mesophyll abscisic acid restrains early growth and ... · cum) and arabidopsis (arabidopsis...

Mesophyll Abscisic Acid Restrains Early Growth andFlowering But Does Not DirectlySuppress Photosynthesis1[OPEN]

Boaz Negin,a,2 Adi Yaaran,a,2 Gilor Kelly,b Yotam Zait,a and Menachem Mosheliona,3,4

aThe Robert H. Smith Institute of Plant Sciences and Genetics in Agriculture, The Hebrew University ofJerusalem, Rehovot 7610001, IsraelbInstitute of Plant Sciences, Agricultural Research Organization, The Volcani Center Bet‐Dagan 7505101, Israel

ORCID IDs: 0000-0003-1890-9848 (B.N.); 0000-0001-9343-9976 (A.Y.); 0000-0002-3889-0024 (G.K.); 0000-0003-4266-1635 (Y.Z.);0000-0003-0156-2884 (M.M.).

Abscisic acid (ABA) levels increase significantly in plants under stress conditions, and ABA is thought to serve as a key stress-response regulator. However, the direct effect of ABA on photosynthesis and the effect of mesophyll ABA on yield under bothwell-watered and drought conditions are still the subject of debate. Here, we examined this issue using transgenic Arabidopsis(Arabidopsis thaliana) plants carrying a dominant ABA-signaling inhibitor under the control of a mesophyll-specific promoter(FBPase::abi1-1, abbreviated to fa). Under normal conditions, fa plants displayed slightly higher stomatal conductance and carbonassimilation than wild-type plants; however, these parameters were comparable following ABA treatment. These observationssuggest that ABA does not directly inhibit photosynthesis in the short term. The fa plants also exhibited a variety of alteredphenotypes under optimal conditions, including more vigorous initial growth, earlier flowering, smaller flowers, and delayedchlorophyll degradation. Furthermore, under optimal conditions, fa plant seed production was less than a third of that observedfor the wild type. However, under drought conditions, wild-type and fa seed yields were similar due to a significant reduction inwild-type seed and no reduction in fa seed. These findings suggest that endogenous basal ABA inhibits a stress-escape responseunder nonstressed conditions, allowing plants to accumulate biomass and maximize yield. The lack of a correlation betweenflowering time and plant biomass combined with delayed chlorophyll degradation suggests that this stress-escape behavior isregulated independently and upstream of other ABA-induced effects such as rapid growth and flowering.

Plants are autotrophic organisms that rely on carbonassimilation for organicmatter production, and thus CO2accessibility is extremely important. However, this ac-cessibility comes at a cost. Opening stomata to allowCO2to enter allows water to leave through those same pores.In order to regulate the balance between water loss andcarbon uptake, stomata can respond to environmentalstimuli and hormonal signals. The phytohormone

abscisic acid (ABA) is the main hormone known to reg-ulate various stress responses in a variety of species fromgreen algae to angiosperms (Takezawa et al., 2011). Inangiosperms, the effects of ABA on stomatal guard cellshave been well studied, particularly with regard to pro-ductivity parameters (e.g. plant water balance, stress re-sponse, and carbon assimilation). Nevertheless, the roleof ABA in regulating stress responses in other non-stomatal productive tissues (e.g.mesophyll tissue) and itsimpact on plant water balance have received less atten-tion, although new evidence suggests that mesophyllcells produce significant amounts of ABA under water-stress conditions (McAdam and Brodribb, 2018). Theseeffects can be seen in transcriptomic analyses (Hoth et al.,2002; Seki et al., 2002;Matsui et al., 2008;Mizoguchi et al.,2010;Wang et al., 2011;González-Guzmán et al., 2012), inwhich ABA has been shown to affect thousands of genes(Nemhauser et al., 2006) involved in a wide range ofprocesses. These effects, which are sometimesmasked bythe effect of ABA on gas exchange, can also be seen inorganisms in which ABA does not affect stomata(Brodribb and McAdam, 2011; McAdam and Brodribb,2012), but does act as a stress hormone.

In the past, it was believed that ABA is synthesized inplant roots and carried through the xylem to the shoot,where it causes stomatal closure. However, in grafting

1This work was supported by the Israel Ministry of Agricultureand Rural Development (Eugene Kandel Knowledge centers) as partof the “Root of the Matter” — The root zone knowledge center forleveraging modern agriculture; the Israel Science Foundation (ISF)(grant no. 876/16); and the United States-Israel Binational ScienceFoundation (BSF) (grant no. 2015100).

2 These authors contributed equally to this work.3Author for contact: [email protected] author.The author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policy de-scribed in the Instructions for Authors (www.plantphysiol.org) is:Menachem Moshelion ([email protected]).

B.N., A.Y., and M.M. planned and designed the research; B.N.,A.Y., and G.K. performed the experiments; B.N., A.Y., and Y.Z. ana-lyzed the data; B.N. and M.M. wrote the manuscript.

[OPEN]Articles can be viewed without a subscription.www.plantphysiol.org/cgi/doi/10.1104/pp.18.01334

910 Plant Physiology�, June 2019, Vol. 180, pp. 910–925, www.plantphysiol.org � 2019 American Society of Plant Biologists. All Rights Reserved. www.plantphysiol.orgon October 25, 2020 - Published by Downloaded from

Copyright © 2019 American Society of Plant Biologists. All rights reserved.

http://orcid.org/0000-0003-1890-9848

http://orcid.org/0000-0003-1890-9848

http://orcid.org/0000-0001-9343-9976

http://orcid.org/0000-0001-9343-9976

http://orcid.org/0000-0002-3889-0024

http://orcid.org/0000-0002-3889-0024

http://orcid.org/0000-0003-4266-1635

http://orcid.org/0000-0003-4266-1635

http://orcid.org/0000-0003-0156-2884

http://orcid.org/0000-0003-0156-2884

http://orcid.org/0000-0003-1890-9848

http://orcid.org/0000-0001-9343-9976

http://orcid.org/0000-0002-3889-0024

http://orcid.org/0000-0003-4266-1635

http://orcid.org/0000-0003-0156-2884

http://crossmark.crossref.org/dialog/?doi=10.1104/pp.18.01334&domain=pdf&date_stamp=2019-05-21

http://dx.doi.org/10.13039/501100003977

http://dx.doi.org/10.13039/501100003977

http://dx.doi.org/10.13039/501100003977

mailto:[email protected]

http://www.plantphysiol.org

mailto:[email protected]

http://www.plantphysiol.org/cgi/doi/10.1104/pp.18.01334


experiments performed in tomato (Solanum lycopersi-cum) and Arabidopsis (Arabidopsis thaliana) using ABA-synthesis mutant root stocks and wild-type scions,stomata were able to close regardless of impaired ABAsynthesis in the root (Holbrook et al., 2002; Christmannet al., 2007). These findings raised the question of howplant stomata respond to drying soil. It has been sug-gested that the bundle sheath may act as a controlcenter, regulating leaf hydraulic conductance in re-sponse to environmental stimuli (Sade et al., 2014b).The existence of root-derived, hydraulic long-distancesignaling has also been suggested (Christmann et al.,2013). In Arabidopsis, bundle sheath cells constitute abarrier to apoplastic water transport from the xylemto the mesophyll. In these cells, ABA reduces mem-brane permeability to water through the regulationof aquaporins (Shatil-Cohen et al., 2011). FollowingShatil-Cohen et al. (2011), Pantin et al. (2013) examinedresponses of different ABA-sensing mutants, as well asthe ost2-2 mutant to ABA, and found that although themutants’ stomata were insensitive to ABA, entire leavesstill responded to the hormone (Pantin et al., 2013).These findings suggest that manipulation of ABA sig-naling in green tissues could affect gas exchange with-out directly affecting stomatal sensitivity to ABA.In addition to its well-documented effects on angio-

sperm stomata and gas exchange, the direct effect ofABA on short-term photosynthetic activity is still notclear. It is difficult to distinguish whether the reductionin photosynthesis seen under stress conditions is ex-clusively related to the decrease in substomatal CO2(Ci) concentration caused by the impact of ABA onstomatal closure, or if there is some other direct bio-chemical inhibition of photosynthesis. This issue haslong been debated (Mawson et al., 1981; Raschke andHedrich, 1985; Downton et al., 1988; Popova et al., 1996;Liang et al., 1997) and, to the best of our knowledge, noconclusive physiological evidence has been reported.Several reviews have concluded that ABA might havedifferential modes of action, according towhich, duringmild drought stress, the decrease in photosynthesiscorrelates mainly with Ci (i.e. is affected by stomatalregulation) and, under more severe stress, there is ad-ditional, direct biochemical inhibition of photosynthe-sis in the mesophyll (Flexas and Medrano, 2002; Flexaset al., 2004). Morover, under severe or prolonged stress,ABA is involved in the regulation of leaf senescence.Examples of this can be found in wheat (Triticum aes-tivum), in which rising ABA concentrations lead to themovement of carbohydrates from stems to seeds (Yanget al., 2003); in barley (Hordeum vulgare), in which linesexhibiting delayed stress-induced senescence hadlower ABA levels (Seiler et al., 2014); and in tomato, inwhich ABA concentration-dependent promotion ofsenescense was also seen (Tung et al., 2008). In Arabi-dopsis, some of the mechanisms underlying ABA-regulated leaf senescence have recently been revealed.Gao et al. (2016) found that ABA-activated transcrip-tion factors bind to the promoter of chlorophyll-catabolizing proteins and promote their expression. In

addition, different ABA-sensing mutants displayed a“stay green” phenotype in response to ABA treatment(Gao et al., 2016).One of the most pronounced effects of ABA involves

drought tolerance. ABAmediates many drought-relatedprocesses from reduction of transpiration (Iuchi et al.,2001; Schroeder et al., 2001) through the inhibition ofshoot growth and thus reducing the plants’ consump-tion of resources, especiallywater, to osmotic adjustment(Mason et al., 1990). The final outcome of these effects isenhanced tolerance to drought (Iuchi et al., 2001; Qin andZeevaart, 2002; Fujita et al., 2005).However, this droughttolerance comes at a price. Even thoughABA's inductionof drought tolerance is a multitiered process, as has beenmentioned, one ofABA's fastest effects on the plant is thereduction of stomatal conductance (Taiz and Zeiger,2006), which is the trait most strongly correlated withyield (de Wit, 1958; Tanner and Sinclair, 1983; Sinclairet al., 1984; Lu et al., 1994; Fischer et al., 1998; Richards,2000; Kemanian et al., 2005; Blum, 2009). Consequently,drought-tolerant crops usually have lower yields underwell-watered conditions (for review, see Negin andMoshelion, 2017). Therefore, manipulation of ABA sig-naling might be a promising approach for increasingcrop yield under drought conditions (Joshi-Saha et al.,2011).Yet, the present understanding of ABA’s effects on

drought responses that emerges from the literature isnot clear cut, partially due to the different definitions ofdrought and drought tolerance and the different ABAlevels and responses caused by such conditions. Thisleads us to the following question: Does ABA affectyield under well-watered and drought conditions and,if so, how? For example, a line of ABA-hypersensitivetransgenic canola (Brassica napus) showed no differencein yield relative to that of wild-type plants under well-watered conditions. However, under mild droughtconditions, the transgenic plants had significantlyhigher yields than control plants (Wang et al., 2005). Inwheat exposed to moderate drought, both shoot drybiomass and seed yield were greater in plants treatedwith exogenous ABA (Travaglia et al., 2010). Tomatoplants with impaired ABA synthesis (flacca and sitiensmutants) had lower fresh biomass levels than did wild-type plants under both well-watered (Sagi et al., 2002)and drought (Aroca et al., 2008) conditions. Further-more, ABA-deficient flacca scions grafted onto wild-type roots exhibited reduced biomass, as compared towild-type self-grafts. However, biomass was not re-duced when wild-type scions were grafted onto flaccaroots (Chen et al., 2002). Taken together, it seems thatABA has a positive effect on plant biomass and yieldunder mild drought conditions. However, under moresevere stress, the advantages ABA provides throughstomatal closure and plant adaptation to water loss aretransformed into an adverse effect due to the inhibitionof growth and the promotion of leaf senescence(Sreenivasulu et al., 2012).Following the elucidation of the ABA signal transduc-

tion pathway in 2009 (Ma et al., 2009; Park et al., 2009),

Plant Physiol. Vol. 180, 2019 911

The Role of Mesophyll Abscisic Acid

www.plantphysiol.orgon October 25, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.


it was found that the previously described dominantABA-insensitive mutant abi1-1 (Koornneef et al., 1984), inwhich a SNP led to aGly toAsp substitution (Leung et al.,1994;Meyer et al., 1994), is insensitive toABAdue to sterichindrance that reduces the affinity of abi1-1 for the ABAreceptor, and thus abi1-1 continues to inhibit SnRK ac-tivity even though ABA is present and bound to the re-ceptor (Joshi-Saha et al., 2011).

ABA’s complex and intertwined regulation of gasexchange and stress responses leads to the question ofwhether and to what extent the ABA in green tissuesinhibits photosynthesis and how it affects plant growthunder both unstressed and drought conditions. To thebest of our knowledge, these questions have not beenfully addressed using a whole-plant model in whichABA insensitivity is limited to the green tissues.Therefore, we examined these questions using trans-genic plants that express the abi1-1 protein under agreen tissue-specific promoter, which leads to domi-nant ABA insensitivity in mesophyll and bundle sheathcells. We initially hypothesized that ABA directly in-hibits carbon assimilation in green tissue (i.e. in addi-tion to the inhibition caused by the reduced availabilityof CO2) and that insensitivity to ABA in green tissueswould lead to enhanced growth and yield under well-watered conditions, but a somewhat impaired stressresponse under drought conditions.

RESULTS

FBPASE::abi1-1 Transgenes

In order to assess the effect of ABA on photosynthesisin angiosperms, we used the mutant PP2C abi1-1 pro-tein. This protein dominantly inhibits ABA sensing,driven by the wheat FBPase promoter, which, as anucleus-expressed chloroplastic protein, is expressed ingreen tissues (see “Materials and Methods”). TheFBPase::abi1-1 transgene (fa) was inserted into plantsusing Agrobacterium-mediated transformation, and threeindependent lines were selected (fa1, fa2, and fa7). TheFBPase promoter expression pattern was confirmed to bemesophyll specific, as shown previously by Sade et al.(2014a), using FBPase::GFP expressing plants. In these,we indeed sawgreen fluorescence in themesophyll tissue(Fig. 1, A and B), but not in stomata (Fig. 1C) or roots(Fig. 1D). The dominant nature of the abi1-1 mutation isdependent on the ratio between the nonmutated ABI1and mutated abi1-1 proteins. We, therefore, quantifiedthis ratio through restriction enzyme digestion of the PCRproduct of ABI1 complementary DNA (cDNA), which iscut in the endogenous form but not in the mutated form.We found that the original abi1-1 gene was 100% uncutand that 6.8% of the gene in the wild type was uncut,indicating the efficiency of the restriction reaction.Among fa1, fa2, and fa7, 72.7%, 78.5%, and 66.7% of thegene was uncut, respectively (Supplemental Fig. S1).

We next used reverse transcription-quantitative PCR(RT-qPCR) expression analysis of the ABA reporter

genes NCED3 (Kelly et al., 2017), RAB18 (Lång andPalva, 1992), and ABI5 (Lopez-Molina et al., 2001) toevaluate the homogeneity of the selected lines. Thesegenes were expressed similarly in the three fa lines.Furthermore, whereas ABA treatment significantly in-duced the expression of these genes in wild-type plants,there was far less induction in the fa lines and the in-duction that did occur was insignificant. These differ-ences also led to a statistically significant interactionbetween line and ABA treatment (Fig. 1, E-G). In orderto assess whether the difference in the ABA responsewas related to different ABA levels or dominant inhi-bition of ABA signaling by abi1-1, we quantified theconcentration of ABA in wild-type and fa leaves(Fig. 1H). Two of the fa lines had higher levels of ABAthan wild type, whereas the third had a concentrationsimilar to that observed for the wild type.

Morphological and Phenological Characterization ofTransgenic Plants

The first irregular phenotype that was observed in faplants was their faster growth. This could be seen fromearly stages of vegetative growth (Fig. 2, A–E), throughearlier flowering that led to taller plants during the firstflowering stages (Fig. 2, F and G) and earlier seedproduction, drying, and death.

In order to assess early growth vigor, we photo-graphed 6-week-old plants (grown under short-dayconditions) and leaf area was measured. At that age,fa plants had a significantly larger rosette area thanwild-type plants (6.38 6 0.31 cm2 as compared with3.28 6 0.29 cm2; Fig. 1).

In addition, fa plants flowered earlier, which led toearlier bolting and a shorter life cycle, that is, they alsobegan senescence earlier and had a shorter life span(Fig. 2). We repeated the short-day experiment in atemperature-regulated greenhouse in 4-L pots. Hereagain, fa plants flowered significantly earlier (at 36.7 60.2 d after sowing as compared with 47 d after sowingin wild type; Fig. 3A).

Our first hypothesis was that the fa plants' rapidinitial growth led to early accumulation of the criticalmass needed for flowering under short-day conditions.This critical mass could be caused by elevated sugarconcentrations that would trigger a flowering signal. Totest that hypothesis, we compared the transgenicplants’ rosette biomass at flowering time to that of wild-type plants. The average biomass of the transgenicplants at the time of flowering was 4.5 times less thanthat of wild-type plants (2.086 0.09 g as comparedwith9.356 0.25 g in wild type). This difference was reflectedin both dry and fresh weights (Fig. 3B). The ratio of dryto fresh biomass was not significantly different betweenthe two lines (106 0.16% inwild type as comparedwith9.6 6 0.16% in fa plants).

We next examined whether the early flowering phe-notype of fa plants was related to the plants reaching aleaf-number threshold. If there was such a threshold,

912 Plant Physiol. Vol. 180, 2019

Negin et al.


http://www.plantphysiol.org/cgi/content/full/pp.18.01334/DC1


even though the wild-type biomass was far greater thanthe transgenic plants at flowering, the number of leavesat flowering would be similar across the two lines. Afteronly leaves longer than 1 cm of plants grown in a short-day growth room were counted, the fa plants' leafnumber figures were found to be significantly lowerthan those of wild-type plants (23.5 6 1.7 in fa plants ascompared with 50.7 6 2.8 in wild-type plants; Fig. 3C).

Leaf area at the time of flowering was also significantlysmaller among fa plants (946 13 cm2 among fa plants ascompared with 284 6 26 cm2 among wild-type plants;Fig. 3D).These findings led us to believe there was a more

direct connection between the insensitivity to ABA inthe mesophyll and flowering time. In order to furthertest this connection, we examined the time of flowering

Figure 1. FBPase::abi1-1 transgene characterization. A to D, Composite images of different tissues of FBPase::GFP-expressingplants. Mesophyll (A and B; Bar = 100 mm and 10 mm, respectively), stomata (C; Bar = 20 mm), and root (D; Bar = 50 mm) areshown. Composite mesophyll and stomata images are composed of overlays of bright-field, GFP (520 nm emission), and auto-fluorescence (650 nm emission) images. Composite root images are composed of bright-field and GFP images. E to G, RT-qPCRexpression analysis of the ABA reporter genesNINE-CIS-EPOXYCAROTENOIDDIOXYGENASE 3 (NCED3; E), RESPONSIVE TOABA 18 (RAB18; F), andABA INSENSITIVE 5 (ABI5; G) before and following ABA induction in wild-type (WT) plants and the threeindependent fa lines: fa1, fa2, and fa7 (n = 5). H, Foliar ABA quantification of well-irrigated plants of wild type and three in-dependent lines of fa (n = 3). Different letters represent a significant difference as determined using Tukey’s honestly significantdifference (HSD) test (P , 0.05).





under long-day conditions. As they did in the green-house during short days, fa plants also flowered signifi-cantly earlier when exposed to long days in a growthroom (fa plants began to flower at 26.66 0.2 d and wild-type plants began to flower at 37 6 0.7 d; Fig. 3E). Theydid so despite their far smaller biomass (0.1 6 0.01 g, ascompared with 0.7 6 0.08 g; Fig. 3F), leaf number (8.660.035, as comparedwith 16.56 0.6; Fig. 3G), and leaf area(4.76 0.5 cm2, as comparedwith 25.66 2.2 cm2; Fig. 3H).

Another morphological feature of fa plants wasthat although their leaves were larger than those ofwild-type plants (Supplemental Fig. S2), their flow-ers were smaller.We photographed flowers from aboveand from the side with petals removed, and analyzedflower area and style length. The fa flower area andstyles lengthwere significantly smaller than those of thewild type (0.63 6 0.03 mm2 for fa flowers as comparedwith 1.276 0.15 mm2 for wild-type flowers, and 0.9760.03 mm as compared with 1.32 6 0.075 mm for styleslength; Fig. 4). In contrast with leaves and flowers, faseedling roots did not differ in length from those ofwild-type seedlings (Supplemental Fig. S3).

Gas Exchange of Well-Watered Plants

In order to test whether ABA inhibits photosynthesisdirectly in green tissues and to try to better understandthe greater growth vigor and earlier flowering of faplants, we used gas-exchange measurements to exam-ine their photosynthesis and water relations.

Under control conditions (i.e. no added ABA), fastomatal conductance (gs) was higher than that of thewild type (335 6 16 mmol m22 s21 as compared with264 6 23 mmol m22 s21; Fig. 5A). ABA perfusion tothe xylem reduced the gs of both lines. Here again, fags was significantly higher than that of the wild type(176 6 14 mmol m22 s21 as compared with 123 617 mmol m22 s21). Carbon assimilation (AN) wasslightly higher in fa leaves both when treated with ABAand when left untreated (6.13 6 0.12 mmol m22 s21

as compared with 5.59 6 0.2 mmol m22 s21, respec-tively, in leaves that were not treated with ABA,and 5.08 6 0.14 mmol m22 s21 compared with 4.5460.25 mmol m22 s21, respectively, in ABA-treatedleaves). In leaves that were not treated with ABA, theratio of transpiration to carbon assimilation (instanta-neous water use efficiency) was higher in wild-typeleaves (2.13 6 0.12 mmol CO2 mol21 H2O in wild typeand 1.836 0.05mmol CO2mol21 H2O in fa leaves). Thisdifference was maintained when leaves were treatedwith ABA (3.08 6 0.16 in the wild type as comparedwith 2.536 0.09 in fa leaves; Fig. 5D). Although fa plantshad higher gs, AN, and Ci before ABA treatment, theirresponse to ABA was similar to that of the wild typeand there was no statistically significant interactionbetween plant type and response to the ABA treatment(Supplemental Table S1). We next examined the possi-bility that although the responses to ABA were similar,fa plants that were not treated with ABA may have hadaltered photosynthetic efficiency. We constructed A/Cicurves and calculated the maximum capacity of

Figure 2. Morphological and pheno-logical fa plant characterization. A to D,Rosettes of 6-week-old wild-type (WT;A) and fa plants (B, fa1; C, fa2; D, fa7).Bars = 3 cm. E, Mean + SE rosette area ofwild-type and fa plants. Statistical anal-ysis was performed using Student’s t test;**significant difference at P , 0.01.Wild type: n = 36; fa: n = 72. F, Four-week-old wild-type and fa plants grownunder long-day conditions. Bar = 6 cm.G, Approximately 10-week-old wild-type and fa plants grown under short-day conditions, digitally extracted forcomparison. Bar = 10 cm.


Negin et al.






Rubisco carboxylation and maximum electron trans-port rate. No significant differences were found in theseparameters (Supplemental Fig. S4).Our results raised the possibility that elevated gs in fa

plants was due to reduced stomatal sensitivity to ABA,even though FBPase::GFP fluorescence could not bedetected in guard cells. In order to test this hypothesis,weexamined the response of stomata to ABA in epidermispeels from fa and thewild type. Untreated fa stomata hadslightly although significantly larger apertures than thatof wild-type stomata (1.87 6 0.06 mm as compared with1.64 6 0.08 mm; Fig. 6B). In response to treatment with10 mM ABA, the apertures of fa stomata were reducedsignificantly by 37% (from 1.87 6 0.06 mm to 1.175 60.03mm; Fig. 6B). Thiswas similar to the 38% reduction inwild-type stomatal aperture observed following ABAtreatment (from 1.64 6 0.08 mm to 1 6 0.07 mm). Whencross-interactions were tested statistically, no significantdifference was found in the response patterns to ABAamong fa and wild-type stomata. These results showedthat fa stomata respond to ABAmuch like the stomata ofwild-type plants, even though fa stomata had slightlylarger initial apertures.Following these results, we examined how mesophyll

insensitivity to ABA affects leaf water potential(cw) in wild-type and fa plants under ABA treatmentand under drought. Under ABA treatment, a signifi-cant cross-interaction existed, meaning that fa leaves

responded differently than wild-type leaves to ABAtreatment and exhibited an increase rather than a de-crease in their cw (Supplemental Fig. S5B). Underdrought conditions, whereaswild-type plants exhibitedsignificantly reduced cw, among fa plants, the reduc-tion in cw was insignificant (Supplemental Fig. S5D).

Seed Yield of Plants Grown in a Growth Room

While first characterizing fa plants, we wanted to eval-uate how their tissue-specific insensitivity to ABA wouldaffect yield. Seeds were collected approximately once aweek for 4weeks, and irrigationwas stopped 2weeks intoseed collection, creating conditions of terminal droughtstress. Throughout the seed-collection period, fa yield wassignificantly higher than wild-type yield (Fig. 7). How-ever, that difference can be attributed to irrigation stop-page that favored the faster-growing fa plants. Whenplants were allowed to complete their life cycle during thedrought experiments, the yield of well-watered wild-typeplants was far greater than that of fa plants.

Greenhouse Drought Treatment

The fa plants' vigorous initial growth and slightlyraised gs together with their stomata’s normal responseto ABA led us to test their behavior under “field”

Figure 3. Flowering time, biomass, leaf number, and leaf area at flowering of wild-type (WT) and fa plants grown under short- orlong-day conditions. A and E, Days from sowing to flower meristem emergence of plants grown under short-day conditions in atemperature-controlled greenhouse (A) and plants grown under long-day conditions in a growth room (E). B and F, Average freshrosette biomass at the time of flowering of plants grown under short-day (B) or long-day conditions (F). C andG, Number of leavesat flowering under short- (C) or long-day (G) conditions. D and H, Leaf area at flowering under short- (D) or long-day (H) con-ditions. Numbers at the bottom of the columns indicate the number of plants tested. **Significant difference relative to that in thewild type (P , 0.01) as determined using Student’s t test.








conditions, that is growing plants in much bigger pots(4 L) in a climate-controlled greenhouse (natural sun-light) and allowing them to complete their life cycleunderwell-watered aswell aswater-limited conditions.Our initial results suggested that under well-wateredconditions, fa plants would transpire more and alongwith their enhanced initial growth vigor they wouldalso have higher yields. To examine the gs response topot relative water content over the course of thedrought treatment, we plotted gs against soil watercontent. Stress conditions were considered to have beeninitiated after plants had reached the soil water limita-tion point (ucrit; Halperin et al., 2017). Here again, fa gswas higher than that of the control. The ucrit of fa plantswas not significantly different than that of wild-typeplants (27.58 6 1.65% as compared with 24.68 62.65%; Fig. 8).

These first results from the drought experimentseemed to support our initial findings obtained in thegrowth chamber conditions. However, to our surprise,under well-watered conditions, wild-type average seedyield was more than triple that of the fa lines (2.69 60.64 g as compared with 0.756 0.08 g; Fig. 9A) and the

dry biomass of wild-type plants was more than doublethat of fa plants (8.39 6 1.21 g as compared with 3.9 60.35 g; Fig. 9B). This also led to a greater harvest indexin wild-type plants (0.28 6 0.06 as compared with0.175 6 0.02; Fig. 9C). Nevertheless, under water-limited conditions (25% irrigation volume relative tothe well-watered control), wild-type seed yield wassignificantly reduced by almost 80% to 0.54 6 0.05 g.The seed yield of the transgenic plants was slightlyand insignificantly reduced by 13.3% to 0.65 6 0.05 g.This difference in yield reduction was also expressedin a significant interaction between the line and the ir-rigation regime (Supplemental Table S1), illustratingthat the different genotypes responded differently todrought. Under water-limited conditions, wild-typedry biomass was reduced by 70.8% (to 2.45 6 0.13 g),as compared with a 49.7% reduction (to 1.94 6 0.1 g)among fa plants. Here too, there was a significant in-teraction between the line and the irrigation regime.These different response patterns led to opposite re-sponses in terms of the harvest index, with the harvestindex of the wild type reduced under water-limitedconditions to 0.22 6 0.01 and the fa harvest indexraised to 0.336 0.02 under those same conditions. Thisalso led to the fa harvest index being significantly higherthan that of the wild type under the 25% irrigation re-gime, and a significant Line 3 Irrigation Treatmentinteraction was also seen for that parameter.

An additional parameter measured in this experi-ment was plant height, which was a good way tomonitor the growth rates of the different genotypes in anondestructive manner. Plant height was measuredtwice during the experiment and again at its conclusion,when plants were cut for biomass measurements. Asshown in growth-chamber measurements (Fig. 7), un-der well-watered as well as water-limited conditions,the vigorous initial growth of fa plants led to their beingsignificantly taller than wild-type plants at the firstmeasurement point. However, under well-wateredconditions, the second set of measurements revealedno statistically significant difference between theheights of wild-type and fa plants. Furthermore, at thethird measurement point, wild-type plants were sig-nificantly taller than fa plants. In contrast, under water-limited conditions, fa plants were taller than wild-typeplants at all three measurement points (Fig. 9D).

Chlorophyll Degradation

The better performance of fa plants under stress con-ditions led us to examine their senescence response bymeasuring chlorophyll degradation. We measuredchlorophyll content in light-grown leaves and in leavesthat were dark-treated for 8 d. Interestingly, light-grownfa leaves had a significantly lower total chlorophyllcontent than did light-grown wild-type leaves (29.13 60.45 mg cm22 as compared with 26.4 6 0.5 mg cm22;Fig. 10C). However, following dark treatment, the re-duction in the chlorophyll content of fa leaves was much

Figure 4. Flower size and style length. A, Flower area of wild-type (WT)and fa plants. B, Style length of wild-type and fa plants. Numbers at thebottom of the columns indicate the sample size. **Significant differenceat P , 0.01, as determined using Student’s t test. B to F, Pictures ofrepresentative wild-type (C) and fa (D to F) flowers. G to K, Pictures ofrepresentative wild-type (G and H) and fa (I to K) styles. Bars = 1 mm.


Negin et al.




smaller (reduced to 10.2 6 1.4 mg cm22 in wild type ascompared with 21.76 0.8 mg cm22 in fa leaves). This ledfa total chlorophyll content following dark treatment tobe significantly higher than that observed for the wildtype, and this differential response was found to bestatistically significant (Fig. 10C). This differential re-sponse to senescence treatment could also be seen in leafcoloring, withwild-type leaves turning yellow followingthe senescence treatment, whereas fa leaves remainedgreen (Fig. 10D).The response pattern of chlorophyll a was similar to

that observed for total chlorophyll and was signifi-cantly higher in the wild type before dark treatment(21.3 6 0.35 mg cm22 as compared with 18.8 6 0.3 mgcm22). Following dark treatment, chlorophyll a contentwas significantly reduced in both wild-type and faleaves, although this reduction was far less significantin fa leaves (to 7.7 6 1.1 mg cm22 in wild-type leavesand to 14.8 6 0.5 mg cm22 in fa leaves; Fig. 10A). Thisled to fa leaves having significantly higher chlorophyll alevels following dark treatment. Chlorophyll b contentbehaved differently than chlorophyll a content; therewas no significant difference between the chlorophyll bcontents of the two lines before dark treatment (7.9 60.15 mg cm22 as compared with 7.59 6 0.26 mg cm22)and chlorophyll b levels of fa leaves were not signifi-cantly reduced following dark treatment (wild type:2.486 0.36 mg cm22; fa: 6.916 0.34 mg cm22; Fig. 10B).In wild-type leaves following dark treatment, chloro-phyll a and b and total chlorophyll contents were re-duced by 63.7%, 68.6%, and 65%, respectively, whereasthe chlorophyll a and b and total chlorophyll contents

of fa leaves were reduced by 21.3%, 8.9%, and 17.8%,respectively.

DISCUSSION

ABA has been reported to affect the transcription ofthousands of genes (Nemhauser et al., 2006) and is repor-ted to have significant redundancy in its signal transduc-tion pathway (Umezawa et al., 2010). Moreover, the ABAresponse varies in different tissues and under differentenvironmental conditions (Saab et al., 1990; Sade andMoshelion, 2017). This complexity makes it hard to iso-late the role of ABA in specific processes. In this study, weused fa plants carrying the ABA-insensitive abi1-1 trans-gene under the control of a green tissue-specific promoterto isolate ABA responses in those tissues without affectingother key tissues such as stomata and roots (Fig. 1, A–D).The expression ofABA reporter genes did not increase in faplants following ABA treatment, thus validating fa plantsexperimental suitability. As could be expected, due to theseveral negative feedback loops triggered by the ABA re-sponse, two out of the three fa lines had higher concen-trations of foliar ABA comparedwith that of the wild type(Fig. 1H). These plants did not exhibit an elevated ABAresponse due to the abi1-1mutant’s dominant nature. Thisenabled us to explore how mesophyll ABA affects shootgrowth, photosynthesis, and stress response.

Plant Morphology

An interesting phenotype observed in fa plants wastheir particularly vigorous initial growth and faster life

Figure 5. Wild-type (WT) and fa gas exchange inresponse to ABA treatment. A, gs. B, AN. C, Ci. D,instantanious water use ifficiency (iWUE; AN/E).Numbers at the bottom of the columns indicatethe sample size. “+” indicates plants that weretreated with ABA; “-” indicates plants that werenot. **Significant difference between ABA-treatedand untreated leaves of the same genotype;△ and△△, significant difference among similarlytreated leaves of different genotypes. △Signifi-cant difference at P , 0.05; ** and △△, signifi-cant difference at P , 0.01. Comparisons wereperformed using Student’s t test.





cycle. In the first weeks after germination, fa plants hada greater leaf area than wild-type plants, and theyflowered, produced seed, and died earlier than wild-type plants (Figs. 2 and 3), a phenotype we identifiedas stress-escape behavior. This phenomenon supportsthe suggestion that under nonstressed conditions,basal endogenous ABA might play a role in the inhi-bition of shoot growth (Tung et al., 2008). Thus, thestress-escape behavior of fa plants may be the result ofinsensitivity to basal ABA levels. Early flowering un-der short-day conditions is one of the most strikingphenotypes of fa plants. Because fa plants also grewfaster than wild-type plants, we initially hypothesizedthat their earlier flowering was induced by the plantsreaching a critical mass at which point assimilate ac-cumulation triggers flowering (Sachs and Hackett,1969; Roldán et al., 1999; Wahl et al., 2013) or theirreaching a critical leaf number, similar to what is seenin tomato (Lifschitz and Eshed, 2006). However, weruled out these hypotheses as fa plants flowered at amuch smaller biomass and when they had far fewerleaves (Fig. 3). Few studies have revealed a link be-tween ABA and flowering. Most recently, a link wasfound between the drought-induced flowering inhib-itor SHORT VEGETATIVE PHASE, reduced ABA

catabolism, and flowering (Wang et al., 2018). In-creased ABA levels have also been reported to delayflowering, although this could be attributed to a gen-eral reduction in growth (Lefebvre et al., 2006),and ABA has been found to inhibit floral initia-tion in Polianthes tuberosa (Su et al., 2002). In Arabi-dopsis, a possible mechanism was suggested bywhich ABA inhibits flowering via phosphorylationof ABA-responsive kinase substrate 1 inhibiting

Figure 6. Stomatal aperture. A, Stomata of the different lines with (+)andwithout (-) ABA treatment as photographed during the experiments.Stomata chosen for this figure were those whose apertures were mostsimilar to the average for their treatment. Bars = 20 mm. B, Stomatalapertures observed in wild-type (WT) and fa epidermal peels with (+)and without (-) 10 mM ABA treatment. **Significant difference (P ,0.01) between treated and untreated stomata of the same genotype;△significant difference (P , 0.05) between the untreated fa stomata andthe untreated wild-type stomata. Numbers at the bottom of the columnsindicate the sample size.

Figure 7. Average seed weight of fa and wild-type (WT) plants grownunder short-day conditions in a growth room and exposed to terminaldrought.Mean seedweight (6 SE) wild type n = 4, fa n = 9 at the differentcollection dates (days after sowing). **Significant difference (P , 0.01)relative to that in the wild type on the same date, as determined usingStudent’s t test.

Figure 8. Stomatal conductance of wild-type (WT) and fa plants in re-sponse to volumetric soil water content. Comparison of the gs patternsof wild-type and fa plants exposed to terminal drought or exposed to25% irrigation or well-watered, in relation to their soil water content.Trend lines represent best fits in piecewise-linear model as calculatedusing anOrigin program (see “Materials andMethods”). u, Critical pointat which plants began to respond to drought by reducing gs. Wild typen = 38; fa n = 114; wild type R2 = 0.52; fa R2 = 0.685.


Negin et al.



ABA-responsive kinase substrate 1 from binding toDNA, which leads to down-regulation of the CON-STANS gene (Takahashi et al., 2016). Phloem-localizedFLOWERING LOCAS T expression (Corbesier et al.,2007) coincides with leaf insensitivity to ABA-inducing flowering even though floral meristems areunaffected in fa plants.

It is interesting to note that although CONSTANSdoes not affect flower morphology (Pidkowich et al.,1999), fa flowers were significantly smaller than wild-type flowers (Fig. 4). Barrero et al. (2005) noted smallerflowers among ABA-deficient mutants and attributedthis to the mutants’ generally inhibited growth (Barreroet al., 2005). However, because the growth of fa plants

Figure 9. Wild-type (WT) and fa plants’ yield,biomass, and plant height in response to droughttreatment. A, Seed yield. B, Dry biomass asmeasured at harvest time. C, Harvest index, ascalculated by dividing seed yield by dry shootbiomass. Numbers at the bottom of the columnsindicate the sample size. Data are means 6 SE.Different letters represent a significant differenceas determined using Tukey HSD test (P , 0.05).Interactionswere tested using a two-way ANOVA.D, wild-type and fa plant height, as measured atthree dates over the course of their life cycle (6March, 27 March, and 1 May) wild type n = 7,wild type25% n = 6, fa n = 18, fa25% n = 18.**Significant difference (P , 0.01) between faplants and the wild type at the same date andunder the same irrigation regime, as determinedusing Student’s t test; triangles represent a signif-icant difference (△△: P , 0.01) between twoconsecutive measuring dates for the same geno-type and irrigation regime, as determined using aStudent’s t test. Triangles were placed above thelater of the two dates.

Figure 10. Chlorophyll concentration (conc.) ofwild-type (WT) and fa light-grown leaves or thosekept in darkness for 8 d. A, Chlorophyll a. B,Chlorophyll b. C, Total chlorophyll. 8d = 8-d darktreatment. Three separate repetitions were per-formed for each treatment. Different letters rep-resent a significant difference as determined usingthe Tukey HSD test (P , 0.05). Numbers at thebottom of the columns indicate the sample size.D, Representative scanning of leaves followingsenescence treatment, digitally extracted forcomparison. Bar = 2 cm.





was not inhibited at stages before flowering, this doesnot seem to be the reason for the smaller flowers ob-served in our study.

Gas Exchange

ABA is known to reduce transpiration and photo-synthesis via stomatal closure. Nevertheless, there hasbeen some debate as to whether ABA has a direct effecton photosynthesis in mesophyll tissue in a pathwaythat is not related to limited availability of CO2 (due tostomatal closure). Gas-exchange experiments weredesigned to answer this question. The insensitivity ofthe fa mesophyll tissue to ABA together with normalABA-induced stomatal closure meant that if ABA doesindeed affect the biochemistry of angiosperm photo-synthesis, the transgenic plants would show elevatedcarbon assimilation due to insensitivity to the hormone.Initially, we verified that fa plants exhibited reducedstomatal conductance in response to ABA treatment ina manner similar to that observed for the wild type(Figs. 5A and 6). Although the gs of fa plants was greaterthan that of the wild type when ABA was not applied,the two sets of plants responded similarly to ABAtreatment (no statistical interaction between plant typeand ABA treatment). The results showed that among faand wild-type plants, there was no difference in thereduction of AN in response to ABA (Fig. 5B). Wetherefore concluded that ABA does not directly inhibitphotosynthesis under the examined conditions. Theseresults received further validation from the A/Ci curveresults showing that photosynthetic efficiency wasunaltered in fa plants (Supplemental Fig. S4).

One question that arose from these experiments wasas follows: If fa stomata respond normally to ABA,whatis the reason for their wider stomatal apertures andhigher gs? The wide-ranging developmental and hy-draulic effects of ABA could affect this phenotype, forexample, by altering leaf hydraulic conductance (Shatil-Cohen et al., 2011) and cell wall development(Wakabayashi et al., 1989). However, further investi-gation of this question is beyond the scope of this study.

fa “Field” Experiments

The fa plants had higher yields (i.e. dry seed biomass)than didwild-type plants under short-day conditions inthe growth room, under conditions of terminal droughtstress (Fig. 7). We wanted to test whether fa plantswould maintain those yield levels under well-wateredand water-limited conditions that more closely resem-bled field conditions (i.e. larger soil volume, daylightradiation intensity, and a day/night temperature gra-dient). We hypothesized that fa insensitivity to ABAwould lead to higher yields under nonterminal droughtconditions via a stay green-like phenotype (Riveroet al., 2007). In the yield experiments performed in thegreenhouse, we allowed plants to complete their life

cycle under well-irrigated conditions. In our prelimi-nary experiment in the growth room, irrigation wasstopped before that point, which resulted in fa plantyields exceeding those of wild-type plants due to theirfaster growth and earlier flowering stress-escape be-havior (Fig. 7). However, in the greenhouse, well-watered wild-type plants yielded far more than faplants and had a better harvest index as well (Fig. 9). Infact, fa plants seemed to have a more rapid life cycle notonly in terms of early growth vigor and flowering, butalso in terms of earlier senescence and drying. How-ever, under water-limited conditions, the yield of wild-type plants was limited and similar to that of fa plants,probably due to limitation of the wild-type reproduc-tive phase by shortening of the plant life cycle. Fur-thermore, whereas drought treatment reduced thewild-type harvest index, it improved the harvest in-dex of fa plants.

Taken together, these results somewhat surprised us.Because ABA is a hormone that regulates the responseto stress, we assumed that high levels of ABA wouldinduce an escape mechanism and would be in line withthe understanding that ABA promotes senescence andthe allocation of resources to seeds. ABA's role in reg-ulating plant stress-escape behavior is still the subject ofdebate (Riboni et al., 2013). In fa plants, insensitivity toABA caused what can be seen as a stress-escapemechanism: an accelerated and shorter life cycle thatis beneficial under terminal drought conditions (as seenin the growth-room yield experiment; Fig. 7; Negin andMoshelion, 2017). This stress-escape mechanism maybe beneficial under water-limited conditions, but itlimits yield potential under nonstressed conditions.This stress-escape behavior is exemplified by the plantheight measurements; fa plants initially grew fasterthan wild-type plants, but stopped growing earlierunder well-watered conditions and, at the end of theexperiment, were significantly shorter than wild-typeplants. However, under water-limited conditions, faplants were taller at all three measurement points, ap-parently due to their initial rapid growth before theonset of drought (Fig. 9D).

These results are congruent with those of Franks(2011), who examined drought escape mechanisms inBrassica rapa and found that stress-escape mechanismswere coupled with increased transpiration and reducedwater-use efficiency. Those findings hint at a reductionin ABA synthesis or sensitivity. In addition, Franks(2011) mentioned the trade-off between drought toler-ance and escape, meaning that plants that use droughtescape mechanisms cannot be drought-tolerant andvice versa (Franks, 2011).

The embodiment of the different stress responses canbe seen in the response of the plants’ harvest index todrought treatment. Wild-type plants, which do not usestress-escape mechanisms, reach maximal yields underwell-watered conditions and, therefore, develop amassive shoot as compared with fa plants. Pendingcompletion of their life cycle, biomass is directly relatedto seed yield. However, under drought conditions,


Negin et al.




wild-type plants’ initial growth of a large shoot cannotbe translated into seed yield and their harvest index isreduced. In fa plants, on the other hand, because astress-escape mechanism is used, the seed yield ishardly affected by drought and the reduction in plantbiomass under water-limited conditions leads to animproved harvest index (Fig. 9).In addition, although fa plants had significantly

higher gs compared with that of the wild type, theirresponse to drought was unimpaired due to normalstomatal closure. Such behavior, that is, the uncouplingof gs from the stress response under well-wateredconditions, could be better suited for dealing withmild stress conditions, since it allows for high levels oftranspiration and photosynthesis under well-wateredconditions, together with a normal stress response.

Yield Stability

Another aspect of the stress-escape mechanism is itseffect on yield stability. Whereas wild-type plantsexhibited a severe 80% reduction in their yield follow-ing drought treatment (as compared with the well-irrigated control), the yield of fa plants was reducedby only 13% (Fig. 9). Furthermore, these results wereobtained under relatively mild stress and it can be ex-pected that under more severe stress wild-type plantswould show an even greater yield penalty, whereas faplants would suffer less. Stress-escape mechanisms areespecially beneficial in drought-prone environmentswhere, following initial rainfall events, there is no cer-tainty that there will be any additional rain. In such asituation, plants that use early rain to complete their life

cycle, although not achieving high yield in rainy years,will produce a small, but stable yield, which is benefi-cial in uncertain environments. That being said, theexamination of ABA’s involvement in stress-escapemechanisms in terms of yield measurements shouldbe approached cautiously until the relevant relation-ships can be examined in additional plant (preferablycrop) species.

Leaf Senescence

Under a senescence-inducing dark treatment, faleaves exhibited delayed chlorophyll degradation ascompared with wild-type leaves (Fig. 10), supportingABA's role in promoting leaf senescence. It seems as if faplants exhibit a contradicting stay-green phenotypeand an escape phenotype simultaneously. These resultsand those of the yield experiments may together beexplained by the escape mechanism, which leads to aprogrammed shorter life cycle regardless of the stay-green phenotype. Similar to early flowering, the ap-parent contradiction between the stay-green phenotypeand the stress-escape response suggests that this stress-escape mechanism is not a side effect of ABA’s regula-tion of flowering and senescence, but rather a separateand independent stress response.

CONCLUSIONS

The role of basal endogenous ABA in the green tis-sues (mainly the mesophyll) of plants growing undernonstressed conditions may be involved in restraining

Figure 11. Schematic model of the relative development and physiological performance of wild-type (wt) and fa plants underdrought-stress and well-watered conditions. A, Under well-watered conditions (i.e. no drought stress induction), ABA levels arerelatively constant. The fa plants exhibit stress-escape behavior that includes greater initial growth vigor and gs, and earlierflowering time, as compared with that in the wild type. However, the growth rate and gs of fa plants decline more quickly as theplant senesces, whereas the wild-type gs remains constant and wild-type plant biomass surpasses that of fa plants. These dif-ferences are mirrored in yield levels. B, Under drought conditions, plants reduce their gs at a similar point and with a similarpattern. The fa stress-escape behavior results in a less severe yield penalty, as compared with the wild type. The fa floweringinitiated under well-watered conditions is not affected by drought. Wild-type plants exhibit delayed flowering at the beginning ofdrought, but later reach a high flowering percentage (wild-type flowering under drought stress based on Su et al., 2013). Takentogether, this model exemplifies the payoff of the stress-escape mechanism. Under optimal conditions, this mechanism severelylimits yield potential. However, under drought conditions that begin in themiddle of the growing season, this mechanism reducesthe yield penalty and maintains yield stability.





mechanisms of early growth vigor and flowering.This enables the inhibition of the stress-escape re-sponse that is exhibited by plants insensitive to green-tissue ABA.

This inhibition of a stress-escape mechanism underoptimal conditions allows plants to reach maximumpotential yields, as exhibited by the wild-type plants inthis work. In contrast, under stress, the plants that wereinsensitive to ABA and escaped the stress reached alower than optimal, but stable yield, comparable withthe lower yield of the stressedwild-type plants. The factthat both sets of plants reached similar yields understress explains the evolutionary advantage of the wildtype’s opportunistic behavior (Fig. 11).

We suggest that ABA’s role in leaf senescence, whichis in opposition to its role in the inhibition of the stress-escape response, suggests that this inhibition involves amechanism independent of a stay-green phenotype.Similarly, the lack of correlation between flowering andproductivity measurements such as photosynthetic rateand biomass indicates that the observed inhibition offlowering is part of a signal transduction pathway thatinhibits the stress-escape response and, in this case,is not caused by the inhibition of vegetative growth.Finally, we conclude that although ABA promoteschlorophyll degradation, in the short term this phyto-hormone does not directly inhibit the photosyntheticmachinery.

MATERIALS AND METHODS

Plant Material and Growing Conditions

All Arabidopsis (Arabidopsis thaliana) plants used in this study were of theColombia (col) ecotype, and this ecotype is referred to as the wild type. Inaddition to wild-type plants, in all of the Arabidopsis experiments, we usedtransgenic FBPase::abi1-1 (fa) plants. For physiological experiments, Arabi-dopsis plants were grown in a growth room with short-day conditions (10 hlight/14 h dark) at temperatures of 18°C to 22°C. Plants grown for seed, andlong-day flowering experiments were grown in a growth room kept at a tem-perature of 22°C with 16 h of light. For drought and yield experiments, plantswere grown in a temperature-controlled greenhouse with temperatures rang-ing between 18°C and 22°C from December through April (2016). When grownin Murashige and Skoog plates, plants were grown in a cell-culture room at atemperature of 22°C with 16 h of light each day.

FBPase::abi1-1 Constructs and Plant Transformation

For construct assembly, the MultiSite Gateway Three-Fragment VectorConstruction Kit (Invitrogen) was used according to the manufacturer's in-structions. For green tissue-specific expression, the FBPase promoter (Lloydet al., 1991; Sade et al., 2014a) was used. FBPase is a chloroplastic proteinencoded in the nucleus and expressed specifically in green tissues, but notin stomata (Fig. 1). The gene used was the abi1-1 gene, which was PCRamplified from abi1-1 plants (Koornneef et al., 1984). The DONR plasmidswere inserted into the binary pB7M24GW (Invitrogen) plasmid containingthe 35S terminator and the BAR glufosinate-resistance gene. Plasmids wereinserted into Arabidopsis plants from the col ecotype using the floral-dipmethod (Clough and Bent, 1998). Four lines that exhibited segregation in-dicative of the presence of one insert (fa1, fa2, fa6, and fa7) were chosen,although in the end, experiments were performed without the fa6 line.Homozygote t3 lines were selected and used throughout the study. Thepresence of the transgene containing the G to A substitution was confirmedby sequencing t3 plant DNA.

Physiological and Morphological Characterization ofTransgenic Plants

For quantitative analysis of RAB18, NCED3, and ABI5 expression by RT-qPCR, leaves were harvested from each plant and immediately immersed intoliquid nitrogen. Total RNA was extracted using total RNA mini kit (GeneaidBiotech). cDNA was prepared using the qPCRBIO cDNA synthesis kit (PCRBiosystems) according to themanufacturer’s instructions. qPCRwas performedin the presence of SYBR Green ROXMix (Thermo Fisher Scientific) in a CorbettResearch Rotor-Gene 6000 cycler. The reaction was 30 s at 94°C followed by 40cycles consisting of 10 s at 94°C, 30 s at 60°C and 20 s at 72°C. Analysis wasperformed using Rotor-Gene 6000 series software 1.7. The PCR primers used foramplification of RAB18 were forward: 59 TTACCAGAACCGTCCAGGAG 39and reverse: 59ACCACCACCAGTTCCGTATC 39, forNCED3were forward: 59AAAGCCATCGGTGAGCTTCA 39 and reverse: 59 GCAGCTCTGGCGTAGAATAG 39, and forABI5were forward: 59 TGGAGAGGAAGAGGAAGCAA 39and reverse 59 CTCGGGTTCCTCATCAATGT 39. The specificity of the primerswas determined by a melting curve analysis; a single, sharp peak in the meltingcurve indicates that a single, specific DNA sequence was amplified. Arabi-dopsis TUB2 (b-tubulin; Kelly et al., 2017) was used as a reference for thestandardization of quantities of cDNA.

Foliar ABA concentrations were measured using a liquid chromatography-mass spectrometry system, which consisted of Dionex Ultimate 3000 RS HPLCcoupled to Q Exactive Plus hybrid Fourier Transform mass spectrometerequippedwith heated electrospray ionization source (Thermo Fisher Scientific).The HPLC separations were carried out using an Acclaim C18 column (2.1 3150 mm, particle size 2.2 mm; Dionex). The mass spectrometer was operated innegative ionizationmode, with a spray voltage of 3 kV, capillary temperature of300°C, electrospray ionization capillary temperature of 300°C, sheath gas rate(arb) of 40, and auxiliary gas rate (arb) of 10. Mass spectra were acquired in them/z 130-600 D range at a resolving power of 70,000. Data analysis was carriedout using Xcalibur software (Thermo Fisher Scientific). For calibration andanalysis, abscisic acid and abscisic acid-D6 (internal standard) were purchasedfrom Toronto Research Chemicals.

Short-day flowering was evaluated in a temperature-controlled greenhouseduring January and February (2016). Plants were considered to be “flowering”when flower buds could be seen, before bolting. Among these plants, six mini-blocks were used for biomass evaluation at flowering. In these blocks, oncebuddingwas noticed, the plant rosette was cut at midday and put into a zipper-locked bag. These rosettes were weighed, and then dried in a 60°C oven andweighed again to determine dry biomass. For the evaluation of flowering underlong-day conditions, both budding and bolting were evaluated, due to theplants’ small size at the time of flowering, which made recognition of floweringbuds before bolting difficult. For the evaluation of leaf number at flowering,plants were grown in a short-day growth room. Once the plants reached thebolting stage, rosettes were harvested and leaves were separated and scannedusing an Epson Perfection v37 scanner (www.epson.com). Leaves longer than1 cmwere counted, and leaf area was analyzed using ImageJ software (https://imagej.nih.gov/ij/).

Flower size was evaluated in well-watered plants from the temperature-controlled greenhouse. Flowers were cut and photographed through anOlympus SZX7 binocular scope (http://www.olympus-global.com) with anOlympus LC20 camera. Flower area and style height were then calculated usingImageJ software. For leaf area and root length, see Supplemental Methods.

Leaf Gas-Exchange Measurements

Gas-exchange measurements, including stomatal conductance (gs), carbonassimilation (AN), Ci, and transpiration (E) were performed on leaves of 6- to 8-week-old plants grown in a short-day growth room. Leaves were excised beforethe light in the growth room was turned on. Two leaves were cut from eachplant and were put into control tubes containing artificial xylem sap (1 mM

K2HPO4, 1 mM KH2PO4, 1 mM CaCl, 0.1 mM MgSO4, 3 mM KNO3, 0.1 mM

MnSO4, and 0.01% [v/v] dimethyl sulfoxide, titrated to pH 5.8 using KOH;Shatil-Cohen et al., 2011) or artificial xylem sap with ABA at a final concen-tration of 10 mM. The leaves were then put into hermetically sealed transparentboxes and left under lighting for 1 h. Following that period, the lids wereopened for 5 min, after which gas exchange was measured using the LI-6400xtportable gas-exchange system (LI-COR). Cuvette conditions were set to400 mL L21 CO2, photosynthetically active radiation 200 mE m22 s21, vaporpressure deficit;1.5, and a flow of 200 mmol s21. For A/Ci curves and cw, seeSupplemental Methods.


Negin et al.


http://www.epson.com

https://imagej.nih.gov/ij/

https://imagej.nih.gov/ij/

http://www.olympus-global.com




Stomatal Aperture

Leaves of 6- to 8-week-old plants grown in a short-day growth room werecut during themorning hours. Two epidermal stripswere peeled from each leaf.One strip was put into stomatal opening buffer (containing 20 mM KCl, 1 mM

CaCl2, and 5 mM MES hydrate, and titrated to pH 6.15 using KOH; Acharyaet al., 2013), and the other was put into the same buffer that would later besupplemented with ABA. Following 2 h in the light, ABA was added to a finalconcentration of 10 mM and dimethyl sulfoxide was added to the controltreatment to a final concentration of 0.01% (v/v). After another 1.5 h in the light,stomata were photographed at a magnification of 403 and stomatal aperturewas analyzed using ImageJ software.

Arabidopsis Greenhouse Drought Experiment: Setup

Plants were grown in a temperature-controlled greenhouse in 4-L pots, withan upside-down 1-L pot inserted in themiddle of each pot in order to reduce potvolume while maintaining surface area. Each pot contained a block of all of theexperimental plants: wild type, fa1, fa2, and fa7. Plant location in the pot wasrandomized. Until flowering, all pots received the same irrigation regime, using4 L/h dripper heads. For experimental setup, also see Supplemental Fig. S11.Once flowering began, pots were divided into two irrigation regimes: well-watered and 25% of well-watered (this was done by changing the dripperhead from 4 L/h to 1 L/h). Plants were then grown until the end of theirlife cycle.

Arabidopsis Drought-Treatment Measurements

The gs levels of plants were measured after the initiation of the droughttreatment with the first measurement, performed at t0, considered “well-watered.” Measurements were taken using a leaf porometer (SC-1 Porometer,Decagon Devices) during the morning hours (9 to 11 AM). At the same time, soilwater content was measured using a Prochek probe (Decagon Devices).

Seeds of plants from the different watering regimes were continually col-lected (twice a week) due to different flowering, fruit ripening, and plant deathtimes. Dry biomass was measured at the experiment's end by harvesting plants'aerial parts anddrying that tissue in an oven at 60°C for aweek. Seedweightwasmeasured after a similar drying procedure.

Chlorophyll Content

Leaf discs with a radius of 3mmwere cut from 6- to 8-week-old Arabidopsisplants grown in a short-day growth room. Discs were cut from untreatedleaves, as well as leaves that had undergone a senescence treatment that in-cluded incubation in the dark for 8 d (Markovich et al., 2017). The discswere putinto 80 v/v% acetone and stored in a freezer (220°C) for at least 1 week. Fol-lowing that treatment, absorption was read at two different wave lengths (663nm and 645 nm) using a spectrophotometer (MRC V-1100D). Chlorophyllcontent was then calculated using the following equations: chlorophyll a(mg) = 663 nm absorption 3 12.4-645 nm absorption 3 2.7; chlorophyll b(mg) = 645 nm absorption3 23-663 nm absorption3 4.7; and total chlorophyllwas calculated as the sum of chlorophyll a + b (Bruinsma, 1963).

Statistical Analyses

To plot soil water content against transpiration in the Arabidopsis droughtexperiments, a two-piece linear fit through the origin program (http://www.originlab.com) was used. In the other experiments, when two variables wereexamined (e.g. line and ABA treatment), the interaction between those factorswas evaluated using a two-way ANOVA. When no significant interactionexisted in the ANOVA, Student's t test was used. In cases in which there was asignificant cross interaction, the Tukey–HSD test was used. JMP 12 pro (SASInstitute; http://www.jmp.com/en_us/home.html) was used for all analyses,except for the comparison of soil water content with gs. The different p-valuesattained from the two-way ANOVAs can be found in Supplemental Table S1.

Accession Numbers

Accession numbers of major genes mentioned in this paper are FBPasepromoter – AR390745; abi1-1 - AT4G26080.1 polymorphism 4769512; NCED3

- AT3G14440.1; RAB18 – AT5G66400.1; and ABI5 - AT2G36270; TUB2 –

AT5G62690.

SUPPLEMENTAL DATA

The following supplemental materials are available.

Supplemental Figure S1. Semiquantification of the native ABI1 gene vs.the abi1-1 mutant gene in wild type, fa and col-abi1-1 leaves.

Supplemental Figure S2. fa plants had significantly larger leaves com-pared to wild type.

Supplemental Figure S3. Root length of 9-d-old fa and wild type seedlingsgrown on perpendicularly placed plates.

Supplemental Figure S4. fa and wild type leaves exhibited similar CO2

assimilation/leaf intercellular CO2 (A/Ci) curves.

Supplemental Figure S5. Effects of ABA treatment and drought on the leafwater potentials of fa and wild type plants.

Supplemental Figure S6. Flowering data (as shown in Fig. 3) broken downto illustrate results for individual fa lines.

Supplemental Figure S7. Flower size and style-length data (as shown inFig. 4) broken down to illustrate results for individual fa lines.

Supplemental Figure S8. Wild type and fa gas exchange in response toABA treatment (as shown in Fig. 5) for the individual lines.

Supplemental Figure S9. Stomatal-aperture data, separated out for indi-vidual fa lines.

Supplemental Figure S10. Wild type and fa plants' yield, biomass andharvest-index response to drought treatment; data presented for indi-vidual fa lines.

Supplemental Figure S11. Experimental setup for the greenhouse droughttreatment.

Supplemental Table S1. p values of two way anovas performed.

Supplemental Methods.

Received October 29, 2018; accepted March 14, 2019; publishedMarch 25, 2019.

LITERATURE CITED

Acharya BR, Jeon BW, Zhang W, Assmann SM (2013) Open Stomata1 (OST1) is limiting in abscisic acid responses of Arabidopsis guard cells.New Phytol 200: 1049–1063

Aroca R, Del Mar Alguacil M, Vernieri P, Ruiz-Lozano JM (2008) Plantresponses to drought stress and exogenous ABA application are mod-ulated differently by mycorrhization in tomato and an ABA-deficientmutant (sitiens). Microb Ecol 56: 704–719

Barrero JM, Piqueras P, González-Guzmán M, Serrano R, Rodríguez PL,Ponce MR, Micol JL (2005) A mutational analysis of the ABA1 gene ofArabidopsis thaliana highlights the involvement of ABA in vegetativedevelopment. J Exp Bot 56: 2071–2083

Blum A (2009) Effective use of water (EUW) and not water-use efficiency(WUE) is the target of crop yield improvement under drought stress. FCrop Res 112: 119–123

Brodribb TJ, McAdam SAM (2011) Passive origins of stomatal control invascular plants. Science 331: 582–585

Bruinsma J (1963) The quantitative analysis of chlorophylls a and b in plantextracts. Photochem Photobiol 2: 241–249

Chen G, Lips SH, Sagi M (2002) Biomass production, transpiration rateand endogenous abscisic acid levels in grafts of flacca and wild-typetomato (Lycopersicon esculentum). Funct Plant Biol 29: 1329–1335

Christmann A, Weiler EW, Steudle E, Grill E (2007) A hydraulic signal inroot-to-shoot signalling of water shortage. Plant J 52: 167–174

Christmann A, Grill E, Huang J (2013) Hydraulic signals in long-distancesignaling. Curr Opin Plant Biol 16: 293–300

Clough SJ, Bent AF (1998) Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743





http://www.originlab.com

http://www.originlab.com

http://www.jmp.com/en_us/home.html
















Corbesier L, Vincent C, Jang S, Fornara F, Fan Q, Searle I, Giakountis A,Farrona S, Gissot L, Turnbull C (2007) FT protein movement contrib-utes to long-distance signaling in floral induction of Arabidopsis. Sci-ence 316: 1030–1033

de Wit CT (1958) Transpiration and Crop Yields. Institute of Biological andChemical Research on Field Crops and Herbage, Wageningen, TheNetherlands, http://edepot.wur.nl/186445

Downton WJS, Loveys BR, Grant WJR (1988) Stomatal closure fully ac-counts for the inhibition of photosynthesis by abscisic acid. New Phytol108: 263–266

Fischer RA, Rees D, Sayre KD, Lu Z-M, Condon AG, Saavedra AL (1998)Wheat yield progress associated with higher stomatal conductance andphotosynthetic rate, and cooler canopies. Crop Sci 38: 1467–1475

Flexas J, Medrano H (2002) Drought-inhibition of photosynthesis in C3

plants: Stomatal and non-stomatal limitations revisited. Ann Bot 89:183–189

Flexas J, Bota J, Loreto F, Cornic G, Sharkey TD (2004) Diffusive andmetabolic limitations to photosynthesis under drought and salinity in C3

plants. Plant Biol (Stuttg) 6: 269–279Franks SJ (2011) Plasticity and evolution in drought avoidance and escape

in the annual plant Brassica rapa. New Phytol 190: 249–257Fujita Y, Fujita M, Satoh R, Maruyama K, Parvez MM, Seki M, Hiratsu K,

Ohme-Takagi M, Shinozaki K, Yamaguchi-Shinozaki K (2005) AREB1is a transcription activator of novel ABRE-dependent ABA signaling thatenhances drought stress tolerance in Arabidopsis. Plant Cell 17:3470–3488

Gao S, Gao J, Zhu X, Song Y, Li Z, Ren G, Zhou X, Kuai B (2016) ABF2,ABF3 and ABF4 promote ABA-mediated chlorophyll degradation andleaf senescence by transcriptional activation of chlorophyll catabolicgenes and senescence-associated genes in Arabidopsis. Mol Plant 9:1272–1285

González-Guzmán M, Pizzio GA, Antoni R, Vera-Sirera F, Merilo E,Bassel GW, Fernández MA, Holdsworth MJ, Pérez-Amador MA,Kollist H, et al (2012) PYR/PYL/RCAR receptors play a major role inquantitative regulation of stomatal aperture and transcriptional re-sponse to abscisic acid. Plant Cell 24: 2483–2496

Halperin O, Gebremedhin A, Wallach R, Moshelion M (2017) High‐throughput physiological phenotyping and screening system for thecharacterization of plant–environment interactions. Plant J 89: 839–850

Holbrook NM, Shashidhar VR, James RA, Munns R (2002) Stomatalcontrol in tomato with ABA-deficient roots: Response of grafted plantsto soil drying. J Exp Bot 53: 1503–1514

Hoth S, Morgante M, Sanchez J-P, Hanafey MK, Tingey SV, Chua N-H(2002) Genome-wide gene expression profiling in Arabidopsis thalianareveals new targets of abscisic acid and largely impaired gene regulationin the abi1-1 mutant. J Cell Sci 115: 4891–4900

Iuchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata S,Kakubari Y, Yamaguchi-Shinozaki K, Shinozaki K (2001) Regulationof drought tolerance by gene manipulation of 9-cis-epoxycarotenoiddioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis.Plant J 27: 325–333

Joshi-Saha A, Valon C, Leung J (2011) Abscisic acid signal off theSTARting block. Mol Plant 4: 562–580

Kelly G, Lugassi N, Belausov E, Wolf D, Khamaisi B, Brandsma D,Kottapalli J, Fidel L, Ben-Zvi B, Egbaria A, Acheampong AK, Zheng C,et al (2017) The Solanum tuberosum KST1 partial promoter as a tool forguard cell expression in multiple plant species. J Exp Bot 68: 2885–2897

Kemanian AR, Stöckle CO, Huggins DR (2005) Transpiration-use effi-ciency of barley. Agric Meteorol 130: 1–11

Koornneef M, Reuling G, Karssen CM (1984) The isolation and charac-terization of abscisic acid‐insensitive mutants of Arabidopsis thaliana.Physiol Plant 61: 377–383

Lång V, Palva ET (1992) The expression of a rab-related gene, rab18, is in-duced by abscisic acid during the cold acclimation process of Arabidopsisthaliana (L.) Heynh. Plant Mol Biol 20: 951–962

Lefebvre V, North H, Frey A, Sotta B, Seo M, Okamoto M, Nambara E,Marion-Poll A (2006) Functional analysis of Arabidopsis NCED6 andNCED9 genes indicates that ABA synthesized in the endosperm is in-volved in the induction of seed dormancy. Plant J 45: 309–319

Leung J, Bouvier-Durand M, Morris PC, Guerrier D, Chefdor F, GiraudatJ (1994) Arabidopsis ABA response gene ABI1: Features of a calcium-modulated protein phosphatase. Science 264: 1448–1452

Liang J, Zhang J, Wong MH (1997) Can stomatal closure caused by xylemABA explain the inhibition of leaf photosynthesis under soil drying?Photosynth Res 51: 149–159

Lifschitz E, Eshed Y (2006) Universal florigenic signals triggered by FThomologues regulate growth and flowering cycles in perennial day-neutral tomato. J Exp Bot 57: 3405–3414

Lloyd JC, Raines CA, John UP, Dyer TAA (1991) The chloroplast FBPasegene of wheat: Structure and expression of the promoter in photosyn-thetic and meristematic cells of transgenic tobacco plants. Mol GenGenet 225: 209–216

Lopez-Molina L, Mongrand S, Chua NH (2001) A postgermination de-velopmental arrest checkpoint is mediated by abscisic acid and requiresthe ABI5 transcription factor in Arabidopsis. Proc Natl Acad Sci USA 98:4782–4787

Lu Z, Radin JW, Turcotte EL, Percy R, Zeiger E (1994) High yields inadvanced lines of Pima cotton are associated with higher stomatalconductance, reduced leaf area and lower leaf temperature. PhysiolPlant 92: 266–272

Ma Y, Szostkiewicz I, Korte A, Moes D, Yang Y, Christmann A, Grill E(2009) Regulators of PP2C phosphatase activity function as abscisic acidsensors. Science 324: 1064–1068

Markovich O, Steiner E, Kou�ril Š, Tarkowski P, Aharoni A, Elbaum R(2017) Silicon promotes cytokinin biosynthesis and delays senescence inArabidopsis and Sorghum. Plant Cell Environ 40: 1189–1196

Mason Robertson J, Hubick KT, Yeung EC, Reid DM (1990) Develop-mental responses to drought and abscisic acid in sunflower roots I. Rootgrowth, apical anatomy, osmotic adjustment. J Exp Bot 41: 325–327

Matsui A, Ishida J, Morosawa T, Mochizuki Y, Kaminuma E, Endo TA,Okamoto M, Nambara E, Nakajima M, Kawashima M, et al (2008)Arabidopsis transcriptome analysis under drought, cold, high-salinityand ABA treatment conditions using a tiling array. Plant Cell Physiol 49:1135–1149

Mawson BT, Colman B, Cummins WR (1981) Abscisic acid and photo-synthesis in isolated leaf mesophyll cell. Plant Physiol 67: 233–236

McAdam SAM, Brodribb TJ (2012) Fern and lycophyte guard cells do notrespond to endogenous abscisic acid. Plant Cell 24: 1510–1521

McAdam SAM, Brodribb TJ (2018) Mesophyll cells are the main site ofabscisic acid biosynthesis in water-stressed leaves. Plant Physiol 177:911–917

Meyer K, Leube MP, Grill E (1994) A protein phosphatase 2C involved inABA signal transduction in Arabidopsis thaliana. Science 264: 1452–1455

Mizoguchi M, Umezawa T, Nakashima K, Kidokoro S, Takasaki H, FujitaY, Yamaguchi-Shinozaki K, Shinozaki K (2010) Two closely relatedsubclass II SnRK2 protein kinases cooperatively regulate drought-inducible gene expression. Plant Cell Physiol 51: 842–847

Negin B, Moshelion M (2017) The advantages of functional phenotyping inpre-field screening for drought-tolerant crops. Funct Plant Biol 44:107–118

Nemhauser JL, Hong F, Chory J (2006) Different plant hormones regulatesimilar processes through largely nonoverlapping transcriptional re-sponses. Cell 126: 467–475

Pantin F, Monnet F, Jannaud D, Costa JM, Renaud J, Muller B,Simonneau T, Genty B (2013) The dual effect of abscisic acid on sto-mata. New Phytol 197: 65–72

Park S-Y, Fung P, Nishimura N, Jensen DR, Fujii H, Zhao Y, Lumba S,Santiago J, Rodrigues A, Tsz-fung FC (2009) Abscisic acid inhibits type2C protein phosphatases via the PYR/PYL family of START proteins.Science 324: 1068–1071

Pidkowich MS, Klenz JE, Haughn GW (1999) The making of a flower:Control of floral meristem identity in Arabidopsis. Trends Plant Sci 4:64–70

Popova LP, Tsonev TD, Lazova GN, Stoinova ZG (1996) Drought‐andABA‐induced changes in photosynthesis of barley plants. Physiol Plant96: 623–629

Qin X, Zeevaart JAD (2002) Overexpression of a 9-cis-epoxycarotenoiddioxygenase gene in Nicotiana plumbaginifolia increases abscisic acid andphaseic acid levels and enhances drought tolerance. Plant Physiol 128:544–551

Raschke K, Hedrich R (1985) Simultaneous and independent effects ofabscisic acid on stomata and the photosynthetic apparatus in wholeleaves. Planta 163: 105–118

Riboni M, Galbiati M, Tonelli C, Conti L (2013) GIGANTEA enablesdrought escape response via abscisic acid-dependent activation of the


Negin et al.


http://edepot.wur.nl/186445


florigens and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS.Plant Physiol 162: 1706–1719

Richards RA (2000) Selectable traits to increase crop photosynthesis andyield of grain crops. J Exp Bot 51: 447–458

Rivero RM, Kojima M, Gepstein A, Sakakibara H, Mittler R, Gepstein S,Blumwald E (2007) Delayed leaf senescence induces extreme droughttolerance in a flowering plant. Proc Natl Acad Sci USA 104: 19631–19636

Roldán M, Gómez-Mena C, Ruiz-García L, Salinas J, Martínez-ZapaterJM (1999) Sucrose availability on the aerial part of the plant promotesmorphogenesis and flowering of Arabidopsis in the dark. Plant J 20:581–590

Saab IN, Sharp RE, Pritchard J, Voetberg GS (1990) Increased endogenousabscisic acid maintains primary root growth and inhibits shoot growthof maize seedlings at low water potentials. Plant Physiol 93: 1329–1336

Sachs RM, Hackett WP (1969) Control of vegetative and reproductivedevelopment in seed plants. HortScience 4: 103–107

Sade N, Moshelion M (2017) Plant aquaporins and abiotic stress. In FChaumont and S Tyerman,, eds, Plant Aquaporins. Signaling andCommunication in Plants. Springer, Cham, Switzerland, pp 185–206

Sade N, Gallé A, Flexas J, Lerner S, Peleg G, Yaaran A, Moshelion M(2014a) Differential tissue-specific expression of NtAQP1 in Arabidopsisthaliana reveals a role for this protein in stomatal and mesophyll con-ductance of CO2 under standard and salt-stress conditions. Planta 239:357–366

Sade N, Shatil-Cohen A, Attia Z, Maurel C, Boursiac Y, Kelly G, GranotD, Yaaran A, Lerner S, Moshelion M (2014b) The role of plasmamembrane aquaporins in regulating the bundle sheath-mesophyll con-tinuum and leaf hydraulics. Plant Physiol 166: 1609–1620

Sagi M, Scazzocchio C, Fluhr R (2002) The absence of molybdenum co-factor sulfuration is the primary cause of the flacca phenotype in tomatoplants. Plant J 31: 305–317

Schroeder JI, Kwak JM, Allen GJ (2001) Guard cell abscisic acid signallingand engineering drought hardiness in plants. Nature 410: 327–330

Seiler C, Harshavardhan VT, Reddy PS, Hensel G, Kumlehn J, Eschen-Lippold L, Rajesh K, Korzun V, Wobus U, Lee J, et al (2014) Abscisicacid flux alterations result in differential abscisic acid signaling re-sponses and impact assimilation efficiency in barley under terminaldrought stress. Plant Physiol 164: 1677–1696

Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T, Kamiya A,Nakajima M, Enju A, Sakurai T, et al (2002) Monitoring the expressionpattern of around 7,000 Arabidopsis genes under ABA treatments usinga full-length cDNA microarray. Funct Integr Genomics 2: 282–291

Shatil-Cohen A, Attia Z, Moshelion M (2011) Bundle-sheath cell regula-tion of xylem-mesophyll water transport via aquaporins under droughtstress: A target of xylem-borne ABA? Plant J 67: 72–80

Sinclair TR, Tanner CB, Bennett JM (1984) Water-use efficiency in cropproduction. Bioscience 34: 36–40

Sreenivasulu N, Harshavardhan VT, Govind G, Seiler C, Kohli A (2012)Contrapuntal role of ABA: Does it mediate stress tolerance or plantgrowth retardation under long-term drought stress? Gene 506: 265–273

Su W-R, Huang K-L, Shen R-S, Chen W-S (2002) Abscisic acid affects floralinitiation in Polianthes tuberosa. J Plant Physiol 159: 557–559

Su Z, Ma X, Guo H, Sukiran NL, Guo B, Assmann SM, Ma H (2013)Flower development under drought stress: Morphological and tran-scriptomic analyses reveal acute responses and long-term acclimation inArabidopsis. Plant Cell 25: 3785–807

Taiz L, Zeiger E (2006) Plant Physiology, Ed 4. Sinauer Associates, Sun-deland, Massachusetts

Takahashi Y, Kinoshita T, Matsumoto M, Shimazaki K (2016) Inhibitionof the Arabidopsis bHLH transcription factor by monomerizationthrough abscisic acid-induced phosphorylation. Plant J 87: 559–567

Takezawa D, Komatsu K, Sakata Y (2011) ABA in bryophytes: How auniversal growth regulator in life became a plant hormone? J Plant Res124: 437–453

Tanner CB, Sinclair TR (1983) Efficient water use in crop production: re-search or re-search? In HM Taylor, WR Jordan, TR Sinclair, eds, Limi-tations to Efficient Water Use in Crop Production. American Society ofAgronomy, Wisconsin, pp 1–27

Travaglia C, Reinoso H, Cohen A, Luna C, Tommasino E, Castillo C,Bottini R (2010) Exogenous ABA increases yield in field-grown wheatwith moderate water restriction. J Plant Growth Regul 29: 366–374

Tung SA, Smeeton R, White CA, Black CR, Taylor IB, Hilton HW,Thompson AJ (2008) Over-expression of LeNCED1 in tomato (Solanumlycopersicum L.) with the rbcS3C promoter allows recovery of lines thataccumulate very high levels of abscisic acid and exhibit severe pheno-types. Plant Cell Environ 31: 968–981

Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M,Shinozaki K, Yamaguchi-Shinozaki K (2010) Molecular basis of thecore regulatory network in ABA responses: Sensing, signaling andtransport. Plant Cell Physiol 51: 1821–1839

Wahl V, Ponnu J, Schlereth A, Arrivault S, Langenecker T, Franke A, FeilR, Lunn JE, Stitt M, Schmid M (2013) Regulation of flowering by tre-halose-6-phosphate signaling in Arabidopsis thaliana. Science 339:704–707

Wakabayashi K, Sakurai N, Kuraishi S (1989) Effects of ABA on synthesisof cell-wall polysaccharides in segments of etiolated squash [Cucurbitamaxima] hypocotyl I. Changes in incorporation of glucose and myo-inositol into cell-wall components. Plant Cell Physiol 30: 99–105.

Wang RS, Pandey S, Li S, Gookin TE, Zhao Z, Albert R, Assmann SM(2011) Common and unique elements of the ABA-regulated tran-scriptome of Arabidopsis guard cells. BMC Genomics 12: 216

Wang Y, Ying J, Kuzma M, Chalifoux M, Sample A, McArthur C, UchaczT, Sarvas C, Wan J, Dennis DT, McCourt P, Huang Y (2005) Moleculartailoring of farnesylation for plant drought tolerance and yield protec-tion. Plant J 43: 413–424

Wang Z, Wang F, Hong Y, Yao J, Ren Z, Shi H, Zhu J-K (2018) Theflowering repressor SVP confers drought resistance in Arabidopsis byregulating abscisic acid catabolism. Mol Plant 11: 1184–1197

Yang JC, Zhang JH, Wang ZQ, Zhu QS, Liu LJ (2003) Involvement ofabscisic acid and cytokinins in the senescence and remobilization ofcarbon reserves in wheat subjected to water stress during grain filling.Plant Cell Environ 26: 1621–1631





mesophyll abscisic acid restrains early growth and ... · cum) and arabidopsis (arabidopsis...

Documents