matrix metalloproteinase expression and regulation during ... · matrix metalloproteinase...

Matrix Metalloproteinase Expression and Regulation

During Pregnancy, Term Labour, and Postpartum

by

Tina Tu-Thu Ngoc Nguyen

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Department of Physiology

University of Toronto

© Copyright by Tina Tu-Thu Ngoc Nguyen 2015

ii

Matrix Metalloproteinase Expression and Regulation

During Pregnancy, Term Labour, and Postpartum

Tina Tu-Thu Ngoc Nguyen

Master of Science, 2015

Department of Physiology, University of Toronto

ABSTRACT

It is widely accepted that pregnancy, spontaneous term labour (TL), and postpartum (PP)

involution is associated with changes in the cellular and extracellular composition of the uterus.

These changes involve metalloproteinases (MMPs) secretion by myometrial smooth muscle cells

and infiltrating leukocytes. MMP activation results in collagenolysis, modulation of cellular

behaviour and barrier function. I hypothesize that during late gestation, the expression and activity

of myometrial MMPs and their tissue inhibitors (TIMPs) increase in preparation for TL, and are

regulated by mechanical stretch. The current in vivo study demonstrated that gene and protein

expression of MMP-7 and MMP-11 were upregulated during TL, suggesting labour promotion;

whereas other MMPs (2, 3, 8, 9, 10, 12) were induced only during the early PP period. The sources

of myometrial MMPs during TL and PP include myocytes and resident leukocytes. In vitro studies

did not support the regulation of myometrial MMP expression by mechanical stretch.

iii

ACKNOWLEDGEMENTS

The cherished amount of time spent in the Lye Lab has been both unforgettable and a life-

changing educational experience. Over the years, not only have I developed long-lasting

relationships with colleagues and fellow graduate students on the 6th floor of the Lunenfeld-

Tanenbaum Research Institute, I have received the opportunity to learn valuable research

techniques and expand on my scientific knowledge. I would like to especially thank my research

supervisor Dr. Stephen Lye for giving the opportunity to study as a Master of Science Candidate

in the Lye Lab and for his constant support. I would also like to thank Dr. Oksana Shynlova for

her remarkable guidance and mentorship during my studies and her dedication towards the

completion of my degree. I definitely cannot forget to thank Anna Dorogin for all of her guidance

and technical assistance with sample collection and performing my experiments. I am also grateful

for all the scientific advice, stories, and laughs from all the members of the Lye and Kingdom lab

who have made my Master’s experience an enjoyable one: Ela Matysiak-Zablocki, Bev Bessey,

Richard Maganga, Tali Farine, Melissa Kwan, Bona Kim, Jovian Wat, Dr. Jan Heng, Dr. Lubna

Nadeem, Dr. Mark Kibschull, Dr. Caroline Dunk, Dr. Jianhong Zhang, Dr. Kristin Connor, Tam

Lye, Dora Baczyk, Farshad Ghasemi, Khrystyna Levytska, and Hala Kufaishi. In addition I would

like to thank Richard Bielecki for his assistance with all microscope equipment. Special thanks to

the members of my Supervisory Committee Dr. Stephen Matthews and Dr. Michelle Bendeck for

their insightful comments and guidance to provide direction for my thesis project.

Thank you to my family, especially my mother for all of her hard work to take care of me

throughout my life and during my studies. Also thanks to my friends, particularly those whom I

have met along my scientific journey, and Julien Sallais, for all the love, support and comfort you

all have given me. I hope to make you all proud.

iv

CONTRIBUTORS

The following people contributed to the results presented in this thesis:

Anna Dorogin assisted in tissue collection, immunohistochemical analysis, and in situ

zymography for the bilaterally pregnant rat model.

Tissue collection and RT-qPCR analysis was performed in collaboration with Dr. Oksana

Shynlova with the assistance of Anna Dorogin.

Tali Farine assisted with enzymatic isolation and sample collection for the in vitro model of

mechanical stretch using primary human myometrial cells.

v

TABLE OF CONTENTS

ABSTRACT...................................................................................................................................ii

ACKNOWLEDGEMENTS..........................................................................................................iii

CONTRIBUTORS.........................................................................................................................iv

TABLE OF CONTENTS................................................................................................................v

LIST OF TABLES.......................................................................................................................viii

LIST OF FIGURES........................................................................................................................ix

LIST OF ABBREVIATIONS........................................................................................................xi

CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW

1.1 Overview: Preterm and Term Labour…………………………………………….….........2

1.2 Overview: Postpartum Uterine Involution…………………………………………….…...4

1.3 The Myometrium during Pregnancy, Labour, and Postpartum………………………….5

1.3.1 Myometrial smooth muscle phenotypes during pregnancy…………………………….…....5

1.3.2 Extracellular matrix modifications in the myometrium during pregnancy………….….…...8

1.3.3 Myometrial Inflammation……………………………………………………………….…..9

1.4 Matrix Metalloproteinases…………………………………………….…..........................11

1.4.1 Matrix metalloproteinases as regulators of tissue remodeling……………………………..11

1.4.1.1 Collagenases…………………………………………………………………….14

1.4.1.2 Gelatinases………………………………………………………………………15

1.4.1.3 Stromelysins……………………………………………………………………..16

1.4.1.4 Stromelysin Subgroup: Matrilysin and Metalloelastase…………………………16

1.4.1.5 Regulation of MMP activity: TIMPs…………………………………………….17

1.4.2 Matrix Metalloproteinases as immunoregulatory proteases…………….……….…………19

1.4.2.1 MMPs as modulators of inflammation…………………………………………..19

1.4.2.2 MMPs as modulators of pregnancy and labour…….……………………………20

1.5 Thesis Rationale and Hypothesis…………………………………………….…………….22

1.6 Specific Aims and Objectives…………………………………………….………………...23

1.6.1 Aim 1: To characterize the expression pattern of myometrial MMPs and TIMPs throughout

pregnancy, labour and postpartum……………………………………………………………….23

1.6.2 Aim 2: Investigate the in vivo regulation of MMP and TIMP expression by mechanical

stretch…………………………………………………………………………………………….24

1.6.3 Aim 3: Investigate the in vitro regulation of MMP and TIMP expression by mechanical

stretch…………………………………………………………………………………………….24

vi

CHAPTER 2: MATERIALS AND METHODS

2.2 Rat Gestational Profile of MMP Expression……………………………………………...27 2.2.1 Bilaterally Pregnant Rat Animal Model of Gestation………………………………….…..27

2.2.2 Unilaterally Pregnant Rat Model of Gestation……………………………………………..28

2.2.3 Tissue Collection and Preparation………………………………………………………….28

2.2.4 Real-Time Polymerase Chain Reaction (RT-PCR) Analysis of mRNA expression…….…29

2.2.5. Gelatin Zymography and Western Blot Analysis of Protein Expression ……………….…31

2.2.6 Localization of Myometrial MMPs by immunohistochemistry…………………………….34

2.2.7 Localization of Myometrial MMP expression and activity by in situ zymography…………35

2.2.8 Localization of Leukocyte MMP expression and activity by in situ zymography………….36

2.3 Effect of In Vitro Mechanical Stretch on Human MMP mRNA Expression…………….37 2.3.1 In vitro primary human myometrial cell model of mechanical stretch……………………..37

2.3.2 Assessment of cell viability following in-vitro mechanical stretch experiments…………...38

2.3.3 Characterization of primary human myometrial cells with immunocytochemistry…..……39

2.3.4 Sample collection, preparation and RT-PCR analysis of mRNA expression...…………….40

2.3.5 Analysis of conditioned media for secreted MMPs and TIMPs’ protein expression using a

human MMP 9-plex panel and TIMP 4-plex panel Luminex assay………..……………….…...42

2.3.6 In vitro primary rat myometrial cell model of mechanical stretch………………………….43

2.3.7 Sample collection, preparation and RT-PCR analysis of mRNA expression ….………….44

2.5 Statistical Analysis………………………………………………………………………….45

CHAPTER 3: RESULTS

3.1 Introduction………………………………………………………………………………...47

3.2 Gestational Regulation of MMP Gene Expression in the Rat Myometrium…………….48 3.2.1 Myometrial MMP mRNA expression in the bilaterally pregnant rat model………………..49

3.2.2 Myometrial MMP mRNA expression in the unilaterally pregnant rat model……………...59

3.3 Gestational Regulation of MMP Protein Expression in the Rat Myometrium………….64 3.3.1 Western blot analysis of MMP levels and gelatin zymography of the myometrial tissue

from bilaterally pregnant rats…………………………………………………………………….64

3.3.2 Western blot analysis of MMP levels and gelatin zymography of the myometrial tissue

from unilaterally pregnant rats…………………………………………………………………...70

3.4 Temporal and Spatial Localization of MMPs in the Rat Myometrium………….………74 3.4.1 Tissue localization of MMP in the rat myometrium by immunohistochemistry…………....74

3.4.2 Tissue localization of MMP activity in the rat myometrium by in situ zymography…..……78

3.5 In Vitro Cell Model of Mechanical Stretch…………………..…………………………….85 3.5.1 In vitro primary rat myometrial cell model of mechanical stretch………………………….85

3.5.2 In vitro primary human myometrial cell model of mechanical stretch……………………..86

3.5.3 In vitro mechanical stretch does not influence myometrial MMPs gene expression............89

3.5.4 Secreted myometrial MMPs proteins detected by Luminex assay…………………………93

vii

CHAPTER 4: DISCUSSION

4.1 Gestational Regulation of MMP Gene and Protein Expression in the Rat

Myometrium................................................................................................................................96 4.1.1 The Role of MMPs during Gestation, Term Labour, and Postpartum Involution……….….96

4.1.2 The Role of MMPs in Uterine Inflammation: Mutual Regulation………….………….….104

4.1.3 Regulation of Myometrial MMP Expression: Potential Mechanisms…………….....….…106

4.2 Changes of Myometrial MMPs Are Not an Effect of Mechanical Stretch (In Vitro

Primary Cell Model) ................................................................................................................108

4.3 Conclusion: Proposed Model for the Role of Myometrial MMPs During Late

Gestation, Term Labour, and Postpartum Involution…………………………………..…109

CHAPTER 5: FUTURE DIRECTIONS

5.1 Future Directions.................................................................................................................112

REFERENCES....................................................................................................................115

viii

LIST OF TABLES

CHAPTER 2

Table 2.1 Primer pair information for Rat (Rattus Norvegicus) genes examined using RT-PCR..30

Table 2.2 Information of antibodies used for Rat-specific experiments………………………….33

Table 2.3 Information of antibodies used for immunocytochemistry……..…………….……….40

Table 2.4 Primer pair information for Human (Homo sapien) genes examined using RT-PCR....41

ix

LIST OF FIGURES

CHAPTER 1

Figure 1.1 Myometrial SMC phenotypes during pregnancy, labour and postpartum…………...…7

CHAPTER 3

Figure 3.1: Gestational expression of Gelatinases’ mRNA in bilaterally pregnant, laboring and

postpartum (PP) rat myometrium………………………………….…………………………….51

Figure 3.2: Gestational expression of Collagenases’ mRNA in bilaterally pregnant, laboring and

postpartum rat myometrium………………………………………………………………….….52

Figure 3.3: Gestational expression of Stromelysins’ mRNA in bilaterally pregnant, laboring and


Figure 3.4: Gestational expression of Matrilysin (MMP7) and Macrophage Metalloelastase’s

(MMP12) mRNA in bilaterally pregnant, laboring and postpartum rat myometrium…………..54

Figure 3.5: Gestational expression of TIMP mRNA in bilaterally pregnant, laboring and


Figure 3.6 Comparative characteristics of MMP and TIMP gene expression in the pregnant, term

labour, and postpartum rat myometrium……………………………………………………..56-57

Figure 3.7: Expression of Gelatinases MMP-2 and MMP-9 genes in the myometrium of

unilaterally pregnant rats during gestation, term labour and postpartum….………….………….60

Figure 3.8: Expression of Stromelysins MMP-3, MMP-10, and MMP-11 genes in the

myometrium of unilaterally pregnant rats during gestation, term labour and postpartum……….61

Figure 3.9: Expression of Collagenase (MMP-8), Matrilysin (MMP-7) and Metalloelastase

(MMP-12) genes in the myometrium of unilaterally pregnant rats during gestation, term labour

and postpartum………………………………………………………………….……………….62

Figure 3.10: Protein levels of Collagenase MMP-8 in the rat myometrium throughout gestation,

labour and postpartum………………………………………………………………….………..65

Figure 3.11: Protein levels of Stromelysins in the rat myometrium throughout gestation, labour

and postpartum………………………………………………………………….……………….66

Figure 3.12: Protein levels of Matrilysin and Metalloelastase in rat myometrium throughout

gestation, labour and postpartum…………………………………………………………….......67

Figure 3.13: Representative Gelatin Zymography and Densitometric analysis………………….69

Figure 3.14: Protein levels of Matrilysin and Macrophage Metalloelastase in the unilaterally

pregnant rat myometrium throughout gestation, labour and post-partum………………………..72

x

Figure 3.15: Representative Gelatin Zymography and Densitometric analysis………………….73

Figure 3.16: Temporal and spatial localization of MMP-7 in pregnant, labouring and postpartum

rat uterus…………………………………………………………………………………............75


rat uterus…………………………………………...…………………………….………………76


rat uterus…………………………………………...…………………………….………………77

Figure 3.19: Representative images for in situ zymography using fluorescent MMP substrates:

DQ gelatin (second column), DQ collagen type I (third column) and DQ collagen type IV (right

column) for tissue localization of MMP activity………………………………………………...79

Figure 3.20: Gelatinase activity of rat myometrium and tissue leukocytes during late gestation

(GD21, 22), term labour (D23) and post-partum (1PP) ….………………………...……………81

Figure 3.21: Representative images from in situ gelatin zymography and CD68

immunofluorescence….………………………...……………………………………………….82

Figure 3.22: Representative images from in situ collagen I zymography and CD68


Figure 3.23: Representative images from in situ collagen IV zymography and CD68


Figure 3.24: Representative immunocytochemical fluorescent images of primary human

myometrial cells at passage 0, 2 and 4….………………………...……………………………..86

Figure 3.25: Representative images from assessment of cell viability following mechanical stretch

of primary human myometrial cells……………………………………………………………...88

Figure 3.26: Expression changes in mRNA levels of MMPs as an effect of in vitro static

mechanical stretch of primary human myometrial cells…………………………………………90



Figure 3.28: Expression changes in mRNA levels of TIMPs as an effect of in vitro static


Figure 3.29: Changes in MMP and TIMP protein secretion primary human myometrial cells as an

effect of in vitro mechanical stretch……………………………………………………………...94

CHAPTER 4

Figure 4.1. Evidence-based model for the role of myometrial MMPs during labour and postpartum

involution………………………………………………………………………………………111

xi

LIST OF ABBREVIATIONS

BM Basement Membrane

BSA Bovine Serum Albumin

CAP Contraction-Associated Protein

CBD Collagen Binding Domain

CCL C-C (motif) Chemokine Ligand

CM Circular Muscle Layer

CXCL C-X-C (motif) Chemokine Ligand

ddH2O Double Deionized Water

DMEM Dulbecco’s Modified Eagle Medium

EC Endothelial Cell

ECM Extracellular Matrix

EDTA Ethylenediaminetetraacetic acid

EtOH Ethanol

FBS Fetal Bovine Serum

FDA Fluorescein Diacetate

GD Gestational Day

HBSS++ Hank’s Buffered Salt Solution (with Calcium and Magnesium)

HBSS-- Hank’s Buffered Salt Solution (without Calcium and Magnesium)

HRP Horseradish Peroxidase

ICC Immunofluorescent Cytochemistry

IF Immunofluorescence

IGF Insulin-like Growth Factor

IGFR Insulin-like Growth Factor Receptor

IHC Immunohistochemistry

IL Interleukin

ITS-A Insulin-Transferrin-Selenium-Sodium Pyruvate Supplement

LM Longitudinal Muscle Layer

MMP Matrix Metalloproteinase

NE Neutrophil Elastase

NSM Non-Stretch-Conditioned Media

NBF Neutral buffered formalin

xii

P4 Progesterone

PBS Dulbecco’s Phosphate-Buffered Saline (without Calcium and Magnesium)

PBS-T Phosphate-Buffered Saline with Tween-20

PDGF-A Platelet-Derived Growth Factor Alpha

PFA Paraformaldehyde

PI Propidium Iodide

PP Postpartum

PPIA Peptidylprolyl Isomerase A (Cyclophilin A)

PTL Preterm Labour

RT Room temperature

RT-qPCR Real Time Quantitative Polymerase Chain Reaction

SCM Stretch-Conditioned Media

SDS Sodium Dodecyl Sulfate

SEM Standard Error of the Mean

SMA Smooth Muscle Actin

SMC Smooth Muscle Cell

TBP TATA Box-binding Protein

TBS-T Tris Buffer Solution with 0.02% Tween-20

TGF-β Transforming Growth Factor-Beta

TIMP Tissue Inhibitor of Metalloproteinases

TNF-α Tumor Necrosis Factor-Alpha

TL Term Labour

WB Western Blot Analysis

ZBF Zinc-Buffered Fixative

1

CHAPTER 1

INTRODUCTION AND LITERATURE REVIEW

Chapter 1: Introduction and Literature Review

2

1.1 Overview: Preterm and Term Labour

Preterm labour (PTL) refers to premature delivery before 37 weeks of gestation [1]. PTL

is a significant clinical problem for modern obstetricians because it occurs in 5-18% of all

pregnancies and is a major contributor of perinatal mortality (70%) and morbidity (75%). Preterm

infants are also 40 times more likely to die than term infants, and are at an increased risk of

developing cerebral palsy, blindness, deafness and respiratory illness [1-6]. However, it is difficult

to define the exact causes of spontaneous PTL as many factors – such as uterine infection,

premature rupture of membranes (PROM), and chronic chorioamnionitis – can contribute to the

early onset of labour [7, 8]. Several studies suggest that normal term labour (TL) in humans is an

inflammatory process and infection/inflammation has been seen as one of the contributing factors

of PTL [9-12].

TL is a highly orchestrated process involving coordinated events in multiple tissues, which

include the myometrium, decidua, fetal membranes, and cervix [13]. However past attention was

mainly given to study the mechanisms that regulate the myometrium and the cervix in preparation

for labour [9, 14]. Nearing the end of pregnancy, the cervix begins to soften and dilate, while the

myometrium progresses to a contractile phenotype. Interestingly, both of these coordinated

changes are associated with remodeling of the tissue environment, and are regulated by the

endocrine and immune systems [14-17]. Current knowledge pertaining to the underlying

mechanisms that regulate pregnancy associates pro-inflammatory pathways with the switch

between myometrial quiescence and myometrial activation [18]. Particularly during pregnancy,

myometrial quiescence is maintained – primarily by increased levels of circulating progesterone

– until the switch to a contractile phenotype is required for labour initiation. Progesterone receptor

signaling suppresses the expression of pro-inflammatory mediators such as chemokine CCL2,


3

(the major chemoattractant for monocytes), contraction-associated proteins (CAPs) such as

connexin-43 (Cx43), and prostaglandin receptors (PGRs) [14, 19-23].

Inflammatory responses, which include leukocyte infiltration into uterine tissues, can

spontaneously initiate processes like cervical ripening, rupture of fetal membranes, decidual and

myometrial activation. Numerous studies have reported not only increases in pro-inflammatory

mediators, but especially the influx of macrophages and neutrophils into several uterine

compartments before and during TL [6, 10, 11, 16, 24-26]. Additionally, intrauterine infections

can lead to PTL, suggesting a possible causality link between inflammation and spontaneous PTL

[13, 27]. Hamilton et al. further confirmed this link, through their report of macrophages in the

human and rat decidua – the pregnant endometrial layer acting as the fetal-maternal interphase –

during TL and PTL, also providing evidence to suggest decidual inflammation precedes labour

[26]. Interestingly, Shynlova et al. observed several differences regarding leukocyte infiltration

in the myometrium and decidua between PTL and TL. During TL macrophage infiltration

precedes neutrophil infiltration, whereas neutrophil infiltration specifically increased during

infection-induced PTL and remained elevated PP [20, 28]. These findings indicate that

particularly the myometrium, decidua, and cervix are immunoregulatory tissues capable of

recruiting peripheral leukocytes through the release of different inflammatory mediators. The

discovery that uterine inflammation is associated with labour onset suggests that targeting these

inflammatory pathways or pro-inflammatory mediators could represent a potential approach to

prevent PTL. Thus further investigation into the underlying mechanisms that regulate the

labouring process may reveal more specific targets to efficiently address spontaneous PTL.


4

1.2 Overview: Postpartum Uterine Involution

Following parturition and shedding of the placenta, the uterus undergoes drastic

physiological tissue alterations similar to wound healing, with the aim to return to a pre-pregnant

state (ready for future pregnancies). This process is termed postpartum (PP) uterine involution,

which involves rapid and extensive remodeling of the extracellular matrix (ECM), resulting in a

dramatic reduction (at least 10-fold) in the size of the uterus in the PP period [17, 29-32]. The

myometrium is the main component that undergoes reversible modification to accommodate the

enlarged uterus during pregnancy, making it one of the primary sites of tissue rearrangement

during uterine involution. This myometrial transition includes a reduction in number and size of

the smooth muscles cells (SMCs), along with degradation of ECM components – especially the

collagen and elastin deposited during pregnancy [29, 33-36]. Nishinaka et al. have reported the

presence of myofibroblastic interstitial cells surrounding myometrial SMCs during the PP period

for removal of degraded collagen and elastic fibers by macrophage phagocytosis [34].

Additionally Hsu et al. observed increased myometrial autophagy – degradation of cytoplasmic

organelles using lysosomal machinery – was associated with reduction in SMC size [33].

Shynlova et al. also detected an increase in the expression of genes encoding insulin-like growth

factor (IGF)-1, IGF binding protein (BP)-5 and IGF-1 receptor (IGF1R), associated with

regeneration of uterine tissues [37]. These findings indicate that the uterine smooth muscle

undergoes physiological adaptations and phenotypic differentiation during pregnancy and is

followed by tissue regeneration during the involution phase.

PP involution is a complex biological process involving interactions between a variety of

cells – including fibroblasts, myofibroblasts, SMCs and immune cells – and is mediated by

hormones, growth factors, cytokines and chemokines [29]. In concordance, Shynlova et al.


5

detected high levels of macrophage infiltration during the PP period localized to the endometrium-

myometrium junction and this influx was tightly regulated by a group of chemokines including

CCL2 [22, 38]. Interestingly, chemokines released by myometrial cells not only recruit peripheral

leukocytes, but can also induce cellular proliferation, differentiation, apoptosis, and angiogenesis

– all biological processes necessary for uterine tissue rearrangement during involution [29, 39].

These findings suggest that the maternal immune system not only regulates TL but also regulates

PP uterine involution [20, 40].

1.3 The Myometrium during Pregnancy, Labour and Postpartum

1.3.1 Myometrial smooth muscle phenotypes during pregnancy

In the rodent, the myometrium is organized into two main layers: 1) the outer longitudinal

muscle layer that is oriented along the axis of the uterine horn, and 2) the sub-endometrial circular

muscle layer that is perpendicular to the uterine axis [41, 42]. The outer layer has especially been

seen to be actively associated with parturition, which suggests its primary involvement in

myometrial contractility [43, 44]. SMCs make up approximately half of the cells in the

myometrium, and are known to self-secrete basement membrane (BM) components that

encapsulate and surround each individual SMC [45-47]. These uterine SMCs physiologically

adapt to pregnancy and undergo, near term, a drastic transition from a fairly quiescent state to an

activated contractile state. In particular, the sequential phenotypic transition has been described

as follows: 1) the early proliferative phase is characterized by upregulated IGF-1 and anti-

apoptotic Bcl-2 signaling (SMC hyperplasia); 2) an intermediate synthetic phase, involving

increase in cell size (SMC hypertrophy) and induction of interstitial matrix synthesis; 3) a late

contractile phase fully committed to labour involving SMCs working as a syncytium due to Cx43


6

induction, with increased expression of contractile machinery proteins, and 4) PP involution

following parturition, which returns the myometrium back to a pre-pregnant state (Figure 1.1)

[29, 35, 48-50].

This phenotypic switch to the contractile/labour phase involves expression of well-studied

pro-inflammatory mediators and CAPs [19, 21, 22]. Several studies have addressed the

upregulated expression of CAPs, such as the gap junction protein Cx43 and PGRs, within the

myometrium to promote labour [21, 51, 52]. These protein changes not only are necessary to

increase SMC excitability and connectivity, but also to promote myometrial contractility [21, 51,

52]. Moreover, these myometrial changes are regulated by both hormonal (estrogen and

progesterone) and mechanical stimuli associated with late gestation [29, 49, 53]. These findings

advocate the importance of myometrial activation in labour initiation and further elucidation of

the underlying mechanisms will assist in developing new therapies for PTL.


7

Figure 1.1 Myometrial SMC phenotypes during pregnancy, labour and postpartum. The myometrial SMCs undergo a programmed transition between distinct phenotypes that

include: 1) an early proliferative phase associated with SMC hyperplasia; 2) an intermediate

synthetic phase involving SMC hypertrophy; 3) a late contractile phenotype associated with the

upregulation of CAPs that will commit SMCs to synchronous labour contractions; and 4) a

phase of postpartum involution involving expression of genes associated with wound repair, cell

apoptosis, ECM remodeling, and tissue regeneration, which allows the uterus to resume a pre-

pregnant state. Reproduced with permission from Shynlova et al.[29].


8

1.3.2 Extracellular matrix modifications in the myometrium during pregnancy

The ECM is an important component of all tissues, providing a stable three-dimensional

environment for the growth and function of parenchymal cells. The ECM is a non-cellular

structure that has a unique tissue-specific composition to support biological function and

encompasses both cellular – fibroblasts that secrete matrix proteins – and non-cellular components

[54, 55]. The ECM can be further divided into two types, the interstitial connective tissue matrix

that provides structural support for tissues, and the basal lamina – secreted by epithelial cells and

separates them from the surrounding stroma [54]. Mammalian ECM is composed of

approximately 300 proteins (the core matrisome) and includes the structural proteins fibrillar

collagens (type I, II and III collagen) and elastin, substrate adhesion molecules: fibronectin,

laminin and collagen IV, as well as numerous glycoproteins, and proteoglycans. Additionally, the

components of the ECM constantly interact with their integrin cell-surface receptors to regulate

and maintain tissue integrity [35, 54]. The ECM is also constantly remodeled to maintain tissue

homeostasis – such as cell proliferation, apoptosis or differentiation [56].

It is well understood that extensive remodeling of the uterine ECM throughout the course

of pregnancy transpires to accommodate fetal growth and promote the SMC transition from a

quiescent to a contractile phenotype (Figure 1.1) [35, 57-59]. One of the early reports of

myometrial remodeling by Granstrom et al., reported extensive collagenolytic activity in the

uterine body – similar to the cervical ripening process – following the onset of labour [60]. The

myometrium particularly exhibits changes in the expression of ECM components as a result of

hormonal and mechanical stimuli throughout pregnancy [35]. Garfield and Hayashi suggested that

the degradation of the myometrial ECM facilitates the formation of gap junctions between SMCs

to increase cellular connectivity for coordinated uterine contractions [61]. It is indicative that


9

activation of myometrial ECM remodeling is also an essential physiological process to maintain

synchronized labour contractions.

Interestingly, changes in gene and protein expression of myometrial ECM components

can be induced by biological mechanical stretch of the uterus in vivo using a well-established

unilaterally pregnant rat model of gestation. Shynlova et al. reported significant alterations in the

expression of multiple myometrial ECM genes, specifically a coordinated decrease in gene

expression of fibrillar proteins (i.e. type I collagen) and an increase in elastin, fibronectin and BM

proteins (laminin, and collagen IV) towards term in rats [35]. This model provided evidence that

ECM modifications can be stretch-regulated, specifically in the gravid (pregnant) uterine horn to

accommodate the growing fetus/es, placenta and amniotic fluid, whereas the ECM in the empty

horn is not influenced by mechanical stimuli [17, 35]. It was suggested that remodeling of the

ECM increases elasticity of the uterus, and supports the change in SMC phenotype in preparation

for labour contractions by restoring the BM surrounding individual SMCs [35]. These findings

were consistent with the immunohistochemical results from Nishinaka et al. that suggested the

BM of individuals SMCs are structurally modified during late gestation to support labour

contractions [34]. The organized structures of BM and focal adhesion proteins during TL further

confirmed that stretched-induced modification of ECM provides cell-matrix stability for optimal

labour contractions [47].

1.3.3 Myometrial inflammation

Several studies have investigated the role of immune cells and inflammatory mediators

contributing to events preceding TL and PTL [10, 11, 62]. For instance, the mRNA and protein

expression level of certain pro-inflammatory cytokines and chemokines were elevated before,


10

during, and immediately after TL in reproductive tissues [11, 17, 20, 28]. In particular, Thomson

et al. first reported the predominant presence of neutrophils and macrophages accumulating in the

human myometrium during spontaneous TL [10]. Osman et al. further reported increased

expression of IL-1β, IL-6, and IL-8, and similar infiltration of macrophages and neutrophils, in

the myometrium and cervix [11]. Our lab also recently reported that macrophage and neutrophil

populations were increased in parallel with pro-inflammatory cytokine induction in the mouse

myometrium and decidua during TL, which further increased during the early PP period [20, 28].

It is well understood that activated leukocytes further amplify the inflammatory signal via

additional secretion of cytokines – such as IL-1β, IL-6, and TNF-α – in the targeted reproductive

tissue during late gestation and TL [63]. The pro-inflammatory state that develops in reproductive

tissues (i.e. in the myometrium) as a result of the increased inflammatory mediators, has been

widely accepted to be essential for the induction of labour – for instance IL-1β can upregulate

prostaglandin production [6, 11, 16, 24-26, 62]. Since PGRs are constantly expressed in the

myometrium, the cytokine-mediated upregulation of prostaglandin production would directly

promote myometrial contractions.

Interestingly, it was observed that the expression of Monocyte Chemoattractant Protein-1

(MCP-1, also known as CCL2), a chemokine involved in macrophage migration, was significantly

upregulated in the pre-partum rat myometrium due to mechanical stretch from the growing fetus

and was inhibited by progesterone signaling [22]. MCP-1 expression was also associated with the

infiltration of macrophages into the term rat myometrium. This study links endocrine and

mechanical signalling to the regulation of leukocyte infiltration by inflammatory mediators and

labour induction. Lee et al. recently demonstrated that cytokines produced by mechanically

stretched human myometrial SMCs were able to upregulate the expression of cell adhesion

molecules (such as ICAM-1, major ligand for leukocyte integrin LFA-1) on endothelial cells


11

(ECs), and promoted leukocyte transendothelial migration [64]. These results collectively show a

potential association between the increase in uterine inflammatory mediators as a result of

mechanical stretch of the myometrium, leukocyte infiltration and the induction of labour [20, 28,

64]. However, the exact molecular mechanism that regulates the influx of leukocytes into uterine

tissue following cell adhesion requires further investigation [17, 20, 28].

1.4 Matrix Metalloproteinases

1.4.1 Matrix Metalloproteinases as regulators of tissue remodeling

Apart from ECM proteins and inflammatory mediators, the application of defined

mechanical stimuli to different types of cells has been shown to influence gene expression and

protein synthesis of a group of zinc-containing endopeptidases capable of degrading ECM

proteins, known as matrix metalloproteinases (MMPs). All MMPs are grouped based on substrate

preference or the organization of their domain constituents, such as collagenases (MMP-1, 8, 13),

gelatinases (MMP-2 and 9), and stromelysins (MMP-3, 10, 11). However all MMPs contain a

common sequence motif His-Glu-X-Gly-His-X-X-Gly-X-X-His within their catalytic site, where

the three His residues coordinate the catalytic zinc ion (Zn2+) [65]. MMPs are either secreted (as

pro- or active enzymes) or anchored to the cell surface and their physiological substrates include

ECM components (i.e. collagen, proteoglycans, fibronectin, and laminin), as well as non-matrix

proteins (i.e. cytokines, chemokines, receptors and antimicrobial peptides) [66-69].

The majority of MMPs are secreted with a self-inhibitory pro-domain upstream of the

catalytic domain, and contain a conserved Cys residue that interacts with Zn2+ in the active site to

inhibit catalytic activity. The pro-domain requires either proteolytic removal or oxidative

modification of the thiol group for protease activation [54, 65, 69]. The expression and activity


12

level of MMPs was first believed to be regulated in two ways: 1) physiologically, by a group of

proteins called Tissue Inhibitors of MMPs (TIMPs) and 2) by the α2-macroglobulin. TIMPs form

non-covalent 1:1 complexes with MMPs and either inhibit or promote the enzymatic activity of

MMPs; whereas α2-macroglobulin acts as a general proteinase inhibitor and regulates MMPs

activity by entrapping them and leading the macroglobulin-MMP complex to be cleared by

receptor-mediated endocytosis [68]. Now it is recognized that MMP gene expression can be

regulated by several factors including cell-receptor signaling, growth factors, and cytokines [31,

70, 71]. Recently, a major extracellular MMP inducer, called EMMPRIN has been characterized.

EMMPRIN is a member of the Ig superfamily that includes T cell receptors, major

histocompatibility complex (MHC) antigens, and neural cell adhesion molecules. It was first

identified as a tumor cell-surface molecule capable of stimulating collagenase expression by

fibroblasts however Braudmeier et al. have shown that EMMPRIN treatment of human uterine

fibroblasts also resulted in stimulation of MMP-1 and MMP-2 expression [72]. Interactions

between cell-surface integrin receptors with ECM ligands such as collagen and fibronectin can

also induce MMP expression to reorganize the ECM [73, 74].

Typically, MMPs are not actively expressed in healthy tissues, but they can be detected in

all diseased, inflamed, or injured tissues [75, 76]. MMPs can be produced and secreted by a variety

of cells within the tissue that undergoes remodeling, which include fibroblasts, epithelial and

endothelial cells [54, 76]. Once activated, MMPs initiates ECM remodeling primarily by cleavage

of ECM components to modulate composition and structure, but can also release any biological

molecules (i.e. growth factors) bound to ECM components [54]. Several studies investigating the

phenotypes of MMP-null mice have deduced that MMPs are not only important for regulation of

physiological processes including wound healing, ovulation, implantation, angiogenesis, and

embryogenesis via remodeling of the ECM architecture, but also are capable of regulating cellular


13

behaviour – such as promoting cellular migration and increasing permeability between cell-cell

junctions [77-80]. For instance, MMPs can promote angiogenesis by degrading the vascular BM

to allow ECs to invade the surrounding tissue, releasing ECM-bound angiogenic growth factors

like VEGF, and by cleaving cell-cell adhesion molecules between ECs [79]. Interestingly,

activated leukocytes infiltrating reproductive tissues also produce several MMPs and TIMPs,

supporting the role of MMPs in regulating inflammation and reproductive function [10].

As previously mentioned, since MMPs are involved in a variety of physiological

processes, their expression must be highly regulated to maintain tissue-specific activity. MMP

synthesis and activation can be regulated for both tissue-specific remodeling (i.e. isolated wound

healing) and differential expression of specific MMPs can be required for certain functions (i.e.

MMP-9 is essential for embryo implantation) [71, 74, 81, 82]. Conversely, failure to maintain

MMP homeostasis leads to excess MMP activity and uncontrolled proteolysis, which has been

associated with impaired barrier function and several diseases – autoimmune, cardiovascular

diseases, and cancer [83]. As MMPs are synthesized and secreted as zymogens, physiological

activation becomes a checkpoint for their regulation. Plasmin, urokinase type plasminogen

activator (uPA) and tissue type plasminogen activator (tPA) have been previously implicated in

MMP activation [84]. Pro-inflammatory cytokines IL-1β and TNF-α have been shown to induce

MMP expression in numerous tissues, while progesterone and TGF-β can suppress MMP

expression [71, 85]. As was previously mentioned, the principal method of MMP regulation is

physical inhibition by TIMPs or inactivation through proteolytic degradation (by other proteases),

and/or physical clearance by α2-macroglobulin [74, 77, 81]. Furthermore, TGF-β has been shown

to induce TIMP-1 production by endometrial stromal cells to further inhibit MMP activity [71,

86]. Graham et al. have also demonstrated that TGF-β regulates MMP expression in first trimester


14

trophoblasts by up-regulating TIMP-1 and TIMP-2 and down-regulating plasminogen activator

expression [87].

1.4.1.1 Collagenases

One of the major class of MMPs is the collagenases, named based on their preference to

enzymatically process fibrillar collagens for collagenolysis. This class is comprised of MMP-1

(fibroblast collagenase), MMP-8 (neutrophil collagenase) and MMP-13 (collagenase-3). The

collagenases share a similar structural organization of their domains that contains a pro-peptide

domain at the N-terminus, catalytic domain, a linking hinge region, and a hemopexin-like domain

at the C-terminus [76, 80]. For collagenases, the hinge region coordinates the interaction between

the catalytic region and the hemopexin-like domain [88]. This interaction is important for

substrate recognition and positioning, necessary for their primary physiological role in remodeling

of the collagenous components of the ECM [49, 89]. Interestingly, collagenases are able to cleave

collagen molecules without unwinding the triple helical structure of their substrate.

Although they can cleave all fibrillar collagens, MMP-1 preferentially targets type III

collagen, MMP-8 prefers type I collagen, and MMP-13 prefers type II collagen [76]. Furthermore,

besides efficient degradation of collagens, the collagenases also cleave a wide variety of non-

collagenous substrates, such as aggrecan, chemokines, and IGFs [76, 90]. The collagenases have

been previously shown to regulate reproductive function. Specifically, MMP-1 has been

associated with the breakdown of the stromal components of the uterine endometrial lining during

menstruation [30]. In addition, since collagen I makes up a large portion of the uterine ECM it

was suggested that collagenases may play a role in remodeling of uterine tissues during gestation

to accommodate the growing fetus [35]. It is also feasible to speculate that collagenases may


15

become important participants during the PP uterine involution when this organ undergoes

extensive remodeling to return to its pre-pregnant state [91].

1.4.1.2 Gelatinases

The gelatinases encompass MMP-2 (gelatinase A) and MMP-9 (gelatinase B), and are

defined as such based on their affinity for denatured collagen (i.e. gelatin) [76]. What makes the

gelatinases structurally different from the collagenases is the additional presence of a collagen

binding domain (CBD), comprised of three type II fibronectin-like repeating elements inserted

into the catalytic domain [80, 81, 92]. The CBD is the main domain for substrate recognition for

MMP-2, and is essential for specific binding and positioning of substrates to the catalytic site for

both gelatinases [76, 93, 94]. The mechanism of MMP-2 activation has been defined in detail,

where one proposed model involves the interaction with TIMP-2 and the membrane-bound MT1-

MMP (MMP-14) for removal of the pro-peptide [95, 96]. On the other hand, removal of the pro-

peptide for MMP-9 activation can be exerted by several soluble MMPs, such as MMP-2, 3 & 7

and other proteases [94, 97].

Apart from gelatin degradation, the gelatinases also have an affinity for components of the

BM, intercellular gap junctions (i.e. occludin), cytokines (i.e. IL-1β), growth factors (i.e. pro-

TNFα) and ECM receptors (i.e. integrins) [66, 76, 78, 81, 98]. The expression of MMP-2&9 has

been highly associated with reproductive tissues, during ovulation and implantation, making them

key players in maintaining reproductive function as well as tissue remodeling within reproductive

organs [30, 71, 99, 100]. Their affinity for denatured collagen and degradation of ECM

components also supports their role in PP involution.


16

1.4.1.3 Stromelysins

This class comprises of the three stromelysins MMP-3 (stromelysin-1), MMP-10

(stromelysin-2) and MMP-11 (stromelysin-3), all of which are capable of degrading a wide range

of ECM proteins including gelatin, fibronectin, and BM component laminin, with the exception

of collagen I [76, 101, 102]. The stromelysins, however, can cleave other collagens (with varying

affinities) such as components of the BM (i.e. collagen type IV), and MMP-3 can efficiently

activate other pro-MMPs, such as pro-MMP-1 [69, 76, 102]. The stromelysins also play a role in

the activation or inactivation of non-ECM proteins such as cytokines (i.e. TNF-α precursor and

IL-1β) and growth factors (i.e. EGF) [76].

MMP-3 & 10 are structurally similar and contain a pro-peptide domain, a catalytic domain,

and a C-terminal hemopexin-like domain responsible for substrate recognition. These two

stromelysins share substrate specificity; however, MMP-3 has a higher affinity and proteolytic

efficiency than MMP-10 [30, 69, 76, 80]. Whereas MMP-11 is structurally different, containing

a motif for intracellular activation by furin (and other furin-like proteases) within the Golgi and

is secreted extracellularly in its active form [76, 103]. Importantly, all stromelysins, especially

MMP-3 &11 have been shown to be highly associated with reproductive tissues such as the uterus

(during menstruation, implantation, pregnancy, labour and PP), placenta and involuting mammary

gland [30, 76].

1.4.1.4 Stromelysin subgroup: Matrilysin and Metalloelastase

MMP-7 (matrilysin) and MMP-12 (macrophage metalloelastase) are two MMPs often

classified in the stromelysin subgroup as they share similarities with MMP-11. MMP-7 was first

described as putative uterine metalloprotease-1 (PUMP-1) but now is generally referred to as

matrilysin. MMP-7 structurally is the smallest MMP as it only contains the pro-peptide and


17

catalytic domain, while MMP-12 contains the additional hinge region and hemopexin domain (for

substrate binding and recognition) [76]. Like the stromelysins, MMP-7&12 can cleave a wide

variety of ECM substrates such as collagen I&IV, gelatin, elastin, fibronectin and laminin, and

have an affinity towards non-ECM proteins like cytokines (i.e. pro-TNF-α) and able to activate

other pro-MMPs [69, 76, 78]. In addition, MMP-7 can also cleave cell-surface junctional

molecules (i.e. VE-cadherin) to modulate tissue permeability [104, 105].

The broad range of substrates supports the notion that MMP-7&12’s main biological

function is to remodel the ECM, regulate immune function and promote immune cell recruitment

and migration [30, 76, 78]. MMP-7 is expressed in a variety of tissues and has been seen to be

associated with reproductive tissues, especially in the uterus during the menstrual cycle,

implantation, labour and PP period [30, 99, 106]. MMP-12 is essential for leukocyte

transmigration into tissues, where knock-out of MMP-12 expression led to restricted macrophage

infiltration [78]. These correlations suggest that MMP-7&12 may play a role in regulating tissue

remodeling and inflammation within the uterus.

1.4.1.5 Regulation of MMP activity: TIMPs

The TIMPs (TIMP-1-4) are one of the endogenous forms of MMP broad spectrum

regulation/inhibition factors that bind to MMPs in a 1:1 stoichiometric configuration, and like

MMPs, are regulated in response to the need for tissue remodeling [69, 107, 108]. TIMPs are

structurally comprised of two domains, the N- and C-terminus; the N-terminal domain can fold

into a separate unit and independently inhibit MMPs [107, 108]. TIMPs normally form complexes

with pro-MMPs via the interactions of their C-terminal domains with the MMP’s hemopexin

domain, and since this does not involve the N-terminal domain, these complexes can further

interact with a second MMP [108]. Although the four TIMPs share sequential similarities, their


18

differences confer specificity such that certain TIMPs have higher affinities for certain MMPs,

which affects their biological function [69, 107, 108]. For instance, TIMP-1 has a more restricted

inhibitory range compared to TIMP-2-4, particularly for membrane-type (MT) MMPs, but

strongly inhibits MMP-3&7 [108, 109]. TIMP-2 plays an important role in the recruitment and

cell-surface activation of pro-MMP-2 via MT1-MMP, while TIMP-1 cannot bind to pro-MMP-2,

but instead can form an inhibitory complex with MMP-3 or pro and active MMP-9 [95, 110, 111].

TIMP-4 can also form a complex with MT1-MMP and pro-MMP-2 however, this does not lead

to its activation but rather inhibits the action of MT1-MMP [112]. Interestingly, TIMP-2 and pro-

MMP-2 can form a large inhibitor of MMP (LIMP) complex that can additionally inhibit MMP-

2, the collagenases, and stromelysins [113]. Unlike the other TIMPs that are primarily soluble and

remain diffused within tissues, TIMP-3 is also tightly bound to the ECM through its C-terminal

domain [109].

In addition to MMP inhibition or activation, TIMPs can have various other biological

functions including regulation of cell proliferation and migration, and be involved in angiogenic

and apoptotic pathways. For example, TIMP-3 has been observed to have pro-apoptotic functions

whereas, TIMP-1, 2&4 are anti-apoptotic [69, 109, 114-117]. TIMP regulation of cell signaling

to promote the aforementioned processes can be either MMP-dependent, such as TIMP-1

inhibition of MMP-mediated degradation of IGF binding protein-3 (IGFBP-3), or can be through

direct interactions with specific cell-surface receptors (i.e. CD63) or cell-surface integrins (i.e. α3

and β1 subunits) [109, 118]. However, it has been shown that TIMPs can either promote cell

growth and survival, inhibit cell death or cell growth depending on the cell types and downstream

effectors involved [109].


19

1.4.2 Matrix Metalloproteinases as immunoregulatory proteases

1.4.2.1 MMPs as modulators of inflammation

The involvement of MMPs in inflammatory processes has suggested their potential role

to modulate leukocyte influx into inflamed tissues. For instance, in a mouse model for

autoimmune skin blistering disease, MMP-9-null mice exhibited decreased neutrophil recruitment

due to the lack of α1-proteinase inhibitor inactivation by MMP-9, which results in deficiency of

neutrophil elastase (NE) function [119]. MMPs can also regulate the activity of cytokines and

chemokines, and the formation of chemotactic gradients to affect the movement of leukocytes by

being either pro-inflammatory – by activation of IL-1β and TNF-α – or anti-inflammatory –

MMP-3 can degrade active IL-1β [120-123]. Several studies have shown that specific MMPs

regulate chemotactic gradients by direct cleavage of chemokines or indirectly by cleaving

ECM/non-ECM molecules that bind to chemokines at certain locations. For instance, Li et al.

have observed MMP-7 is able to regulate the trans-epithelial efflux of neutrophils by shedding

syndecan-1 bound to chemokine CXCL1 (KC) in the lung [124]. MMP-2-mediated cleavage of

macrophage-derived CCL7 (MCP-3) leads to the formation of antagonistic peptides of the CC

chemokine receptor [122]. MMP-9 and MMP-8 can cleave and activate CXCL8 (IL-8) and LIX

(mouse equivalent of human CXCL5&6), respectively. However, proteolytic processing by

MMP-9 inactivates CXCL1 and CXCL4. This provides evidence that MMPs can both amplify or

reduce inflammatory signals, specifically affecting leukocyte recruitment by mediating the

change in the bioavailability of local chemokines [125-128]. Processing/activating of these

inflammatory mediators suggest that in addition to tissue remodeling, MMPs are involved in the

labour process by regulating leukocyte infiltration into the uterus.

Leukocytes can follow two pathways of migration: 1) transcellular (through the

cytoplasm) or 2) paracellular (in between ECs) [129, 130]. Several studies have indicated


20

leukocyte infiltration into tissues is associated with regulated modifications to increase junctional

permeability while preserving endothelial barrier function [131, 132]. Specifically ECs can

experience delocalization and decreased expression of their cellular junction molecules or

proteolytic degradation of those complexes to disrupt and loosen the tight junctions [132-134]. It

has been previously shown that leukocyte adhesion initiated intracellular signalling pathways to

enhance permeability to promote migration [134, 135]. Deem et al. revealed that lymphocyte-

mediated VCAM-1 crosslinking activates downstream production of NADPH oxidase and

reactive oxygen species (ROS). ROS then mediates the activation of EC-associated MMPs to

enable leukocyte migration; inhibition of endothelial MMPs block VCAM-1-dependent migration

[135]. MMPs are suggested to modulate leukocyte migration by regulating the permeability of

cell barriers. Specifically, the activity of gelatinases (MMP-2&9), are known to be responsible for

the degradation of intercellular junction proteins (i.e. occludin and VE-cadherin), leading to an

increase in microvascular permeability [78, 136, 137].

1.4.2.2 MMPs as modulators of pregnancy and labour

It has been well-established that MMPs are important modulators of ovulation (MMP-1),

implantation of the fertilized embryo (gelatinases), and decidualization and trophoblastic invasion

during early pregnancy [30, 82, 106, 138]. It has been hypothesized that late gestational changes,

labour, and parturition are associated with increased expression and activation of MMPs, which

would result in relaxation of uterine muscle, inhibit myometrial contraction, and/or promote tissue

remodeling during PP period [139]. Yin et al. reported an increase in gelatinase gene expression

but a decrease in MMP-7 in pregnant rat myometrium strips collected at mid- and late gestation,

and these findings were augmented in response to prolonged mechanical stretch. These authors

suggested that these changes in MMP expression inhibit contraction and induce uterine relaxation


21

in response to mechanical stretch imposed by the growing fetus during pregnancy [139]. Roh et

al. observed that the release of pro-inflammatory cytokines (IL-1 and TNF-) by activated

macrophages and neutrophils induced the production of MMP-9 by myometrial SMCs prior to

TL, suggesting a link between MMP expression and labour-associated inflammation [31]. As

previously mentioned, MMP-9 is capable of cleaving 1) degraded collagen in the extracellular

matrix, 2) endothelial tight junctions, and 3) activating non-matrix proteins such as IL-1β and IL-

8 [31, 78].

PTL in humans has been linked to ECM degradation, caused by imbalance between MMPs

and their TIMPs. Tency et al. reported that during PTL, there was an increase in the ratio of MMP-

9:TIMP-1 and MMP-2:TIMP-2, favouring gelatin degradation [57]. Xu et al. also observed an

increase in MMP-9 in fetal membranes (FM) and human placental (PL) tissue during TL and PTL,

supporting their importance in facilitating rupture of FM and PL detachment by degrading

components of the uterine ECM [58]. MMP-3, capable of activating latent forms of other MMPs

(specifically MMP-2), was also significantly increased in the amniotic fluid at TL and PTL

(associated with amniotic infection) [125]. MMPs may be important for the amplification of

inflammatory signals in uterine tissues before and during TL and PTL; targeting premature MMP

activation can be insightful in treating premature delivery. Importantly, through the use of a mouse

model of inflammation-induced PTL, Koscica et al. reported that the administration of a broad

spectrum MMP inhibitor (GM6001) resulted in reduction of the rate of PTL, suggesting a direct

involvement of MMPs in regulating the labouring process [140].


22

1.5 Thesis Rationale and Hypothesis

Current PTL therapeutic strategies primarily focus on inhibiting myometrial contractions

(i.e. tocolytic drugs), but have been found to ineffectively delay labour onset in the majority of

women. Particularly due to these therapies targeting later stages of the labour cascade – when

irreversible changes in the reproductive tissues have already occurred [141, 142]. Research aiming

to characterize the exact mechanisms underlying the onset of TL will assist in understanding

whether similar changes occur during PTL. Dr. Lye and colleagues have suggested a new model

for labour initiation where mechanical stretch of the uterine tissues by the growing fetus increases

myometrial cytokine/chemokine expression which 1) upregulates cell adhesion molecules on

endothelial cells; 2) activates peripheral leukocytes and induces their infiltration into the

myometrium. Here, leukocytes contribute to labour initiation by inducing myometrial contractility

and play a role in decidual activation – by promoting synthesis of prostaglandins [17, 64].

Prostaglandins (i.e. PGF2α) not only stimulate myometrial contractions, they can also induce

gelatinolytic activity by increasing MMP and down-regulating TIMP expression, and modulate

the secretion of pro-inflammatory cytokines and chemokines [51, 143, 144].

The increasingly recognized role of MMPs as activators and regulators of inflammatory

pathways suggests their potential involvement in remodeling of reproductive tissue (i.e.

myometrium). My research 1) characterized the myometrial expression of MMPs and TIMPs

during pregnancy, labour and postpartum, 2) to define putative mechanisms that regulate their

expression and/or activity, and the contribution of MMPs to inflammatory pathways within this

tissue.

I hypothesized that throughout gestation, there is an increase in myometrial MMP and a

decrease in TIMP expression /activity in preparation for two major events: 1) labour contractions


23

to expel the fetus and 2) subsequent uterine remodeling during PP involution. I also speculate that

mechanical stretch of the uterine walls by the growing fetus can regulate the expression and

activity of myometrial MMPs and TIMPs.

1.6 Specific Aims and Objectives

1.6.1 Aim 1: To characterize the expression pattern of myometrial MMPs and TIMPs throughout

pregnancy, labour and postpartum.

Due to a lack of pregnant human uterine tissue, I aimed to characterize the gene/protein

expression of certain MMPs/TIMPs in vivo using an animal (rat) model of gestation and term

labour. It was hypothesized that the gene and protein expression/activity would increase towards

late gestation and culminate during the early postpartum period. It is speculated that in addition

to myometrial smooth muscle cells, infiltrating leukocytes would also be the source of MMP

expression. To test this, myometrial tissues were collected from pregnant (gestational day (GD)

6, 8, 10, 12, 14, 15, 17, 19, 21, 22), labouring (GD23) and postpartum (1PP and 4PP) rats. Real-

Time Polymerase Chain Reaction (RT-PCR) was used to quantify changes in MMP gene

expression; Western blot analysis was used to validate and quantify protein expression. This study

specifically focused on studying the collagenases (MMP-1, 8, 13), gelatinases (MMP-2, 9),

stromelysins (MMP-3, 10, 11), matrilysin (MMP-7), metalloelastase (MMP-12) and TIMP-1, 2,

3, and 4 mRNA expression. For protein analysis, focus was placed on 1) the expression of MMP-

8 which preferentially cleaves collagen I, a major component of the uterine interstitial ECM; 2)

MMP-7 known to be active in rat uterine tissue during TL and PP; 3) the major stromelysins

MMP-3 and MMP-11; and 4) MMP-12 known to be highly expressed by macrophages [31, 78,

145, 146]. The activity of MMP-2 and -9 throughout gestation was also studied by gelatin


24

zymography and temporal/spatial localization of MMPs in rat myometrial tissue was studied using

immunohistochemistry, in situ zymography, and immunofluorescence of leukocyte-specific

markers.

1.6.2 Investigate the in vivo regulation of MMP and TIMP expression by mechanical stretch.

Previous reports have suggested that mechanical stretch can influence gene/protein

expression of MMPs and TIMPs in other tissues [147, 148]. It has been previously shown by

colleagues in the Lye laboratory using a unilaterally pregnant rat model, that the gravid (pregnant)

uterine horn experiences greater changes (across gestation) in the expression of ECM components

compared to the non-gravid (empty) horn [35]. It is hypothesized that mechanical stretch from the

growing fetus upregulates the expression of myometrial MMPs compared to the empty horn.

Analysis of this well-established rat model, may reveal differences in the expression and activity

of major MMPs in the gravid and empty uterine horns in comparison with normal bilaterally

pregnant rats. Myometrial tissues were collected from GD 6, 12, 15, 17, 19, 21, 22, labouring

(GD23) and 1 day PP rats. Similar to Aim 1, RT-qPCR was used to quantify changes in MMP

gene expression, Western blot and gelatin zymography was used to validate and quantify protein

expression and activity. These experiments provide insight on the regulation of MMP expression

by in vivo biological mechanical stretch from the growing fetus.

1.6.3 Investigate the in vitro regulation of MMP and TIMP expression by mechanical stretch.

Although the in vivo unilaterally pregnant rat model provides insight on the regulation of

myometrial MMP expression, it does not provide confirmation whether mechanical stretch

directly regulates MMP expression. To investigate the sole effect of mechanical stretch – without


25

other potential regulatory factors such as signals from the fetus and placenta – an in vitro cell

model will be studied. It was recently shown by Lee et al. that media collected from stretched

myometrial cell line hTERT-HM 1) showed an increase in multiple pro-inflammatory cytokines

and chemokines, and 2) promoted an increase in permeability of human endothelial cells in culture

[17]. In addition, Loudon et al. observed that mechanical stretch of primary human myometrial

cells increased mRNA and protein levels of CXCL8 [149]. However, the role of MMPs was not

considered in these studies. It is hypothesized that applying static mechanical stretch would

simulate the stretch of the growing fetus and upregulate the expression of MMPs by myometrial

SMCs. To investigate the direct effect of static mechanical stretch on the synthesis and secretion

of MMPs/TIMPs in vitro, two different approaches were employed.

First, primary rat myocytes were enzymatically isolated from the uterine tissues. These

myocytes were mechanically stretched using a computer-driven in vitro stretch system (FX-5000,

Flexcell Int). Total RNA and protein were extracted from these cells and stretch-conditioned

media (SCM) or media conditioned by the non-stretched cells (NCM) were collected to compare

the gene/protein expression level of MMPs, TIMPs using RT-PCR and gelatin zymography

analysis, correspondingly. However, results from this in vitro model were inconclusive.

Secondly, primary human myometrial cells were enzymatically isolated and mechanically

stretched for 24 hours using the FX-5000 stretch system, and the expression of MMPs (both

mRNA and protein) as well as NCM/SCM were analyzed. Using human myometrial cells

produced from tissue biopsies instead of primary rat myometrial cells will better correlate the

findings from our animal studies for future human applications.

26

CHAPTER 2

MATERIALS AND METHODS

Chapter 2: Materials and Methods

27

2.1 INTRODUCTION

This chapter describes the materials and detailed methodologies used for the thesis

experiments. The buffers that were used such as phosphate buffered saline (PBS) and Hank’s

buffered salt solution (HBSS), were prepared and autoclaved in-house by the sterilization and

Media Prep department at the Lunenfeld-Tanenbaum Research Institute (LTRI) unless otherwise

specified.

2.2 RAT GESTATIONAL PROFILE OF MMP EXPRESSION

2.2.1 Bilaterally Pregnant Rat Animal Model of Gestation

The in vivo myometrial mRNA gestational expression profile of MMPs and TIMPs was

investigated using a bilaterally pregnant rat model of gestation, term labour (TL) and postpartum

(PP). Virgin female Wistar rats (12-15 weeks, 225-250g weight) and male Wistar rats (250-300g

weight) were purchased from Charles River Laboratories (St. Constance, QC, Canada) and housed

in the MaRS Toronto Medical Discovery Tower Animal Research Facility (Toronto, ON,

Canada). The research ethics board approved these animal studies (AUP #2379). Rats were

maintained on standard rat chow and water in a 12:12 hour light-dark cycle. The rats were mated

and the day when a vaginal plug was detected was considered day 1 of gestation. Animals were

euthanized by carbon dioxide inhalation and uterine samples were collected on gestational day

(GD) 6, 8, 10, 12, 14, 15, 17, 19, 21, 22, 23 (TL), 1 day PP and 4 day PP.


28

2.2.2 Unilaterally Pregnant Rat Model of Gestation

The in vivo effect of mechanical stretch from the growing fetuses was investigated using

a unilateral horn pregnancy model. Virgin female Wistar rats were anesthetized and tubal ligation

was performed through a flank incision. This ensured that the animals would become pregnant in

only one uterine horn [150]. Prior to mating, animals were allowed to recover from surgery for at

least 7 days. Uterine tissues from the gravid and empty horns were collected separately on GD 6,

12, 15, 19, 21, 23L, and 1PP.

2.2.3 Tissue Collection and Preparation

Whole uteri were excised from the pregnant rats, and fat and blood vessels were carefully

removed.

For biochemical studies: Placentae and pups were removed from the pregnant uteri, the

myometrium was separated from the decidua basalis and decidua parietalis (endometrium) by

mechanical scraping on ice which we have previously shown removes the entire luminal

epithelium and the majority of the uterine stroma [151]. Tissue was rinsed in ice-cold PBS

(Sigma-Aldrich Canada Co., Oakville, ON, Canada) and flash frozen in liquid nitrogen.

For immunohistochemical, immunofluorescence and in situ zymography analysis: The intact

uterine horns were placed in ice-cold PBS, cut into 3-10-mm segments using a scalpel blade and

fixed immediately in 10% neutral-buffered formalin (NBF, VWR International, Mississauga, ON,

Canada) solution at 4˚C for 24 hours or overnight in zinc buffered fixative (ZBF; 100mM Tris

buffer pH 7.4, 3mM calcium acetate, 27mM zinc acetate, 37mM zinc chloride; see Table 2.2

[14;17]) while shaking at RT. Following fixation, the whole uteri were rinsed with PBS overnight.

NBF-fixed tissue were dehydrated in 70%, 80%, 90%, 95%, 100% ethanol series for 30 minutes


29

each, cleared in xylene three times for 15 minutes, heated in paraffin wax three times for 30

minutes and embedded into paraffin blocks. ZBF-fixed tissue were dehydrated in 70%, 80%, 90%

and 100% (twice) ethanol baths for one hour each, cleared in xylene three times for 15 minutes,

heated in paraffin wax three times for 30 minutes and embedded into paraffin blocks.

2.2.4 Real-Time Polymerase Chain Reaction (RT-PCR) Analysis of mRNA expression

The frozen myometrium was homogenized using the TissueLyser II (Qiagen Inc.,

Mississauga, ON, Canada) to isolate total RNA using Qiagen RNeasy Universal Mini kit (Qiagen

Inc.). Total myometrial RNA was reverse transcribed using the iScript supermix (Bio-Rad

Laboratories (Canada) Ltd., Mississauga, ON, Canada) to cDNA (1µg of RNA in 20µL reaction).

A primer mastermix (2.5µL of Sigma Scientific SYBR green, 1µL of RNase-free water, and

0.5µL of 3µM forward and reverse primers) was combined with 1µL of the 5 ng/µL cDNA

product for a final volume of 5 µL per well in a 384-well PCR plate. The plate was then subjected

to Real-Time PCR using the CFX384 system (Bio-Rad). Transcript levels of collagenases (MMP-

1, 8, 13), gelatinases (MMP-2, 9), stromelysins (MMP-3, 10, 11), matrilysin (MMP-7),

metalloelastase (MMP-12) and TIMP-1, 2, 3, 4 were examined using set of specific primers

designed using free NCBI Primer Blast software and produced by Eurofins Genomics (Eurofins

MWG Operon LLC, Huntsville, AL, USA), (see Table 2.1).


30

Table 2.1 Primer pair information for Rat (Rattus Norvegicus) genes examined using RT-PCR

† Genes excluded from statistical analysis; either not detected or n < 4 after exclusion.

Abbreviation Name Accession

Number Primers (5’-3’)

Amplicon Size

(base pairs)

MMP-1† Interstitial /Fibroblast

Collagenase NM_001134530.1

F: ACGCAGATTTAGCCTCCGAA

R: TGACTTGGTAATGGGTTGCC 97

MMP-8 Neutrophil Collagenase NM_022221.1

F: GGAGTGTGCCATCAACCCTGACC

R:

ACCATGGTCTCTTGAGACGAAAGCA

86

MMP-13 Collagenase 3 NM_133530.1 F: GGCTTAGATGTGACTGGCAAA R: CATTTGAGTGTTCGAGGGAAA

113

MMP-2 Gelatinase A NM_031054.2 F: TGGCGGACAGTGACACCACG

R: TGGGGCCTCGTACACGGCAT 105

MMP-9 Gelatinase B NM_031055.1 F: TTCTCTGGGCGCAAAATGTGGGT

R: ACGCGGGAGAAGTCCGGTGA 114

MMP-3 Stromelysin 1 NM_133523.3 F: AGATCCATGGAAGGCGTCGTGT R: AGGAAACCACTTCAGTGCGCCA

136

MMP-10 Stromelysin 2 NM_133514.1 F: TGCTGCTGTGCTTTCCGAT

R: AGCAAGATCCATGGTTGAGTGG 80

MMP-11 Stromelysin 3 NM_012980.2 F: TGCTGCTTTCCAGGATGCTGAGG

R: AAGTCGGGACCTATGGGTCGAGG 120

MMP-7 Matrilysin (PUMP-1) NM_012864.2 F: CCTGTTCCGCATTGTGTGTC R: TAATTCTGCGCCTGTTCCCA

102

MMP-12 Macrophage Metalloelastase NM_053963.2 F: TCTCTGGGCTTCCCTGCATCTGT

R: TCCTGCCTCACATCGTACCTCCA 116

TIMP-1 Tissue Inhibitor of

Metalloproteinase 1 NM_053819.1

F: CTGCCTGCAGCTTCCTGGTTCC

R: AGGGAAACACTGTGCACACCCCA 105



F: AGATCACACGCTGCCCTATG

R: TGGTGCCCATTGATGCTCTT 97



F: TGCTGACAGGGCGCGTGTATGA

R: CCTTGCGCTGGGACAGTGTGAG 93


Metalloproteinase 4 NM_ 001109393.1

F: TTGCTATGCAGTGCCGTGTA

R: TGGGCCTGGTACCCATAGAG 93

IGF1R Insulin-like Growth Factor 1

Receptor NM_000875.4

F: GCATCTGATCATTGCTCTGC

R: GCCCAATCTGCTGTTATTCC 103

PPIA Peptidylprolyl Isomerase A

(Cyclophilin A) NM_017101.1

F: TATCTGCACTGCCAAGACTGA

R: CCACAATGCTCATGCCTTCTTTCA 80

PDGF-A Platelet-derived Growth Factor

Alpha NM_012801.1

F: AGCGACTGGCTCGAAGTC

R: CTCCAAGGCATCCTCAGC 89

TBP TATA Box-Binding Protein NM_0001004198 F: AGAACAATCCAGACTAGCAGCA

R: GGGAACTTCACATCACAGCTC 120


31

Following RT-qPCR, a dissociation curve was constructed by increasing temperature from

65°C to 95°C for detection of PCR product specificity. In addition, a no-template control (H2O

instead of cDNA) was analyzed for possible contamination in the master-mix. A cycle threshold

(Ct) value was recorded for each sample. The Ct value is defined as the number of amplification

cycles required for detection of a fluorescent signal (SYBR green) that exceeds background levels.

Ct values are inversely proportional to mRNA levels within each sample. PCR reactions were set

up in technical triplicates and the mean of the 3 Ct values was calculated by the software (CFX

Manager, Bio-Rad). A comparative Ct method (∆∆Ct method) was applied to the raw Ct values

to find a relative gene expression. The expression levels of MMPs and TIMPs were normalized

to the geometric mean of three housekeeping genes for bilaterally pregnant rat samples:

cyclophilin/peptidylprolyl isomerase A (PPIA), platelet-derived growth factor alpha (PDGF-A),

and TATA box-binding protein (TBP). For unilaterally pregnant animals’ MMP and TIMP gene

expression was normalized to the three housekeeping genes PPIA, PDGF-A and insulin-like

growth factor 1 receptor (IGFR1). All housekeeping genes used exhibited stable mRNA levels

throughout gestation. Results were displayed as fold-change relative to GD6 (bilaterally pregnant

rats) or relative to a corresponding GD6 in the empty horn (unilaterally pregnant rats) within each

experimental run.

2.2.5. Gelatin Zymography and Western Blot Analysis of Protein Expression

Total protein was extracted from frozen myometrial tissue homogenized using a bicine

salt lysis buffer. The homogenate was centrifuged at 20,800 g for 15 minutes at 4⁰C. The

supernatant was collected and protein concentration was determined using a Pierce BCA protein

assay kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). For Western blot analysis of


32

MMP-8, MMP-7, MMP-3, and MMP-11 protein expression, 30 µg (for MMP-8 analysis) or 70

µg of total protein (for MMP-7, 3 & 11 analysis) were added to sample buffer (NuPAGE LDS 4x

Sample Buffer, Novex) with β-merceptoethanol solution (Sigma-Aldrich) and heated for 10

minutes at 95⁰C. The protein was then loaded on 12% bis-acrylamide electrophoresis gels and ran

for 2 hours at 100V at room temperature with 1x Tris-Glycine SDS running buffer diluted from

the 10x stock (Wisent Inc., St-Bruno, QC, Canada). Following gel electrophoresis, proteins were

transferred onto PVDF membranes (0.2 µm Trans-Blot® Turbo™ Midi PVDF Transfer Packs

(Bio-Rad), using the Trans-Blot® Turbo™ Transfer System (Bio-Rad). Membranes were quickly

washed with TBS-T, blocked in 5% non-fat milk for 1 hour at room temperature, and incubated

with primary antibodies (Table 2.2) overnight at 4⁰C with gentle shaking. Next, membranes were

washed 3 times 5 minutes in TBS-T prior to incubation with HRP-biotinylated secondary antibody

(Table 2.2) for 1 hour with gentle shaking at room temperature. Membranes were washed 3 times

for 5 minutes in TBS-T and then developed with Luminata Crescendo Western HRP substrate

(Millipore (Canada) Ltd., Etobicoke, ON, Canada) or SuperSignal West Femto Chemiluminescent

Substrate (Thermo Fisher Scientific Inc.), depending on the intensity of the signal. Images were

taken using the VersaDoc™ Imaging System (Bio-Rad) and analysed using Image Lab software

(Bio-Rad). Protein expression levels were normalized to the calcium-binding protein calponin

used as the housekeeping protein, and expressed relative to GD6.


33

Table 2.2 Information of antibodies used for Rat-specific experiments.

Western Blot (WB), Immunohistochemistry (IHC), Immunofluorescence (IF)

For analysis of enzymatic gelatinase activity, gelatin zymography was applied: 50 µg of

total protein from myometrial tissue homogenates were added to sample buffer (1:2, Novex, Life

Technologies Inc., Burlington, ON, Canada) prior to loading onto Novex pre-cast 12% tris-

glycine gelatin gels (Novex, Life Technologies Inc.). Gel electrophoresis was run for

approximately 4 hours at 110V at 4⁰C (to prevent denaturation of gelatinases) with 1x Novex

Tris-Glycine SDS running buffer (Life Technologies Inc.) using the Novex X-Cell II Mini Cell

system (Life Technologies Inc.). Following electrophoresis, gels were incubated for 30 minutes

in 1x renaturing buffer (Novex) to remove SDS and renature the gelatinases and then for 30

minutes in 1x developing buffer (Novex) with gentle shaking at room temperature. Next gels were

incubated in developing buffer overnight at 37⁰C. Gels were then washed 3 times with double

Target Host Company Used for Method Antibody Type Dilution

MMP-9 Mouse Millipore IHC Primary 1:200, 1:200

MMP-8 Rabbit Abcam WB Primary 1:500

MMP-3 Rabbit Abcam WB Primary 1:500

MMP-11 Rabbit Abcam WB, IHC Primary 1:500, 1:150

MMP-7 Rabbit Abcam WB, IHC primary 1:200, 1:150

MMP-12 Rabbit Abcam WB primary 1:1000

Calponin Mouse Sigma WB Primary 1:1000

CD45 Mouse Bio Legend IF Primary 1:200

CD68 Mouse AbD Serotec IF Primary 1:200

Anti-mouse-HRP Sheep GE Healthcare WB Secondary 1:2000

Anti-rabbit-HRP Donkey GE Healthcare WB Secondary 1:2000

Anti-mouse

biotinylated

Goat Vector IHC Secondary 1:300

Anti-rabbit

biotinylated

Goat Vector IHC Secondary 1:200

Alexa 546 anti-

mouse

Donkey Life Technologies IF Secondary 1:200


34

deionized water (ddH2O, Milli-Q, Millipore (Canada) Ltd.) to remove excess developing buffer

prior to staining with Simply Blue stain (Novex) for 1 hour with gentle shaking at room

temperature. Gels were rinsed with ddH2O to clearly see the contrast between the blue-stained gel

and gelatinase activity (white bands). Images were taken using the VersaDoc™ Imaging System

(Bio-Rad) and analysed using Image Lab software (Bio-Rad). Gelatinase activity levels were

calculated relative to GD6.

2.2.6 Localization of Myometrial MMPs by immunohistochemistry

Paraffin embedded formalin-fixed rat uteri were sectioned at 5 µm. Sections were baked

at 37⁰C overnight, deparaffinized and rehydrated in xylene, 100%, 95%, 80%, and 70% ethanol

baths for 5 minutes each and quenched with 3% H2O2 in methanol for 20 minutes. Slides were

washed 3 times with PBS and antigen retrieval was performed by microwaving the slides in

DAKO (Burlington, ON, Canada) Target Retrieval Solution (pH 9, diluted 1:10 in ddH2O). Slides

were first microwaved at power level 6 for 5 minutes in a closed container and then left to cool

on ice for 20 minutes. The microwaving process was repeated but at power level 6 for 3 minutes

in an open container and then cooled on ice for 15 minutes. Sections were washed three times for

5 minutes with PBS and isolated on the glass slide (Fisher Scientific, Ottawa, ON, Canada) using

a wax pen (DAKO). Additional permeabilization was performed using 0.01% Triton X-100

(Sigma-Aldrich) diluted in PBS for 10 minutes. Slides were then blocked for 20 minutes at room

temperature using protein blocking solution (DAKO, 1:1 diluted in PBS) and incubated with

primary antibody (Table 2.2) for MMP-9, MMP-7 and MMP-11 – rabbit IgG (1:200, Santa Cruz

Biotechnology, Inc., Dallas, TX, USA) was used as the negative control – diluted in a PBS

solution (1/3 DAKO antibody diluent, 2/3 PBS--) at 4⁰C overnight in a covered humidified box.


35

The following day, sections were washed three times with PBS and incubated with

biotinylated secondary anti-rabbit antibody (diluted in PBS, Table 2.2) for 1 hour at room

temperature in a humidified box followed by incubation with streptavidin-HRP solution (DAKO)

for 1 hour at room temperature. Sections were then washed three times with PBS and developed

with a DAB kit (DAKO), counterstained with Gill’s No.1 Accustain® Hematoxylin (Sigma-

Aldrich), and were mounted with Surgipath Micromount® mounting media (Leica Microsystems

Inc., Concord, ON, Canada). For the assessment of staining intensity, myometrial cells from each

of the two sets of tissues were observed on the Olympus BX61 Motorized Microscope and

MicroSuite™ system (Olympus America Inc., Melville, New York, USA). A minimum of five

fields were examined for each gestational day and uterine horn for each set of tissue, and

representative tissue sections were photographed with a Olympus DP72 Microscope Digital

Camera (Olympus America Inc.).

2.2.7 Localization of Myometrial MMP expression and activity by in situ zymography

ZBF-fixed, paraffin-embedded whole uteri were sectioned at 5 µm, baked at 37⁰C for 1

hour (to adhere the sections onto glass slides), deparaffinized and rehydrated in xylene, 100%,

95%, 80%, and 70% ethanol for 5 minutes each. Sections were then incubated with fluorescent

substrates: DQ gelatin, collagen I, or collagen IV (Life Technologies Inc.) in a reaction buffer

(1/50 dilution) for 2 hours at 37⁰C in a humidified box. For a negative control (NEG) sections

were pre-incubated for 1 hour at 37⁰C with 0.02M EDTA and 0.02M EDTA + substrate for 2

hours at 37 ⁰C. Following incubation with the fluorescent substrates, sections were post-fixed in

a 4% NBF solution for 5 min, washed three times for 5 min with PBS, counterstained with DAPI


36

(1:1000, Sigma-Aldrich) for 10 min, and mounted with a coverslip using Immu-Mount mounting

media (Thermo Fisher Scientific Inc.).

2.2.8 Localization of Leukocyte MMP expression and activity by in situ zymography

Immunolocalization of MMP expression by leukocytes and specifically macrophages was

defined using a mouse anti-CD45 (leukocyte common antigen) and anti-CD68 (macrophage-

specific marker) specific antibodies. Immediately following incubation with DQ gelatin, collagen

I or collagen IV fluorescent substrates and 4% NBF post-fixation for in situ zymography, sections

were blocked using a protein blocking solution (DAKO) for 1 hour at room temperature, then

incubated with primary anti-CD45 (BioLegend, San Diego, CA, USA) and anti-CD68 (AbD

Serotec, Bio-Rad, Raleigh, NC, USA) antibody overnight at 4⁰C in a humidified box. Sections

were washed three times for 5 minutes with PBS, cell nuclei were counter-stained using DAPI

(1:1000) in conjunction with the secondary antibody (donkey anti-mouse Alexa Fluor 546, Life

Technologies Inc.) for 1 hour at room temperature. Slides were washed once with PBS and

mounted with a coverslip using Immu-Mount mounting media (Thermo Fisher Scientific Inc.).

Images for regular and in situ zymography were taken using a spinning disc confocal Leica

DMI6000 B Inverted Microscope for Biomedical Research system (Leica Microsystems Inc.) and

the Volocity (Version 6.3) 3D Image Analysis software (PerkinElmer, R&D, Woodbridge, ON,

Canada).


37

2.3 EFFECT OF IN VITRO MECHANICAL STRETCH ON MMP EXPRESSION

2.3.1 In vitro primary human myometrial cell model of mechanical stretch

In addition to rat primary myometrial cells I used human primary myometrial cells to

investigate the direct effect of static mechanical stretch on MMP/TIMP expression and secretion.

Tissue biopsies were acquired from term-not-in-labour women undergoing elective caesarian

section and enzymatically digested. The uterine sample was placed in HBSS++ containing 1x Pen-

Strep-AmpB (Lonza, VWR International) and 50 µg/mL of Normocin™ (InvivoGen, San Diego,

CA, USA), and brought to a biological safety cabinet. Any remaining fat and blood vessels were

carefully excised and the sample was rinsed with fresh HBSS++. The sample was then cut into

approximately 1mm x 2mm pieces, washed 3 times for 5 minutes with HBSS and 5mL of warm

enzyme mix were added, transferred to a 50mL tube (Greiner Bio-One, VWR International), and

incubated in a water bath (37⁰C) for 1 hour. Following 1 hour of enzymatic digestion, 5mL of

dissociation mix were added (to stop digestion) and the tissue solution was pipetted, passed

through a 100µm metal cell strainer, and the collected primary cells were placed on ice. The

leftover tissue was put into a clean 50mL tube and 5mL of fresh warm enzyme mix was added.

The tissue was again incubated for 1 hour in a 37⁰C water bath; the enzymatic digestion was

repeated 4 times or until all of the uterine tissue was digested.

The collected cell suspension was centrifuged for 15 minutes at 250 g at 4⁰C. The

supernatant was aspirated and the pellet was resuspended in 5mL fresh 10% FBS DMEM (with

Pen-Strep-AmpB and Normocin) and the cell suspension was passed through a 23G needle. Cells

were counted using the CASY Cell Counter and analyzer system (Roche Innovatis AG, Roche

Diagnostics, Laval, QC, Canada), plated into 10 cm diameter tissue culture dishes with 10% FBS

DMEM and left to grow in a 5% CO2, 37⁰C incubator. Cells were washed daily with HBSS-- (with


38

Pen-Strep-AmpB and Normocin) and DMEM was changed. Once the plates were 90-100%

confluent, cells were harvested by trypsinization with 0.5% Trypsin-EDTA (Gibco®, Life

Technologies Inc.). Cells were collected into 15mL tubes (Greiner Bio-One, VWR International)

and centrifuged at 180 g for 5 minutes at 4⁰C to pellet the cells and the supernatant was aspirated.

Fresh warm 20% FBS DMEM were then added to resuspend the pellet and cells were passaged.

At passage 4, 200,000 cells in 3mL/well were plated onto collagen I-coated 6-well Flexcell

plates (Flexcell International Corp.) and allowed to grow until 75-80% confluency. When

confluent, cells were serum starved for 24 hours with 5mL/well of serum-free DMEM with a

insulin-transferrin-selenium-sodium pyruvate supplement (ITS-A, Life Technologies Inc.) and

subjected to a static mechanical stretch using a computer-driven in vitro stretch system (FX-5000,

Flexcell International Corp.) in a 5% CO2, 37⁰C incubator for 24 hours at 25% elongation, or

were stretched for 24 hours and then left for another 24 hours without stretch to simulate

postpartum relaxation following pregnancy (total of 48 hours). Control plates were left un-

stretched in the same incubator to provide similar environmental conditions.

2.3.2 Assessment of cell viability following in vitro static mechanical stretch

The assessment of cell viability following static stretch and/or additional 24 hours of

relaxation was employed using propidium iodide (PI) and fluorescein diacetate (FDA) staining

(Sigma-Aldrich). The principle behind this method is that FDA is taken up by live cells, and the

non-fluorescent dye is converted to the green fluorescent fluorescein metabolite. Whereas PI is a

nuclear staining dye that can pass through permeated cell membranes of dead cells and intercalates

with DNA to fluoresce red [152]. Immediately after stretch, cells were washed twice and then

stained with PI and FDA by incubating with 1mL of PBS, 500µL of FDA (20µg/mL) and 150µL


39

of PI (20µg/mL) for 3 minutes at room temperature. The solution was aspirated and the flexible

membranes of the Flexcell plate containing the stained cells were carefully cut out with a blade

and immediately mounted onto a glass slide (Fisher Scientific) without mounting media. The

slides were viewed and images were taken immediately using a spinning disc confocal microscope

Leica DMI6000 B Inverted Microscope for Biomedical Research system (Leica Microsystems

Inc.) and the Volocity 3D Image Analysis software (PerkinElmer, R&D) at 100x and 200x

magnification.

2.3.3 Characterization of primary human myometrial cells by immunocytochemistry

To characterize the origin of enzymatically isolated cells, a small aliquot of the cell

suspension (~100-1000 cells) at passage 0, 1, 2, 4, 6 and 8 was plated onto sterile microscope

cover glass (22x30, Fisher Scientific) and left to attach in the 37⁰C incubator overnight. Cells

were washed twice in PBS, fixed in 4% PFA (diluted in PBS) for 20 minutes. Plates were rinsed

once for 5 minutes with PBS and stored in the 4⁰C fridge for at least 24 hours until further

processing. Next, coverslips were rinsed with fresh PBS, permeabilized with PBS-T (250µL of

Tween-20 in 500mL of PBS--) for 15 minutes, then washed with PBS and blocked in 5% FBS

blocking solution (46.5mL of PBS, 2.5mL of FBS, 1mL of donkey serum) for 30 minutes at

room temperature. Next, coverslips were transferred to a plate covered in aluminum foil,

outlined with a wax pen (DAKO), the primary antibody (diluted in blocking solution) was

applied (150-200µL per coverslip) and incubated overnight at 4⁰C (Table 2.3). Following

incubation, coverslips were washed twice with PBS-T and incubated with secondary antibody

(table 2.2) for 1 hour at room termperature in the covered plate. Coverslips were washed again

with PBS-T, incubated for 10 minutes with DAPI (1:1000 diluted in PBS--) and carefully


40

mounted with Shandon Immu-Mount™ (Thermo Fisher Scientific Inc.) onto glass slides. Images

were taken using a spinning disc confocal microscope Leica DMI6000 B Inverted Microscope

for Biomedical Research system (Leica Microsystems Inc.) and the Volocity 3D Image Analysis

software (PerkinElmer, R&D) at 100x and 200x magnification.

Table 2.3 Information of antibodies used for immunocytochemistry

2.3.4 Sample collection, preparation and RT-PCR analysis of mRNA expression

Similarly as section 2.4.2, non-stretched (NSM) and stretched (SCM) conditioned media

was collected and stored at -20⁰C, total RNA was isolated using TRIzol and purified using

RNeasy MinElute Cleanup kit. Purified RNA was stored at -80⁰C or reverse transcribed to

cDNA and analyzed using RT-qPCR (see section 2.2.3). Changes in human MMPs and TIMPs

mRNA expression were examined using a specifically designed set of primers (Eurofins

Genomics, Table 2.4). Expression levels were normalized to the geometric mean of three human

housekeeping genes: cytochrome C-1 (CYC1), glyceraldehyde 3-phosphate dehydrogenase

(GAPDH), and TATA box-binding protein (TBP).

Target Host Company Antibody Type Dilution

Smooth Muscle Actin (SMA) Mouse DAKO Primary 1:50

H-Caldesmon Mouse Sigma Primary 1:50

Desmin Goat Santa Cruz Primary 1:75

Vimentin Goat Santa Cruz primary 1:50

Mouse IgG1 (negative control) Mouse DAKO Primary 1:200

Goat IgG1 (negative control) Goat Santa Cruz Primary 1:200

Alexa 488 anti-mouse Donkey Life Technologies Secondary 1:300

Alexa 546 anti-goat Donkey Life Technologies Secondary 1:200


41

Table 2.4 Primer pair information for Human (Homo sapien) genes examined using RT-PCR

† Genes excluded from statistical analysis; either not detected or n < 4 after exclusion

‡ Primers designed based on human MMP primer sequences from [153]

Abbreviation Name Accession

Number Primers (5’-3’)

Amplicon Size

(base pairs)

MMP-1‡ Interstitial /Fibroblast

Collagenase NM_002421.3

F: CTGGCCACAACTGCCAAATG

R: CTGTCCCTGAACAGCCCAGTACTTA 103

MMP-8† Neutrophil Collagenase NM_002424.2 F: AAAGCCTCGCTGTGGAGTG

R: CTGTAGGTCAAGTTAGTGCGTTCC 87

MMP-13†‡ Collagenase 3 NM_002427.3 F: TGGTCCAGGAGATGAAGACC

R: TCCTCGGAGACTGGTAATGG 97

MMP-2‡ Gelatinase A NM_004530.5 F: TCTCCTGACATTGACCTTGGC

R: CAAGGTGCTGGCTGAGTAGATC 303

MMP-9†‡ Gelatinase B NM_004994.2 F: TTGACAGCGACAAGAAGTGG

R: GCCATTCACGTCGTCCTTAT 179

MMP-3‡ Stromelysin 1 NM_002422.3 F: ATTCCATGGAGCCAGGCTTTC

R: CATTTGGGTCAAACTCCAACTGTG 138

MMP-10 Stromelysin 2 NM_002425.2 F: GCCTCTACTGAGGAACCCCT

R: TGGCATCGAAGGACAAAGCA 94

MMP-11 Stromelysin 3 NM_005940.3 F: GCCGCCTCTACTGGAAGTTT

R: GCACAGCCAAGAAGTCAGG 87

MMP-7‡ Matrilysin (PUMP-1) NM_002423.3 F: CAGGAAACACGCTGGCTCAT

R: AGACTGCTACCATCCGTCCA 97

MMP-12† Macrophage Metalloelastase NM_002426.4 F: GGAGACCCAAAAGAGAACCA

R: CCACGGTAGTGACAGCATCA 97



F: GCTCCTCCAAGGCTCTGAAA

R: GCAGGATTCAGGCTATCTGGG 113

TIMP-2 Tissue Inhibitor of Metalloproteinase 2

NM_003255.4 F: TTCCCTCCCTCAAAGACTGA

R: CAAAGCCACCTACCTCCAAA 120

TIMP-3† Tissue Inhibitor of


F: ACCTGCCTTGCTTTGTGACT

R: GGCGTAGTGTTTGGACTGGT 95

TIMP-4† Tissue Inhibitor of Metalloproteinase 4

NM_003256.3 F: TGTGGCTCTTTCCGTCTTTC

R: GACCTCTGTTTCCCTGCCTA 101

CYC1 Cytochrome C-1 NM_001916.4 F: CAGATAGCCAAGGATGTGTG

R: CATCATCAACATCTTGAGCC 93

GAPDH Glyceraldehyde

3-Phosphate Dehydrogenase NM_002046.5

F: AGATCATCAGCAATGCCTCC

R: CATGAGTCCTCCCACGATAC 92

TBP TATA Box-Binding Protein NM_003194.4 F: CCACAGCTCTTCCACTCACA

R: CTGCGGTACAATCCCAGAAC 138


42

2.3.5 Analysis of conditioned media for secreted MMPs and TIMPs’ protein expression using

human Luminex assays

The Bio-Plex Pro™ Human 9-plex MMP (MMP-1, 2, 3, 7, 8, 9, 10, 12, and 13) and 4-

plex TIMP (TIMP-1-4) Luminex assays (Bio-Rad) were used to assess MMP secretion in NSM

and SCM. This assay allows for simultaneous detection of multiple analytes within a sample in

one well of a 96-well plate, through the use of magnetic beads coupled to individual monoclonal

antibodies specific for the analytes of interest. The Bio-Plex® system then detects and quantifies

the specific targets based on the spectral signatures (bead region) assigned to the magnetic beads

(xMAP Technology, Luminex Corporation, USA) and the amount of fluorescent signal from the

biotin-labeled detection antibodies and fluorescent streptavidin reporter complex bound to the

analytes in each sample.

Five milliliters of the NSM and SCM were analyzed for MMP/TIMP protein expression.

Prior to use, the frozen media was slowly defrosted at 4⁰C to prevent degradation of enzymes

and kit reagents were also brought to room temperature. Secreted MMP and TIMP protein

concentrations in the CM were assessed in 50 µL of the undiluted NSM and SCM samples with

0.5% BSA (in duplicate). The assays were performed according to the provided instruction

manuals. The plates were washed with the Hydroflex™ microplate washer (Tecan Group Ltd.,

Switzerland) and data acquisition was performed and analyzed using a Bio-Plex® 200 system

and Bio-Plex Manager™ 5.0 software (Bio-Rad).


43

2.3.6 In vitro model of mechanical stretch using primary rat myometrial cells

The direct effect of static mechanical stretch on the synthesis and secretion of

MMPs/TIMPs by myometrial SMCs in vitro was also investigated using a primary rat myometrial

cell model. Virgin female Wistar rats (12-15 weeks, 225-250g weight) were purchased from

Charles River Laboratories (Wilmington, MA) and housed in the MaRS Toronto Medical

Discovery Tower Animal Research Facility (Toronto, ON). They were maintained on standard rat

chow and water in a 12:12 hour light-dark cycle. The rats were subcutaneously injected with 50µg

of 17β-estradiol 24 hours prior to tissue collection.

Rats were euthanized by CO2 inhalation and whole uteri were collected and placed in

HBSS++ (with calcium and magnesium) supplemented with 1.25mL of Penicillin-Streptomycin-

Amphotericin B (Pen-Strep-AmpB) (Lonza BioWhittaker™, VWR International). Uteri were

placed inside a biological safety cabinet, rinsed with fresh HBSS++ (with Pen-Strep-AmpB), fat

and blood vessels were removed. The uteri were then cut into approximately 1mm-thick rings into

a 125mL Erlenmeyer flask and washed 3 times for 5 minutes with HBSS—(without calcium and

magnesium). Myocytes were enzymatically isolated by collagenase digestion: 10 ml of warm

enzyme mix were added and incubated with gentle shaking at 37⁰C for one hour. 10 mL of

dissociation mix were added to the flask and the mixture was pipetted 30 times to mechanically

disrupt the tissue. Next the entire solution was passed through a cell strainer (pore size 40 µm) to

separate the isolated myometrial cells and incompletely digested tissue. The strained cells were

placed on ice and 10mL of fresh warm enzyme mix were added to the incompletely digested

tissue. The flask was incubated with gentle agitation at 37⁰C for 30 minutes and the process was

repeated until all tissue was digested (5-6 times).


44

The collected cells were then centrifuged for 15 minutes at 4⁰C and 250 g, and the

supernatant was discarded. Cell pellets were resuspended with warm 10% FBS in high glucose

Dulbecco’s Modified Eagle Medium (DMEM, Gibco®, Life Technologies Inc.) and strained

through a 70µm cell strainer (BD Falcon™, BD Biosciences, Mississauga, ON, Canada). To

separate fibroblasts from primary rat myocytes, the cell suspension was plated on 15cm plastic

plates (~20 mL/plate) and incubated at 37⁰C for 30 minutes. Myocytes were collected, stained to

check their viability using 0.4% Trypan Blue solution (Lonza BioWhittaker™, VWR

International), counted using a hemocytometer (50µL of Trypan Blue and 50µL of cell

suspension) and plated on collagen I-coated 6-well Flexcell (Flexcell International Corp.,

Burlington, NC, USA) plates (2.2 million cells per well) with 3mL of DMEM. Cells were cultured

for 2-3 days until 75-80% confluent, then serum starved for 24 hours with 5mL of serum-free

DMEM with ITS-A (Life Technologies Inc.). Primary myocytes underwent a static mechanical

stretch for 2, 8, and 24 hours (25% elongation) using a computer-driven in vitro stretch system

(FX-5000, Flexcell International Corp.) in a 5% CO2, 37⁰C incubator. Control non-stretched

plates were left in the same incubator to provide similar environmental conditions.

2.3.7 Sample collection from rat culture plates, preparation and RT-PCR analysis of mRNA

expression

After 2, 8, and 24 hours media conditioned by non-stretched (NSM) and stretched

(SCM) cells were collected and plates were washed twice with ice-cold PBS. 1mL (per 3 wells

of the sample treatment) of TRIzol (Life Technologies Inc.) was added to 3 wells, cells were

scraped with cell scrapers (Sarstedt Inc., Montreal, QC, Canada) and TRIzol mix was

transferred to a 1.5mL tubes. Similar to Section 2.3.4, total RNA was isolated, reverse


45

transcribed to cDNA, and subjected to RT-qPCR analysis using the same primers as the in vivo

study (Table 2.1).

2.5 STATISTICAL ANALYSIS

For gestational profiles of the bilaterally pregnant rat model, analysis of statistically

significant differences between groups was performed on the natural log (ln) transformation of

the normalized data (relative to a corresponding GD6), unless otherwise stated, using one-way

ANOVA with the Newman-Keuls post-hoc test for multiple comparisons. Specifically for

samples collected from the unilaterally pregnant rat model, unless otherwise stated, statistical

analysis was performed on the normalized data (relative to a corresponding GD6e) using Two-

way ANOVA with Bonferroni’s post-hoc test for multiple comparisons. For in vitro studies,

statistical analysis was performed on the fold-change data (relative to a corresponding 24 hours

not-stretched sample) using one-way ANOVA and Newman-Keuls multiple comparisons test.

The level of significance was set at p<0.05 (*), p<0.01 (**) and p<0.001 (***). Significant

outliers within each data set were determined by the Grubb’s test (GraphPad Software, Inc., CA,

USA) and removed from analysis. All statistical analyses were performed using GraphPad

Prism version 5.0 (GraphPad Software, Inc.).

46

CHAPTER 3

RESULTS

Chapter 3: Results

47

CHAPTER 3 - RESULTS

3.1 INTRODUCTION

It is widely accepted that pregnancy is associated with changes in the cellular

characteristics and the extracellular composition of the uterus [14, 35, 82]. As it has been

previously reported, uterine SMCs in the myometrium and activated infiltrating immune cells can

produce extracellular matrix-degrading MMPs before TL and during the PP period [30, 31, 78,

82, 139]. This can result in restricted collagenolysis and can affect the function of cellular barriers

due to the broad variety of MMP substrates available in the uterus [30, 78, 99, 134, 136]. The

increasingly recognized role of MMPs as activators and regulators of inflammatory pathways

suggests their potential role as key immunoregulatory enzymes in reproductive tissues,

specifically in the myometrium [31, 75, 78, 82, 99, 124]. Therefore, we hypothesize that during

late pregnancy, the expression and activity of myometrial MMPs increases in preparation for two

major events: 1) term labour and 2) PP uterine involution. Our aim was to 1) characterize the

myometrial expression of MMPs and TIMPs during pregnancy, TL and PP, 2) define putative

mechanisms that regulate their expression and/or activity. Our findings will contribute to defining

the involvement of MMPs in inflammatory pathways within uterine tissue and will provide insight

on the mechanism responsible for labour induction.

Chapter 3: Results

48

3.2 GESTATIONAL REGULATION OF MMP GENE EXPRESSION IN THE RAT

MYOMETRIUM

Gestational regulation of MMP gene expression was assessed using two rat models of

pregnancy. Six sets of rat myometrial tissue were collected from bilaterally pregnant rats

throughout gestation (GD6, 8, 10, 12, 14, 15, 17, 19, 21, 22), during active term labour (GD23),

and the PP period (1PP and 4PP). In addition, four sets of rat myometrial tissue were collected

from both the empty (e) and gravid (g) uterine horns throughout gestation (GD6, 12, 15, 17, 19,

21, 23, 1PP) from unilaterally pregnant rats. mRNA levels of ten specific soluble MMPs and four

TIMPs was analyzed using RT-qPCR and normalized against three housekeeping genes: PPIA,

PDGF-A, and TBP or IGF1R (for bilaterally or unilaterally pregnant samples respectively) .

Specific focus was placed on analysing gestational changes in mRNA expression observed for

collagenases (MMP-1, 8, 13), gelatinases (MMP-2, 9), stromelysins (MMP-3, 10, 11), matrilysin

(MMP-7), metalloelastase (MMP-12) and TIMP-1, 2, 3, 4. The results acquired from RT-qPCR

analysis were expressed as a fold-change relative to GD6 (early gestation) to picture the change

in MMPs’ mRNA expression throughout gestation; data for MMP-1 was excluded due to the low

expression of mRNA transcripts observed (Ct values > 33). Statistical analysis for the bilaterally

pregnant tissues was performed on the non-transformed relative expression data (determined with

the computed ΔΔCT method) using one-way ANOVA and the Newman-Keuls multiple

comparisons test. Statistical analysis for the bilaterally pregnant tissues was performed on the

transformed relative fold-change data (relative to GD6e) using two-way ANOVA and

Bonferroni’s multiple comparisons test.

Chapter 3: Results

49

3.2.1 Myometrial MMP mRNA expression in the bilaterally pregnant rat model

mRNA levels of the well-studied class of soluble MMPs, the gelatinases (MMP-2&9),

determined by RT-qPCR were relatively stable throughout bilaterally pregnant rat gestation and

labour, with an increase in mRNA expression 1 day PP (Figure 3.1). Furthermore, MMP-2 mRNA

levels were consistently high throughout gestation (Ct values approximately 22-25) and were

upregulated 2-3-fold in the PP period (Ct values approximately 20-22) supporting a role of MMP-

2 in tissue remodeling 1) to accommodate the growing fetus and 2) for PP involution. In contrast,

mRNA levels for MMP-9 were lowly expressed throughout gestation as depicted by Ct values of

approximately 31-33. Similarly, mRNA levels of the collagenases (MMP-8&13) and two

stromelysins (MMP-3&10) were low throughout gestation compared to a sharp increase observed

1 day PP compared to GD6.

Most interesting is that the myometrial gene expression of MMP-7 (Figure 3.4) in

bilaterally pregnant rats was very low throughout gestation (GD6-GD21) but was dramatically

upregulated in the term rat myometrium (GD22, 200-fold increase) and further increased in the

labouring myometrium at GD23 (350-fold increase). Importantly, MMP-7 remained elevated 1

day PP (150-fold increase) and 4 day PP (20-fold increase). The drastic changes observed for

MMP-7 gene expression at term on GD22 could reflect a role for MMP-7 during the preparation

of the uterus for the active labouring process. The continuous expression of mRNA during GD23

and 1PP supports the role of this enzyme in tissue remodeling to support active labour contractions

and involution for transitioning the uterus back to a pre-pregnant state. Similar to MMP-7, MMP-

11 (stromelysin-3) exhibited sustained elevation of transcript levels during term, active labour and

PP which may indicate that this specific stromelysin is also important for promoting the labour

process and PP involution alongside MMP-7. Both genes displayed very similar gestational

Chapter 3: Results

50

profiles; however, only changes for MMP-7 were found to be significant during labour. Whereas

mRNA levels for MMP-12 were significantly elevated during GD22, they immediately decreased

during active labour (GD23) – suggesting the existence of a protective mechanism stabilizing the

myometrium during active labour contractions – and was again induced during the PP period.

This may suggest the observed changes to MMP-12 gene expression is contributed by immune

cells infiltrating the myometrium prior to labour and during PP involution.

Evidently, all MMPs studied experienced a significant increase in mRNA expression 1

day PP (1PP), and this highest level of mRNA expression validates their role for promoting tissue

remodeling during PP involution. In regards to their endogenous tissue inhibitors, TIMP-1 and

TIMP-2 gene expression was elevated at mid-gestation compared to the PP period, whereas TIMP-

3 and TIMP-4 expression was constant during gestation but elevated during the PP period (Figure

3.5). This correlates with the suggested role of TIMP-1 and TIMP-2 in suppressing MMP activity

during pregnancy whereas TIMP-3 and TIMP-4 may play more of a role in regulating tissue

remodeling in the PP period.

Chapter 3: Results

51

Figure 3.1: Gestational expression of Gelatinases’ mRNA in bilaterally pregnant, laboring

and postpartum (PP) rat myometrium.

Transcript levels of MMP-2 (A) and MMP-9 (B) were both significantly upregulated in the rat

myometrium during 1PP and 4PP compared to the rest of gestation supporting their role in PP

involution. mRNA expression was normalized to three housekeeping genes, Cyclophilin A

(PPIA), platelet-derived growth factor A (PDGF-A), and TATA-binding protein (TBP). Statistical

analysis (one-way ANOVA and the Newman-Keuls multiple comparisons test) was performed on

the ln-transformed data and are presented as fold-changes relative to a corresponding GD6 within

each run. The bars represent mean±SEM (n=5-6/GD). Bars with different letters are statistically

different from each other. p<0.001.

Chapter 3: Results

52

Figure 3.2: Gestational expression of Collagenases’ mRNA in bilaterally pregnant, laboring

and postpartum rat myometrium.

Transcript levels of Collagenases: MMP-8 (A) and MMP-13 (B) were both highly upregulated in

the rat myometrium during 1PP compared to the rest of gestation supporting their role for

promoting tissue remodeling in PP involution. mRNA expression was normalized to three

housekeeping genes, PPIA, PDGF-A, and TBP. Statistical analysis (one-way ANOVA and the

Newman-Keuls multiple comparisons test) was performed on the ln-transformed data and are

presented as fold-changes relative to a corresponding GD6 within each run. The bars represent

mean±SEM (n=5-6/GD). Bars with different letters are statistically different from each other.

p<0.001.

Chapter 3: Results

53

Figure 3.3: Gestational expression of Stromelysins’ mRNA in bilaterally pregnant, laboring

and postpartum rat myometrium.

Transcript levels of MMP-3 (A), MMP-10 (B) and MMP-11 (C) were significantly upregulated in

the rat myometrium during 1PP compared to the rest of gestation supporting their role their role

in PP involution. mRNA expression was normalized to three housekeeping genes, PPIA, PDGF-

A, and TBP. Statistical analysis (one-way ANOVA and the Newman-Keuls multiple comparisons

test) was performed on the ln-transformed data and are presented as fold-changes relative to a

corresponding GD6 within each run. The bars represent mean±SEM (n=5-6/GD). Bars with

different letters are statistically different from each other. p<0.001.

Chapter 3: Results

54

Figure 3.4: Gestational expression of Matrilysin (MMP-7) and Macrophage

Metalloelastase’s (MMP-12) mRNA in bilaterally pregnant, laboring and postpartum rat

myometrium. Transcript levels of MMP-7 (A) was induced in the rat myometrium during late gestation (GD22),

further increased during term labour (GD23), and remained elevated during the PP period. MMP-

12 (B) expression was induced during GD22, decreased during active labour (GD23) but

increased during the PP period. mRNA expression was normalized to three housekeeping genes,

PPIA, PDGF-A, and TBP. Statistical analysis (one-way ANOVA and the Newman-Keuls multiple

comparisons test) was performed on the ln-transformed data and are presented as fold-changes

relative to a corresponding GD6 within each run. The bars represent mean±SEM (n=5/GD). Bars

with different letters are statistically different from each other. p<0.001.

Chapter 3: Results

55

Figure 3.5: Gestational expression of TIMP mRNA in bilaterally pregnant, laboring and

postpartum rat myometrium.

mRNA expression of TIMP-1 (A) and TIMP-2 (B) remained constant throughout gestation while

transcript levels of TIMP-3 (C) and TIMP-4 (D) increased during the PP period. mRNA

expression was normalized to three housekeeping genes, PPIA, PDGF-A, and TBP. Statistical

analysis (one-way ANOVA and the Newman-Keuls multiple comparisons test) was performed on

the ln-transformed data and are presented as fold-changes relative to a corresponding GD6 within

each run. The bars represent mean±SEM (n=5/GD). Bars with different letters are statistically

different from each other. TIMP-1&2 p<0.01, TIMP-3&4 p<0.001

Chapter 3: Results

56

Chapter 3: Results

57

Figure 3.6: Comparative characteristics of MMP and TIMP gene expression in the

pregnant, term labour, and postpartum rat myometrium. A) Relative gene expression of stromelysins (MMP-10,3 & 11), B) matrilysin (MMP-7) and

metalloelastase (MMP-12), C) collagenases (MMP-8 & 13), D) gelatinases (MMP-2 & 9), and

E) TIMPs (TIMP-1-4). Normalized expression of mRNA levels (as calculated by the ΔΔCT

method) were expressed as a fold-change relative to MMP-10’s (lowest expression among all

MMPs and TIMPs) gene expression on GD6, which was chosen as a calibrator for a

comparative study.

Chapter 3: Results

58

Total mRNA expression throughout gestation, TL and PP for MMPs and TIMPs was

further analyzed in a comparative study. The normalized expression calculated by the ΔΔCT

method (Bio-Rad CFX Manager software) were compared to visualize the relative gestational

changes of the MMPs and TIMPs genes studied (Figure 3.6). MMP-10’s gene expression was

lowest among all MMP and TIMP therefore MMP-10’s expression on GD6 was chosen as a

calibrator. The data were analyzed and grouped by MMP classes and revealed that all (the

stromelysins, matrilysin, metalloelastase, and collagenases) exhibited low mRNA abundance

throughout gestation. In contrast, the gelatinases were highly expressed throughout gestation

relative to other MMP subgroups, especially MMP-2, showing at least a 200-fold relative

expression compared to MMP-10. Relative to MMP-10, the other stromelysins (MMP-3 & 11),

collagenases and gelatinases showed the highest increase 1PP (at least 350-fold), whereas MMP-

7 and MMP-12 show weaker increases in mRNA on 1PP (150-fold). Furthermore MMP-7

displayed the highest level of gene expression (at least 550-fold relative expression) during active

TL compared to all MMPs and TIMPs analyzed. This comparative study further suggests the

abundance of MMP mRNA is MMP-specific during TL to regulate myometrial function, and all

MMPs are upregulated in the PP period to promote post-labour remodeling of the uterus.

Interestingly, the TIMPs’ mRNA levels were also highly expressed compared to the

majority of MMPs (except for the gelatinases) throughout gestation, supporting their involvement

in regulating MMP activity. TIMP-2 exhibited the highest level of TIMP expression throughout

gestation, while TIMP-1 & 3 had a similar pattern of expression similar to that of the gelatinases.

These findings support the inhibitory role of TIMP-2 for the majority of MMPs, and potential

interaction between TIMP-1 & 3 with MMP-2 & 9 to form inhibitory complexes in the rat

myometrium throughout gestation. Importantly, TIMP-3 & 4 were highly upregulated PP (450-

fold), suggesting their role in regulating uterine involution.

Chapter 3: Results

59

3.2.2 Myometrial MMP mRNA expression in the unilaterally pregnant rat model

To assess the effect of biological uterine stretch on the expression of MMPs/TIMPs in

vivo, a unilaterally pregnant rat model was used (in collaboration with Dr. O. Shynlova).

Myometrial tissues from empty (non-pregnant) and gravid (pregnant) uterine horns were collected

at different gestational days. Gene expression was normalized to three housekeeping genes (PPIA,

PDGF-A, and IGFR1) and expressed as fold-changes relative to a GD6 empty (e) horn sample.

As expected, gene expression of all MMPs was very low in the empty horn myometrium during

gestation and term labour. Analysis of the full spectrum of specific soluble MMPs in the gravid

uterine horn (described above for bilaterally pregnant rats) showed a very similar expression

profile during pregnancy, labour and the PP involution period. There were no statistically

significant differences (by Bonferroni’s multiple comparisons test) in mRNA expression between

the empty and gravid horn during gestation and active labour (GD23) of the gelatinases (MMP-2

and 9) and the majority of the MMPs studied (MMP-3, 8, 10, 11, 12).

However, MMP-3, 8, 9, 10, and 12 all exhibited a significantly higher expression of

transcript levels in the gravid horn compared to the empty horn on 1 day PP (Figure 3.7-3.9). A

dramatic increase in mRNA expression of the stromelysin MMP-11 was observed in both the

empty and gravid horns 24 hours after term labour, possibly indicating that expression of this gene

during the PP period was regulated by hormonal changes rather than by the release of mechanical

stretch of the uterus after the expelling of the fetuses. Furthermore, the upregulation of certain

MMP mRNA 1 day PP specifically in the gravid horn and not the empty shows a correlation with

remodeling the pregnant tissue back to a non-pregnant state.

Chapter 3: Results

60

Figure 3.7: Expression of Gelatinases MMP-2 (A) and MMP-9 (B) genes in the myometrium

of unilaterally pregnant rats during gestation, term labour and postpartum. Transcript levels in empty (white bars) and gravid (gray bars) uterine horns were normalized to

three housekeeping genes, PPIA, PDGF-A and IGFR1 levels and expressed in fold-changes

relative to a GD6 empty sample. The bars represent meanSEM (n=3-4/GD). Statistical analysis

was performed on the natural log-transformed data using two-way ANOVA and the Bonferroni’s

multiple comparisons test. A significant difference between the gravid and empty horn of the same

gestational day is indicated by *** (p<0.001). Gestational days with different letters (gravid horn)

or Greek symbols (empty horn) are statistically different from each other within the respective

horns; p<0.05. Gestational days without letters or Greek symbols are not statistically different

from each other by two-way ANOVA.

Chapter 3: Results

61

Figure 3.8: Expression of Stromelysins MMP-3 (A), MMP-10 (B) and MMP-11 (C) genes in

the myometrium of unilaterally pregnant rats during gestation, term labour and

postpartum.

Transcript levels in empty (white bars) and gravid (gray bars) uterine horns were normalized to

three housekeeping genes, PPIA, PDGF-A, and TBP and expressed in fold-changes relative to a

GD6 empty sample. The bars represent meanSEM (n=3-4/GD). Statistical analysis was

performed on the relative fold-change data using two-way ANOVA and the Bonferroni’s multiple

comparisons test. A significant difference between gravid and empty horn of the same gestational

day is indicated by *** (p<0.001). Gestational days with different letters (gravid horn) or Greek

symbols (empty horn) are statistically different from each other within the respective horns;

p<0.05. Gestational days without letters or Greek symbols are not statistically different from each

other by two-way ANOVA.

Chapter 3: Results

62

Figure 3.9: Expression of Collagenase (MMP-8, A), Matrilysin (MMP-7, B) and

Metalloelastase (MMP-12, C) genes in the myometrium of unilaterally pregnant rats during

gestation, term labour and postpartum.

Transcript levels in empty (white bars) and gravid (gray bars) uterine horns were normalized to

three housekeeping genes (PPIA, PDGF-A, and TBP) expressed in fold-changes relative to a GD6

empty sample. The bars represent meanSEM (n=3-4/GD). Statistical analysis was performed on

the relative fold-change data (MMP-3&7) or ln-transformed data (MMP-12) using two-way

ANOVA and the Bonferroni’s multiple comparisons test. A significant difference between gravid

and empty horn of the same gestational day is indicated by *(p<0.05), ** (p<0.01), ***

(p<0.001). Gestational days with different letters (gravid horn) or Greek symbols (empty horn)

are statistically different from each other within the respective horns; p<0.05. Gestational days

without letters or Greek symbols are not statistically different from each other by two-way

ANOVA.

Chapter 3: Results

63

Interestingly, in the case of MMP-7, we observed upregulation of mRNA in the gravid

(pregnant) horn as compared to the empty horn during GD23, suggesting an effect of either

mechanical stretch or the presence of the fetal/placental unit on MMP-7’s transcript levels (Figure

3.9). More specifically, the induction of uterine contractions during labour and the removal of

mechanical stretch after expelling of fetuses may be involved with the upregulation of MMP-7.

This phenomenon was also observed for MMP-12, which also displayed higher mRNA levels

within the gravid horn during late gestation in addition to TL and PP – beginning from GD19 –

compared to the empty horn, suggesting a correlation between MMP-12 mRNA expression and

myometrial transition to a contractile phenotype in preparation for active TL. On the contrary, we

also detected a significant upregulation of MMP-7 in the empty uterine horn during active labour

contractions suggesting mechanical stretch is not the sole regulator of gene expression. These

findings support the hypothesis of 1) MMPs having a dual role in the myometrium as key

regulators of tissue remodeling during labour and PP involution and 2) different regulatory

mechanisms exists in the transcriptional activation of different MMP genes.

Chapter 3: Results

64

3.3 GESTATIONAL REGULATION OF MMP PROTEIN EXPRESSION IN THE RAT

MYOMETRIUM

3.3.1 Western blot analysis of MMP levels and gelatin zymography of the myometrial tissue from

bilaterally pregnant rats

To investigate whether the upregulated expression of mRNA transcripts resulted in the

production and secretion of MMPs by the myometrium, gestational changes in protein levels were

further assessed by WB. Specific interest was on the well-studied gelatinases (MMP-2&9), the

collagenase (MMP-8), the major stromelysins (MMP-3&11), and the uterine matrilysin (MMP-

7) to identify any correlation between mRNA gestational changes with protein expression.

Statistical analysis was performed on the ln-transformed relative fold-change data using one-way

ANOVA and Newman-Keuls multiple comparisons test.

MMP-8 is a major collagenase known to be secreted mainly by neutrophils and has a high

affinity for fibrillar collagen I, a major component of the uterine ECM. MMP-8 protein expression

was highly expressed with no significant changes throughout gestation, TL, and PP. This,

however, did not correlate with transcript levels that exhibited a dramatic increase 1 day PP.

Chapter 3: Results

65

Figure 3.10: Protein levels of Collagenase MMP-8 in the rat myometrium throughout

gestation, labour and post-partum. Representative Western blots (A) and densitometric analysis of Neutrophil Collagenase (B,

MMP-8) protein expression levels were normalized to Calponin. Statistical analysis (one-way

ANOVA) was performed on the ln-transformed data and are presented as fold-changes relative to

a corresponding GD6 within each run. Bar graphs showing the meanSEM (n=4/GD). Any

differences between gestational days were not found to be statistically significant by one-way

ANOVA.

Chapter 3: Results

66

Figure 3.11: Protein levels of Stromelysins in the rat myometrium throughout gestation,

labour and postpartum. Representative Western blots (A) and densitometric analysis of Stromelysins (B, MMP-3 and C,

MMP-11). MMP protein expression levels were normalized to Calponin. Statistical analysis (one-

way ANOVA and Newman-Keuls multiple comparisons test) was performed on the ln-

transformed data and are presented as fold-changes relative to a corresponding GD6 within each

run. Bar graphs showing the meanSEM (n=4/GD). Bars with different letters are statistically

different from each other (MMP-11 p<0.01). Gestational days without letters are not statistically

different from each other by one-way ANOVA.

Chapter 3: Results

67

Figure 3.12: Protein levels of Matrilysin and Metalloelastase in the rat myometrium

throughout gestation, labour and post-partum. Representative Western blots (A) and densitometric analysis of Matrilysin (B, MMP-7) and

Metalloelastase (C, MMP-12). MMP protein expression levels were normalized to Calponin.

Statistical analysis (one-way ANOVA and Newman-Keuls multiple comparisons test) was

performed on the ln-transformed data and are presented as fold-changes relative to a

corresponding GD6 within each run. Bar graphs showing the meanSEM (n=4/GD). Bars with

different letters are statistically different from each other (MMP-7 p<0.001 and MMP-12 p<0.05).

Gestational days without letters are not statistically different from each other by one-way

ANOVA.

Chapter 3: Results

68

Stromelysins, known to cleave a variety of ECM substrates, mRNA levels were

dramatically upregulated during PP involution, however, the protein immunoblot analysis of the

major stromelysin MMP-3 showed stable protein levels throughout gestation, labour and PP. On

the contrary, active stromelysin MMP-11 protein showed a dramatic upregulation at late gestation

(starting from GD17) and a significant increase in protein expression on GD23, as compared to

early gestation. The gestational profile for protein expression of MMP-7 and MMP-12 were also

analyzed using WB analysis. MMP-7 (29 kDa) was significantly upregulated on GD23 (Figure

3.12) and depicts a similar pattern as transcript levels of MMP-7 (Figure 3.4). MMP-12 was highly

and relatively stable expressed throughout gestation, with a slight increase in protein expression

in the early PP period (Figure 3.12). This MMP-12 protein expression pattern was different to

MMP-12 gene, which was increased 150-fold on GD22 (Figure 3.4) but this upregulation was not

seen at the protein level. The observed increase in protein levels of MMP-7 and MMP-11 on

GD23 suggest their involvement in tissue remodeling of the myometrium to promote labour

contractions.

Protein activity observed for active MMP-2 using gelatin zymography (Figure 3.13)

showed a significant induction at 1 day PP, a profile similar to the expression of MMP-2 gene.

Active MMP-9 protein activity detected by gelatin zymography was very low and could not be

accurately analysed.

Chapter 3: Results

69

Figure 3.13: Representative Gelatin Zymography (A) and Densitometric analysis (B), (C).

Gelatinase activity of total protein (50µg/well) in rat myometrial tissues throughout gestation,

labour and postpartum (visualized as light bands and presented as fold-change relative to a

corresponding GD6). MMP-2 activity is observed predominantly at 68 kDa (latent pro-form) and

62 kDa (active form). MMP-9 at 92 kDa (latent pro-form) and 87 kDa (active form) was very low

throughout gestation MMP-9 was observed in the decidua conditioned media used as a positive

control (+ve). (B) Densitometric analysis of the gelatin zymography; bars represent the relative

density of MMP-2. The results shown are the mean±SEM (n=4/GD). Statistical analysis (one-

way ANOVA and Newman-Keuls multiple comparisons test) was performed on the fold-change

data. Significant differences between gestational days were indicated by different letters (pro-

MMP-2 p<0.01 and active MMP-2 p<0.001).

Chapter 3: Results

70

3.3.2 Western blot analysis of MMP levels and gelatin zymography of the myometrial tissue from

unilaterally pregnant rats

We examined whether the differences in MMP-7 mRNA expression between the empty

and gravid horn observed during GD23 and 1PP, resulted in similar changes in protein levels.

Visually, there were no differences in MMP-7 protein expression between the gravid and empty

horns during labour and 1PP. Yet statistical analysis (two-way ANOVA and Bonferroni’s multiple

comparisons test) revealed that MMP-7 protein expression in the gravid horn was statistically

significantly different from the empty horn. This phenomenon is due to the inexplicable dramatic

decrease in the expression of the housekeeping protein calponin (that we used as a loading control)

in the gravid horn myometrium 1 day PP (Figure 3.14). Furthermore, calponin was only detectable

in three of the four data sets for gravid 1PP thus the only optical density detected for 1PP was

applied to the remaining three data sets for normalization. This decrease in expression was also

observed in the bilaterally pregnant rat model (Figure 3.10-12), however, for unknown reason,

the down-regulation was more dramatic in the unilaterally pregnant model. Interestingly, this

correlates with Brodt-Eppley and Myatt, who also used calponin for normalization and detected

a slightly lower expression of calponin during early PP in the bilaterally pregnant rat myometrium

[154].

Surprisingly, immunoblot analysis of MMP-12 protein expression revealed an increase in

active MMP-12 expression (not detected in the bilaterally pregnant myometrium) within the

gravid horn compared to the empty horn (Figure 3.14). These results further confirm that MMP

expression is not exclusively regulated by mechanical stretch of the rat myometrium, but rather

other mechanisms, potentially endocrine factors or activated leukocytes (known sources of MMP

secretion) might also be responsible for the difference in MMP expression within the empty and

Chapter 3: Results

71

gravid uterine horns [78, 85]. For instance, the PP MMP-12 could be secreted by infiltrating

macrophages [20, 30, 82].

Gelatin zymography revealed a similar expression profile between pro-MMP-2 protein

and MMP-2 mRNA throughout gestation, depicting no differences between the empty and gravid

uterine horns (Figure 3.15). In contrast, starting from early gestation until term active MMP-2

was higher in the empty horn compared to the gravid horn. This suggests that during gestation

and labour, MMP-2 activity in the gravid horn is suppressed by the presence of fetal/placental

unit and it is activated during PP for the remodeling/involution process, when the fetuses are

expelled. We speculate that in the empty horn, this suppression is absent due to a lack of factors

produced by placenta and/or fetus.

Chapter 3: Results

72

Figure 3.14: Protein levels of Matrilysin and Macrophage Metalloelastase in the unilaterally

pregnant rat myometrium throughout gestation, labour and postpartum. Representative Western blots (A) and densitometric analysis of Matrilysin (B, MMP-7) and

MMP-12 (C, pro-MMP-12 and D, active MMP-12). MMP protein expression levels were

normalized to Calponin and expressed as fold-change relative to a GD12 empty horn (e) sample.

Bar graphs showing the meanSEM (n=4/GD). Statistical analysis was performed on the relative

fold-change data using two-way ANOVA and the Bonferroni’s multiple comparisons test. A

significant difference between the gravid and empty horn of the same gestational day is indicated

by *** (p<0.001). Gestational days with different letters (gravid horn) or Greek symbols (empty

horn) are statistically different from each other within the respective horns; p<0.05. Gestational

days without letters or Greek symbols are not statistically different from each other by two-way

ANOVA.

Chapter 3: Results

73

Figure 3.15: Representative Gelatin Zymography (A) and Densitometric analysis (B), (C).

Gelatinase activity of total protein (50µg/well) in unilaterally pregnant rats presented as empty

(e) vs. gravid (g) (visualized as light bands). Densitometric analysis was presented as fold-change

relative to the GD6 empty horn (6e). MMP-2 activity is observed predominantly at 68 kDa (latent

pro-form) and 62 kDa (active form). MMP-9 at 92 kDa (latent pro-form) and 87 KDa (active

form) was undetectable throughout gestation similar to the bilaterally pregnant rats. (B)

Densitometric analysis of the gelatin zymography; bars represent the relative density of MMP-2.

The results shown are the mean±SEM (n=4/GD). Statistical analysis was performed on the

relative fold-change data using two-way ANOVA and the Bonferroni’s multiple comparisons test.

A significant difference between the gravid and empty horn of the same gestational day is

indicated by *(p<0.05), ** (p<0.01), and *** (p<0.001). Gestational days with different Greek

symbols are statistically different from each other within the empty horn; p<0.05. Gestational

days without letters or Greek symbols are not statistically different from each other by two-way

ANOVA.

Chapter 3: Results

74

3.4 TEMPORAL AND SPATIAL LOCALIZATION OF MMPs IN THE RAT

MYOMETRIUM

3.4.1 Tissue localization of MMP in the rat myometrium by immunohistochemistry

Temporal localization of MMP proteins was first assessed in formalin-fixed and paraffin-

embedded tissue sections collected during mid-gestation (GD15), late gestation (GD21), term

labouring (GD23) and 1 day PP using antibodies specific to MMP-7 (Figure 3.16), MMP-9

(Figure 3.17), and MMP-11 (Figure 3.18). MMPs were localized to both longitudinal (LM) and

circular (CM) myometrial layers throughout gestation. We noticed a difference in the spatial

localization of MMPs: during mid-and late-gestation myometrial MMP expression was

predominantly intracellular within the perinuclear region of SMCs, however during TL and PP

involution there was a shift to extracellular localization.

Interestingly, MMP-7 and 9 were highly expressed at term (GD21) and during labour

(GD23) but only MMP-7 remained elevated PP. Immunostaining results suggests that MMP-9

protein is expressed within the rat myometrium during gestation although the enzyme is not active

(as revealed by gelatin zymography, Figure 3.13). MMP-11 expression was seen primarily

intracellular throughout gestation with highest extracellular levels during 1PP. Altogether we

observed that intracellular and extracellular MMP protein expression in the rat uterus is increased

as gestation progresses towards term labour and peaked during PP involution. In addition, MMP

expression was not only observed in myometrial SMCs but very often much stronger staining was

detected in cells morphologically distinct from SMCs – suggestive of infiltrating immune cells –

localized especially around myometrial blood vessels and in the vascular plexus, the area between

longitudinal and circular myometrial layers.

Chapter 3: Results

75

Figure 3.16: Temporal and spatial localization of MMP-7 in pregnant, labouring and

postpartum rat uterus.

Tissue sections from GD 15, GD21, labouring (GD23), and 1 day PP (1PP) rat uteri were

immunostained for MMP-7 (brown immunostain) and counterstained with haematoxylin. Positive

immunostaining was observed in both the circular myometrial layer (CM), longitudinal

myometrial layer (LM) and decidua (Dec) throughout gestation. Single cell staining (red arrow)

is suggestive of MMP-7 expression by infiltrating immune cells while perinuclear staining

suggests expression by SMCs. Intracellular and extracellular expression of MMP-7 increased

drastically in GD23 and 1PP animals. No staining was detected in the negative control slide (1PP)

using rabbit IgG. Magnification: 100x

Chapter 3: Results

76




immunostained for MMP-9 (brown immunostain) and counterstained with haematoxylin. Positive

immunostaining for MMP-9 was observed in the longitudinal myometrial layer (LM), the circular

myometrial layer (CM), and the decidua throughout gestation. Expression was predominantly

perinuclear during mid and late gestation (GD15, GD21) and PP by smooth muscle cells.

Increased extracellular expression of MMP-9 was primarily observed in the LM during labour,

with some expression present in non-SMC cells (red arrow) suggestive of infiltrating immune

cells. MMP-9 expression began to decrease in PP animals. No staining was detected in the

negative control slide (GD23) using rabbit IgG. Magnification: 100x

Chapter 3: Results

77




immunostained for MMP-11 (brown immunostain) and counterstained with haematoxylin.

Positive immunostaining was observed in both the circular myometrial layer (CM), longitudinal

myometrial layer (LM) and decidua (Dec) throughout gestation. Expression was predominantly

perinuclear in SMCs and present in non-SMC single cells (red arrow) suggestive of infiltrating

immune cells. Some extracellular expression of MMP-11 was observed in the LM during late

gestation and labour, and further increased in the CM during GD23 and 1PP. No staining was

detected in the negative control slide (GD23) using rabbit IgG. Magnification: 100x

Chapter 3: Results

78

3.4.1 Tissue localization of MMP activity in the rat myometrium by in situ zymography

Spatial distribution/localization of MMP enzymatic activity was performed using in situ

zymography with different ECM substrates (Figure 3.19). Four sets of rat uteri were collected at

GD15, 21, 22, 23 and 1 day PP, fixed in a zinc-buffered fixative and paraffin-embedded. This

methodology was adapted from Hadler-Olsen et al., who reported that zinc fixation and paraffin

embedding was able to preserve tissue morphology and enzymatic activity better than that of

frozen sections [155]. Tissue localization of MMP activity was detected in the uterine sections

incubated with fluorescent substrates (1) DQ-gelatin, (2) DQ-type I collagen and (3) DQ-type IV

collagen. These substrates were chosen based on a study by Gonzales et al. that reported these

three ECM proteins are actively degraded by major MMPs in mice [102, 156]. Increased

fluorescence indicated increased gelatin and collagen degradation by MMPs. To verify that the

observed fluorescence is due to protease activity, negative control sections were pre-incubated

with buffer containing 10 mM EDTA to inhibit MMPs which was followed by substrate

application.

Chapter 3: Results

79

Figure 3.19: Representative images for in situ zymography using fluorescent MMP

substrates: DQ gelatin (second column), DQ collagen type I (third column) and DQ collagen

type IV (right column) for tissue localization of MMP activity.

Increased green fluorescence (increased gelatin, collagen I and IV degradation) was localized

intracellularly to the perinuclear region of the myometrial cytoplasm during late gestation

(D21&22) and term labour (D23), however during 1 day PP (1PP) fluorescence was mostly

detected extracellularly in the myometrial parenchyma. Sections were pre-incubated with 0.02M

EDTA for 1 hour, then incubated with EDTA+substrate as the negative control (EDTA+gelatin)

of fluorescence. Slides were counter-stained with DAPI (nuclear staining). Magnification: 100x

Chapter 3: Results

80

In situ zymography indicated high levels of MMP activity for gelatin and collagen I

degradation were localized to the perinuclear region of individual myometrial SMCs at term

(GD22) and during labour (GD23). Importantly, MMP activity was highly upregulated in the

myometrial parenchyma on 1 day PP as shown by increased fluorescence, depicting degradation

of gelatin, collagen I and collagen IV. Similar to Immunohistochemical analysis, numerous single

cells morphologically different from SMCs were also observed in myometrial tissue in a close

proximity to blood vessels. We speculated that in addition to SMCs, immune cells may also be a

source of MMP expression. This hypothesis was tested by performing immunofluorescent

staining for CD45 (leukocyte common antigen) and CD68 (macrophage marker) immediately

following in situ zymography.

CD45 immunofluorescent staining in combination with in situ zymography depicted co-

expression of CD45 (red fluorescence) and protease activity (green fluorescence – gelatin

degradation) by activated immune cells (Figure 3.20). These data support the notion that

infiltrated leukocytes within the myometrium expresses MMPs either to aid in their migration by

increasing EC permeability, or to remodel the myometrium to promote the labouring process and

PP involution. Specific subgroup of leukocytes, CD68+ macrophages, have been previously

shown to infiltrate into uterine tissues (myometrium and decidua) before TL and during PP

involution [20, 28]. Further investigation of immunofluorescent co-staining for CD68 and in situ

zymography indicated that macrophages are one of the leukocytes responsible for myometrial

MMP expression. Importantly, macrophages show expression of gelatin, collagen I and collagen

IV-degrading proteases as seen by co-staining of green (protease activity) and red fluorescence

(CD68). (Figure 3.21-23), which suggests that they are partially responsible for total MMP gene

and/or protein expression detected in myometrium.

Chapter 3: Results

81

Figure 3.20: Gelatinase activity of rat myometrium and tissue leukocytes during late

gestation (GD21, 22), term labour (D23) and postpartum (1PP).

Representative images showing co-localization of in situ gelatin zymography (green) and

immunofluorescence of the leukocyte common antigen CD45 (red). Co-immunostaining indicates

that leukocytes (arrows) recruited into the myometrium during gestation, labour, and PP expressed

gelatinases along with smooth muscle cells. Slides were counter-stained with DAPI (blue nuclear

staining). Images were acquired using Volocity software and a spinning-disc confocal microscope

at 400x magnification.

Chapter 3: Results

82

Figure 3.21: Representative images from in situ gelatin zymography and CD68

immunofluorescence.

Co-immunostaining for CD68 (red) following in situ zymography indicated that macrophages

(arrows) infiltrated into the myometrium also expressed gelatinases along with smooth muscle

cells. Slides were counter-stained with DAPI (blue nuclear staining). Images were acquired using

Volocity software and a spinning-disc confocal microscope at 400x (GD15 and GD21) and 600x

(GD23 and 1PP) magnification.

Chapter 3: Results

83

Figure 3.22: Representative images from in situ collagen I zymography and CD68

immunofluorescence.


(arrows) infiltrated into the myometrium also expressed collagen I-degrading enzymes along with

smooth muscle cells. Slides were counter-stained with DAPI (blue nuclear staining). Images were

acquired using Volocity software and a spinning-disc confocal microscope at 400x magnification.

Chapter 3: Results

84

Figure 3.23: Representative images from in situ collagen IV zymography and CD68

immunofluorescence.


(arrows) infiltrated into the myometrium also expressed collagen IV-degrading enzymes along

with smooth muscle cells. Slides were counter-stained with DAPI (blue nuclear staining). Images

were acquired using Volocity software and a spinning-disc confocal microscope at 400x

magnification.

Chapter 3: Results

85

3.5 IN VITRO PRIMARY CELL MODEL OF MECHANICAL STRETCH

3.5.1 In vitro primary rat myometrial cell model of mechanical stretch

Numerous studies indicate that MMP expression and activity is regulated by mechanical

stretch in different cell types [157-160]. To examine the direct effect of mechanical stimuli on the

expression of MMPs, we developed an in vitro culture system using primary myometrial cells.

Primary myocytes were enzymatically isolated from 10 uteri collected from virgin estrogenized

rats and plated on 6-well flexplates coated with collagen I (n=3). The number of isolated cells

differed significantly between 3 consecutive cell cultures. To simulate biological mechanical

stretch of the uterine horn by growing fetus, primary myometrial cells were artificially stretched

for 2, 8 and 24 hours (25% elongation) and the expression of different MMPs and TIMPs was

analyzed using specific rat primers. Stretch- related changes in mRNA expression were minimal

and the expression was highly variable between three cultures, possibly due to a difference in

characteristics of the isolated primary cells.

We also studied the activity of the protein secreted by those cells into the SCM. We found

that protein expression of secreted MMP-7 and MMP-11 were undetectable in the collected NCM

and SCM when compared with an in vivo rat myometrial GD15 sample as positive control. Pro-

and active-MMP-2 (69 and 62 kDa) and active MMP-9 (84kDa) were detected by zymography,

however, there was no effect of stretch (S) compared to non-stretch (NS) on protein expression

and activity (data not shown). Thus as an alternative approach, the effect of in vitro static

mechanical stretch on MMP expression was assessed using a primary human myometrial cell

culture model.

Chapter 3: Results

86

3.5.2 In vitro primary human myometrial cell model of mechanical stretch

Human primary myometrial cells enzymatically isolated from term non-labouring tissue

biopsies were characterized by immunofluorescent cytochemistry (ICC) to assess their phenotype

at passage 0, 1, 2 and 4. ICC assessment suggests that cultured primary myometrial cells are

myofibroblasts characterized by the co-expression of fibroblastic (Vimentin) and smooth muscle

(Desmin, SMA, and H-Caldesmon) differentiation markers (Figure 3.24).

Figure 3.24: Representative immunocytochemical fluorescent images of primary human

myometrial cells at passage 0, 2 and 4.

Cells were characterized for expression of differentiation markers for fibroblasts and smooth

muscle cells. Primary myometrial cells were plated directly after enzymatic isolation (passage 0),

and following the 2nd and 4th passages; they expressed markers for differentiated fibroblasts

(Vimentin) and some (arrows) expressed markers for differentiated smooth muscle cells (Desmin,

Smooth Muscle Actin, H-Caldesmon). Images were acquired using Velocity software and a

spinning-disc confocal microscope at 200x magnification.

Chapter 3: Results

87

As seen in Figure 3.23, cells enzymatically isolated from pregnant human uterine tissue at

passage 0 are primarily fibroblasts expressing Vimentin, with some cells expressing smooth

muscle differentiation markers. Following the 1st (not shown) and 2nd passage, these cultured

myometrial cells begin to increasingly differentiate towards a myofibroblast phenotype by up-

regulating SMA and H-Caldesmon expression, while still retaining expression of the fibroblast

marker Vimentin. By passage 4, the majority of cells in culture were myofibroblasts, by

simultaneously expressing of Vimentin, Desmin, SMA and H-Caldesmon. Since this in vitro

primary human cell culture model is phenotypically variable from cells present in the in vivo

environment, I suggest that these cells may behave differently in response to static mechanical

stretch.

After the 4th passage, approximately 200,000 myometrial cells were plated on collagen I-

coated 6-well flex (containing flexible membranes) plates (Flexcell Inc., n=4) and left to grow to

confluency (75-80%) prior to serum starvation for 24 hours. Immediately following serum

starvation, static mechanical stretch (25% elongation) was applied to the flex plates for 24 hours

(24h S) or 24 hours of stretch followed by 24 hours of relaxation (24h S + 24h R). For both groups

(S and S+R) there were non-stretched cells incubated for the same time interval (24h NS and 48h

NS). Cell viability after stretch and stretch with relaxation was assessed using PI-FDA staining

and confirmed that stretch did not induce cell death since there was no significant increase in PI-

positive cells after stretch as compared to static non-stretched cells (Figure 3.25).

Chapter 3: Results

88

Figure 3.25: Representative images from assessment of cell viability following mechanical

stretch of primary human myometrial cells.

The assessment of cell viability following 24 hours static stretch and additional 24 hours for

relaxation, was employed using propidium iodide (PI) and fluorescein diacetate (FDA) staining.

FDA (green) revealed live cells while PI (red) revealed cell death. There was minimal strain of

static mechanical stretch on the cell viability. Images were acquired using the Volocity software

and a spinning-disc confocal microscope at 200x magnification.

Chapter 3: Results

89

3.5.3 In vitro mechanical stretch does not influence myometrial MMPs gene expression

Total RNA was extracted from the myometrial cells collected with TRIzol® (Life

Technologies) and the mRNA was reversed transcribed to cDNA for RT-qPCR analysis. The

entire set of MMPs and TIMPs was assessed using human primers (similar to section 3.2),

however, only MMP-1, 2, 3, 11 and TIMP-1 & 2 were expressed (Ct values ≤ 33) by cultured

primary human myometrial cells (Figure 3.26-3.28). The data suggests that there was no

significant effect of stretch on MMP-1, 2, 3, 11 and TIMP-1 & 2 mRNA expression. Additionally,

it was observed that 24 hour static mechanical stretch followed by an additional 24 hours in culture

without stretch (to simulate the relaxation observed in the PP period) modified mRNA expression

for MMP-1, 2, 3 and 11 as compared to cells stretched for 24 hours. However, this trend was

similar for both non-stretched and stretch plates, indicating that there is an indirect effect of time

in culture rather than stretch. We also noticed that in non-stretched myometrial cultures MMP-1,

and MMP-3 exhibited a decrease in mRNA expression, while MMP-2, MMP-11 and TIMP-2

exhibited an increase after being in culture for 48 hours as compared to 24 hours group.

Chapter 3: Results

90


mechanical stretch of primary human myometrial cells.

Transcript levels of MMP-1 (A) and MMP-2 (B) expressed by 24 hour non-stretched (24h NS),

24 hour stretched (24h S), 48 hour non-stretched (48h NS) and 24 hour stretch + 24 hour relaxation

(24h S + 24h R), were normalized to three housekeeping genes, TATA-binding protein (TBP),

cytochrome C1 (CYC1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and expressed as

fold-change relative to 24 hours Non-Stretch. The bars represent mean±SEM (n=3-4 at each time

point). Statistical analysis (one-way ANOVA and Newman-Keuls multiple comparisons test) was

performed on the relative fold-change data. Significant differences between gestational days are

indicated by asterisks, * (p<0.05), ** (p<0.01).

Chapter 3: Results

91



Transcript levels of MMP-3 (A) and MMP-11 (B) expressed by 24 hour non-stretched (24h NS),




fold-change relative to 24 hours Non-Stretch. The bars represent mean±SEM (n=3-4 at each time


performed on the relative fold-change data.Significant differences between gestational days are

indicated by asterisks, * (p<0.05), ** (p<0.01), and *** (p<0.001).

Chapter 3: Results

92

Figure 3.28: Expression changes in mRNA levels of TIMPs as an effect of in vitro static


Transcript levels of TIMP-1 (A) and TIMP-2 (B) expressed by 24 hour non-stretched (24h NS),




fold-changes relative to 24 hours Non-Stretch. The bars represent mean±SEM (n=3-4 at each time


performed on the relative fold-change data. Significant differences between gestational days are

indicated by asterisks, * (p<0.05).

Chapter 3: Results

93

3.5.4 Secreted myometrial MMPs proteins detected by Luminex assay

The undiluted NSM and SCM were screened by the Bio-Plex Pro™ Human MMP and

TIMP Luminex assays (Bio-Rad) and MMP-1, 2, 3, & 10 and TIMP-1 & 2 were detected. For the

analysis, some calculated MMP/TIMP concentrations were excluded if detection values were

extrapolated below the lowest concentration of the standard curve. In addition, if some values

were extrapolated beyond the highest concentration of the standard curve, that particular data

point was assigned the value of the highest standard concentration. Based on the aforementioned

criteria, secreted MMPs/TIMPs that were detected in less than four of NSM/SCM data sets were

excluded from further analysis. Therefore only MMP-1 & 2 and TIMP 1 & 2 underwent statistical

analysis (Figure 3.29).

Cultured primary human myometrial cells secreted MMP-1 (105-8400 pg/mL), MMP-2

(1220-33,000 pg/mL), TIMP-1 (3600-18,000 pg/mL) and TIMP-2 (11,500-19,500 pg/mL) in the

NSM and SCM. Importantly, there was no effect of static mechanical stretch, and only secreted

MMP-2 levels exhibited a 10-fold increase after culturing for 48 hours as compared to 24 hours

incubation in serum-free media. This further suggests that in vitro culture conditions can influence

the expression of MMPs and the underlying mechanisms that regulate myometrial MMP

expression and secretion need to be further elucidated.

Chapter 3: Results

94

Figure 3.29: Changes in MMP and TIMP protein secretion primary human myometrial cells

as an effect of in vitro mechanical stretch.

Changes in protein secretions detected in the conditioned medium of myometrial cell culture

collected from non-stretched and stretched flex plates after 24 hours and 48 hours of incubation.

The bars represent mean±SEM (n=4-5 at each time point) expressed in fold-change relative to 24

hours Non-Stretch Conditioned Medium (NSM). Statistical analysis (one-way ANOVA and

Newman-Keuls multiple comparisons test) was performed on the relative fold-change data.

Significant differences between gestational days are indicated by asterisks, * (p<0.05).

95

CHAPTER 4

DISCUSSION

Chapter 4: Discussion

96

4.1 GESTATIONAL REGULATION OF MMP GENE AND PROTEIN EXPRESSION IN

THE RAT MYOMETRIUM

My results show that: 1) throughout gestation the majority of myometrial MMP genes

displayed low and stable expression that was highly upregulated PP. 2) Myometrial MMP-7

(matrilysin), MMP-11 (stromelysin-3), and MMP-12 (macrophage metalloelastase) genes and

proteins were induced at term. Particularly, on GD22 (term) MMP-7, MMP-12, and MMP-11

showed 200-fold, 150-fold and 15-fold increase respectively compared to early gestation (GD6),

which remained elevated during TL and PP. 3) Gelatin, collagen I, and collagen IV-degradation

mediated by MMP activity in the pregnant, labouring and PP myometrium can be attributed to

two cell types: myometrial SMCs and resident leukocytes (specifically CD68+ macrophages).

These in vivo results suggest a dual role for myometrial MMPs in regulating processes involved

in 1) promoting TL and 2) PP uterine involution.

During late gestation and TL the expression of certain MMP genes was significantly

different between gravid and non-gravid (empty) uterine horns of unilaterally pregnant rats. This

difference suggests that in vivo mechanical stretch or the presence of the fetus and/or placenta

may play a role in regulating MMP expression. To examine the potential regulatory role of

mechanical stretch, I performed in vitro studies using primary myometrial SMCs in combination

with Flexcell stretch system. My data indicate that there is not a direct effect of static mechanical

stretch on both MMP gene and secreted protein expression by human myometrial cells.

4.1.1 The Role of MMPs during Gestation, Term Labour, and Postpartum Involution

The myometrium undergoes dramatic changes in its cellular phenotypes and ECM

composition throughout pregnancy, TL and PP. During gestation, specific molecular mechanisms


97

must exist to regulate myometrial ECM remodeling to accommodate the growing fetus in a

quiescent environment, and yet be able to activate labour contractions at term [20, 35, 37].

Following parturition, the uterus is remodeled to a pre-pregnant state, which is accompanied by a

dramatic reduction in size which primarily involves rapid and extensive MMP-mediated ECM

degradation and cessation of cellular hypertrophy [31, 32, 35, 161, 162]. MMP activity during PP

involution has been studied extensively in rodents, undeniably correlating it with the dramatic

regeneration of uterine tissue including neo-angiogenesis, ECM transformation and modulation

of cellular phenotype [17, 29, 30, 34, 35]. MMP-7 was first identified by Woessner et al. due to

its high expression in the early PP rat uterus, whereas MMP-13 collagenase activity was also

recognized for its role in uterine involution [145, 161, 163-166]. However, little is known about

the role of other myometrial MMPs during gestation, active TL or PP.

Throughout gestation, myometrial SMCs change their phenotype from hyperplastic

(proliferative) to hypertrophic (or synthetic). Both stages of myometrial growth are associated

with ECM modifications to accommodate the increase in SMC number and size [49]. Therefore,

the major structural component of the uterine ECM, fibrillar collagen, must be constantly

reorganized for pregnancy maintenance [35]. Comparative analysis of overall MMP gene

expression (Figure 3.6) indicates that the collagenases (MMP-8&13) and gelatinases, especially

MMP-2, were highly (yet relatively stable) expressed throughout pregnancy with mRNA levels

being 100-300 fold higher in comparison to the lowest expressed MMP-10. In addition, the results

obtained from gelatin zymography indicate that throughout gestation, MMP-2 is constantly active,

whereas western blot analysis revealed persisting high levels of MMP-8 protein expression

(Figure 3.10), suggestive of restricted collagenolysis. Compared to the other collagenases MMP-

1 & 13, MMP-8 is known to preferentially cleave collagen type I, the most abundant collagen

type in the uterus [76]. Through speculation, it is plausible that similar to keratinocytes [167, 168],


98

when SMCs proliferate or expand in size, their cell-surface collagen integrin receptors (such as

α2β1) come into contact with the surrounding collagen I molecules, which may induce

intracellular signaling and increase expression of MMP-8. These findings point to the role of both

collagenases and gelatinases, in the modification of the ECM environment during pregnancy to

increase elasticity of the myometrium. This action is necessary to accommodate the growing

fetus/es, in which the collagenases would cleave fibrillar collagens into fragments that would be

denatured into gelatin. Furthermore, the gelatinases would then degrade gelatin into small peptide

fragments for rapid removal by the infiltrating immune cells possibly macrophages [162].

Although MMP-9 was highly expressed throughout gestation (Figure 3.6), MMP-9 protein

activity was not detected by gelatin zymography. This phenomenon has been previously reported,

suggesting that mRNA and protein abundances in cells correlate poorly due to different post-

transcriptional intracellular regulatory mechanisms, for instance microRNA (miRNA) can either

upregulate or silence gene expression [169-171]. The silencing is mediated by miRNA binding to

mRNA by complimentary alignment to 1) inhibit protein translation or 2) induce mRNA

degradation via RISC (RNA induced silencing complex) [172]. Several studies have revealed a

variety of miRNAs that target MMP mRNA, either by upregulating gelatinase expression (i.e.

miR-29b directly targets MMP-2) to directly promote cell proliferation and migration, or by

down-regulating gelatinase expression (miR-9 negatively modulates MMP-2 and -9 expression

indirectly by targeting their upstream NF-κB1 signaling) [171, 173-175]. It is also plausible to

speculate that MMP-9 function during TL is species- or tissue-specific, as was previously shown

by Roh et al. on the lack of progesterone-mediated suppression of MMP-9 production by human

myometrial cells, the effect that was previously observed in cultured rabbit cervical fibroblasts

[31].


99

My zymography results are in concordance with preceding data by Yin et al., which

reported prominent active and pro-form of MMP-2 and less intense MMP-9 bands in uterine tissue

homogenate from pregnant rats at mid-gestation (GD12) and late gestation (GD19). Unlike our

experiments that were done solely on the myometrium throughout rat gestation, they detected

weak MMP-9 activity in the uterine tissue, possibly due to the presence of the decidua, which was

not separated from the myometrium in their study [139]. In contrast, our immunohistochemical

examination of pregnant rat uterus detected prominent myometrial MMP-9 protein expression

(probably in its pro-MMP form). During late gestation (GD21) MMP-9 expression was localised

mostly intracellular, particularly in the perinuclear region of myocytes (i.e. in the endoplasmic

reticulum and Golgi bodies), but increased extracellularly during active TL (Figure 3.17). This

confirmed previous results by Roh et al. that reported in vivo expression of MMP-9 by SMCs,

interstitial fibroblasts and inflammatory cells in the term non-labouring and labouring human

myometrium samples [31].

My analysis revealed generally steady levels of MMPs-7, 11 and 12 genes throughout

gestation with upregulation at term. This profile correlates well with the second switch in the

myometrial phenotype during late gestation from synthetic to contractile [15] to support the

synchronized contractions of labour [34]. The stromelysins (MMP-3, 10, 11) and the related

MMPs (MMP-7 & 12) are capable of degrading elastin, cell adhesion molecules, proteoglycans,

fibronectin and components of the BM, laminin and collagen type IV [54, 99], which can modify

the ECM structural environment for active labour contractions. Although uterine MMP-7 was first

identified during PP involution [54, 161, 166], these findings – in which a strong correlation was

observed between gene and protein expression – suggest functionality of this enzyme during late

gestation and TL. In addition, active MMP-11 protein also showed a dramatic upregulation at late

gestation and active TL, as compared to the early gestation which corresponds well with its gene


100

expression (Figure 3.11). Protein expression for MMP-7, 11 & 12, and especially enzymatic

activity of the major gelatinase MMP-2 were all dramatically upregulated during PP, consistent

with their involvement in uterine involution and ECM remodeling resulting in reduced uterine

size. Additionally, due to the upregulation of CX-43 protein observed during TL to promote SMC

contractility, the ability of MMP-7 to degrade these junction proteins suggests its possible role in

controlling SMC connectivity after birth [176].

Similar to the temporal and spatial localization of MMP-9, MMP-7 & 11 proteins were

expressed by SMCs in both the longitudinal and circular myometrial layers. Their expression was

predominantly intracellular (in the perinuclear region) during mid and late-gestation, however, s

shift to extracellular MMP-7 protein localization occurred earlier during labour compared to

MMP-11 and was upregulated PP. Remarkably, positive staining indicated that MMP-9, MMP-7

and MMP-11 proteins were expressed not only by uterine myocytes but also by single cells

morphologically distinct from SMCs, localizing outside the muscle bundles. In accordance with

numerous publications, it is speculated that those cells are activated leukocytes recruited to the

myometrium to express pro-inflammatory cytokines and chemokines [11, 133]. Previous studies

have identified that macrophages were the predominant immune cells in the myometrium during

late gestation, TL and PP [11, 20, 62]. Consistent with these findings, our lab has previously

reported induction of MCP-1 (CCL2, chemokine involved in macrophage migration), and

confirmed an influx of CD68+ macrophages before and during TL in the rat myometrium [22].

Uterine leukocytes, especially macrophages can support active labour contractions by secreting

cytokines like IL-1β, IL-6, and TNF-α to promote the induction of CAPs [63]. Infiltrating

leukocytes are themselves known sources of MMPs, and additional MMPs produced by other

cells can further promote leukocyte migration into inflamed tissue [67, 75, 78]. In situ

zymography analysis suggests that uterine matrix remodeling by SMCs and leukocytes is MMP-


101

mediated as seen by degradation of fluorescent-labelled gelatin, collagen I, and collagen IV

substrates, known to be actively cleaved by MMPs [76]. This suggests that the increase in MMP

production by the rat myometrium correlates with leukocyte infiltration to promote term labour

and PP involution. Therefore, myometrial ECM degradation may actually be a combined result

of MMP secretion by both myometrial cells and infiltrating peripheral or resident leukocytes.

The role of MMP-11 in the myometrium, is not well defined. Previous studies have

indicated that MMP-11 can regulate BM stability and levels of fibronectin, collagen IV, and

laminin (BM components) in the ECM [76, 177, 178]. I speculate that the substantial increase in

MMP-11 during active labour (GD23) suggests a role in degrading BM surrounding individual

SMCs to increase SMC connectivity for coordinated myometrial contractions, and to facilitate

leukocyte migration within the myometrium [34, 35, 78, 178]. MMP-11 has also been described

to readily cleave α1-proteinase inhibitor (also known as α1-antitrypsin) that predominantly

inhibits neutrophil elastase (NE)-mediated degradation of ECM components, and α2-

macroglobulin – a general proteinase inhibitor that induces MMP removal by endocytosis [68,

179-181]. Based on the literature, MMP-11 can potentially maintain proteolytic activity of other

MMPs by preventing their inhibition during late gestation, TL and PP. Conversely, MMP-12

protein levels were also highly expressed throughout gestation and were further upregulated in

the rat myometrium PP (Figure 3.12). MMP-12 is expressed primarily by macrophages and is

important for their migration [78]. Previous reports have indicated an increase in the

monocyte/macrophage population in the rat and mouse myometrium prior to term, that remained

elevated during TL and PP. This sustained elevation suggests that in addition to myometrial SMCs

or fibroblasts (as skin-derived myofibroblasts/fibroblasts have been previously shown to be a

source of MMP-12), resident or infiltrating immune cells might be responsible for the observed


102

MMP-12 expression – especially higher mRNA levels within the gravid horn (compared to the

empty horn) during late gestation [20, 26, 182].

Analysis of TIMP expression in the rat myometrium (Figure 3.5 and 3.6) provides

potential explanation of the constant low expression and activity of MMPs throughout gestation.

Comparative analysis revealed that TIMP-2 exhibited the highest expression level from all TIMPs,

while TIMP-1 and TIMP-3 were also highly expressed throughout gestation, and their expression

pattern was similar to the gelatinases. This pattern of TIMP protein expression is similar to our

lab’s recent results in the human vagina [183]. It is known that TIMP-1 and TIMP-2 can form

specific complex with MMP-9 and MMP-2 (via their C-terminus), respectively, and further

interact with other MMPs via their N-terminus to potentially prevent their activation [107, 108].

These findings support the inhibitory role of TIMP-2 for the majority of MMPs, and the potential

interaction between TIMP-1 & 3 with MMP-2 & 9 to form inhibitory complexes in the rat

myometrium throughout gestation. Interestingly, a recent study that sought to compare the total

myometrial transcript repertoire between term and spontaneous TL (in humans) by high-

throughput RNA sequencing reported that TIMP-1 was the gene most highly upregulated in

association with labour [184]. Furthermore, in regards to the PP period, TIMP-3 & 4’s gene

expressions were highly upregulated (450-fold) suggesting their role in regulating PP involution

(Figure 3.5 and 3.6). Apart from MMP inhibition/activation, TIMPs are also known to have other

biological functions which include regulation of cell proliferation, migration, angiogenesis and

apoptosis. Since TIMP-3 has been observed to have pro-apoptotic function, while TIMP-4 is anti-

apoptotic, this correlates with the observed increase in expression for these two TIMPs during PP,

which may promote apoptosis of hypertrophied SMC and stimulate new cell growth and

regeneration respectively [69, 109, 114-117].


103

It has been previously reported that MMP-mediated degradation of ECM components can

result in biologically active peptides. Interestingly, these particular chemoattractive peptides can

originate from ECM components – such as elastin, laminin and fibronectin – that are known to be

cleavable substrates for MMP-7, 11 & 12. Elastin abundance is vital for the elastic recoil of the

uterine tissue and provides resilience when exposed to external stimuli. This property of elastin is

important in the reproductive tract to accommodate its enormous expansion in pregnancy [35].

However, elastin degradation can result in the generation of elastin-derived peptides with

chemotactic properties for monocyte recruitment [185]. MMP-12 indirectly promotes additional

elastin destruction by degrading the serine proteinase inhibitor α1-antitrypsin (which potentiates

NE activity) [179, 186]. Cleavage of the laminin α5 chain results in a chemotactic peptide that

has been shown to recruit leukocytes and induce MMP-9 production, both in vitro and in vivo

[187]. MMP-9-mediated hydrolysis of collagen can also result in a chemotactic fragment (Pro-

Gly-Pro) that is homologous to the major chemoattractant for neutrophils CXCL1/GROα/KC and

can activate the CXCL1 receptor to induce neutrophil chemotaxis in airway inflammation [78,

127, 188]. Moreover, fibronectin and hyaluronan fragments have been shown to stimulate

macrophage cytokine and chemokine production [189, 190]. Fibronectin fragments have also

been observed to stimulate transendothelial migration of HIV-1 infected leukocytes by

upregulating the expression of TNF-α which induces the expression of adhesion molecules like

selectins, ICAMs and VCAM-1 [191, 192]. This correlates with previous in vitro studies in our

lab that observed an upregulation of ICAM-1 in response to mechanical human myometrial

stretch-induced cytokines, which promoted leukocyte transendothelial migration [64]. Apart from

increasing chemoattraction, MMP-7 has also been shown to actively cleave VE-cadherin – one of

the junctional proteins that maintains vascular barrier function [193]. These findings additionally


104

suggest the MMP-specific production observed during late gestation and TL promotes leukocyte

recruitment and infiltration by upregulating chemotaxis and vascular EC permeability.

4.1.2 The Role of MMPs in Uterine Inflammation: Mutual Regulation

Labour and PP involution-associated pathways – which includes ECM remodeling – are

known to be largely stimulated by the expression of cytokines secreted by myometrial cells and

the active release of cytokines and growth factors already present in the ECM [194, 195]. It is

anticipated that the influx of leukocytes further amplifies the inflammatory signal to induce

parturition and PP involution through the release of leukocyte-derived cytokines (such as IL-1β

and TNF-α) and MMPs [17, 22, 29, 63, 64, 196]. Not surprisingly, monocytes/macrophages have

been identified to have the ability to secrete all soluble MMPs that were studied – MMP-1, 2, 3,

7, 8, 9, 10, 11, 12, and 13, as well as the four TIMPs [197]. Neutrophils, however, have been

reported to primarily secrete MMP-8, MMP-9 and MMP-12 [127, 196, 198]. Several cytokines

(i.e. TNF-α, and IL-1β) and growth factors (i.e. IGF-1 and TGF-β) have been previously shown

to regulate transcriptional activation of MMP genes in a variety of cells including

monocytes/macrophages in atherosclerotic plaques, glomerular mesangial cells, and the human

colonic epithelium [197, 199, 200]. Binding of cytokines and growth factors to their cell-surface

receptors results in upregulation of intracellular signaling (such as the mitogen-activated protein

kinases (MAPK) and NF-κB pathways) inducing MMP expression [200-203]. More importantly,

although these pro-inflammatory cytokines and growth factors can regulate MMP expression,

MMPs can also regulate their bioavailability by cleavage of their binding proteins [71, 204, 205].

As previously mentioned, MMP-mediated cleavage of ECM peptides can result in the

formation of chemotactic gradients, but can also regulate cytokine and chemokine release [67, 75,

78]. TNF-α is a potent pro-inflammatory cytokine that can be expressed as a membrane-bound


105

protein on the surface of macrophages, or secreted and bound to fibronectin and laminin [203,

206, 207]. MMP-mediated cleavage (especially MMP-7 and MMP-3) releases active TNF-α to

generate a chemoattractive gradient for macrophage recruitment and induce expression of labour-

associated genes (like prostaglandins) in the myometrium [208-210]. Another potent pro-

inflammatory cytokine IL-1β, can also be activated by MMP-mediated cleavage of its precursor

via MMP-2, 3 and 9. Interestingly, MMP-3 can degrade active IL-1β therefore suggesting a dual

role for MMPs in cytokine regulation [211]. Similar to MMP-3 inactivation of IL-1β, MMP-

mediated cleavage of CCL7 (by MMP-2) and MCP-1 (by MMP-1, -3 and -13) results in a

truncated peptide that is unable to bind to the CC chemokine receptor. MMP-9 processing of

mature chemokine IL-8/CXCL8 has been reported to result in a more effective chemoattractant

for neutrophil recruitment [127]. Furthermore, previous studies have reported that MMP-null

mice displayed diminished leukocyte infiltration into the targeted tissue – such as MMP-7

knockout demonstrated impaired neutrophil efflux into the alveolar space due to the lack of MMP-

7 mediated shedding of syndecan-1 and release of CXCL1 to generate a chemotactic gradient

[124]. These findings suggest that MMPs identified in the rat myometrium show a possible

involvement in the regulation of cytokine and chemokine bioavailability and activity. This further

reinforces the role of MMPs in regulating leukocyte migration and leukocyte-mediated

inflammation.

The family of insulin-like growth factors, in particular IGF-1 and IGF-II are known to

stimulate cell proliferation, collagen synthesis, and muscle growth/regeneration, therefore making

their bioavailability important to assist PP uterine involution to a non-pregnant state [212-214].

The IGF-signaling system is tightly regulated by IGFBPs which prevent IGF-1 and IGF-II from

binding to the IGF-1 receptor [194, 215]. MMP-7-mediated cleavage of IGFBP-5 is capable of

liberating IGF-II to function as an autocrine myofibroblast growth factor [215]. Interestingly,


106

Shynlova et al. previously reported an increase in IGF-1, IGFBP-5 and the IGF-1 receptor in the

rat myometrium during TL and PP involution [37]. In accordance, the observed increase in MMP-

7 can conceivably suggests a potential role for this enzyme in upregulating IGF-1 signaling in the

myometrium. Another growth factor, TGF-β is secreted in its inactive form which can be

associated with the interstitial ECM through latent TGF-β binding proteins (LTBPs) [194, 216-

218]. Active TGF-β can also bind to collagen IV, fibronectin and heparin-sulfate proteoglycans

(HSPGs). MMP-mediated release of TGF-β bound to ECM components results in a potent

chemoattractant for monocytes and macrophages, and further stimulates their expression of bFGF

and TNF-α [204]. These reports together with the data provide evidence to support that MMP

expression in the PP rat myometrium mediates ECM remodeling and also promotes tissue

regeneration through the liberation of growth factors.

4.1.3 Regulation of Myometrial MMP Expression: Potential Mechanisms

Yin et al. had previously reported that stretch of myometrium strips isolated from virgin

rats was associated with an increase in gelatinase expression and activity, which was further

enhanced following hormonal treatment with 17-β estradiol and progesterone. This study

suggested that MMP expression could be regulated by mechanical stretch of the uterine walls by

growing fetuses [139]. As a result, a unilaterally pregnant rat model was employed to thoroughly

investigate the potential mechanisms of myometrial MMP activation [35]. It was observed that

mRNA levels of MMP-7, 11 and 12 in the gravid uterine horn was greater during labour as

compared to the empty uterine horn, however, protein levels did not exhibit similar differences.

Furthermore, gelatin zymography revealed a stable expression profile for pro-MMP-2 protein

throughout gestation, which depicts no differences between empty and gravid uterine horns

(Figure 3.13). Surprisingly, starting from early gestation until term, active MMP-2 was higher in


107

the empty horn compared to the gravid horn. Based on my results from bilaterally pregnant rats,

which exhibited dramatic increase in activated MMP-2 during PP (when the fetus is expelled),

these findings suggest that during gestation and labour, MMP-2 activity in the gravid horn is

suppressed by the presence of fetal/placental units (possibly inhibins or TGF-β capable of down-

regulating MMP expression) while this suppression is absent in the empty uterine horn [219].

It can be speculated that since MMP expression can be cytokine-mediated, the observed

difference in gene expression is a result of activation by cytokines derived from infiltrating

leukocytes, the placenta, and fetal membranes present in the gravid horn [10, 20, 78, 197, 200,

220, 221]. In accordance, the mRNA expression of MMP-3, 8 and 11 was also dramatically

upregulated in the gravid uterine horn 24 hours after the delivery of the fetus due to tissue

remodeling during PP involution; and was not stretch-dependent [17, 22, 29, 33, 35, 64, 82].

Additionally, active MMP-12 protein was greatly detected in the gravid horn (compared to the

empty horn) of the PP uterus, which may indicate the presence of MMP-secreting immune cells

[78]. These findings suggest that mechanical stretch may not play a direct role in the regulation

of MMP expression, but rather is regulated by factors from the fetal/placental units.

One of the possible molecular mechanisms of MMP gene regulation before labour is the

activator protein (AP)-1 family of transcription factors (Jun and Fos) that are known to

transcriptionally activate a variety of myometrial genes involved in the labouring process [222,

223]. Previous studies found that many ECM, CAPs, MMPs and TIMPs genes contain AP-1 sites

in their promoter regions [223, 224]. In particular, all the MMPs that were highly regulated in the

rat myometrium contained the AP-1 promoter region – MMP-9, 7, 12 and 11 (AP-1-like region)

[74]. It was also reported that mRNA levels of cFos, FosB and JunB transcription factors are

increased in the rat myometrium during TL, implicating their role in regulating parturition [223,

225]. I suggest that at term, upregulated myometrial AP-1 proteins that promote the expression of


108

ECM components, CAPs, and cytokines, can also influence the expression of certain MMPs. The

direct mechanism is currently unknown; however, given that IL-1β and TNF-α is expressed in the

labouring myometrium and can stimulate AP-1 transcriptional activity, it can be speculated that

myometrial MMPs might be regulated by cytokine-mediated induction of AP-1 transcription

factors [17, 74, 226, 227].

4.2 CHANGES OF MYOMETRIAL MMPs ARE NOT AN EFFECT OF MECHANICAL

STRETCH (IN VITRO PRIMARY CELL MODEL)

Results from the in vivo experiments using isolated rat myocytes did not allow us to

conclude whether myometrial MMP expression is regulated by mechanical stretch. However, this

contradicts the previously observed increase in gelatinases as a result of mechanically stretch rat

myometrial strips [139]. Particularly, cyclic mechanical stretch of reproductive cells in vitro

resulted in augmented expression of MMP-1 in both cultured human uterine cervical fibroblasts

cells and human decidual cells [147, 228]. To further investigate the potential mechanical

regulation of MMP expression, in vitro stretch experiments were performed using primary human

myometrial cells. Overall, the in vitro experiments using primary human cells are consistent with

the results from the in vivo rat studies, and indicated that there was no effect of static mechanical

stretch on MMP-1, 2, 3, 11 and TIMP-1&2 gene expression. Additionally, the analysis of secreted

MMP and TIMP proteins within the conditioned media demonstrated that in vitro mechanical

stretch also had no significant effect on MMP secretion by primary human myometrial cells.

However, 24 hour static mechanical stretch that was followed by an additional 24 hours of

relaxation (mimicking the release of stretch in the PP period following labour) resulted in a change

in mRNA expression for human MMP-1, 2, 3 and 11.


109

One possible explanation for this observation is that prolonged serum-starvation (72 hours

in total) – media containing ITS-A (Life Technologies Inc.) supplement instead of FBS – may

influence the expression of multiple MMPs. In addition, our in vitro results contradict the findings

of Zhao et al., who previously reported that cyclic stretch augmented MMP-1 production in

human uterine SMCs [229]. I noticed that the recorded increase in MMP expression in other

cultured primary uterine cells – human decidua, cervical fibroblasts, and myometrial SMCs –

were always a result of cyclic mechanical stretch, while our study employed static mechanical

stretch to simulate continuous stretch by the growing fetus during pregnancy [17, 64, 147, 228,

229]. It is suggestive that our model of biologic static stretch mimics a quiescent pregnancy

environment and was not able to stimulate MMPs, while cyclic stretch, which simulates active

labour contractions, might show direct effect on MMP expression. Based on these findings, the

mechanisms that regulate myometrium MMPs need to be further elucidated.

4.3 CONCLUSION: A PROPOSED MODEL FOR THE ROLE OF MYOMETRIAL

MMPS DURING LATE GESTATION, TERM LABOUR, AND POSTPARTUM

INVOLUTION

In summary, the main findings from the in vivo studies using the bilaterally pregnant rat

model clearly suggests two distinct roles for MMPs within the myometrium. Expression of

specific MMPs by myometrial SMCs is 1) constantly expressed throughout gestation to remodel

the ECM and to increase elasticity of the tissue to accommodate the growing fetus, and 2)

upregulated during late gestation to promote leukocyte infiltration to support active labour

contractions. In addition, infiltrating leukocytes express MMPs to remodel the ECM and amplify

the inflammatory signal. MMP expression is further upregulated during the PP period to 1)


110

remodel the ECM back to a pre-pregnant state and 2) promote tissue regeneration following birth.

Based on our findings from characterizing the gestational profile of soluble MMP expression

within the rat myometrium, I propose the following model to explain the role of myometrial

MMPs (Figure 4.1).

Results from my studies suggest that expression/activity of specific MMPs (MMP-7, 11

and 12) may be important for mediating the transition from term to active labour. Therefore MMP-

7, 11 and 12 can act as potential targets for the development of novel therapeutic strategies for

prevention of PTL. For instance, instead of the use of a broad spectrum MMP inhibitor (i.e.

GM6001), an inhibitor specific to MMP-7, 11 or 12 may provide favourable outcomes for women

at risk for PTL – such as synthetic MMP Inhibitor II or III (Santa Cruz Biotechnology, Inc., Dallas,

Texas, USA). Moreover, in vitro static mechanical stretch (which resembles uterine stretch during

gestation) has no effect of MMP gene and protein expression in primary human myometrial cells.

Further studies must be performed to elucidate 1) the possible regulatory role of cyclic mechanical

stretch on the expression of the MMPs studied and 2) the functional role of myometrial MMPs.


111

Figure 4.1. Evidence-based model for the role of myometrial MMPs during labour and

postpartum involution.

Based on our data and previous studies in the literature, I suggest that near term, hormonal

changes and expression of pro-inflammatory cytokines 1) induces the secretion of multiple

MMPs by myometrial cells. 2) By degrading ECM components, myometrial MMPs would

increase leukocyte chemoattraction and vascular permeability to 3) facilitate peripheral

leukocyte recruitment and transendothelial migration into the uterine smooth muscle. Within the

myometrium, these activated leukocytes can secrete pro-inflammatory cytokines and MMPs to

4) amplify the inflammatory signal and promote the laboring process and 5) promote ECM

remodeling during postpartum involution to return the uterus back to a pre-pregnant state.

112

CHAPTER 5

FUTURE DIRECTIONS

Chapter 5: Future Directions

113

5.1 FUTURE DIRECTIONS

The major findings from the two in vivo rat models of pregnancy suggested the role of

MMPs during late gestation and TL is to regulate ECM remodeling to accommodate uterine

contractions and promote leukocyte infiltration, possibly by increasing vascular permeability. In

situ zymography revealed that CD45+ leukocytes in the myometrium, especially CD68+

macrophages expressed gelatin, collagen I and collagen IV-degrading enzymes (Figure 3.20-

3.23), consistent with MMP expression. To confirm our results, fluorescent immunohistochemical

studies should be performed for co-expression of markers of different immune cells (i.e. CD68,

NE, CD3 etc.) and MMP-specific antibodies to identify specific leukocyte populations expressing

MMPs. A previous study by Koscica et al. reported that the administration of broad-spectrum

MMP inhibitor GM6001 resulted in reduced rates of PTL in mice [140]. Therefore further animal

studies could be performed to characterize the MMP expression profile in the GM6001-mediated

PTL attenuation model (with PTL induced by RU-486 and LPS) and investigate the effect of more

specific MMP inhibitors – that would target specific MMP subgroups – on the rate of PTL.

Current results from both in vivo and in vitro models suggest that there is no effect of

mechanical stretch on MMPs expression. Zhao et al. however reported increased expression of

MMP-1 by primary human myometrial cells in response to cyclic mechanical stretch. Based on

the aforementioned in vitro studies, it is also possible that applying cyclic stretch – instead of or

following static stretch – to simulate active labour contractions may better induce expression of

the major MMPs studied (MMP-7 and MMP-11) to resemble the changes observed in the in vivo

rat models, and better define the regulation of MMP expression (by mechanical stretch) during

TL [147, 228, 229].

Chapter 5: Future Directions

114

It has been shown that hormones (estrogen and progesterone), pro-inflammatory

cytokines (i.e. IL-1β), growth factors (i.e. IGF-1), and cell-adhesion molecules (i.e. VCAM-1 with

LFA-1) affect MMP expression [31, 135, 230, 231]. Modification to the cell culture system by

treatment of myometrial cells with 1) mifepristone (the progesterone antagonist RU486) or 2)

cytokines and/or growth factors may allow for better understanding of MMP regulated expression

[64, 71, 85]. Alternatively, co-culture of myometrial cells (either hTERT-HM cell line or primary

myometrial cells) with other cells such as ECs and certain leukocytes populations (i.e. human

monocytic cell line THP-1), may reveal expression changes of MMPs in vitro that would better

simulate in vivo conditions (i.e. cellular interactions) and provide potential evidence of

upregulating MMPs to promote TL and PP involution.

We suggest that the major role of myometrial MMPs is to promote transendothelial

migration of leukocytes into the myometrium by upregulating vascular permeability – based on

the substrates that certain MMPs are able to cleave include BM components, gap junction and cell

adhesion proteins [67, 134, 193]. To investigate the functional role of myometrial MMPs on

endothelial cell permeability, a transendothelial permeability assay can be employed using the

human uterine microvascular endothelial cell line (hUtMVEC-Myo, Lonza, currently used in the

Lye lab) [64]. EC barrier function can be assessed by testing the ability of a fluorescein probe to

pass from the upper to lower chamber of the endothelium-covered inserts with/without the broad

spectrum MMP inhibitor GM6001, or MMP inhibitors more specific to MMP-7 and 11.

References

115

REFERENCS

1. Liu, L., H.L. Johnson, S. Cousens, J. Perin, S. Scott, J.E. Lawn, I. Rudan, H. Campbell,

R. Cibulskis, M. Li, C. Mathers, R.E. Black, W.H.O. Child Health Epidemiology

Reference Group of, and Unicef, Global, regional, and national causes of child

mortality: an updated systematic analysis for 2010 with time trends since 2000. Lancet,

2012. 379(9832): p. 2151-61.

2. Rush, R.W., M.J. Keirse, P. Howat, J.D. Baum, A.B. Anderson, and A.C. Turnbull,

Contribution of preterm delivery to perinatal mortality. Br Med J, 1976. 2(6042): p. 965-

8.

3. European Community collaborative study of outcome of pregnancy between 22 and 28

weeks' gestation. Working Group on the Very Low Birthweight Infant. Lancet, 1990.

336(8718): p. 782-4.

4. McCormick, M.C., The contribution of low birth weight to infant mortality and

childhood morbidity. N Engl J Med, 1985. 312(2): p. 82-90.

5. Shapiro-Mendoza, C.K. and E.M. Lackritz, Epidemiology of late and moderate preterm

birth. Semin Fetal Neonatal Med, 2012. 17(3): p. 120-5.

6. Goldenberg, R.L., J.D. Iams, J.F. Culhane, and R. Romero, Epidemiology and causes of

preterm birth. Lancet, 2008. 371(9606): p. 75-84.

7. Ward, R.M. and J.C. Beachy, Neonatal complications following preterm birth. BJOG:

An International Journal of Obstetrics & Gynaecology, 2003. 110 Suppl 20: p. 8-16.

8. Jabbour, H.N., K.J. Sales, R.D. Catalano, and J. Norman, Inflammatory pathways in

female reproductive health and disease. Reproduction, 2009. 138(6): p. 903-919.

9. Nelson, S.M., A.H. Khan, and J. Norman, Cervical and myometrial physiology and

preterm labor. Expert Rev. Obstet. Gynecol., 2007. 2(2): p. 179-192.

10. Thomson, A.J., J.F. Telfer, A. Young, S. Campbell, C.J. Stewart, I.T. Cameron, I.A.

Greer, and J.E. Norman, Leukocytes infiltrate the myometrium during human

parturition: further evidence that labour is an inflammatory process. Hum Reprod,

1999. 14(1): p. 229-36.

11. Osman, I., A. Young, M.A. Ledingham, A.J. Thomson, F. Jordan, I.A. Greer, and J.E.

Norman, Leukocyte density and pro-inflammatory cytokine expression in human fetal

membranes, decidua, cervix and myometrium before and during labour at term. Mol

Hum Reprod, 2003. 9(1): p. 41-5.

12. Sakamoto, Y., P. Moran, J.N. Bulmer, R.F. Searle, and S.C. Robson, Macrophages and

not granulocytes are involved in cervical ripening. J Reprod Immunol, 2005. 66(2): p.

161-73.

13. Romero, R., J. Espinoza, L.F. Goncalves, J.P. Kusanovic, L. Friel, and J.K. Nien,

Inflammation in preterm and term labour and delivery. Seminars in Fetal & Neonatal

Medicine, 2006. 11(5): p. 317-326.

References

116

14. Garfield, R.E., G. Saade, C. Buhimschi, I. Buhimschi, L. Shi, S.Q. Shi, and K. Chwalisz,

Control and assessment of the uterus and cervix during pregnancy and labour. Hum

Reprod Update, 1998. 4(5): p. 673-95.

15. Challis, J.R.G., S.G. Matthews, W. Gibb, and S.J. Lye, Endocrine and paracrine

regulation of birth at term and preterm. Endocr Rev, 2000. 21(5): p. 514-50.

16. Bokstrom, H., M. Brannstrom, M. Alexandersson, and A. Norstrom, Leukocyte

subpopulations in the human uterine cervical stroma at early and term pregnancy. Hum

Reprod, 1997. 12(3): p. 586-90.

17. Shynlova, O., Y.H. Lee, K. Srikhajon, and S.J. Lye, Physiologic uterine inflammation

and labor onset: integration of endocrine and mechanical signals. Reprod Sci, 2013.

20(2): p. 154-67.

18. Renthal, N.E., K.C. Williams, and C.R. Mendelson, MicroRNAs--mediators of

myometrial contractility during pregnancy and labour. Nat Rev Endocrinol, 2013. 9(7):

p. 391-401.

19. Mendelson, C.R., Minireview: fetal-maternal hormonal signaling in pregnancy and

labor. Mol Endocrinol, 2009. 23(7): p. 947-54.

20. Shynlova, O., T. Nedd-Roderique, Y. Li, A. Dorogin, and S.J. Lye, Myometrial immune

cells contribute to term parturition, preterm labour and post-partum involution in mice.

J Cell Mol Med, 2013. 17(1): p. 90-102.

21. Dong, X., C. Yu, O. Shynlova, J.R. Challis, P.S. Rennie, and S.J. Lye, p54nrb is a

transcriptional corepressor of the progesterone receptor that modulates transcription of

the labor-associated gene, connexin 43 (Gja1). Mol Endocrinol, 2009. 23(8): p. 1147-

60.

22. Shynlova, O., P. Tsui, A. Dorogin, and S.J. Lye, Monocyte chemoattractant protein-1

(CCL-2) integrates mechanical and endocrine signals that mediate term and preterm

labor. J Immunol, 2008. 181(2): p. 1470-9.

23. Chwalisz, K. and R.E. Garfield, Role of nitric oxide in the uterus and cervix:

implications for the management of labor. J Perinat Med, 1998. 26(6): p. 448-57.

24. Romero, R., O. Erez, and J. Espinoza, Intrauterine infection, preterm labor, and

cytokines. Journal of the Society for Gynecologic Investigation, 2005. 12(7): p. 463-465.

25. Osman, I., A. Young, F. Jordan, I.A. Greer, and J.E. Norman, Leukocyte density and

proinflammatory mediator expression in regional human fetal membranes and decidua

before and during labor at term. J Soc Gynecol Investig, 2006. 13(2): p. 97-103.

26. Hamilton, S., Y. Oomomian, G. Stephen, O. Shynlova, C.L. Tower, A. Garrod, S.J. Lye,

and R.L. Jones, Macrophages infiltrate the human and rat decidua during term and

preterm labor: evidence that decidual inflammation precedes labor. Biol Reprod, 2012.

86(2): p. 39.

27. Romero, R., F. Gotsch, M. Mazor, J. Espinoza, T. Chaiworapongsa, O. Erez, J.P.

Kusanovic, and S. Hassan, The preterm parturition syndrome. BJOG: An International

Journal of Obstetrics & Gynaecology, 2006. 113 Suppl 3: p. 17-42.

References

117

28. Shynlova, O., T. Nedd-Roderique, Y. Li, A. Dorogin, T. Nguyen, and S.J. Lye,

Infiltration of myeloid cells into decidua is a critical early event in the labour cascade

and post-partum uterine remodelling. J Cell Mol Med, 2013. 17(2): p. 311-24.

29. Shynlova, O., P. Tsui, S. Jaffer, and S.J. Lye, Integration of endocrine and mechanical

signals in the regulation of myometrial functions during pregnancy and labour. Eur J

Obstet Gynecol Reprod Biol, 2009. 144 Suppl 1: p. S2-10.

30. Hulboy, D.L., L.A. Rudolph, and L.M. Matrisian, Matrix metalloproteinases as

mediators of reproductive function. Mol Hum Reprod, 1997. 3(1): p. 27-45.

31. Roh, C.R., W.J. Oh, B.K. Yoon, and J.H. Lee, Up-regulation of matrix

metalloproteinase-9 in human myometrium during labour: a cytokine-mediated process

in uterine smooth muscle cells. Mol Hum Reprod, 2000. 6(1): p. 96-102.

32. Halme, J. and J.F. Woessner, Jr., Effect of progesterone on collagen breakdown and

tissue collagenolytic activity in the involuting rat uterus. J Endocrinol, 1975. 66(3): p.

357-62.

33. Hsu, K.F., H.A. Pan, Y.Y. Hsu, C.M. Wu, W.J. Chung, and S.C. Huang, Enhanced

myometrial autophagy in postpartum uterine involution. Taiwan J Obstet Gynecol, 2014.

53(3): p. 293-302.

34. Nishinaka, K. and Y. Fukuda, Changes in extracellular matrix materials in the uterine

myometrium of rats during pregnancy and postparturition. Acta Pathol Jpn, 1991. 41(2):

p. 122-32.

35. Shynlova, O., J.A. Mitchell, A. Tsampalieros, B.L. Langille, and S.J. Lye, Progesterone

and gravidity differentially regulate expression of extracellular matrix components in the

pregnant rat myometrium. Biol Reprod, 2004. 70(4): p. 986-92.

36. Walker, C.G., S. Meier, H. Hussein, S. McDougall, C.R. Burke, J.R. Roche, and M.D.

Mitchell, Modulation of the immune system during postpartum uterine inflammation.

Physiol Genomics, 2015. 47(4): p. 89-101.

37. Shynlova, O., P. Tsui, A. Dorogin, B.L. Langille, and S.J. Lye, Insulin-like growth

factors and their binding proteins define specific phases of myometrial differentiation

during pregnancy in the rat. Biol Reprod, 2007. 76(4): p. 571-8.

38. Jones, R.L., N.J. Hannan, T.J. Kaitu'u, J. Zhang, and L.A. Salamonsen, Identification of

chemokines important for leukocyte recruitment to the human endometrium at the times

of embryo implantation and menstruation. J Clin Endocrinol Metab, 2004. 89(12): p.

6155-67.

39. Kayisli, U.A., N.G. Mahutte, and A. Arici, Uterine chemokines in reproductive

physiology and pathology. Am J Reprod Immunol, 2002. 47(4): p. 213-21.

40. Christiaens, I., D.B. Zaragoza, L. Guilbert, S.A. Robertson, B.F. Mitchell, and D.M.

Olson, Inflammatory processes in preterm and term parturition. J Reprod Immunol,

2008. 79(1): p. 50-7.

41. Matsumoto, J., [Changes of the contraction of the circular and longitudinal muscles of

pregnant rat myometrium during pregnancy (author's transl)]. Nihon Sanka Fujinka

Gakkai Zasshi, 1980. 32(11): p. 1749-57.

References

118

42. Izumi, H., Changes in the mechanical properties of the longitudinal and circular muscle

tissues of the rat myometrium during gestation. Br J Pharmacol, 1985. 86(1): p. 247-57.

43. Weiss, S., T. Jaermann, P. Schmid, P. Staempfli, P. Boesiger, P. Niederer, R. Caduff,

and M. Bajka, Three-dimensional fiber architecture of the nonpregnant human uterus

determined ex vivo using magnetic resonance diffusion tensor imaging. Anat Rec A

Discov Mol Cell Evol Biol, 2006. 288(1): p. 84-90.

44. Aguilar, H.N. and B.F. Mitchell, Physiological pathways and molecular mechanisms

regulating uterine contractility. Hum Reprod Update, 2010. 16(6): p. 725-44.

45. Seki, T., I. Naito, T. Oohashi, Y. Sado, and Y. Ninomiya, Differential expression of type

IV collagen isoforms, alpha5(IV) and alpha6(IV) chains, in basement membranes

surrounding smooth muscle cells. Histochem Cell Biol, 1998. 110(4): p. 359-66.

46. Ross, R. and S.J. Klebanoff, The smooth muscle cell. I. In vivo synthesis of connective

tissue proteins. J Cell Biol, 1971. 50(1): p. 159-71.

47. Shynlova, O., M. Chow, and S.J. Lye, Expression and organization of basement

membranes and focal adhesion proteins in pregnant myometrium is regulated by uterine

stretch. Reprod Sci, 2009. 16(10): p. 960-9.

48. Shynlova, O., A. Oldenhof, A. Dorogin, Q. Xu, J. Mu, N. Nashman, and S.J. Lye,

Myometrial apoptosis: activation of the caspase cascade in the pregnant rat

myometrium at midgestation. Biol Reprod, 2006. 74(5): p. 839-49.

49. Shynlova, O., R. Kwong, and S.J. Lye, Mechanical stretch regulates hypertrophic

phenotype of the myometrium during pregnancy. Reproduction, 2010. 139(1): p. 247-53.

50. Shynlova, O., S.J. Williams, H. Draper, B.G. White, D.J. MacPhee, and S.J. Lye,

Uterine stretch regulates temporal and spatial expression of fibronectin protein and its

alpha 5 integrin receptor in myometrium of unilaterally pregnant rats. Biol Reprod,

2007. 77(5): p. 880-8.

51. Xu, C., A. Long, X. Fang, S.L. Wood, D.M. Slater, X. Ni, and D.M. Olson, Effects of

PGF2alpha on the expression of uterine activation proteins in pregnant human

myometrial cells from upper and lower segment. J Clin Endocrinol Metab, 2013. 98(7):

p. 2975-83.

52. Xie, N., L. Liu, Y. Li, C. Yu, S. Lam, O. Shynlova, M. Gleave, J.R. Challis, S. Lye, and

X. Dong, Expression and function of myometrial PSF suggest a role in progesterone

withdrawal and the initiation of labor. Mol Endocrinol, 2012. 26(8): p. 1370-9.

53. Hertelendy, F. and T. Zakar, Regulation of myometrial smooth muscle functions. Curr

Pharm Des, 2004. 10(20): p. 2499-517.

54. Bonnans, C., J. Chou, and Z. Werb, Remodelling the extracellular matrix in development

and disease. Nat Rev Mol Cell Biol, 2014. 15(12): p. 786-801.

55. Fullar, A., J. Dudas, L. Olah, P. Hollosi, Z. Papp, G. Sobel, K. Karaszi, S. Paku, K.

Baghy, and I. Kovalszky, Remodeling of extracellular matrix by normal and tumor-

associated fibroblasts promotes cervical cancer progression. BMC Cancer, 2015. 15(1):

p. 256.

References

119

56. Hynes, R.O., The extracellular matrix: not just pretty fibrils. Science, 2009. 326(5957):

p. 1216-9.

57. Tency, I., H. Verstraelen, I. Kroes, G. Holtappels, B. Verhasselt, M. Vaneechoutte, R.

Verhelst, and M. Temmerman, Imbalances between matrix metalloproteinases (MMPs)

and tissue inhibitor of metalloproteinases (TIMPs) in maternal serum during preterm

labor. PLoS One, 2012. 7(11): p. e49042.

58. Xu, P., N. Alfaidy, and J.R. Challis, Expression of matrix metalloproteinase (MMP)-2

and MMP-9 in human placenta and fetal membranes in relation to preterm and term

labor. J Clin Endocrinol Metab, 2002. 87(3): p. 1353-61.

59. Riemer, R.K. and M.A. Heymann, Regulation of uterine smooth muscle function during

gestation. Pediatr Res, 1998. 44(5): p. 615-27.

60. Granstrom, L., G. Ekman, U. Ulmsten, and A. Malmstrom, Changes in the connective

tissue of corpus and cervix uteri during ripening and labour in term pregnancy. Br J

Obstet Gynaecol, 1989. 96(10): p. 1198-202.

61. Garfield, R.E. and R.H. Hayashi, Appearance of gap junctions in the myometrium of

women during labor. Am J Obstet Gynecol, 1981. 140(3): p. 254-60.

62. Bollapragada, S., R. Youssef, F. Jordan, I. Greer, J. Norman, and S. Nelson, Term labor

is associated with a core inflammatory response in human fetal membranes,

myometrium, and cervix. Am J Obstet Gynecol, 2009. 200(1): p. 104 e1-11.

63. Gomez-Lopez, N., D. StLouis, M.A. Lehr, E.N. Sanchez-Rodriguez, and M. Arenas-

Hernandez, Immune cells in term and preterm labor. Cell Mol Immunol, 2014. 11(6): p.

571-81.

64. Lee, Y.H., O. Shynlova, and S.J. Lye, Stretch-induced human myometrial cytokines

enhance immune cell recruitment via endothelial activation. Cell Mol Immunol, 2015.

12(2): p. 231-42.

65. Tallant, C., A. Marrero, and F.X. Gomis-Ruth, Matrix metalloproteinases: fold and

function of their catalytic domains. Biochim Biophys Acta, 2010. 1803(1): p. 20-8.

66. Sternlicht, M.D. and Z. Werb, How matrix metalloproteinases regulate cell behavior.

Annu Rev Cell Dev Biol, 2001. 17: p. 463-516.

67. Van Lint, P. and C. Libert, Chemokine and cytokine processing by matrix

metalloproteinases and its effect on leukocyte migration and inflammation. J Leukoc

Biol, 2007. 82(6): p. 1375-81.

68. Murphy, G. and H. Nagase, Progress in matrix metalloproteinase research. Mol Aspects

Med, 2008. 29(5): p. 290-308.

69. Visse, R. and H. Nagase, Matrix metalloproteinases and tissue inhibitors of

metalloproteinases: structure, function, and biochemistry. Circ Res, 2003. 92(8): p. 827-

39.

70. Braundmeier, A.G. and R.A. Nowak, Cytokines regulate matrix metalloproteinases in

human uterine endometrial fibroblast cells through a mechanism that does not involve

increases in extracellular matrix metalloproteinase inducer. Am J Reprod Immunol,

2006. 56(3): p. 201-14.

References

120

71. Curry, T.E., Jr. and K.G. Osteen, Cyclic changes in the matrix metalloproteinase system

in the ovary and uterus. Biol Reprod, 2001. 64(5): p. 1285-96.

72. Braundmeier, A.G., A.T. Fazleabas, B.A. Lessey, H. Guo, B.P. Toole, and R.A. Nowak,

Extracellular matrix metalloproteinase inducer regulates metalloproteinases in human

uterine endometrium. J Clin Endocrinol Metab, 2006. 91(6): p. 2358-65.

73. Werb, Z., P. Tremble, and C.H. Damsky, Regulation of extracellular matrix degradation

by cell-extracellular matrix interactions. Cell Differ Dev, 1990. 32(3): p. 299-306.

74. Chakraborti, S., M. Mandal, S. Das, A. Mandal, and T. Chakraborti, Regulation of

matrix metalloproteinases: an overview. Mol Cell Biochem, 2003. 253(1-2): p. 269-85.

75. Parks, W.C., C.L. Wilson, and Y.S. Lopez-Boado, Matrix metalloproteinases as

modulators of inflammation and innate immunity. Nat Rev Immunol, 2004. 4(8): p. 617-

29.

76. Sbardella, D., G.F. Fasciglione, M. Gioia, C. Ciaccio, G.R. Tundo, S. Marini, and M.

Coletta, Human matrix metalloproteinases: an ubiquitarian class of enzymes involved in

several pathological processes. Mol Aspects Med, 2012. 33(2): p. 119-208.

77. Page-McCaw, A., A.J. Ewald, and Z. Werb, Matrix metalloproteinases and the

regulation of tissue remodelling. Nat Rev Mol Cell Biol, 2007. 8(3): p. 221-33.

78. Manicone, A.M. and J.K. McGuire, Matrix metalloproteinases as modulators of

inflammation. Semin Cell Dev Biol, 2008. 19(1): p. 34-41.

79. Rundhaug, J.E., Matrix metalloproteinases and angiogenesis. Journal of cellular and

molecular medicine, 2005. 9(2): p. 267-85.

80. Sela-Passwell, N., G. Rosenblum, T. Shoham, and I. Sagi, Structural and functional

bases for allosteric control of MMP activities: can it pave the path for selective

inhibition? Biochim Biophys Acta, 2010. 1803(1): p. 29-38.

81. Nagase, H. and J.F. Woessner, Jr., Matrix metalloproteinases. J Biol Chem, 1999.

274(31): p. 21491-4.

82. Fata, J.E., A.T. Ho, K.J. Leco, R.A. Moorehead, and R. Khokha, Cellular turnover and

extracellular matrix remodeling in female reproductive tissues: functions of

metalloproteinases and their inhibitors. Cell Mol Life Sci, 2000. 57(1): p. 77-95.

83. Yan, C. and D.D. Boyd, Regulation of matrix metalloproteinase gene expression. J Cell

Physiol, 2007. 211(1): p. 19-26.

84. Mignatti, P. and D.B. Rifkin, Biology and biochemistry of proteinases in tumor invasion.

Physiol Rev, 1993. 73(1): p. 161-95.

85. Denison, F.C., S.C. Riley, C.L. Elliott, R.W. Kelly, A.A. Calder, and H.O. Critchley,

The effect of mifepristone administration on leukocyte populations, matrix

metalloproteinases and inflammatory mediators in the first trimester cervix. Mol Hum

Reprod, 2000. 6(6): p. 541-8.

86. Huang, H.Y., Y. Wen, J.C. Irwin, J.S. Kruessel, Y.K. Soong, and M.L. Polan, Cytokine-

mediated regulation of 92-kilodalton type IV collagenase, tissue inhibitor or

metalloproteinase-1 (TIMP-1), and TIMP-3 messenger ribonucleic acid expression in

human endometrial stromal cells. J Clin Endocrinol Metab, 1998. 83(5): p. 1721-9.

References

121

87. Graham, C.H., I. Connelly, J.R. MacDougall, R.S. Kerbel, W.G. Stetler-Stevenson, and

P.K. Lala, Resistance of malignant trophoblast cells to both the anti-proliferative and

anti-invasive effects of transforming growth factor-beta. Exp Cell Res, 1994. 214(1): p.

93-9.

88. Tsukada, H. and T. Pourmotabbed, Unexpected crucial role of residue 272 in substrate

specificity of fibroblast collagenase. J Biol Chem, 2002. 277(30): p. 27378-84.

89. Fasciglione, G.F., M. Gioia, H. Tsukada, J. Liang, R. Iundusi, U. Tarantino, M. Coletta,

T. Pourmotabbed, and S. Marini, The collagenolytic action of MMP-1 is regulated by the

interaction between the catalytic domain and the hinge region. J Biol Inorg Chem, 2012.

17(4): p. 663-72.

90. McCawley, L.J. and L.M. Matrisian, Matrix metalloproteinases: they're not just for

matrix anymore! Curr Opin Cell Biol, 2001. 13(5): p. 534-40.

91. Takamoto, N., P.C. Leppert, and S.Y. Yu, Cell death and proliferation and its relation to

collagen degradation in uterine involution of rat. Connect Tissue Res, 1998. 37(3-4): p.

163-75.

92. Morgunova, E., A. Tuuttila, U. Bergmann, M. Isupov, Y. Lindqvist, G. Schneider, and

K. Tryggvason, Structure of human pro-matrix metalloproteinase-2: activation

mechanism revealed. Science, 1999. 284(5420): p. 1667-70.

93. Xu, X., Z. Chen, Y. Wang, L. Bonewald, and B. Steffensen, Inhibition of MMP-2

gelatinolysis by targeting exodomain-substrate interactions. Biochem J, 2007. 406(1): p.

147-55.

94. Vandooren, J., P.E. Van den Steen, and G. Opdenakker, Biochemistry and molecular

biology of gelatinase B or matrix metalloproteinase-9 (MMP-9): the next decade. Crit

Rev Biochem Mol Biol, 2013. 48(3): p. 222-72.

95. Nishida, Y., H. Miyamori, E.W. Thompson, T. Takino, Y. Endo, and H. Sato, Activation

of matrix metalloproteinase-2 (MMP-2) by membrane type 1 matrix metalloproteinase

through an artificial receptor for proMMP-2 generates active MMP-2. Cancer Res,

2008. 68(21): p. 9096-104.

96. Hofmann, U.B., J.R. Westphal, A.J. Zendman, J.C. Becker, D.J. Ruiter, and G.N. van

Muijen, Expression and activation of matrix metalloproteinase-2 (MMP-2) and its co-

localization with membrane-type 1 matrix metalloproteinase (MT1-MMP) correlate with

melanoma progression. J Pathol, 2000. 191(3): p. 245-56.

97. Van den Steen, P.E., B. Dubois, I. Nelissen, P.M. Rudd, R.A. Dwek, and G.

Opdenakker, Biochemistry and molecular biology of gelatinase B or matrix

metalloproteinase-9 (MMP-9). Crit Rev Biochem Mol Biol, 2002. 37(6): p. 375-536.

98. Sbardella, D., R. Inzitari, F. Iavarone, M. Gioia, S. Marini, F. Sciandra, M. Castagnola,

P.E. Van den Steen, G. Opdenakker, B. Giardina, A. Brancaccio, M. Coletta, and M.

Bozzi, Enzymatic processing by MMP-2 and MMP-9 of wild-type and mutated mouse

beta-dystroglycan. IUBMB Life, 2012. 64(12): p. 988-94.

99. Curry, T.E., Jr. and K.G. Osteen, The matrix metalloproteinase system: changes,

regulation, and impact throughout the ovarian and uterine reproductive cycle. Endocr

Rev, 2003. 24(4): p. 428-65.

References

122

100. Deady, L.D., W. Shen, S.A. Mosure, A.C. Spradling, and J. Sun, Matrix

metalloproteinase 2 is required for ovulation and corpus luteum formation in

Drosophila. PLoS Genet, 2015. 11(2): p. e1004989.

101. Wilhelm, S.M., D. Wunderlich, C.A. Maniglia, A.Z. Eisen, and G.I. Goldberg, Primary

structure and function of stromelysin/transin in cartilage matrix turnover. Matrix Suppl,

1992. 1: p. 37-44.

102. Nagase, H., R. Visse, and G. Murphy, Structure and function of matrix

metalloproteinases and TIMPs. Cardiovasc Res, 2006. 69(3): p. 562-73.

103. Pei, D. and S.J. Weiss, Furin-dependent intracellular activation of the human

stromelysin-3 zymogen. Nature, 1995. 375(6528): p. 244-7.

104. Ichikawa, Y., T. Ishikawa, N. Momiyama, M. Kamiyama, H. Sakurada, R. Matsuyama,

S. Hasegawa, T. Chishima, Y. Hamaguchi, S. Fujii, S. Saito, K. Kubota, S. Hasegawa,

H. Ike, S. Oki, and H. Shimada, Matrilysin (MMP-7) degrades VE-cadherin and

accelerates accumulation of beta-catenin in the nucleus of human umbilical vein

endothelial cells. Oncol Rep, 2006. 15(2): p. 311-5.

105. Buhler, L.A., R. Samara, E. Guzman, C.L. Wilson, L. Krizanac-Bengez, D. Janigro, and

D.W. Ethell, Matrix metalloproteinase-7 facilitates immune access to the CNS in

experimental autoimmune encephalomyelitis. BMC Neurosci, 2009. 10: p. 17.

106. Rechtman, M.P., J. Zhang, and L.A. Salamonsen, Effect of inhibition of matrix

metalloproteinases on endometrial decidualization and implantation in mated rats. J

Reprod Fertil, 1999. 117(1): p. 169-77.

107. Brew, K., D. Dinakarpandian, and H. Nagase, Tissue inhibitors of metalloproteinases:

evolution, structure and function. Biochim Biophys Acta, 2000. 1477(1-2): p. 267-83.

108. Brew, K. and H. Nagase, The tissue inhibitors of metalloproteinases (TIMPs): an

ancient family with structural and functional diversity. Biochim Biophys Acta, 2010.

1803(1): p. 55-71.

109. Stetler-Stevenson, W.G., Tissue inhibitors of metalloproteinases in cell signaling:

metalloproteinase-independent biological activities. Sci Signal, 2008. 1(27): p. re6.

110. Gomis-Ruth, F.X., K. Maskos, M. Betz, A. Bergner, R. Huber, K. Suzuki, N. Yoshida,

H. Nagase, K. Brew, G.P. Bourenkov, H. Bartunik, and W. Bode, Mechanism of

inhibition of the human matrix metalloproteinase stromelysin-1 by TIMP-1. Nature,

1997. 389(6646): p. 77-81.

111. Roderfeld, M., J. Graf, B. Giese, R. Salguero-Palacios, A. Tschuschner, G. Muller-

Newen, and E. Roeb, Latent MMP-9 is bound to TIMP-1 before secretion. Biol Chem,

2007. 388(11): p. 1227-34.

112. Bigg, H.F., C.J. Morrison, G.S. Butler, M.A. Bogoyevitch, Z. Wang, P.D. Soloway, and

C.M. Overall, Tissue inhibitor of metalloproteinases-4 inhibits but does not support the

activation of gelatinase A via efficient inhibition of membrane type 1-matrix

metalloproteinase. Cancer Res, 2001. 61(9): p. 3610-8.

113. Heath, J.K., J.J. Reynolds, and M.C. Meikle, Osteopetrotic (grey-lethal) bone produces

collagenase and TIMP in organ culture: regulation by vitamin A. Biochem Biophys Res

Commun, 1990. 168(3): p. 1171-6.

References

123

114. Ahonen, M., M. Poukkula, A.H. Baker, M. Kashiwagi, H. Nagase, J.E. Eriksson, and

V.M. Kahari, Tissue inhibitor of metalloproteinases-3 induces apoptosis in melanoma

cells by stabilization of death receptors. Oncogene, 2003. 22(14): p. 2121-34.

115. Guedez, L., L. Courtemanch, and M. Stetler-Stevenson, Tissue inhibitor of

metalloproteinase (TIMP)-1 induces differentiation and an antiapoptotic phenotype in

germinal center B cells. Blood, 1998. 92(4): p. 1342-9.

116. Koers-Wunrau, C., C. Wehmeyer, A. Hillmann, T. Pap, and B. Dankbar, Cell surface-

bound TIMP3 induces apoptosis in mesenchymal Cal78 cells through ligand-

independent activation of death receptor signaling and blockade of survival pathways.

PLoS One, 2013. 8(7): p. e70709.

117. Baker, A.H., A.B. Zaltsman, S.J. George, and A.C. Newby, Divergent effects of tissue

inhibitor of metalloproteinase-1, -2, or -3 overexpression on rat vascular smooth muscle

cell invasion, proliferation, and death in vitro. TIMP-3 promotes apoptosis. J Clin

Invest, 1998. 101(6): p. 1478-87.

118. Liu, X.W., M.M. Bernardo, R. Fridman, and H.R. Kim, Tissue inhibitor of

metalloproteinase-1 protects human breast epithelial cells against intrinsic apoptotic

cell death via the focal adhesion kinase/phosphatidylinositol 3-kinase and MAPK

signaling pathway. J Biol Chem, 2003. 278(41): p. 40364-72.

119. Liu, Z., X. Zhou, S.D. Shapiro, J.M. Shipley, S.S. Twining, L.A. Diaz, R.M. Senior, and

Z. Werb, The serpin alpha1-proteinase inhibitor is a critical substrate for gelatinase

B/MMP-9 in vivo. Cell, 2000. 102(5): p. 647-55.

120. Li, J., S. Kartha, S. Iasvovskaia, A. Tan, R.K. Bhat, J.M. Manaligod, K. Page, A.R.

Brasier, and M.B. Hershenson, Regulation of human airway epithelial cell IL-8

expression by MAP kinases. Am J Physiol Lung Cell Mol Physiol, 2002. 283(4): p.

L690-9.

121. McQuibban, G.A., G.S. Butler, J.H. Gong, L. Bendall, C. Power, I. Clark-Lewis, and

C.M. Overall, Matrix metalloproteinase activity inactivates the CXC chemokine stromal

cell-derived factor-1. J Biol Chem, 2001. 276(47): p. 43503-8.

122. McQuibban, G.A., J.H. Gong, E.M. Tam, C.A. McCulloch, I. Clark-Lewis, and C.M.

Overall, Inflammation dampened by gelatinase A cleavage of monocyte chemoattractant

protein-3. Science, 2000. 289(5482): p. 1202-6.

123. McQuibban, G.A., J.H. Gong, J.P. Wong, J.L. Wallace, I. Clark-Lewis, and C.M.

Overall, Matrix metalloproteinase processing of monocyte chemoattractant proteins

generates CC chemokine receptor antagonists with anti-inflammatory properties in vivo.

Blood, 2002. 100(4): p. 1160-7.

124. Li, Q., P.W. Park, C.L. Wilson, and W.C. Parks, Matrilysin shedding of syndecan-1

regulates chemokine mobilization and transepithelial efflux of neutrophils in acute lung

injury. Cell, 2002. 111(5): p. 635-46.

125. Park, K.H., T. Chaiworapongsa, Y.M. Kim, J. Espinoza, J. Yoshimatsu, S. Edwin, R.

Gomez, B.H. Yoon, and R. Romero, Matrix metalloproteinase 3 in parturition,

premature rupture of the membranes, and microbial invasion of the amniotic cavity. J

Perinat Med, 2003. 31(1): p. 12-22.

References

124

126. Overall, C.M., G.A. McQuibban, and I. Clark-Lewis, Discovery of chemokine substrates

for matrix metalloproteinases by exosite scanning: a new tool for degradomics. Biol

Chem, 2002. 383(7-8): p. 1059-66.

127. Van den Steen, P.E., P. Proost, A. Wuyts, J. Van Damme, and G. Opdenakker,

Neutrophil gelatinase B potentiates interleukin-8 tenfold by aminoterminal processing,

whereas it degrades CTAP-III, PF-4, and GRO-alpha and leaves RANTES and MCP-2

intact. Blood, 2000. 96(8): p. 2673-81.

128. D'Haese, A., A. Wuyts, C. Dillen, B. Dubois, A. Billiau, H. Heremans, J. Van Damme,

B. Arnold, and G. Opdenakker, In vivo neutrophil recruitment by granulocyte

chemotactic protein-2 is assisted by gelatinase B/MMP-9 in the mouse. J Interferon

Cytokine Res, 2000. 20(7): p. 667-74.

129. Dejana, E., Endothelial cell-cell junctions: happy together. Nat Rev Mol Cell Biol, 2004.

5(4): p. 261-70.

130. Bazzoni, G. and E. Dejana, Endothelial cell-to-cell junctions: molecular organization

and role in vascular homeostasis. Physiol Rev, 2004. 84(3): p. 869-901.

131. Muller, W.A., Leukocyte-endothelial-cell interactions in leukocyte transmigration and

the inflammatory response. Trends Immunol, 2003. 24(6): p. 327-34.

132. Johnson-Leger, C., M. Aurrand-Lions, and B.A. Imhof, The parting of the endothelium:

miracle, or simply a junctional affair? J Cell Sci, 2000. 113 ( Pt 6): p. 921-33.

133. Ledingham, M.A., A.J. Thomson, F. Jordan, A. Young, M. Crawford, and J.E. Norman,

Cell adhesion molecule expression in the cervix and myometrium during pregnancy and

parturition. Obstet Gynecol, 2001. 97(2): p. 235-42.

134. Aghajanian, A., E.S. Wittchen, M.J. Allingham, T.A. Garrett, and K. Burridge,

Endothelial cell junctions and the regulation of vascular permeability and leukocyte

transmigration. J Thromb Haemost, 2008. 6(9): p. 1453-60.

135. Deem, T.L. and J.M. Cook-Mills, Vascular cell adhesion molecule 1 (VCAM-1)

activation of endothelial cell matrix metalloproteinases: role of reactive oxygen species.

Blood, 2004. 104(8): p. 2385-93.

136. Kiran, M.S., R.I. Viji, S.V. Kumar, A.A. Prabhakaran, and P.R. Sudhakaran, Changes in

expression of VE-cadherin and MMPs in endothelial cells: Implications for

angiogenesis. Vasc Cell, 2011. 3(1): p. 6.

137. Liu, J., X. Jin, K.J. Liu, and W. Liu, Matrix metalloproteinase-2-mediated occludin

degradation and caveolin-1-mediated claudin-5 redistribution contribute to blood-brain

barrier damage in early ischemic stroke stage. J Neurosci, 2012. 32(9): p. 3044-57.

138. Zhao, Y.G., A.Z. Xiao, X.M. Cao, and C. Zhu, Expression of matrix metalloproteinase -

2, -9 and tissue inhibitors of metalloproteinase -1, -2, -3 mRNAs in rat uterus during

early pregnancy. Mol Reprod Dev, 2002. 62(2): p. 149-58.

139. Yin, Z., A.A. Sada, O.M. Reslan, N. Narula, and R.A. Khalil, Increased MMPs

expression and decreased contraction in the rat myometrium during pregnancy and in

response to prolonged stretch and sex hormones. Am J Physiol Endocrinol Metab, 2012.

303(1): p. E55-70.

References

125

140. Koscica, K.L., C.V. Ananth, J. Placido, and S.E. Reznik, The effect of a matrix

metalloproteinase inhibitor on inflammation-mediated preterm delivery. Am J Obstet

Gynecol, 2007. 196(6): p. 551 e1-3.

141. Iams, J.D., Current status of prematurity prevention. JAMA, 1989. 262(2): p. 265-6.

142. Tara, P.N. and S. Thornton, Current medical therapy in the prevention and treatment of

preterm labour. Semin Fetal Neonatal Med, 2004. 9(6): p. 481-9.

143. Xu, C., W. Liu, X. You, K. Leimert, X. Fang, S.L. Wood, D.M. Slater, Q. Sun, H. Gu,

D.M. Olson, and X. Ni, PGF2alpha modulates the output of chemokines and pro-

inflammatory cytokines in myometrial cells from term pregnant women through

divergent signaling pathways. Mol Hum Reprod, 2015.

144. O'Brien, W.F., The role of prostaglandins in labor and delivery. Clin Perinatol, 1995.

22(4): p. 973-84.

145. Wolf, K., P. Sandner, A. Kurtz, and W. Moll, Messenger ribonucleic acid levels of

collagenase (MMP-13) and matrilysin (MMP-7) in virgin, pregnant, and postpartum

uterus and cervix of rat. Endocrinology, 1996. 137(12): p. 5429-34.

146. Rosa, R.G., C.A. Tarsitano, S. Hyslop, A.T. Yamada, O.M. Toledo, and P.P. Joazeiro,

Temporal changes in matrix metalloproteinases, their inhibitors, and cathepsins in

mouse pubic symphysis during pregnancy and postpartum. Reprod Sci, 2011. 18(10): p.

963-77.

147. Yoshida, M., N. Sagawa, H. Itoh, S. Yura, M. Takemura, Y. Wada, T. Sato, A. Ito, and

S. Fujii, Prostaglandin F(2alpha), cytokines and cyclic mechanical stretch augment

matrix metalloproteinase-1 secretion from cultured human uterine cervical fibroblast

cells. Mol Hum Reprod, 2002. 8(7): p. 681-7.

148. Tang, Z., L. Yang, R. Xue, J. Zhang, Y. Wang, P.C. Chen, and K.L. Sung, Differential

expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in

anterior cruciate ligament and medial collateral ligament fibroblasts after a mechanical

injury: involvement of the p65 subunit of NF-kappaB. Wound Repair Regen, 2009.

17(5): p. 709-16.

149. Loudon, J.A., S.R. Sooranna, P.R. Bennett, and M.R. Johnson, Mechanical stretch of

human uterine smooth muscle cells increases IL-8 mRNA expression and peptide

synthesis. Mol Hum Reprod, 2004. 10(12): p. 895-9.

150. Ou, C.W., Z.Q. Chen, S. Qi, and S.J. Lye, Increased expression of the rat myometrial

oxytocin receptor messenger ribonucleic acid during labor requires both mechanical

and hormonal signals. Biol Reprod, 1998. 59(5): p. 1055-61.

151. Piersanti, M. and S.J. Lye, Increase in messenger ribonucleic acid encoding the

myometrial gap junction protein, connexin-43, requires protein synthesis and is

associated with increased expression of the activator protein-1, c-fos. Endocrinology,

1995. 136(8): p. 3571-8.

152. Boyd, V., O.M. Cholewa, and K.K. Papas, Limitations in the Use of Fluorescein

Diacetate/Propidium Iodide (FDA/PI) and Cell Permeable Nucleic Acid Stains for

Viability Measurements of Isolated Islets of Langerhans. Curr Trends Biotechnol Pharm,

2008. 2(2): p. 66-84.

References

126

153. Ito, T.K., G. Ishii, H. Chiba, and A. Ochiai, The VEGF angiogenic switch of fibroblasts

is regulated by MMP-7 from cancer cells. Oncogene, 2007. 26(51): p. 7194-203.

154. Brodt-Eppley, J. and L. Myatt, Changes in expression of contractile FP and relaxatory

EP2 receptors in pregnant rat myometrium during late gestation, at labor, and

postpartum. Biol Reprod, 1998. 59(4): p. 878-83.

155. Hadler-Olsen, E., P. Kanapathippillai, E. Berg, G. Svineng, J.O. Winberg, and L. Uhlin-

Hansen, Gelatin in situ zymography on fixed, paraffin-embedded tissue: zinc and ethanol

fixation preserve enzyme activity. J Histochem Cytochem, 2010. 58(1): p. 29-39.

156. Gonzalez, J.M., C.W. Franzke, F. Yang, R. Romero, and G. Girardi, Complement

activation triggers metalloproteinases release inducing cervical remodeling and preterm

birth in mice. Am J Pathol, 2011. 179(2): p. 838-49.

157. Wang, P., L. Yang, X. You, G.K. Singh, L. Zhang, Y. Yan, and K.L. Sung, Mechanical

stretch regulates the expression of matrix metalloproteinase in rheumatoid arthritis

fibroblast-like synoviocytes. Connect Tissue Res, 2009. 50(2): p. 98-109.

158. Reno, F., V. Traina, and M. Cannas, Mechanical stretching modulates growth direction

and MMP-9 release in human keratinocyte monolayer. Cell Adh Migr, 2009. 3(3): p.

239-42.

159. Haseneen, N.A., G.G. Vaday, S. Zucker, and H.D. Foda, Mechanical stretch induces

MMP-2 release and activation in lung endothelium: role of EMMPRIN. Am J Physiol

Lung Cell Mol Physiol, 2003. 284(3): p. L541-7.

160. Bu, S., Y. Zhu, C. Peng, X. Cai, C. Cao, H. Tan, J. Cheng, J. Zhang, J. Liu, H. Li, and K.

Wang, Simulated physiological stretch-induced proliferation of human bladder smooth

muscle cells is regulated by MMPs. Arch Biochem Biophys, 2014. 564: p. 197-202.

161. Woessner, J.F., Jr., Acid hydrolases of the rat uterus in relation to pregnancy, post-

partum involution and collagen breakdown. Biochem J, 1965. 97(3): p. 855-66.

162. Shimizu, K. and K. Maekawa, Collagen degradation in the mouse uterus during

postpartum involution: extracellular pathway. Acta Anat (Basel), 1983. 117(3): p. 257-

60.

163. Jeffrey, J.J. and J. Gross, Collagenase from rat uterus. Isolation and partial

characterization. Biochemistry, 1970. 9(2): p. 268-73.

164. Welgus, H.G., G.A. Grant, J.C. Sacchettini, W.T. Roswit, and J.J. Jeffrey, The

gelatinolytic activity of rat uterus collagenase. J Biol Chem, 1985. 260(25): p. 13601-6.

165. Abramson, S.R., G.E. Conner, H. Nagase, I. Neuhaus, and J.F. Woessner, Jr.,

Characterization of rat uterine matrilysin and its cDNA. Relationship to human pump-1

and activation of procollagenases. J Biol Chem, 1995. 270(27): p. 16016-22.

166. Woessner, J.F., Jr., Regulation of matrilysin in the rat uterus. Biochem Cell Biol, 1996.

74(6): p. 777-84.

167. Saarialho-Kere, U.K., S.O. Kovacs, A.P. Pentland, J.E. Olerud, H.G. Welgus, and W.C.

Parks, Cell-matrix interactions modulate interstitial collagenase expression by human

keratinocytes actively involved in wound healing. J Clin Invest, 1993. 92(6): p. 2858-66.

References

127

168. Pilcher, B.K., J.A. Dumin, B.D. Sudbeck, S.M. Krane, H.G. Welgus, and W.C. Parks,

The activity of collagenase-1 is required for keratinocyte migration on a type I collagen

matrix. J Cell Biol, 1997. 137(6): p. 1445-57.

169. Maier, T., M. Guell, and L. Serrano, Correlation of mRNA and protein in complex

biological samples. FEBS Lett, 2009. 583(24): p. 3966-73.

170. Vogel, C. and E.M. Marcotte, Insights into the regulation of protein abundance from

proteomic and transcriptomic analyses. Nature Reviews Genetics, 2012. 13(4): p. 227-

232.

171. Abba, M., N. Patil, and H. Allgayer, MicroRNAs in the Regulation of MMPs and

Metastasis. Cancers (Basel), 2014. 6(2): p. 625-45.

172. Valencia-Sanchez, M.A., J. Liu, G.J. Hannon, and R. Parker, Control of translation and

mRNA degradation by miRNAs and siRNAs. Genes Dev, 2006. 20(5): p. 515-24.

173. Liu, N., Q. Sun, J. Chen, J. Li, Y. Zeng, S. Zhai, P. Li, B. Wang, and X. Wang,

MicroRNA-9 suppresses uveal melanoma cell migration and invasion through the NF-

kappaB1 pathway. Oncol Rep, 2012. 28(3): p. 961-8.

174. Fang, J.H., H.C. Zhou, C. Zeng, J. Yang, Y. Liu, X. Huang, J.P. Zhang, X.Y. Guan, and

S.M. Zhuang, MicroRNA-29b suppresses tumor angiogenesis, invasion, and metastasis

by regulating matrix metalloproteinase 2 expression. Hepatology, 2011. 54(5): p. 1729-

40.

175. Li, L. and H. Li, Role of microRNA-mediated MMP regulation in the treatment and

diagnosis of malignant tumors. Cancer Biol Ther, 2013. 14(9): p. 796-805.

176. Lindsey, M.L., G.P. Escobar, R. Mukherjee, D.K. Goshorn, N.J. Sheats, J.A. Bruce, I.M.

Mains, J.K. Hendrick, K.W. Hewett, R.G. Gourdie, L.M. Matrisian, and F.G. Spinale,

Matrix metalloproteinase-7 affects connexin-43 levels, electrical conduction, and

survival after myocardial infarction. Circulation, 2006. 113(25): p. 2919-28.

177. Motrescu, E.R., S. Blaise, N. Etique, N. Messaddeq, M.P. Chenard, I. Stoll, C.

Tomasetto, and M.C. Rio, Matrix metalloproteinase-11/stromelysin-3 exhibits

collagenolytic function against collagen VI under normal and malignant conditions.

Oncogene, 2008. 27(49): p. 6347-55.

178. Bejarano, P.A., M.E. Noelken, K. Suzuki, B.G. Hudson, and H. Nagase, Degradation of

basement membranes by human matrix metalloproteinase 3 (stromelysin). Biochem J,

1988. 256(2): p. 413-9.

179. Hubbard, R.C., G. Fells, J. Gadek, S. Pacholok, J. Humes, and R.G. Crystal, Neutrophil

accumulation in the lung in alpha 1-antitrypsin deficiency. Spontaneous release of

leukotriene B4 by alveolar macrophages. J Clin Invest, 1991. 88(3): p. 891-7.

180. Faust, D., K. Raschke, S. Hormann, V. Milovic, and J. Stein, Regulation of alpha1-

proteinase inhibitor release by proinflammatory cytokines in human intestinal epithelial

cells. Clin Exp Immunol, 2002. 128(2): p. 279-84.

181. Pan, W., M. Arnone, M. Kendall, R.H. Grafstrom, S.P. Seitz, Z.R. Wasserman, and C.F.

Albright, Identification of peptide substrates for human MMP-11 (stromelysin-3) using

phage display. J Biol Chem, 2003. 278(30): p. 27820-7.

References

128

182. Manetti, M., S. Guiducci, E. Romano, S. Bellando-Randone, M.L. Conforti, L. Ibba-

Manneschi, and M. Matucci-Cerinic, Increased serum levels and tissue expression of

matrix metalloproteinase-12 in patients with systemic sclerosis: correlation with severity

of skin and pulmonary fibrosis and vascular damage. Ann Rheum Dis, 2012. 71(6): p.

1064-72.

183. Alarab, M., H. Kufaishi, S. Lye, H. Drutz, and O. Shynlova, Expression of extracellular

matrix-remodeling proteins is altered in vaginal tissue of premenopausal women with

severe pelvic organ prolapse. Reprod Sci, 2014. 21(6): p. 704-15.

184. Chan, Y.W., H.A. van den Berg, J.D. Moore, S. Quenby, and A.M. Blanks, Assessment

of myometrial transcriptome changes associated with spontaneous human labour by

high-throughput RNA-seq. Exp Physiol, 2014. 99(3): p. 510-24.

185. Senior, R.M., G.L. Griffin, and R.P. Mecham, Chemotactic activity of elastin-derived

peptides. J Clin Invest, 1980. 66(4): p. 859-62.

186. Owen, C.A., Roles for proteinases in the pathogenesis of chronic obstructive pulmonary

disease. Int J Chron Obstruct Pulmon Dis, 2008. 3(2): p. 253-68.

187. Adair-Kirk, T.L., J.J. Atkinson, T.J. Broekelmann, M. Doi, K. Tryggvason, J.H. Miner,

R.P. Mecham, and R.M. Senior, A site on laminin alpha 5, AQARSAASKVKVSMKF,

induces inflammatory cell production of matrix metalloproteinase-9 and chemotaxis. J

Immunol, 2003. 171(1): p. 398-406.

188. Weathington, N.M., A.H. van Houwelingen, B.D. Noerager, P.L. Jackson, A.D.

Kraneveld, F.S. Galin, G. Folkerts, F.P. Nijkamp, and J.E. Blalock, A novel peptide

CXCR ligand derived from extracellular matrix degradation during airway

inflammation. Nat Med, 2006. 12(3): p. 317-23.

189. Beezhold, D.H. and C. Personius, Fibronectin fragments stimulate tumor necrosis factor

secretion by human monocytes. J Leukoc Biol, 1992. 51(1): p. 59-64.

190. McKee, C.M., M.B. Penno, M. Cowman, M.D. Burdick, R.M. Strieter, C. Bao, and P.W.

Noble, Hyaluronan (HA) fragments induce chemokine gene expression in alveolar

macrophages. The role of HA size and CD44. J Clin Invest, 1996. 98(10): p. 2403-13.

191. Green, D.M., J. Trial, and H.H. Birdsall, TNF-alpha released by comigrating monocytes

promotes transendothelial migration of activated lymphocytes. J Immunol, 1998. 161(5):

p. 2481-9.

192. Birdsall, H.H., W.J. Porter, D.M. Green, J. Rubio, J. Trial, and R.D. Rossen, Impact of

fibronectin fragments on the transendothelial migration of HIV-infected leukocytes and

the development of subendothelial foci of infectious leukocytes. J Immunol, 2004.

173(4): p. 2746-54.

193. Ichikawa, Y., T. Ishikawa, N. Momiyama, M. Kamiyama, H. Sakurada, R. Matsuyama,

S. Hasegawa, T. Chishima, Y. Hamaguchi, S. Fujii, S. Saito, K. Kubota, H. Ike, S. Oki,

and H. Shimada, Matrilysin (MMP-7) degrades VE-cadherin and accelerates

accumulation of beta-catenin in the nucleus of human umbilical vein endothelial cells.

Oncol Rep, 2006. 15(2): p. 311-5.

194. Taipale, J. and J. Keski-Oja, Growth factors in the extracellular matrix. FASEB J, 1997.

11(1): p. 51-9.

References

129

195. Lamagna, C., M. Aurrand-Lions, and B.A. Imhof, Dual role of macrophages in tumor

growth and angiogenesis. J Leukoc Biol, 2006. 80(4): p. 705-13.

196. Bellac, C.L., A. Dufour, M.J. Krisinger, A. Loonchanta, A.E. Starr, U. Auf dem Keller,

P.F. Lange, V. Goebeler, R. Kappelhoff, G.S. Butler, L.D. Burtnick, E.M. Conway, C.R.

Roberts, and C.M. Overall, Macrophage matrix metalloproteinase-12 dampens

inflammation and neutrophil influx in arthritis. Cell Rep, 2014. 9(2): p. 618-32.

197. Newby, A.C., Metalloproteinase expression in monocytes and macrophages and its

relationship to atherosclerotic plaque instability. Arterioscler Thromb Vasc Biol, 2008.

28(12): p. 2108-14.

198. Lin, M., P. Jackson, A.M. Tester, E. Diaconu, C.M. Overall, J.E. Blalock, and E.

Pearlman, Matrix metalloproteinase-8 facilitates neutrophil migration through the

corneal stromal matrix by collagen degradation and production of the chemotactic

peptide Pro-Gly-Pro. Am J Pathol, 2008. 173(1): p. 144-53.

199. Pedersen, G., T. Saermark, T. Kirkegaard, and J. Brynskov, Spontaneous and cytokine

induced expression and activity of matrix metalloproteinases in human colonic

epithelium. Clin Exp Immunol, 2009. 155(2): p. 257-65.

200. Nee, L., N. Tuite, M.P. Ryan, and T. McMorrow, TNF-alpha and IL-1 beta-mediated

regulation of MMP-9 and TIMP-1 in human glomerular mesangial cells. Nephron Exp

Nephrol, 2007. 107(2): p. e73-86.

201. Saikali, Z., H. Setya, G. Singh, and S. Persad, Role of IGF-1/IGF-1R in regulation of

invasion in DU145 prostate cancer cells. Cancer Cell Int, 2008. 8: p. 10.

202. Krstic, J. and J.F. Santibanez, Transforming growth factor-beta and matrix

metalloproteinases: functional interactions in tumor stroma-infiltrating myeloid cells.

ScientificWorldJournal, 2014. 2014: p. 521754.

203. Vaday, G.G., R. Hershkoviz, M.A. Rahat, N. Lahat, L. Cahalon, and O. Lider,

Fibronectin-bound TNF-alpha stimulates monocyte matrix metalloproteinase-9

expression and regulates chemotaxis. J Leukoc Biol, 2000. 68(5): p. 737-47.

204. Rundhaug, J.E., Matrix metalloproteinases, angiogenesis, and cancer: commentary re:

A. C. Lockhart et al., Reduction of wound angiogenesis in patients treated with BMS-

275291, a broad spectrum matrix metalloproteinase inhibitor. Clin. Cancer Res., 9: 00-

00, 2003. Clin Cancer Res, 2003. 9(2): p. 551-4.

205. Foda, H.D. and S. Zucker, Matrix metalloproteinases in cancer invasion, metastasis and

angiogenesis. Drug Discov Today, 2001. 6(9): p. 478-482.

206. Pfeffer, K., Biological functions of tumor necrosis factor cytokines and their receptors.

Cytokine Growth Factor Rev, 2003. 14(3-4): p. 185-91.

207. Black, R.A., C.T. Rauch, C.J. Kozlosky, J.J. Peschon, J.L. Slack, M.F. Wolfson, B.J.

Castner, K.L. Stocking, P. Reddy, S. Srinivasan, N. Nelson, N. Boiani, K.A. Schooley,

M. Gerhart, R. Davis, J.N. Fitzner, R.S. Johnson, R.J. Paxton, C.J. March, and D.P.

Cerretti, A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha

from cells. Nature, 1997. 385(6618): p. 729-33.

208. Alexander, H.A., S.R. Sooranna, L. Myatt, and M.R. Johnson, Myometrial tumor

necrosis factor-alpha receptors increase with gestation and labor and modulate gene

References

130

expression through mitogen-activated kinase and nuclear factor-kappaB. Reprod Sci,

2012. 19(1): p. 43-54.

209. Haro, H., H.C. Crawford, B. Fingleton, K. Shinomiya, D.M. Spengler, and L.M.

Matrisian, Matrix metalloproteinase-7-dependent release of tumor necrosis factor-alpha

in a model of herniated disc resorption. J Clin Invest, 2000. 105(2): p. 143-50.

210. Haro, H., H.C. Crawford, B. Fingleton, J.R. MacDougall, K. Shinomiya, D.M. Spengler,

and L.M. Matrisian, Matrix metalloproteinase-3-dependent generation of a macrophage

chemoattractant in a model of herniated disc resorption. J Clin Invest, 2000. 105(2): p.

133-41.

211. Schonbeck, U., F. Mach, and P. Libby, Generation of biologically active IL-1 beta by

matrix metalloproteinases: a novel caspase-1-independent pathway of IL-1 beta

processing. J Immunol, 1998. 161(7): p. 3340-6.

212. Suh, D.Y., T.K. Hunt, and E.M. Spencer, Insulin-like growth factor-I reverses the

impairment of wound healing induced by corticosteroids in rats. Endocrinology, 1992.

131(5): p. 2399-403.

213. Florini, J.R., D.Z. Ewton, and S.A. Coolican, Growth hormone and the insulin-like

growth factor system in myogenesis. Endocr Rev, 1996. 17(5): p. 481-517.

214. Llewellyn, S., R. Fitzpatrick, D.A. Kenny, J. Patton, and D.C. Wathes, Endometrial

expression of the insulin-like growth factor system during uterine involution in the

postpartum dairy cow. Domest Anim Endocrinol, 2008. 34(4): p. 391-402.

215. Hemers, E., C. Duval, C. McCaig, M. Handley, G.J. Dockray, and A. Varro, Insulin-like

growth factor binding protein-5 is a target of matrix metalloproteinase-7: implications

for epithelial-mesenchymal signaling. Cancer Res, 2005. 65(16): p. 7363-9.

216. Sporn, M.B. and A.B. Roberts, Transforming growth factor-beta: recent progress and

new challenges. J Cell Biol, 1992. 119(5): p. 1017-21.

217. Taipale, J., J. Saharinen, K. Hedman, and J. Keski-Oja, Latent transforming growth

factor-beta 1 and its binding protein are components of extracellular matrix

microfibrils. J Histochem Cytochem, 1996. 44(8): p. 875-89.

218. Saharinen, J., J. Taipale, and J. Keski-Oja, Association of the small latent transforming

growth factor-beta with an eight cysteine repeat of its binding protein LTBP-1. EMBO J,

1996. 15(2): p. 245-53.

219. Jones, R.L., C. Stoikos, J.K. Findlay, and L.A. Salamonsen, TGF-beta superfamily

expression and actions in the endometrium and placenta. Reproduction, 2006. 132(2): p.

217-32.

220. Denison, F.C., R.W. Kelly, A.A. Calder, and S.C. Riley, Cytokine secretion by human

fetal membranes, decidua and placenta at term. Hum Reprod, 1998. 13(12): p. 3560-5.

221. Bowen, J.M., L. Chamley, J.A. Keelan, and M.D. Mitchell, Cytokines of the placenta

and extra-placental membranes: roles and regulation during human pregnancy and

parturition. Placenta, 2002. 23(4): p. 257-73.

References

131

222. Lim, R. and M. Lappas, Differential expression of AP-1 proteins in human myometrium

after spontaneous term labour onset. Eur J Obstet Gynecol Reprod Biol, 2014. 177: p.

100-5.

223. Mitchell, J.A. and S.J. Lye, Differential expression of activator protein-1 transcription

factors in pregnant rat myometrium. Biol Reprod, 2002. 67(1): p. 240-6.

224. Wu, X., H. Shen, L. Yu, M. Peng, W.S. Lai, and Y.L. Ding, Corticotropin-releasing

hormone activates connexin 43 via activator protein-1 transcription factor in human

myometrial smooth muscle cells. Am J Physiol Endocrinol Metab, 2007. 293(6): p.

E1789-94.

225. Shynlova, O.P., A.D. Oldenhof, M. Liu, L. Langille, and S.J. Lye, Regulation of c-fos

expression by static stretch in rat myometrial smooth muscle cells. Am J Obstet

Gynecol, 2002. 186(6): p. 1358-65.

226. Khanjani, S., V. Terzidou, M.R. Johnson, and P.R. Bennett, NFkappaB and AP-1 drive

human myometrial IL8 expression. Mediators Inflamm, 2012. 2012: p. 504952.

227. Lee, I.T., C.C. Lin, S.E. Cheng, L.D. Hsiao, Y.C. Hsiao, and C.M. Yang, TNF-alpha

induces cytosolic phospholipase A2 expression in human lung epithelial cells via

JNK1/2- and p38 MAPK-dependent AP-1 activation. PLoS One, 2013. 8(9): p. e72783.

228. Zhao, Y., K. Koga, Y. Osuga, G. Izumi, M. Takamura, M. Harada, T. Hirata, Y. Hirota,

O. Yoshino, S. Inoue, T. Fujii, and S. Kozuma, Cyclic stretch augments production of

neutrophil chemokines and matrix metalloproteinases-1 (MMP-1) from human decidual

cells, and the production was reduced by progesterone. Am J Reprod Immunol, 2013.

69(5): p. 454-62.

229. Zhao, Y., K. Koga, Y. Osuga, G. Izumi, M. Takamura, M. Harada, T. Hirata, Y. Hirota,

O. Yoshino, T. Fujii, and S. Kozuma, Cyclic stretch augments production of neutrophil

chemokines and matrix metalloproteinase-1 in human uterine smooth muscle cells. Am J

Reprod Immunol, 2013. 69(3): p. 240-7.

230. Zhang, M., Q. Zhou, Q.Q. Liang, C.G. Li, J.D. Holz, D. Tang, T.J. Sheu, T.F. Li, Q. Shi,

and Y.J. Wang, IGF-1 regulation of type II collagen and MMP-13 expression in rat

endplate chondrocytes via distinct signaling pathways. Osteoarthritis Cartilage, 2009.

17(1): p. 100-6.

231. Zhang, D., M. Bar-Eli, S. Meloche, and P. Brodt, Dual regulation of MMP-2 expression

by the type 1 insulin-like growth factor receptor: the phosphatidylinositol 3-kinase/Akt

and Raf/ERK pathways transmit opposing signals. J Biol Chem, 2004. 279(19): p.

19683-90.

matrix metalloproteinase expression and regulation during ... · matrix metalloproteinase...

Documents