method of artificial dna spling by directed ligation (sdl)

Nucleic Acids Research, Vol. 19, No. 24 6757-6761

E.N.Lebedenko, K.R.Birikh, O.V.PIutalov and Yu.A.BerlinM.M.Shemyakin Institute of Bioorganic Chemistry, Academy of Sciences of the USSR, Moscow,117871 USSR

Received October 11, 1991; Revised and Accepted November 26, 1991

ABSTRACT

An approach to directed genetic recombination in vitrohas been devised, which allows for joining together,in a predetermined way, a series of DNA segments togive a precisely spliced polynucleotide sequence (DNAsplicing by directed ligation, SDL). The approach makesuse of amplification, by means of several polymerasechain reactions (PCR), of a chosen set of DNAsegments. Primers for the amplifications containrecognition sites of the class IIS restrictionendonucleases, which transform blunt ends of theamplification products into protruding ends of uniqueprimary structures, the ends to be used for joiningsegments together being mutually complementary.Ligation of the mixture of the segments so synthesizedgives the desired sequence in an unambiguous way.The suggested approach has been exemplified by thesynthesis of a totally processed (intronless) geneencoding human mature interleukin-1a.

INTRODUCTION

Synthesis of artificial genes capable of producing functionallyactive proteins and their analogues has been making an essentialcontribution to studies in molecular biology, including its appliedaspects. Total chemical-enzymatic synthesis and mRNA reversetranscription were the tools which used to dominate this field(1-3) . The advent of the efficient and versatile method ofpolymerase chain reaction (PCR, or DNA amplification in vitro)(4-6) affected, among many others, the gene synthesis problem.Thus, an elegant technique of gene splicing by overlap extension(SOE) was developed (7, 8). We have suggested an alternativeapproach to DNA splicing, also based on PCR, - splicing bydirected ligation (SDL).

MATERIALS AND METHODS

E.coli TGI strain (9), plasmid vectors pUC19 (10) and pDR540(Pharmacia), restriction endonucleases Eco31I, BamHI, Smal,EcoRI, E.coli DNA polymerase I (Klenow fragment), T4polynucleotide kinase and DNA ligase (Ferment, Vilnyus),thermostable DNA polymerase Thermus thermophilus(B.P.Konstantinov Institute for Nuclear Physics, Gatchina,Leningrad Region), alkaline phosphatase from calf intestine (CIP;Boehringer), [7-33P]ATP, [a-33P]dATP (Leningrad) and[a-32P]dNTP (Tashkent) were used. Enzymatic reactions were

carried out in buffers recommended by the suppliers. In the caseof Eco3\\ the buffer contained 10 mM tris-HCl, pH 7.5, 10 mMMgCl2, 25 mM NaCl, 5 mM dithiothreitol; combined treatmentwith £co31I and BamHI endonucleases was carried out in asimilar buffer with 60 mM NaCl and 1 mM dithiothreitol.Polyacrylamide gel electrophoreses (PAGE) were run in thebuffer containing 50 mM tris-borate, pH 8.3, 1 mM EDTA.

Synthesis of primersThe primers for amplification and sequencing were synthesizedby the solid-phase phosphoramidite approach (11, 12) with theuse of the DNA Synthesizer System 1 Plus (Beckman). Aftercleavage off the support and total deprotection, theoligonucleotides were purified by electrophoresis in 15%denaturing PAG.

Amplifications in vitro (PCR)Amplifications of the exon segments of the IL-la gene werecarried out according to the modified method (13) in 50 mlincubation mixture, containing 0.5 /tg DNA from humanleukocytes (isolated according to (14)), 67 mM tris-HCl, pH 8.8,6.7 mM MgCl2, 1 mM dithiothreitol, 16.6 mM (NH^SO,,, 8.5mg BSA, as well as 1 mM EdNTP and 10 pmol each of theupstream and downstream primers 5'-phosphorylated withnonradioactive ATP and T4 polynucleotide kinase, under a layerof the silicon oil. After denaturation (5 min at 94°C) 2 U DNApolymerase T. thermophilus were added. The reaction mixturewas incubated in the DNA Thermal Cycler (Perkin Elmer Cetus)for 1 min at 94°C (denaturation), 2 min at 55°C (annealing),3 min at 72°C (primer extension) in a total of 30 cycles. ThenNaCl to the final concentration 5 mM and 1 U DNA polymeraseI (Klenow fragment) were added and incubation continued for10 min at 20°C to even the ends of the amplification product.

In the case of the two-step amplification for the synthesis ofthe exon 5 fragment, the reaction mixture, obtained with primersUS-5M and DS-5M, was diluted 5000-fold with the above buffer,then US-5 and DS-5 primers, four dNTPs and DNA polymeraseT. thermophilus were added and another 30 cycles of theamplification were carried out. The amplification products wereisolated by electrophoresis in 10% PAG followed byelectroelution and gel-filtration on Sephadex G-50.

Cloning of the amplification productsPCR products were cloned into pUC19 vector which hadpreliminary been cleaved with Smal endonuclease anddephosphorylated with CIP under standard conditions (15).

Downloaded from https://academic.oup.com/nar/article-abstract/19/24/6757/1318483by gueston 14 April 2018

6758 Nucleic Acids Research, Vol. 19, No. 24

Ligation and transformation of competent cells TG-1 were carriedout as described (16), clones containing the desired inserts wereselected on agar with Xgal (17).

Plasmid DNA were isolated by the alkaline lysis method (18)and additionally purified by precipitation with 7.5% polyethyleneglycol 6000 (19).

Assembly of the IL-la gene from the exon fragmentsRecombinant plasmids pUC19, containing the amplificationproducts of the IL-la gene's exons 5, 6 and 7 (25 /tg each), weredigested with the corresponding endonuclease(s)(Eco3U+BamUl in the case of exons 5 and 7, and Eco2>\\ inthe case of exon 6), the reaction mixtures were separated byelectrophoresis in 10% PAG, the desired products, after stainingwith ethidium bromide, were cut out of the gels, combined andelectroeluted. After gel-filtration the yield of the mixture of theexon fragments was 1.3 /tg.

The preparation obtained was lyophilized and treated with T4DNA ligase in 40 /d standard buffer for 12 h at 4°C, the enzymewas thermally inactivated (2 min at 100°C), the mixture wasmade 10 mM in NaCl and treated with BamUl endonuclease.An aliquot (1%) of the reaction mixture, labelled by means ofthe Klenow fragment of DNA polymerase I and [a-32P]dNTPs,was analysed by means of 10% PAGE. The major ligationproduct was isolated by electrophoresis of the main part of theligation mixture, with the labelled mixture as a control. Afterelectroelution and gel-filtration, 0.7 y.g of the desiredpolynucleotide (mature IL-la gene) were obtained and clonedinto pBR540 plasmid at BamWl site with 15-fold fragment'sexcess (0.7 fig fragment and 0.4 ^g plasmid DNA cut with BamHland dephosphorylated with CLP). The resultant mixture was usedto transform TG-1 cells (LB-agar, 100 /ig/ml ampicillin).

Colony hybridisationThe recombinant clones bearing pDR540 with the IL-la insertswere identified by colony hybridisation on nitrocellulosemembranes (Schleicher & Shuell) as described (20). Theamplification primers (US-5 and DS-7, labelled at 5'-end with[7-32P]ATP and T4 polynucleotide kinase) were used as separateprobes for the full-length insert.

exon• •171

5

bp

exon i>

125 bp

part of IL-la

exon

1354

locus in hunan genome

hybridisationwith syntheticprimers

7

bp

DNA sequencingSequencing of double-stranded DNA by the Sanger chain-termination method (21) was carried out with the use of the'Sequencing Kit' (Ferment, Vilnyus), containing a modified T7DNA polymerase, and a number of specially synthesized primers.To sequence inserts into pDR540, an 18-mer 5'-ACAATTAAT-CATCGGCTC, homologous to the coding strand of the plasmidat the toe promoter area, was used. Recombinant pUC19 plasmidswere sequenced with 20-meric primers flanking the polylinkerand somewhat differing from the standard M13 primers: one ofthem (5'-GTTGTAAAACGACGGCCAGT-3') is homologous tothe coding strand at the area of the EcoRl site, whereas the other(5'-GCTATGACCATGATTACGCC-3') is complementary tothe same strand at the area of the Hindlll-site. The source ofthe label in sequencing was [a-33P]dATP in the elongationmixture or 5'-33P-phosphorylated primer.

RESULTS AND DISCUSSION

The most essential features of the suggested method of artificialDNA splicing (SDL) are as follows. A group of DNA (e.g.,genomic DNA) segments to be spliced are amplified by meansof separate PCRs, with specially designed synthetic primers. Eachof these primers consists of a stretch, complementary to an edgeof the corresponding DNA segment, and a pendant 5'-end, i.e.,an end non-complementary to the template, which is known notto interfere with PCR (22). The 5'-end includes a properlyoriented recognition site of a class-IIS restriction endonuclease(see, e.g. (23)) which cleaves each strand of the double-strandedDNA outside of and at a specific distance (different for eachstrand) from the recognition site, thus yielding protruding ends.In the present work we have used £co31I endonuclease (24),which recognizes six-membered non-palindromic segments of adefinite sequence and cuts DNA unilaterally with respect to therecognition site at the distances of one and five nucleotides from

N-N-N-N-X-G-A-G-A-C-C- -G-G-T-C-T-C-X-N-N-N-N-'-N-N-H-N-X-C-T-C-T-G-G- -C-C-A-G-A-G-X-N-N-N-N-

\Eco31l

•H-H-H-H

Eco31II

H-N-N-N-

1. annealing2. ligation

N-N-N-N-•N-H-N-N-

Figure 2 Joining of two DNA fragments with the use of two inversely directedEcolH sites. N and N stand for the complementary nucleotides in thetetranucleotide stretches yielding the complementary Eco3\l ends.

exon 5 fragment exon 6(AA 113-163) (AA 164-205)

exon 7 frag»ent(AA JO6-271)

1. restriction endonuclease(s)2. DNA ligase

spliced geneof nature human IL-la

(AA 113-271)

Figure 1. Assembly of a gene for human mature IL-la by the artificial splicingmethod (a general scheme).

Figure 3. The amplification products of exons 5, 6 and 7 of the IL-la gene:a—exon 5 (fragment), b—exon 6. c—exon 7 (fragment).


Nucleic Acids Research, Vol. 19, No. 24 6759

it to yield 5'-protruding tetranucleotide termini. These verytermini, originated from the £co31I endonuclease action on theamplification products carrying its recognition site, are to be usedfor joining together various DNA segments.

The sequence of any resultant protruding end, in the case ofa class-IIS endonuclease, is determined by the sequence adjoiningits recognition site rather than by the primary structure of thesite itself, as in the case of the usual class II endonucleases. Incontrast to self-complementary (sticky) ends, which result frompalindromic recognition sites of the class II restrictionendonucleases and are inclined to rather promiscuous annealing(in fact, with any DNA segment containing the same end), single-stranded termini produced by the £co31I (and similar class IISendonucleases) treatment each have a specific primary structureand may be referred to as 'unique' ends. Indeed, the total numberof various ends of this kind is high enough (44 = 256 in caseof tetranucleotide protruding ends) to make very low theprobability of the recurrence of any given variant within astructure to be assembled.

Each EcoSlI cleavage site, which is brought into the amplifiedDNA segment with the corresponding primer carrying an Eco3llrecognition site, is designed in such a way that two protrudingends at each prospective junction of two segments are mutuallycomplementary. The multicomponent ligation of a mixture ofDNA fragments so obtained can be anticipated to proceedunambiguously, leading to the desired spliced sequence.

Using this approach, we have synthesized a gene coding formature human interleukin-la (IL-la), a cytokine possessing awide spectrum of biological activities in cell (25). The functionally

GENOMIC DNA

PCR I (primers for exon 51 of I L - l a gene)

BamHI ECO31I5 ' CGOATCCATGTCATCACCTTTTAGCTTCCT^^ffl&CATtATrrrr.r.ATCtar.riCTt-.flnAnAr-Pr:

3 ' GCCTAGGTACAGTAGTGGAAAATCGAAGGAMMW&TOTATTAGACCTACTTCaTCACCCTCTGOC

BamHI, ECO31Isticky |

end Met.5 ' GATCCATGTCATCACCTTTTAQCTTCCT—MBACATAATCTr.GATCAAr.r

3 ' GTACAGTAGTGGAAAATCGAuniqueprotrudingend

unique

AQTGAAATTTGACA'

TTTAAACTGTAC

Tr-rmr-rr »

ITTGGTCACGACGACTTCCTunique

active 159-meric polypeptide, resulted from the C-terminal partof the 271-meric precursor (residues 113-271) in the course ofthe posttranslational processing, is encoded by exons 5 (distalpart), 6 (total) and 7 (proximal part) of the IL-la gene (26). Thescheme of the gene synthesis by means of SDL is presented inFigure 1; accordingly, we have designed a set of primers for thein vitro amplification of the three segments of the IL-la genecorresponding to exons 5—7.

In each of these primers its 3'-terminal part is complementaryto the 3'-terminal part of one of the segment's strands whereasthe other part of the primer is a version of the above mentionedpendant 5'-end. In case of the internal primers (DS-5, US-6,DS-6, US-7), i.e., primers providing for the subsequent joiningof the segments, this 5'-end contains an £co31I site, which makesit possible for a unique protruding end to arise upon thisendonuclease's action on the amplification product. It is to notethat £co31I site in all the primers is presented by one and thesame strand (GGTCTC), so that after the polymerase synthesisof the complementary strand of the amplification product theEco311 nonpalindromic sites in those stretches of the double-stranded DNA which correspond to the upstream and downstreamprimers prove to be oriented in the opposite directions.

As for the two external primers (US-5 and DS-7), they weredesigned and used to introduce additional functional elements(translation initiation and termination signals) in the splicedsequence, as well as restriction sites (BamHI) necessary for itsinsertion into the cloning vector.

Since ligation of two fragments using protruding £co31I endscalls for these ends to be mutually complementary, bothamplification products of a couple of segments to be joinedtogether are to contain, near to the joining site at a distance ofa base pair from each of the inversely oriented £co31I sites, anidentical tetranucleotide double-stranded stretch: it is thesestretches that eventually give rise to the complementary £co31Iends (Figure 2).

Positions of these two identical stretches with respect to theboundaries of the exons to be joined together are set up by thestructures of two corresponding primers (the downstream primerfor one of the segments and the upstream primer for the othersegment) and in principle can vary within both exon segments.The farther from the exon-exon boundary the sites of theprospective joining are located, the longer must be the pendant5'-stretch of one of the two primers. In the case of the IL-lagene we used, among possible variants of joining, the one which

unique unique endogenous stop^•M ^^m CCO31I codons

5 ' AGGAGATCCCTGAGATACC^C GTAGTGAGACCA>SrACTGGAAAACCAGGCGTAGTAAG

3 • CTACGGACTCTATGGfKCCATC fcfTTTQ • I M^yGACCTTTTGGTCCQCATCATTCCTAGunique sticky

Figure 4. Preparation of fragments of exons 5, 6 and 7 by PCR followed by£co311- and BflmHI-treatment (only final products arc depicted in case of exons6 and 7) for their subsequent joining to give the mature IL-la gene flanked withBamHI sticky ends fit for the gene cloning. Primers for PCR are in bold letters,underlined are parts of the primers complementary to the template (genomic DNA).Exon 7, containing an endogenous £bo3II site, gave two fragments. Thetetranucleotide segments marked with closed bars correspond to the uniqueprotruding ends, created by the £co31I treatment of the amplification products,and are used for the interexonic ligations. Each of these tetranucleotide junctionsites includes two 5'-terminal nucleotides of one exon and two 3'-terminalnucleotides of the other exon to be joined together. Positions of the initiationand two termination codons are indicated.

Figure 5. Assembly of the IL-la gene by ligating the exons 5, 6 and 7 fragments(electrophoresis in 10% PAG). 1—dsDNA fragment (496 bp, control); 2—theligation products. Labellings were earned out by filling in the 3'-recessed endswith DNA polymerase and [a-33P]dNTP.


6760 Nucleic Acids Research, Vol. 19, No. 24

led to almost exact exclusion of the exon fragments of interestfrom genomic DNA. For that goal the internal primers weredesigned so that the identical stretches in the amplificationproducts and, therefore, the prospective Eco2>\\ protruding endseach contained two 5'-terminal nucleotides of its own segment(in the complementary part of the primer) and two 3'-terminalnucleotides of the second segment to be joined (in the pendantpart of the same primer).

The primers synthesized were used in three separate PCRs withhuman genomic DNA as template. The second and third couplesof the primers functioned normally, yielding exon 6 and thecorresponding fragment of exon 7, whereas the first set of primers(US-5 and DS-5) did not give any amplification products at all.Apparently it was due to some peculiarities in the template-primerDS-5 interaction, since in the case of the US-5 primer incombination with other than DS-5 oligonucleotides as downstreamprimers the amplification proceeded normally. It is only by meansof a two-step amplification with two different sets of primers thatthe desired fragment of exon 5 was obtained. At the first step—with genomic DNA—two 20-mers were successfully employedas primers. They did not contain pendant ends, i.e. were totallycomplementary to the 3'-terminal parts of the 5th exon's bothstrands: 5'-TCATCACCTTTTAGCTTCCT-3' (US-5M,coincides with the 3'-part of the US-5 primer) and 5'-CTTCAT-CCAGATTATGTAAG-3' (DS-5M; shifted by three nucleotides,as compared with the template-complementary part of DS-5,towards the upstream primer). After that amplification, the PCRwith primers US-5 and DS-5, which failed earlier, and an aliquotof the reaction mixture after the first step as a source of templatewas successfully carried out.

The high specificity of all the above amplifications (Figure 3)

EcoRI1

EcoRI

1

EcoRI

P,K BaaHI

-nil—L-P,K Bairn EcoRI

•xon 5450 '

P,H BanHI

•von

' exon

Eco31I

7

492EcoMI

6 ' exon

1 exon 6 <

7

ECORI

exon

SanHI

BamHI

5

454-385-

Figure 6. Restriction analysis (A—scheme, B—electrophoresis in 10% PAG) ofthe recombinant plasmids bearing the synthetic IL-lor gene insert. A: a —pDR540;b and c—IL-la gene inserted into pDR540 in the correct (pILla-1) and reversed(pILla-2) orientation, respectively . B— 1— pDR540 DNA cleaved with flamHI,EcoRI and Ecoi 11 (control); 2 and 3—recombinant plasmid DNA with the reversedorientation of the insert (pILla-2), cut with EcoRI and flamHI, respectively; 4and 5—the same with the correct orientation of the insert (pILla-1).

made it possible to pass directly to the next step—treatment ofthe amplification products with restriction endonuclease(s) andligation. We had however to take into consideration thenotoriously high occurrence of mistakes in copying DNA by PCRbecause of the lack of the footprinting activity in thermostableDNA polymerases (27). Therefore we carried out the intermediatecloning of the synthesized exon fragments in the pUC19 vectorand sequenced them to pick out, for the subsequent manipulations,clones containing no mutations. Sequencing inserts in a numberof clones did not reveal any mutations, thus showing that in vitroamplification of these segments of genomic DNA proceededcorrectly. The IL-laexon segments are of interest per se, sincethey code for the possible functional domains of IL-la andtherefore might be useful in studies on the functional topographyof the protein's molecule.

To assemble the IL-la gene, the plasmid DNAs, containingthe three exon fragments, were digested with the correspondingrestriction endonuclease(s) (Figure 4), the four exon fragments(exon 7 yielded two fragments due to the presence of anexogenous £co31I site) were purified by PAGE and one-potligated. The resultant mixture was treated with BamH\endonuclease to cleave products of the undesired ligation at thesesites, the synthetic gene was isolated by PAGE (Figure 5) andcloned into the pDR540 plasmid vector at the BamHl site. Therecombinants were selected by colony hybridisation (with5'-32P-labelled external primers US-5 and DS-7, takenseparately for the whole gene sequence to be spanned) and cloneswith the correct orientation of the gene insert were identified byrestriction analysis (Figure 6). Sequencing showed that thestructure synthesized corresponded exactly to the native primarystructure of the mature IL-la gene, containing also initiation andtwo termination codons (one of which native), under the tacpromoter control.

A new method of artificial DNA splicing by directed ligation(SDL) has thus been suggested. It can be considered as a generalapproach to directed joining together of fragments of one orvarious DNA to yield hybrid DNA molecules. SDL might bean alternative to the earlier described SOE method (7, 8); itoperates with strictly defined DNA fragments (e.g., with exonscontaining no 'extra' links), which can be self-sufficient objectsof genetic engineering manipulations, whereas in the case of SOEthe corresponding fragments necessarily contain additionalstretches for the subsequent formation of heteroduplexes.

One of potential applications of the SDL method, which hasbeen illustrated in the present paper, comprises synthesis ofartificially processed (intronless) eukaryotic genes to be expressedin prokaryotic systems. The approach is far less effort-consumingand calls for significantly less information on sequences of exonsinvolved than total chemical-enzymatic synthesis, though is lessversatile than the latter anent directed mutagenesis. At the sametime the SDL method does not need mRNA (necessary for thegene synthesis via cDNA) and therefore can be used even in thecase of silent genes.

A prerequisite for the SDL (as well as SOE) application isinformation on the sequences of exon termini usually resultedfrom sequencing of genes in genomic DNA. The highlyinteresting approach to cloning (and, potentially, sequencing) ofexons recently described (28) can be an efficient source of thatinformation. It is a combination of the latter method with SDL,capable of the precise joining of exons provided primary structureof their termini is known, that appears to be pariculariy promisingin synthesis of spliced eukaryotic genes from genomic DNA.


Nucleic Acids Research, Vol. 19, No. 24 6761

ACKNOWLEDGEMENTS

The present paper is dedicated to the 70th birthday of Dr HarGobind Khorana (Massachusetts Institute of Technology,Cambridge, Massachusetts). Preliminary reports of this workwere presented at the Eighth Symposium on the Chemistry ofNucleic Acid Components (September 17-21, 1990) at BechyneCastle and at the Ninth International Round Table 'Nucleosides,Nucleotides & their Biological Applications' (July 30-August 3,1990) at Uppsala (29, 30).

REFERENCES1. Kimmel, A.R. and Berger, S.L. (eds.) (1987) Methods of Enzymology,

Vol.152, Academic Press, San Diego, pp. 307-755.2. Wu, R. and Grossman, L. (eds.) (1987) Methods of Enzymology, Vol.154,

Academic Press, San Diego, pp. 221 —326.3. Khorana, H.G. (1988) Science, 203, 614-625.4. Ehrlich, H.A. (ed), (1989) PCR Technology: Principles and Applications

for DNA Amplification. Stockton Press, New York.5. Ehrlich, H A., Gibbs, R. and Kazazian, H.H. (1989) Polymerase Chain

Reaction. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.6. Innis, M.A., Gelfand, D.H., Sninsky, JJ . and White, T.J. (eds) (1990) PCR

Protocols. A Guide to Methods and Applications. Academic Press, San Diego.7. Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K. and Pease, L.R. (1989)

Gene, 77, 61-68.8. Horton, R.M., Cai, Z., Ho, S.N. and Pease, L.R. (1990) Biotechniques.

8, 528-535.9. Sambrook, J., Fntsch, E.F. and Maniatis, T. (1989) Molecular Cloning:

A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, p. A. 12.

10. Yanisch-Perron, C , Vieira, J. and Messing, J.(1985) Gene. 33, 103-119.11. Beaucage, S.L. and Caruthers, M.H. (1981) Tetrahedron Letters, 22,

1859-1862.12. Sinha, N.D., Biernat, J., McManus, J. and Koster, H. (1984) Nucleic Acids

Res, 12, 4539-4557.13. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn,

G.T., Mullis, K.B. and Ehrlich, H.A. (1988) Science. 239, 487-491.14. Old, JM (1987) In Davies, K.E.(ed), Human Genetic Diseases: A Practical

Approach. 1RL Press, Oxford, Washington, p. 5.15. Ref. 9, pp. 1.60, 1.61, 5.72.16. Ref. 9, pp. 1.62, 1.70, 1.82-1.84.17. Ref. 9, pp. 1.85, 1.86.18. Ref. 9, pp. 1.25-1.28.19. Ref 9, pp. 1.40, 1.41.20. Ref. 9, pp. 1.90-1.104.21. Murphy, G. and Ward, E.S (1989) In Howe, C.G. and Ward, E.S. (eds)

Nucleic Acids Sequencing: A Practical Approach. IRL Press at OxfordUniversity Press, Oxford, New York, Tokyo, pp. 99-115.

22. Scharf, S.J., Horn, G.T. and Ehriich, H.A. (1986) Science, 233, 1076-107823. Kim, S.C., Podhajska, AJ. and Szybalski, W. (1988) Science, 240, 504-506.24. Butkus, V., Bitinaite, J., Kersulyte, D. and Janulaitis, A. (1985) Biochim.

Biophys. Acta, 826, 208-212.25. Arai, K., Lee, F., Miyajima, A., Miyatake, S., Aral, N. and Yocota, T.,

(1990) In Richardson, C.C., Abelson, J.N., Meister, A. and Walsh, C.T.,(eds.) Annual Review of Biochemistry, Annual Review Inc., Palo Alto,Vol.59, pp. 783-836.

26. Furutani, Y., Notake, M., Fukui, T., Ohue, M., Nomura, H., Yamada,M. and Nakamura, S. (1986) Nucleic Acids Res, 14, 3167-3179.

27. Tindall, K.R. and Kunkel, T.A. (1988) Biochemistry, 27, 6008-6013.28. Auch.D. and Reth, M. (1990) Nucleic Acids Res, 18, 6743.29. Lebedenko, E.N., Plutalov, O.V. and Berlin, Yu.A. (1990) Coll. Czech.

Chem. Commun., 55, Special Issue 1, 269-272.30. Lebedenko, E.N., Plutalov, O.V. and Berlin, Yu.A. (1991) Nucleosides &

Nucleotides, 10,631-632.


method of artificial dna spling by directed ligation (sdl)

Documents