T7

RNA polymerase. When T7 RNA polymerase is produced in sufficient amount, it binds to

the T7 promoter and transcribes the gene of interest. The strain is an E. coli B/r strain does

not contain the lon protease. It also has a mutation in the outer membrane protease, OmpT.

The lack of these two key proteases reduces degradation of heterologous proteins

expressed in the strain.

3.1.4 Chemicals, reagents and kits used for PCR

The following reagents were used for DNA extraction and PCR: formaldehyde, glycerol,

Sodium Lauryl Sulphate (SDS), proteinase K, RNase A, sodium chloride, saturated phenol,

chloroform, Ethidium Bromide (EtBr), agarose (Sigma-Aldrich, USA), 10X master mix

containing KCl, MgCl2, dNTPs, Taq DNA polymerase, DNA ladder 100bp (Cat. no.

#SM0243), 100bp plus (Cat. no. #SM0323) and 1 kb DNA ladder (Cat. no. #SM0313), 6X

loading dye (MBI Fermentas, USA). The following kits were used for PCR purification and

plasmid isolation: QIAquick gel extraction Kit, QIAprep plasmid mini prep kit (Qiagen,

Germany). The following reagents were used for Real time PCR: Power SYBR® Green PCR


57 | P a g e

master mix (Applied Biosystems, USA). The reagents used for cloning purpose are T4 DNA

ligase (MBI Fermentas, USA), SUMO forward and T7 reverse sequencing primers

(Invitrogen, USA).

3.1.5 Chemicals, reagents and kits used for protein analysis

The following reagents were used for production and purification of recombinant proteins:

Kanamycin, IPTG (Sigma-Aldrich, USA), prestained protein molecular weight markers (Cat.

no. #SM1811, #SM671) (MBI fermentas, USA), Ni-NTA agarose resin (Qiagen, Germany),

Dialysis tubing (Sigma-Aldrich, USA), Amicon ultra centrifugal filter devices (Millipore, USA),

BSA (Himedia, India), Folin’s reagents (Merck, India). The following reagents were used for

characterization, immunization and reactivity of recombinant proteins: Nitrocellulose

membrane (Pall Corporation, USA), anti-His-HRP conjugate (Qiagen, Germany),

Acetonitrile, Tri-fluoro acetic acid, HCCA matrix of LC-MS grade and MiniTip C18 (Sigma-

Aldrich, USA), Freund’s complete adjuvant (FCA) and Freund’s incomplete adjuvant (FIA)

(Difco Laboratories, USA), Anti-rabbit, anti-mice IgG conjugates, anti-human IgA, IgG, IgM,

kappa, Lambda HRP conjugates (Dako Cytomation, Denmark), DAB, OPD (Sigma-Aldrich,

USA).

3.1.6 Instruments

Centrifuge 24D (LabNet International), Sorvall Legend Micro21R Centrifuge

(Thermoscientific, USA), Spinwin 1-10k, RC5C (Sorvall Instruments from Thermo-Scientific,

USA), Speed vac centrifuge (Savant concentrator), Thermocycler (Veriti 96 well thermal

cycler from ABI Biosciences, QB-24 from Quanta Biotech, UK), Agarose Gel Electrophoresis

Unit (Thermo electron Corporation EC250), SDS-PAGE electrophoresis unit (BioRad mini

Protean Vertical Electrophoresis System from BioRad Laboratories, USA), blot transfer unit

(Hoefer TE 22Tank transfer unit from Amersham Biosciences, USA). Vortex (Spinix, 100-


58 | P a g e

3200rpm), dry Bath (TC01, Genei, Thermocon), water bath (Grant, LTD 20G from Grant

Instrument, England), magnetic stirrer (C-10, from Central Kagaku, Atto Corporation,

Japan), pH meter (MP220 from Mettler-Toledo, India). Electronic Balance (AB54-S from

Mettler-Toledo, India), incubator with shaker (Labcon 5081 U from Labcon USA), deep

freezers (-200C, Vestfrost, Denmark), microwave oven (Bio Ceramic Samsung, CE 2977N

from Samsung, India), laminar air flow hood (Class II TYPE A2 from Esco, Singapore), gel

documenter (Alpha Innotech, from Amersham Pharmacia Biotech USA). UV torch

(UltraLum, UVAC-18, California), sonicator (ultrasonic disintegrator Vibracell, USA),

spectrophotometer, ELISA plate reader (μQuant from Bio-Tek instruments, USA), MALDI-

TOF (Bruker Microflex LRF-20, Flex Control Workstation, Bermen, Germany) and 7500 Fast

Dx real time PCR Instrument (Applied Biosystems, USA) were used in the study.

3.1.7 Media, buffers, solutions & gels

Bacterial culture media & dyes

Composition of various media & dyes used is given in Appendix I. The following media were

used for sub culturing and maintenance of B. pseudomallei (standard strains, clinical and

soil isolates) and cross reactive bacterial species: Brain Heart Infusion (BHI) broth, BHI agar

(Himedia, India). The following media was used for sub culturing of E. coli strains: Luria

Bertani (LB) broth, LB agar (Himedia, India).

Buffers & solutions

Buffers used in the purification of recombinant proteins under native and denaturing

conditions, SDS PAGE (30% acrylamide solution, separating buffer (1.5M, pH 8.8), stacking

buffer (1M, pH 6.8), 10% APS, 10% SDS, 2X sample buffer and running buffer), western

blotting and ELISA (Tris glycine buffer (25mM, pH 8.3) with methanol 10X phosphate buffer


59 | P a g e

saline (PBS) (0.01M, pH 7.2), PBS along with tween-20 (PBST) and carbonate –

bicarbonate buffer (0.05M, pH 9.6)) and submarine agarose gel electrophoresis (50x Tris

Acetate EDTA (TAE)) are mentioned in Appendix II.

Solutions required for chromosomal DNA purification, competent cells preparation,

staining and destaining solutions for SDS-PAGE gels, copper sulphate, sodium-potassium

tartarate and alkaline copper reagent (ACR) solution for protein estimation, bovine serum

albumin (BSA), substrate solution and stop solution for ELISA were also prepared as per the

composition given in Appendix III.

Gels

Agarose gel (0.8% and 1%) prepared in 1X TAE electrophoresis buffer containing ethidium

bromide (0.5 µg/ ml) were used for DNA and PCR analysis. Agarose gel (1.2%) was used

for gel extraction of PCR products. Polyacrylamide separating gel (12% and 15%) and

stacking gel (5%) were used in SDS-PAGE for recombinant protein analysis. The

compositions of various gels used in study are given in Appendix IV.

3.1.8 Glassware & plasticware

All glass ware and plastic ware used in present study are from Borosil, Schott Duran and

Tarson. CELLSTAR Micro Plate (greiner), dialysis tubing closures (Sigma-Aldrich, USA), F8

Polysorp immunomodule purchased from (Nunc). MicroAmp® Fast optical 96 well Reaction

Plate with bacode (0.1mL), optical adhesive covers, MicroAmp adhesive film applicator

(Applied Biosystem, USA) were also used.


60 | P a g e

3.1.9 Experimental animals

New Zealand female white rabbits 1 to 1.5 kg and inbred BALB/c female mice 15 to 20 gm

were obtained from Animal House Facility of DRDE, Gwalior. The use of animals for all the

experiments was cleared by Animal Ethic Committee of DRDE, Gwalior.

3.2 Methods

3.2.1 Maintenance of bacterial cultures

Standard strains, clinical and environmental isolates of Burkholderia pseudomallei and other

cross reactive bacterial species used in the study were revived from their glycerol stocks,

maintained on BHI agar slants and sub cultured in BHI broth/ agar. The bacterial cultures

were incubated at 37°C for 48 to 72 hours and inactivated by formalin. The E. coli strains

used as host cells and recombinant clones were maintained on LB agar slants and were sub

cultured in LB broth/ agar with appropriate antibiotics according to host and vector. The

cultures of these bacterial strains were incubated at 37°C and used for cloning and

expression work. Glycerol stocks containing 20% (v/v) glycerol of all above mentioned

bacterial strains and recombinant clones were prepared in BHI broth or LB broth and stored

at -80C for long-term storage.

3.2.2 Preparation of genomic DNA

Genomic DNA of all the standard strains, clinical, environmental isolates and other bacterial

strains were extracted using conventional method of phenol: chloroform: isoamylalcohol.

For this 5ml overnight grown bacterial culture in BHI broth was inactivated with 1% formalin

solution for 1hour. The inactivated culture was pelleted at 8000 rpm for 20 minutes;

supernatant was discarded and washed thrice with PBS. After washing with PBS, cells


61 | P a g e

were lysed using lysis buffer containing 100mM Tris-HCl buffer (pH-7.0), 1mM EDTA, 10%

SDS and proteinase K and then incubated at 56°C for 1 hour and RNase A was added and

again incubated at 37°C for 1 hour. After 1 hour an equal volume of phenol: chloroform was

added, mixed by inverting the tubes. Samples were then centrifuged at 13,000 rpm for 10

minutes for separation of DNA from protein. The upper aqueous layer was transferred to

fresh sterile microcentrifuge tube and two volumes of absolute ethanol and 1/10 volume of

3M sodium acetate was added and after gentle mixing kept overnight at -20°C for

precipitation of DNA. The tubes were centrifuged at 13,000 rpm for 10 minutes at 4°C,

supernatant discarded and pellet washed with 70% ethanol and centrifuged at 13,000 rpm

for 10minutes at 4°C. Ethanol was completely removed and pellet was resuspended in 50 µl

of autoclaved milliQ water. In order to determine purity and the concentration of DNA

spectrophotometer was used, OD260nm/ OD280nm ratio was estimated and value of 1.8 or

above was considered as standard for purity. Purified DNA was run on submarine agarose

gel electrophoresis and visualized in gel documentation system (Alpha Innotech, USA).

Agarose gel of 0.8% was prepared in 1X TAE buffer and dissolved by heating and allowed

to cool upto 45°C and EtBr was added to 0.5 µg/ml final concentration. The gel was allowed

to polymerize for 30 to 45 minutes at room temperature and run on electrophoresis

instrument with 1X TAE buffer as running buffer at constant voltage of 80V. After

electrophoresis, gel was examined in gel documentation system. The DNA was stored at -

20°C until further use.

3.2.3 Preparation of recombinant antigens

In order to develop a potential diagnostic antigen for serodiagnosis of melioidosis, 5 different

gene targets were selected namely ompA, groEL, malE that are Burkholderia genus specific

and two targets bpss0096, bpss0120 that are B. pseudomallei species specific. The cloning

of these genes in BL21 (DE3) E.coli host strain was performed as per protocol described by


62 | P a g e

Maniatis et al (1982). The reading frame of each gene was analyzed with respect to pET-

SUMO expression vector which is a linearized vector and primers were designed using gene

runner software.

Primer design and synthesis

The primers required for Burkholderia pseudomallei genus and species specific primers

were designed using Gene Runner software. Primers having %G+C ratio more than 50%,

not forming primer dimer or any internal loop, having both primers TM (forward and reverse)

nearly equal and less than 72ºC were selected. Selected primers were commercially

synthesized in 0.05 μmol scale. The primers were dissolved in autoclaved milliQ water as

per the manufacturer’s instructions to a final concentration of 100 pmol/μl and stock

solutions were stored at -20oC. The working solutions of primers were prepared by diluting

the stock with autoclaved milliQ water in 1:10 ratio and were used for PCR reactions.

Primers sequence of different genes with their size and TM values are given in table 4.


63 | P a g e

Table 4: Primers sequence of different B. pseudomallei specific antigen targets

PCR amplification

PCR conditions were first standardized to amplify the gene targets by running with different

annealing temperature ranging between 50ºC to 60ºC and varying reaction mixture reagents

composition. After standardization procedure for each gene target the PCR reactions were

carried out in 25 µl reaction mixture containing 100 ng of genomic DNA as template, 10

pmol of each primer, 1X PCR buffer containing KCl, 1.5mM MgCl2, 200µM dNTPs, 1 unit

Taq DNA polymerase, made up to 25µl with autoclaved milliQ water. The standard reaction

for PCR is given in table 5:

Table 5: Reaction Mixture for PCR (25µl)

Gene Primer Sequence Size (-mer) TM (°C)

ompA F-5’ATGAATAAACTTTCAAAGCTCG3’

R-5’TTACTGCGCCGGAACGGT3’

22

18

61.5

68.6

groEL F-5’ATGGCAGCTAAAGACGTC3’

R-5’TTACATGTCCATGCCCAT3’

18

18

53.7

51.4

malE F-5’ATGAAAATTCGCGCGATC3’

R-5’TTACTTCACCTTCGCGGC3’

18

18

51.4

56.0

bpss0096 F-5’ATGTCGCGTCAGATTCG3’

R-5’CTATAGTCCCGTACCGCT3’

17

18

61.1

56.8

bpss0120 F-5’ATGTGGCCGGAATTTC3’

R-5’TCACCCGCATGTTCCT3’

16

16

59.4

61.4

Components Concentration

10X PCR buffer 2.5 µl

25 mM MgCl2 1.5 µl

dNTP mix (10mM each) 0.5 µl

Forward primer 1 µl

Reverse primer 1 µl

Taq DNA polymerase 1 µl

Template DNA 1 µl

milliQ water 16.5 µl


64 | P a g e

The reaction mixture was first vortexed and then spins down to ensure equal

distribution of all components. PCR was run in DNA thermal cycler (ABI Applied

Biosciences) following standard protocol as: initial denaturation at 95°C for 5 min followed

by 30 cycles of denaturation at 95°C for 50 sec, annealing temperature (different for each

gene) for 50 sec and extension at 72°C for 1 min, followed by a final extension of 72°C for

10 min (Table 6).

Table 6: PCR conditions

Conditions Temperature(º C) Time

Initial denaturation 95º 5 min

Start cycles 30

Denaturation 95º 50 sec

Annealing Different temperatures for

different gene

50 sec

Elongation 72º 1 min

End Cycle 1

Final Elongation 72º 10 min

Storage 4º Infinite


65 | P a g e

Annealing temperatures standardized for each gene are as follows: 56ºC for ompA,

56ºC for groEL, 55ºC for malE, 55ºC for bpss0096 and 60ºC for bpss0120. PCR amplified

products were analyzed on 1.0% agarose gel and PCR reaction of 100µl was completed

following standardized protocol for cloning purpose. The PCR amplified products were

checked in 1.0% agarose gel after electrophoresis and observed under gel documentation

system. The gene band of appropriate size was cut using a clean scalpel and collected in

separate autoclaved vial and extracted using QIAquick Gel Extraction Kit (Qiagen)

according to the manufacturer instructions. The purified PCR product was again checked in

1.0% agarose gel, quantified spectrophotometrically and used in cloning experiments.

Ligation of genes in pET-SUMO expression vector

Ligation reaction was carried out at 16ºC, the purified PCR products of ompA, groEL, malE,

bpss0096 and bpss0120 were ligated with prelinearized pET-SUMO expression vector using

T4 DNA ligase by following instructions of pET-SUMO manual. The vector: insert was kept

in molar ratio of 1:1 and 10µl ligation mixture was prepared as follows: 2 µl of pET-SUMO

vector, 2µl of insert, 1µl 10X ligation buffer, 1 µl T4 DNA ligase and made up to 10µl by

addition of sterile milliQ water. The ligation mixture was incubated for 16 to 18 hours at

16°C and used for transformation.

Competent cells preparation of E. coli strains

Competent cells of E. coli strains were prepared as per Cohen and associates protocol with

some minor modifications (Cohen et al., 1972). E. coli strains Mach1TM-T1R and BL21 (DE3)

were revived from glycerol stocks provided with pET-SUMO kit stored at -20ºC. The vial of

host cells provided with kit was inoculated into 5ml of LB broth medium and incubated at

37C overnight with constant shaking at 180rpm. 1ml of overnight grown culture was


66 | P a g e

inoculated into fresh 10ml LB broth medium and incubated at 37°C for 3 to 4 hours at

180rpm until the OD600 reaches between 0.4 to 0.6. The cells were transferred to 50 ml

centrifuge tube and chilled on ice for 15 to 20 minutes and centrifuged at 6000rpm for 15

minutes at 4C. The supernatant was discarded and pellet obtained was suspended in 3.4

ml of freshly prepared ice-cold 0.1M CaCl2 (1/10 volume of culture). Cells were mixed

gently with CaCl2 without damaging the cells and kept in ice for 1hour. After 1 hour it was

again centrifuged at 6000rpm for 15 minutes at 4°C. The pellet thus obtained was finally

resuspended in 1.7ml of chilled CaCl2 and 300µl chilled glycerol added to make up the final

concentration to 15%. Competent cells thus prepared were aliquoted as 200l suspensions

in 0.5ml tubes and stored at -80C.

Transformation

Host cells were transformed with the ligated product (containing vector and insert) following

standard protocol (Sambrook, 2001). Two vials of competent host cells (one vial to be

transformed and one vial as control) and one vial containing ligated product (all kept at -

20ºC) were thawed on ice for about 15 to 20 minutes prior to transformation. After complete

thawing, 200 µl of competent cells in one vial was transformed with 10µl of ligated mixture

and mixed by gentle tapping. The other vial was kept untransformed and marked as control

and both the host cell vials (transformed and untransformed) were kept on ice for 5 minutes

and then subjected to heat shock at 42°C for 90 seconds in a water bath. After heat shock

both were immediately transferred to ice bath for again 5 minutes. After completion of this

cold shock, 800µl LB broth was added to both the vials and incubated at 37°C for 1 hour

with shaking, 100 and 200µl of transformed host cell culture and 200µl of untransformed

host cell culture were plated on LB agar plates containing antibiotic kanamycin (50µg/ml)

and incubated at 37°C overnight.


67 | P a g e

Screening and confirmation of transformants

The screening of the transformants or positive clones was done by colony PCR. The well

isolated bacterial colonies grown on selective agar plate after transformation were selected

randomly and subjected to PCR using forward and reverse primer specific to gene. Each

colony was picked up with sterile toothpick and after preparing backup by streaking on

sterile LB agar plate containing antibiotic kanamycin (50µg/ml), rest of the colony was mixed

with 50µl sterile milliQ water. The vials were kept at 100°C for 10 minutes in dry bath for

lysis of the cells and release of DNA from the cells. After that lysed cell suspension was

centrifuged at 13000rpm for 10 minutes to pellet out the cell debris and the supernatant

contained DNA. The reaction mixture with 10µl of the supernatant was used as DNA

template for each PCR reaction. The orientation of the insert inside the cloning vector with

respect to reading frame was also confirmed by PCR with SUMO forward primer of the

vector (provided with the pET-SUMO expression vector kit) and reverse primer of the insert,

following earlier described protocol with annealing temperature of 56°C for ompA, 56°C for

groEL, 55°C for malE, 55°C for bpss0096 and 60°C for bpss0120 gene.

Expression of recombinant proteins

The expression of recombinant proteins by positive clones after induction with IPTG and

also at different time interval was studied. The positive clones of each gene were inoculated

into 5ml LB broth tubes containing kanamycin (50µg/ml) and incubated at 37C with

constant shaking at 180rpm for overnight. The 0.5ml of overnight grown culture was

inoculated into fresh sterile 10ml LB broth medium containing appropriate antibiotics and

incubated at 37C with constant shaking of 180rpm for 3 to 4 hours until it reaches OD600

value of 0.4 to 0.6. 1ml of culture was centrifuged at 8000rpm for 5 minutes, prior to

induction with IPTG and was kept as uninduced sample. Expression of the recombinant


68 | P a g e

protein was induced by adding IPTG to a final concentration of 0.25mM (standardized for

ompA gene) and 1mM (for all other genes). After induction, cultures were again incubated

for 5 hours at 37C under constant shaking at 180rpm. The samples of induced as well as

uninduced culture were aliquoted after 2, 3 and 5 hours after induction, centrifuged at

8000rpm for 5 minutes and stored at -20°C for SDS-PAGE analysis.

The expression of recombinant protein was analyzed by SDS-PAGE as per standard

protocol using discontinuous buffer system with minor modifications (Laemmli, 1970).

Separating gel of 12% or 15% (according to protein size) and stacking gel of 5% was

polymerized in glass plates having 1mm thickness and the composition of separating and

stacking gels are given in appendix IV. The protein samples to be analyzed were mixed

with equal volume of 2X sample loading buffer, boiled for 5 to 10 minutes in dry bath and

centrifuged at 8000rpm for 5 minutes. Polymerized gel were assembled in electrophoresis

unit and 1X running buffer was filled in tank upto 3/4th level to allow passage of current. 20

µl of the protein samples were loaded along with prestained protein ladder (#SM0671/,

#SM1811). Initially electrophoresis was carried out at 80 volt to allow protein samples to

cross stacking gel slowly and then the current was increased to 100 volt till the dye front

reaches the bottom in Biorad electrophoresis unit. The gel was removed from the plate

carefully and stained using freshly prepared staining solution containing Coomassie brilliant

blue R-250 for 15 to 20 minutes and destained using freshly prepared destaining solution

with 2 to 3 changes till the bands were clearly visible. The composition of both staining and

destaining solutions are given in appendix III.

Localization of recombinant proteins

The solubility of expressed recombinant proteins was determined and confirmed whether

the protein is present in cytoplasm in soluble form or as inclusion bodies. 10ml culture of


69 | P a g e

respective positive clone was induced with 0.25 or 1mM IPTG and after 5 hours of induction,

the cells were pelleted by centrifugation at 8000rpm for 20 minutes. Supernatant was

discarded and pellet obtained was washed with 1X PBS. The cells were lysed with

solubilization buffer (pH-8.0) containing 1mg/ml lysozyme and incubated on ice for 30

minutes. The cell suspension was sonicated with 8 seconds impulse at 40W amplitude for 5

to 10 minutes and sonicated sample was centrifuged at 10000rpm for 30 minutes at 4°C.

The supernatant and pellet were analyzed by SDS-PAGE.

Purification of recombinant proteins

The purification of recombinant proteins was done from 25ml bacterial culture after

induction. Ni-NTA affinity column chromatography was used for the purification of

recombinant proteins. The buffers for native conditions were used if the recombinant protein

was found soluble and buffers for denaturing conditions were used if the expressed protein

was found in inclusion bodies. The following steps are used in the purification of

recombinant proteins:

A. Purification under native conditions

rGroEL and rMalE proteins were purified under native conditions as both of them were

expressed in soluble form and secreted to cytoplasm.

Preparation of cleared lysate: The proteins expressed in soluble form were purified under

native condition and the supernatant or clear lysate containing recombinant protein was

used for purification.

Ni-NTA column purification: The clear lysate was mixed with 50% Ni-NTA slurry in 1:3

ratio and kept on magnetic stirrer for 1 hour at 4ºC to allow gentle mixing of clear lysate with

slurry. The column used for purification was pre- equilibrated with lysis buffer and clear


70 | P a g e

lysate mixed with slurry was loaded to the pre-column and the resin was allowed to settle

down to bottom of column. The flow through was collected and stored and the unbound

non-specific proteins were washed with 3 column volume of wash buffer (pH 8.0) for three

times. Recombinant protein bound to column was then eluted using 2ml of elution buffer

(pH 8.0) and fractions collected at different time interval were analyzed in 12% SDS-PAGE

stained with Coomassie brilliant blue and protein bands visualized after destaining.

B. Purification under denaturing conditions

rOmpA, rBPSS0096 and rBPSS0120 proteins formed inclusion bodies and purification was

carried out under denaturing conditions.

Preparation of cleared lysate: The cell pellet obtained from 25ml culture was stored at -

20ºC, thawed on ice for 15 to 20 minutes and then washed with 1X PBS. The cells were

then gently dissolved without foaming in 6 to 8 ml lysis buffer (pH 8.0) which contained 8M

urea as denaturing reagent. Cell suspension obtained after complete dissolution of pellet

was sonicated with 8 seconds impulse at 40W amplitude and incubated at 37ºC for 1 hour

under shaking condition. After 1 hour incubation the cells were centrifuged at 10,000rpm for

30 minutes at room temperature to pellet the cellular debris. The lysate obtained after

centrifugation was used for the purification of recombinant proteins with Ni-NTA agarose

resin by affinity column chromatography. Small fraction of cleared lysate and pellet after

centrifugation were kept for SDS-PAGE analysis.

Ni-NTA column purification: The cleared lysate was mixed gently with 50% Ni-NTA slurry

in 1:4 ratio and kept on magnetic stirrer for 1 hour at room temperature. The lysate-resin

mixture was then loaded to the Ni-NTA column pre-equilibrated with lysis buffer. The

column was washed thrice with 3 column volume of wash buffer (pH 6.3) to remove

unbound non specific proteins. Specific recombinant protein bound to resin was then eluted


71 | P a g e

using 2ml of elution buffer (pH 4.5). Fractions collected after time interval were analyzed by

SDS-PAGE followed by Coomassie brilliant blue staining and protein bands were visualized

after destaining. 12% separating gel was used for rBPSS0096 and rBPSS0120 protein

whereas 15% separating gel was used for rOmpA protein.

Dialysis of recombinant proteins

Dialysis was carried out to remove excess imidazole from protein purified under native

condition or to remove excess urea from protein purified under denaturing condition. The

dialysis tubing of appropriate length was soaked in PBS for 1 to 2 minutes and end of the

tubing was clamped so that protein can be added to the tube. Eluted fractions of

recombinant protein were pooled up and mixed with equal volume of PBS and loaded to

dialysis tube. The tube was clamped from other end and immersed in dialysis buffer tank.

rGroEL and rMalE were purified under native conditions, therefore excess imidazole from

these proteins was removed by diluting the protein (all fractions pooled) with equal volume

in 1X PBS and then dialysed against 1X PBS solution on magnetic stirrer overnight. The

buffer was changed 3 to 4 times for complete removal of imidazole. Recombinant proteins

purified under denaturing conditions were dialysed against gradient solution of urea in 1X

PBS to 6M→ 4M→ 2M→ 1M→ PBS and kept on magnetic stirrer at room temperature for 4

to 6 hours with each solution used. After dialysis protein samples were concentrated by

passing through molecular weight cutoff centrifugal filter device. The 50K MWCO was used

for rGroEL, rMalE, rBPSS0096 and rBPSS0120 and 30K MWCO was used for rOmpA

protein. Flow-through obtained after concentrating the protein and concentrated protein

samples were collected and analsed by SDS-PAGE. The protein samples were filter

sterilized and concentration of protein estimated by Lowry’s method and stored at -200C for

further use (Lowry, 1951).


72 | P a g e

3.2.4 Characterization of recombinant proteins

Western Blotting

The characterization of purified recombinant protein was done by western blotting as per

standard protocol (Towbin et al., 1979). The protein bands from polyacrylamide gel were

transferred electrophoretically to nitrocellulose membrane using Tris glycine buffer with 20%

methanol (transfer buffer) in Hoefer TE 22 (Amersham Biosciences) transfer unit. The

assembly for western blotting was set by sandwiching the gel and the nitrocellulose

membrane between filter papers, soaked in chilled transfer buffer and entrapment of air

bubbles was avoided. The assembly was then placed in the tank with gel facing towards

cathode and nitrocellulose membrane facing towards anode. The tank was filled with

transfer buffer to immerse the assembly completely in buffer. Constant current of 2 mA per

cm2 of gel was applied for 90 minutes for complete transfer of proteins from gel to

membrane. In order to visualize transfer of protein bands on membrane, temporary staining

of membrane was done with Ponceau S stain (Sigma-Aldrich, USA) and the stain was

removed by washing with distilled water after visualization. The protein free sites on the

membrane were blocked with 1% BSA in PBS for overnight at 4°C and washed thrice with

PBS-T (1X PBS with 0.05% Tween 20) for 15 minutes and incubated with anti-His-HRP

conjugate at 1:1000 dilutions for 1 hour at 37˚C. The membrane was again washed with

PBST thrice and reaction was developed with DAB/H2O2 solution. The reaction was

stopped by rinsing the membrane with distilled water after appearance of dark brown band

on the membrane.


73 | P a g e

MALDI-TOF/MS analysis

Mass spectrometric analysis of recombinant proteins was performed using MALDI-TOF TOF

instrument equipped with delayed extraction (150 nanosecond) and a UV ionization laser

(N2, 337nm) with a 3 nanosecond pulse width. The voltage of 20kV, grid voltage of 19kV

was set and laser repetition rate was 20 Hz. Protein samples to be analyzed were run on

SDS PAGE and gel was stained with Commassie Brilliant Blue. The protein band of

appropriate size was cut from gel into very fine pieces. Before in gel trypsin digestion, the

pieces with purified recombinant proteins (rOmpA, rGroEL, rMalE, rBPSS0096 and

rBPSS0120) were washed thrice with 200µl of destaining solvent (50% v/v ACN in 25mM

NH4HCO3) with constant vortexing for 10 minutes. The washed gel pieces were dehydrated

with 200µl of 100% ACN and dried in speed vac concentartor. The protein contained in the

gel was then subjected to digestion using 25µl (20µg/100µl) of trypsin in 50mM NH4HCO3

solution at 37˚C for overnight in a shaker incubator at 100rpm. The peptides were extracted

twice from the gel using 200µl of extraction solvent (5% TFA in 50% ACN). The extracted

peptides were then subjected to lyophilization for complete removal of solvent and the small

pellet left was used for mass analysis. The pellet was dissolved in 8µl milliQ water and for

complete purity of dissolved peptides; samples were eluted using MiniTip C18 and 1 µl of

peptide extract was spotted on MALDI plate and 1 µl of matrix was applied on the peptide

spot. The peptide mass fingerprinting was obtained and α-Cyano-4-hydroxy cinnamic acid

(HCCA) was used as matrix and the instrument was operated in the reflector mode and

hundred shots were averaged per spectra and seven hundred laser shots were

accumulated. Peptide calibration standards include mixture of angiotensin II, angiotensin I,

substance P, bombesin, ACTH clip 1-17, ACTH clip 18-39 and somatostatin 28 covering the

range of 600-3500. The spectra were evaluated using the Flex Analysis Software (Bruker

Daltonics). The MS spectrum obtained was submitted to MASCOT search via Bio tools


74 | P a g e

versions 3.1. The search parameters used were partial methionine oxidation, one missed

cleavage, peptide mass tolerance 200ppm and the database selected for the peptide match

was NCBI/SwissProt.

3.2.5 Protein estimation of recombinant antigens

Lowry’s method was used to determine the concentration of recombinant protein antigen

(Lowry, 1951). In this method protein is quantified based on colour obtained from Folin-

Ciocalteau’s phenol reagent with tyrosine residues of unknown protein and comparing this

with a standard protein, usually BSA. Standard solution of BSA (1mg/ml) in distilled water

was prepared and different volumes (5µl, 10µl, 15µl and 20µl) were taken in micro titer plate.

Test samples were also taken in 4 different volumes of 5µl, 10µl, 15µl and 20 µl. Working

solution of alkaline reagent was prepared from 1% copper sulfate and 2% sodium potassium

tartarate solution and added to each well to make the final volume to 200µl and blank

working solution was used as control. Micro titre plate was then placed on plate shaker to

allow components to mix completely and 10µl of Folin Ciocalteu’s reagent was added to

each well and incubated for 10 to 15 minutes in dark under shaking at room temperature

and optical density was measured at 700 nm.

3.2.6 Generation of hyper immune sera against recombinant antigens

Female BALB/c mice were immunized with 20 to 30g of recombinant antigen and male

New-Zealand white rabbits were immunized with 200g of recombinant antigen to generate

hyper immune sera. Before immunization blood samples from healthy mice and rabbit were

taken and sera separated and stored. The first dose was given with complete Freund’s

adjuvant (CFA) to mice intramuscularly (200µl) and to rabbit subcutaneously (1ml).

Subsequent doses were administered with incomplete Freund’s adjuvant intramuscularly at


75 | P a g e

weekly interval until titre reach to desired level. The rabbit and mice were bled, seven days

after the last booster dose. The blood samples were incubated at 37°C for 1 hour and then

at 4°C for 1 hour, centrifuged at 10,000rpm for 15 minutes to separate the serum. Hyper

immune sera (HIS) were separated and stored at -20C in aliquots until use.

3.2.7. Titration of hyper immune sera by dot-ELISA method

The titration of hyper immune sera was determined by dot ELISA on nitrocellulose

membrane fixed on plastic comb. The respective recombinant antigen was mixed with

equal amount of carbonate-bicarbonate buffer and 2µl of the antigen was coated at the

centre of the nitrocellulose membrane. Combs were allowed to dry at 370C for 30 minutes

and nonspecific sites were blocked with 1% BSA for 1hour at 370C. The unbound proteins

were removed by washing the comb three times with distilled water. The comb was again

incubated with serial dilutions of hyper immune sera and incubated for 1 hour at 370C. The

comb was again washed with distilled water thrice to remove unbound sera and incubated

for 1 hour at 370C with polyclonal goat anti-mice or anti-rabbit immunoglobulin/HRP (Dako

Cytomation, Denmark) at 1:500 dilution in PBS. The strip was again washed thrice with

distilled water and the reaction was developed with PBS-DAB-H2O2 substrate solution. The

reaction was stopped after appearance of brown spot by rinsing the combs in distilled water.

3.2.8 Indirect plate-ELISA for antibody detection in clinical samples of human

melioidosis with recombinant antigens

The indirect microplate IgG ELISA was standardized to determine the reactivity of

recombinant antigens. The purified protein was diluted from a stock solution to 10 µg/ml

(rGroEL), 12µg/ml rOmpA and 25 µg/ml (rMalE, rBPSS0096 and rBPSS0120) in coating

buffer (0.1M carbonate buffer, pH 9.6), and 100µl (100ng) was coated on Nunc


76 | P a g e

immunoplates/modules at 370C for 1 hour. The plates were then washed thrice with PBS-T

and then blocked with 200µl/well of 1% BSA in PBS and kept at 40C overnight. The blocked

wells were again washed three times with PBS-T. The test serum samples were diluted 1:

100 in PBS and 100µl added per well and incubated at 37ºC for 1 hour. After incubation the

ELISA plate was washed three times with PBS-T and incubated with HRP-conjugated anti-

human IgG (Dako, Cytomation, Denmark) in 1:1000 dilution at 370C for 1hour. The wells

were then washed with PBS-T three times and developed using 100µl/well of developing

solution (o-phenylenediamine (OPD) (4mg, 200µl H2O2 and 10ml PBS). The plates were

then kept in the dark for 5 minutes for color development. The reaction was stopped by

addition of 1N H2SO4 (10µl/well) and absorbance was read at 490nm in an ELISA reader.

3.2.9 Estimation of cross reactivity of recombinant proteins with cross reactive

bacterial species

The cross reactivity of recombinant antigens were tested against sonicated antigens of

cross reactive species like Escherichia coli, Klebsiella pneumoniae, Proteus vulgaris,

Pseudomonas aeruginosa, Vibrio fischeri, Staphylococcus aureus, Salmonella typhi and

Yersinia enterocolitica. The sonicated antigens of these bacterial species were used to

immunize female BALB/c mice to raise hyper immune sera following procedure described

earlier. The hyper immune sera were used in indirect plate ELISA to determine the reactivity

with rOmpA, rGroEL, rMalE, rBPSS0096 and rBPSS0120 antigens. The recombinant

antigens were coated at the concentration of 2.5µg per well in 100µl volume. The ELISA

protocol is same as described earlier except polyclonal goat anti-mice immunoglobin/HRP

conjugate was used in 1:500 dilutions. Serum raised against sonicated antigen of B.

pseudomallei was used as positive control and sera from healthy mice used as negative

control in all the assays.


77 | P a g e

3.2.10 SYBR Green PCR based detection of B. pseudomallei specific genes

PCR and SYBR Green real time PCR based on specific target genes of B. pseudomallei

was developed. Primers against three specific genes bpss0075, bpss00076 and bpss0091

were designed and PCR as well as SYBR Green real time PCR was carried out for all these

three genes using standard strains, clinical and environmental isolates of B. pseudomallei.

Sensitivity as well as specificity of both the assays was determined.

Primer design and synthesis

Primers for specific gene targets of B. pseudomallei were designed as per procedure

described earlier. Primer sequences of specific gene targets with their TM values are give in

table 7.

Table 7: Primers sequence of different B. pseudomallei genes:

Gene Primer Sequence Size (-mer) TM(ºC)

bpss0075 F-5’TTGGCGGTGTTTAGAGTG3’

R-5’TCATGCGAATTCATCATC3’

18

18

59.9

57.9

bpss0076 F-5’ATGATGAATTCGCATGAA3’

R-5’TCATACGGCTCTCATTGT3’

18

18

57.4

56.5

bpss0091 F-5’GTGAAAAAGAAGGTCGTA3’

R-5’ TTATTCGTAGGCAAGC3’

18

16

52.4

51.7


78 | P a g e

Real time PCR reaction

The SYBR Green real time PCR was carried out with primers (table 7) and template DNA of

all strains of B. pseudomallei mentioned in table 1. The SYBR Green real time PCR

reaction mixture contained 10pmol of each primer, 50ng of DNA template, 1XPower SYBR®

Green PCR Master Mix and autoclaved milliQ water to make up to volume of 10 µl (table 8).

The amplification protocol was standardized for SYBR Green real time PCR and the

conditions are: initial denaturation of 95°C for 5 minutes followed by 30 cycles of

denaturation at 95°C for 50 seconds, annealing varying for different genes (590C for

bpss0075, 570C for bpss0076 and 520C for bpss0091) for 50 seconds and extension of

72°C for 1 minute followed by final extension at 72°C for 10 minutes. Dissociation stage

(denaturation at 95°C for 15 seconds, followed by lowering down of temperature to 60°C for

15 seconds again denaturation at 95°C for 15 seconds and final lowering down of

temperature to 60°C for 15 seconds) was added at end of each SYBR Green real time PCR

reaction. The non-template controls (NTC), consisting of H2O with and without primers were

used as negative control in all amplification assays.

Table 8: PCR reaction mixture

Reagents Concentration

SYBR Green master mix 5 µl

Forward primer 1 µl

Reverse primer 1 µl

Template DNA 1 µl

MilliQ water 2 µl

Total volume 10 µl


79 | P a g e

3.2.11 Sensitivity and specificity of PCR & real time PCR

The sensitivity of PCR and SYBR Green real time PCR assay using primers of newly

identified specific gene targets (bpss0075, bpss0076 & bpss0091 gene) of B. pseudomallei

was determined. DNA concentration of template DNA of B. pseudomallei standard strain

BPS1688 was estimated and then it was serially diluted 20 fold of its original concentration

starting from 6.5ng/µl to 6.1fg/µl. PCR & SYBR Green real time PCR assay using serially

diluted DNA template was carried out as per protocol mentioned earlier. Positive control (B.

pseudomallei BPS1688 DNA) and negative controls (NTC, H2O with and without primers)

were run along in all amplification assays. In order to determine specificity of the assays

DNA of cross reactive bacterial species mentioned in table 2 were tested with primers of all

three specific genes.

materials and methods - shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/51359/6/4... · 2018....

Documents